#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A1CF	29974	genome.wustl.edu	37	10	52595965	52595965	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr10:52595965delT	ENST00000373993.1	-	4	517	c.473delA	c.(472-474)aagfs	p.K158fs	A1CF_ENST00000373997.3_Frame_Shift_Del_p.K158fs|A1CF_ENST00000395489.2_Frame_Shift_Del_p.K151fs|A1CF_ENST00000395495.1_Frame_Shift_Del_p.K158fs|A1CF_ENST00000282641.2_Frame_Shift_Del_p.K158fs|A1CF_ENST00000374001.2_Frame_Shift_Del_p.K158fs|A1CF_ENST00000373995.3_Frame_Shift_Del_p.K166fs			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	158	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTCAGTAACCTTTTTCATCTC	0.468																																																	0													147.0	142.0	144.0					10																	52595965		2203	4300	6503	SO:0001589	frameshift_variant	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.473delA	10.37:g.52595965delT	ENSP00000363105:p.Lys158fs		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.K158fs	ENST00000373993.1	37	c.473	CCDS7242.1	10																																																																																			A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.468	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2		0.00	53	0	T	NM_014576		52595965	-1	tier1		no_errors	ENST00000282641	ensembl	human	known	74_37	frame_shift_del	8.11	34	3	DEL	1.000	-
AMHR2	269	genome.wustl.edu	37	12	53819645	53819645	+	Frame_Shift_Del	DEL	G	G	-	rs374370282		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr12:53819645delG	ENST00000257863.4	+	6	874	c.794delG	c.(793-795)cggfs	p.R265fs	AMHR2_ENST00000550311.1_Frame_Shift_Del_p.R265fs|AMHR2_ENST00000379791.3_Frame_Shift_Del_p.R265fs	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	ACTGCCAGCCGGGGGGGTCCT	0.577																																																	0									,,	2,4262		0,2,2130	44.0	45.0	45.0		,,	0.9	0.9	12		45	3,8251		0,3,4124	no	frameshift,frameshift,frameshift	AMHR2	NM_020547.2,NM_001164691.1,NM_001164690.1	,,	0,5,6254	A1A1,A1R,RR		0.0363,0.0469,0.0399	,,	,,	53819645	5,12513	2203	4300	6503	SO:0001589	frameshift_variant	0			AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.794delG	12.37:g.53819645delG	ENSP00000257863:p.Arg265fs		A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Frame_Shift_Del	DEL	pirsf_Anti-muellerian_hrmn_rcpt_II,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G267fs	ENST00000257863.4	37	c.794	CCDS8858.1	12																																																																																			AMHR2	-	pirsf_Anti-muellerian_hrmn_rcpt_II,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135409		0.577	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMHR2	HGNC	protein_coding	OTTHUMT00000407048.1		0.00	21	0	G	NM_020547		53819645	+1	tier1		no_errors	ENST00000257863	ensembl	human	known	74_37	frame_shift_del	14.29	18	3	DEL	0.935	-
ASUN	55726	genome.wustl.edu	37	12	27059296	27059296	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr12:27059296C>T	ENST00000261191.7	-	16	2556	c.2020G>A	c.(2020-2022)Gga>Aga	p.G674R	ASUN_ENST00000539625.1_Missense_Mutation_p.G573R	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	674					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTCAAACGTCCAGCAAATTCC	0.348																																																	0													120.0	126.0	124.0					12																	27059296		2203	4298	6501	SO:0001583	missense	0			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.2020G>A	12.37:g.27059296C>T	ENSP00000261191:p.Gly674Arg		B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	pfam_Cell_cycle_regulator_Mat89Bb	p.G674R	ENST00000261191.7	37	c.2020	CCDS8708.1	12	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494990	0.85069	.	.	ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745	T;T;T	0.72835	-0.69;-0.69;-0.69	5.35	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84132	0.0412	10	0.66056	D	0.02	-21.6524	14.5551	0.68094	0.0:0.9291:0.0:0.0709	.	674;573	Q9NVM9;B4DNK1	M89BB_HUMAN;.	R	321;674;573;261	ENSP00000445645:G321R;ENSP00000261191:G674R;ENSP00000443724:G573R	ENSP00000261191:G674R	G	-	1	0	C12orf11	26950563	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	5.696000	0.68287	1.418000	0.47098	0.585000	0.79938	GGA	ASUN	-	pfam_Cell_cycle_regulator_Mat89Bb	ENSG00000064102		0.348	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASUN	HGNC	protein_coding	OTTHUMT00000402819.1	-	0.00	85	0	C	NM_018164		27059296	-1	tier1	-	no_errors	ENST00000261191	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
BMPER	168667	genome.wustl.edu	37	7	34094885	34094885	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr7:34094885A>C	ENST00000297161.2	+	10	1271	c.897A>C	c.(895-897)aaA>aaC	p.K299N	BMPER_ENST00000426693.1_Missense_Mutation_p.K299N	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	299	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AAGACATCAAAGTATGCAAAT	0.488																																																	0													119.0	113.0	115.0					7																	34094885		2203	4300	6503	SO:0001583	missense	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.897A>C	7.37:g.34094885A>C	ENSP00000297161:p.Lys299Asn		A8K1P8|Q8TF36	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_C,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_C,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,pfscan_VWF_C	p.K299N	ENST00000297161.2	37	c.897	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116159	0.37339	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.65732	-0.17;-0.17	6.06	0.0888	0.14456	von Willebrand factor, type C (1);	0.462555	0.25050	N	0.033530	T	0.43831	0.1265	L	0.39326	1.205	0.35812	D	0.82392	B	0.15141	0.012	B	0.09377	0.004	T	0.23691	-1.0181	10	0.25751	T	0.34	.	4.8436	0.13503	0.6192:0.2064:0.0627:0.1118	.	299	Q8N8U9	BMPER_HUMAN	N	299	ENSP00000297161:K299N;ENSP00000393950:K299N	ENSP00000297161:K299N	K	+	3	2	BMPER	34061410	1.000000	0.71417	0.290000	0.24890	0.930000	0.56654	1.295000	0.33377	0.145000	0.18977	0.523000	0.50628	AAA	BMPER	-	pfscan_VWF_C	ENSG00000164619		0.488	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	-	0.00	53	0	A	NM_133468		34094885	+1	tier1	-	no_errors	ENST00000297161	ensembl	human	known	74_37	missense	14.81	46	8	SNP	0.407	C
BSN	8927	genome.wustl.edu	37	3	49694019	49694019	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr3:49694019G>T	ENST00000296452.4	+	5	7144	c.7030G>T	c.(7030-7032)Ggt>Tgt	p.G2344C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2344					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGCTCCTGGGGGTGGCAGTGG	0.647																																																	0													10.0	12.0	11.0					3																	49694019		2185	4276	6461	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7030G>T	3.37:g.49694019G>T	ENSP00000296452:p.Gly2344Cys		O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.G2344C	ENST00000296452.4	37	c.7030	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	3.665	-0.068791	0.07228	.	.	ENSG00000164061	ENST00000296452	T	0.19532	2.14	5.44	1.47	0.22746	.	0.484814	0.21546	N	0.072806	T	0.10252	0.0251	N	0.14661	0.345	0.09310	N	1	P	0.40660	0.726	B	0.36959	0.237	T	0.15378	-1.0439	10	0.62326	D	0.03	-0.0038	6.2695	0.20947	0.2984:0.2635:0.4381:0.0	.	2344	Q9UPA5	BSN_HUMAN	C	2344	ENSP00000296452:G2344C	ENSP00000296452:G2344C	G	+	1	0	BSN	49669023	0.534000	0.26362	0.244000	0.24202	0.964000	0.63967	1.361000	0.34136	0.400000	0.25396	0.655000	0.94253	GGT	BSN	-	NULL	ENSG00000164061		0.647	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	-	0.00	31	0	G	NM_003458		49694019	+1	tier1	-	no_errors	ENST00000296452	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.000	T
C11orf40	143501	genome.wustl.edu	37	11	4593445	4593445	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:4593445G>T	ENST00000307616.1	-	3	387	c.388C>A	c.(388-390)Cac>Aac	p.H130N		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	130										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		AGAAGCTGGTGTTTCATTGCT	0.433																																																	0													144.0	129.0	134.0					11																	4593445		2201	4298	6499	SO:0001583	missense	0				CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.388C>A	11.37:g.4593445G>T	ENSP00000302918:p.His130Asn			Missense_Mutation	SNP	NULL	p.H130N	ENST00000307616.1	37	c.388	CCDS31354.1	11	.	.	.	.	.	.	.	.	.	.	G	0.820	-0.748898	0.03065	.	.	ENSG00000171987	ENST00000307616	T	0.53206	0.63	1.09	-1.3	0.09259	.	.	.	.	.	T	0.21387	0.0515	N	0.08118	0	0.09310	N	1	P	0.34977	0.478	B	0.31812	0.136	T	0.13845	-1.0494	9	0.87932	D	0	.	2.7417	0.05255	0.2397:0.357:0.4033:0.0	.	130	Q8WZ69	CK040_HUMAN	N	130	ENSP00000302918:H130N	ENSP00000302918:H130N	H	-	1	0	C11orf40	4550021	0.001000	0.12720	0.005000	0.12908	0.005000	0.04900	-0.758000	0.04766	-0.438000	0.07232	-0.340000	0.08031	CAC	C11orf40	-	NULL	ENSG00000171987		0.433	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf40	HGNC	protein_coding	OTTHUMT00000383529.1	-	0.00	55	0	G	NM_144663		4593445	-1	tier1	-	no_errors	ENST00000307616	ensembl	human	known	74_37	missense	7.14	51	4	SNP	0.008	T
C16orf46	123775	genome.wustl.edu	37	16	81097443	81097443	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr16:81097443G>T	ENST00000299578.5	-	3	353	c.118C>A	c.(118-120)Cat>Aat	p.H40N	RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000444657.3_Intron|C16orf46_ENST00000378611.4_Missense_Mutation_p.H40N	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	40						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						CAATAAACATGATTTTTTTCA	0.348																																																	0													200.0	183.0	189.0					16																	81097443		2202	4300	6502	SO:0001583	missense	0			BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.118C>A	16.37:g.81097443G>T	ENSP00000299578:p.His40Asn		Q96MA7	Missense_Mutation	SNP	NULL	p.H40N	ENST00000299578.5	37	c.118	CCDS10932.1	16	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280999	0.40394	.	.	ENSG00000166455	ENST00000378611;ENST00000299578	T;T	0.18016	2.24;2.24	5.65	3.69	0.42338	.	0.369039	0.26578	N	0.023594	T	0.19805	0.0476	L	0.34521	1.04	0.30660	N	0.754471	D;D	0.63880	0.993;0.98	P;P	0.52856	0.711;0.711	T	0.04650	-1.0936	10	0.51188	T	0.08	.	9.2817	0.37733	0.0781:0.1453:0.7766:0.0	.	40;40	Q6P387-2;Q6P387	.;CP046_HUMAN	N	40	ENSP00000367874:H40N;ENSP00000299578:H40N	ENSP00000299578:H40N	H	-	1	0	C16orf46	79654944	1.000000	0.71417	0.862000	0.33874	0.086000	0.17979	2.681000	0.46926	0.854000	0.35336	0.563000	0.77884	CAT	C16orf46	-	NULL	ENSG00000166455		0.348	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C16orf46	HGNC	protein_coding	OTTHUMT00000269054.2	-	0.00	108	0	G	NM_152337		81097443	-1	tier1	-	no_errors	ENST00000299578	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	T
C18orf63	644041	genome.wustl.edu	37	18	72020514	72020514	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr18:72020514delA	ENST00000579455.1	+	12	1341	c.1012delA	c.(1012-1014)aaafs	p.K339fs		NM_001174123.1	NP_001167594.1	Q68DL7	CR063_HUMAN	chromosome 18 open reading frame 63	339										breast(1)	1						TTTGACCACTAAAAAAATGCT	0.378																																																	0																																										SO:0001589	frameshift_variant	0				CCDS54189.1	18q22.3	2012-10-24			ENSG00000206043	ENSG00000206043			40037	protein-coding gene	gene with protein product							Standard	NM_001174123		Approved	DKFZP781G0119	uc002llj.3	Q68DL7	OTTHUMG00000178987	ENST00000579455.1:c.1012delA	18.37:g.72020514delA	ENSP00000464330:p.Lys339fs		A6NME8	Frame_Shift_Del	DEL	NULL	p.M340fs	ENST00000579455.1	37	c.1012	CCDS54189.1	18																																																																																			C18orf63	-	NULL	ENSG00000206043		0.378	C18orf63-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	C18orf63	HGNC	protein_coding	OTTHUMT00000444246.2		0.00	42	0	A	NM_001174123		72020514	+1	tier1		no_errors	ENST00000579455	ensembl	human	known	74_37	frame_shift_del	7.41	25	2	DEL	0.996	-
C2orf40	84417	genome.wustl.edu	37	2	106690395	106690395	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:106690395T>G	ENST00000238044.3	+	3	290	c.181T>G	c.(181-183)Ttc>Gtc	p.F61V	C2orf40_ENST00000489174.1_3'UTR|C2orf40_ENST00000409944.1_Missense_Mutation_p.F25V	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	61					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						AGCCAAAGAATTCCTTGGCAG	0.517																																																	0													107.0	120.0	115.0					2																	106690395		2203	4300	6503	SO:0001583	missense	0			BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.181T>G	2.37:g.106690395T>G	ENSP00000238044:p.Phe61Val		D3DVK2	Missense_Mutation	SNP	NULL	p.F61V	ENST00000238044.3	37	c.181	CCDS2072.1	2	.	.	.	.	.	.	.	.	.	.	T	18.88	3.718222	0.68844	.	.	ENSG00000119147	ENST00000409944;ENST00000238044;ENST00000437659	T;T;T	0.58358	0.34;0.34;0.34	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.76328	2.33	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.76570	-0.2911	10	0.87932	D	0	-25.9431	15.827	0.78718	0.0:0.0:0.0:1.0	.	61	Q9H1Z8	AUGN_HUMAN	V	25;61;63	ENSP00000386421:F25V;ENSP00000238044:F61V;ENSP00000388664:F63V	ENSP00000238044:F61V	F	+	1	0	C2orf40	106056827	1.000000	0.71417	0.111000	0.21465	0.488000	0.33401	6.553000	0.73918	2.129000	0.65627	0.533000	0.62120	TTC	C2orf40	-	NULL	ENSG00000119147		0.517	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf40	HGNC	protein_coding	OTTHUMT00000253515.2	-	0.00	58	0	T	NM_032411		106690395	+1	tier1	-	no_errors	ENST00000238044	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.988	G
C4orf47	441054	genome.wustl.edu	37	4	186366117	186366117	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr4:186366117G>T	ENST00000378850.4	+	6	736		c.e6-1			NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47											breast(2)|endometrium(1)	3						TTTCTTCGCAGCCTGGTGGAA	0.378																																																	0													101.0	81.0	87.0					4																	186366117		692	1591	2283	SO:0001630	splice_region_variant	0			AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.715-1G>T	4.37:g.186366117G>T			Q5BLP7	Splice_Site	SNP	-	e6-1	ENST00000378850.4	37	c.715-1	CCDS47169.1	4	.	.	.	.	.	.	.	.	.	.	G	17.49	3.401887	0.62288	.	.	ENSG00000205129	ENST00000378850	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9698	0.97280	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C4orf47	186603111	1.000000	0.71417	0.864000	0.33941	0.599000	0.36880	7.287000	0.78681	2.817000	0.96982	0.563000	0.77884	.	C4orf47	-	-	ENSG00000205129		0.378	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf47	HGNC	protein_coding	OTTHUMT00000360667.1		0.00	58	0	G	NM_001114357	Intron	186366117	+1			no_errors	ENST00000378850	ensembl	human	known	74_37	splice_site	6.00	47	3	SNP	0.994	T
CBLC	23624	genome.wustl.edu	37	19	45295697	45295697	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr19:45295697G>A	ENST00000270279.3	+	7	1126	c.1063G>A	c.(1063-1065)Gct>Act	p.A355T	CBLC_ENST00000341505.4_Missense_Mutation_p.A309T	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	355	Interaction with RET.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CAAGATCTGTGCTGAGAGCAA	0.607			M		AML																																			Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													96.0	84.0	88.0					19																	45295697		2203	4300	6503	SO:0001583	missense	0			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.1063G>A	19.37:g.45295697G>A	ENSP00000270279:p.Ala355Thr		Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.A355T	ENST00000270279.3	37	c.1063	CCDS12643.1	19	.	.	.	.	.	.	.	.	.	.	.	10.41	1.341560	0.24339	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	T;T	0.78595	-1.19;-1.19	4.13	1.9	0.25705	Zinc finger, RING-type (2);SH2 motif (1);Zinc finger, C3HC4 RING-type (1);	0.346220	0.21166	N	0.079071	T	0.54143	0.1840	N	0.12887	0.27	0.39614	D	0.969925	B;B	0.33448	0.312;0.412	B;B	0.24155	0.041;0.051	T	0.49943	-0.8885	10	0.36615	T	0.2	-7.737	8.797	0.34885	0.1941:0.0:0.8059:0.0	.	309;355	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	T	355;309	ENSP00000270279:A355T;ENSP00000340250:A309T	ENSP00000270279:A355T	A	+	1	0	CBLC	49987537	0.997000	0.39634	0.302000	0.25058	0.362000	0.29581	3.314000	0.51943	0.493000	0.27837	0.643000	0.83706	GCT	CBLC	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000142273		0.607	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2		0.00	22	0	G	NM_012116		45295697	+1			no_errors	ENST00000270279	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.995	A
CCDC40	55036	genome.wustl.edu	37	17	78032330	78032330	+	Silent	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr17:78032330G>A	ENST00000397545.4	+	8	1224	c.1197G>A	c.(1195-1197)ctG>ctA	p.L399L	CCDC40_ENST00000374876.4_Silent_p.L399L|CCDC40_ENST00000269318.5_Silent_p.L399L|CCDC40_ENST00000374877.3_Silent_p.L399L	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	399					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ACTTGGCCCTGCATCTCTTCT	0.612																																																	0													51.0	53.0	53.0					17																	78032330		2114	4230	6344	SO:0001819	synonymous_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1197G>A	17.37:g.78032330G>A			A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	pfam_E3_ubiquit_lig_BRE1	p.L399	ENST00000397545.4	37	c.1197	CCDS42395.1	17																																																																																			CCDC40	-	NULL	ENSG00000141519		0.612	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2		0.00	56	0	G	XM_371082		78032330	+1			no_errors	ENST00000397545	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.769	A
CCDC81	60494	genome.wustl.edu	37	11	86123434	86123434	+	Silent	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:86123434C>T	ENST00000445632.2	+	11	1496	c.1224C>T	c.(1222-1224)tcC>tcT	p.S408S	CCDC81_ENST00000278487.3_Silent_p.S143S|CCDC81_ENST00000528728.1_Silent_p.S143S|CCDC81_ENST00000354755.1_Silent_p.S318S	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	408								p.S318S(1)		kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				TCTAGAAATCCTTCCTATTTG	0.358																																																	1	Substitution - coding silent(1)	large_intestine(1)											98.0	99.0	98.0					11																	86123434		2202	4299	6501	SO:0001819	synonymous_variant	0			AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1224C>T	11.37:g.86123434C>T			A0AVL7|Q53FW3|Q9H5E5	Silent	SNP	superfamily_IHF-like_DNA-bd_dom	p.S408	ENST00000445632.2	37	c.1224	CCDS53691.1	11																																																																																			CCDC81	-	NULL	ENSG00000149201		0.358	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC81	HGNC	protein_coding	OTTHUMT00000393756.1		0.00	40	0	C	NM_021827		86123434	+1			no_errors	ENST00000445632	ensembl	human	known	74_37	silent	8.70	21	2	SNP	0.954	T
CIDEA	1149	genome.wustl.edu	37	18	12264413	12264413	+	Silent	SNP	G	G	A	rs139265687		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr18:12264413G>A	ENST00000320477.9	+	3	356	c.291G>A	c.(289-291)acG>acA	p.T97T	CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a	97	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						GAGACAACACGCATTTCATGA	0.488																																																	0													136.0	113.0	121.0					18																	12264413		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.291G>A	18.37:g.12264413G>A			B0YIY7|Q6UPR7	Silent	SNP	pfam_CIDE-N_dom,smart_CIDE-N_dom,pfscan_CIDE-N_dom	p.T97	ENST00000320477.9	37	c.291	CCDS11856.1	18																																																																																			CIDEA	-	pfam_CIDE-N_dom,smart_CIDE-N_dom,pfscan_CIDE-N_dom	ENSG00000176194		0.488	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	HGNC	protein_coding	OTTHUMT00000254599.2	-	0.00	75	0	G	NM_001279		12264413	+1	tier1	rs139265687	no_errors	ENST00000320477	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.797	A
CNPY1	285888	genome.wustl.edu	37	7	155299757	155299757	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr7:155299757delC	ENST00000321736.5	-	3	361	c.199delG	c.(199-201)gagfs	p.E67fs	CNPY1_ENST00000406197.1_Frame_Shift_Del_p.E67fs	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	67										breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		TAGTGTGTCTCCTGGGCGATA	0.438																																																	0													162.0	160.0	161.0					7																	155299757		2043	4186	6229	SO:0001589	frameshift_variant	0				CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.199delG	7.37:g.155299757delC	ENSP00000317439:p.Glu67fs		A6NGX3	Frame_Shift_Del	DEL	pfam_DUF3456	p.E67fs	ENST00000321736.5	37	c.199	CCDS43684.1	7																																																																																			CNPY1	-	pfam_DUF3456	ENSG00000146910		0.438	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CNPY1	HGNC	protein_coding	OTTHUMT00000322335.1		0.00	60	0	C	XM_001129537		155299757	-1	tier1		no_errors	ENST00000321736	ensembl	human	putative	74_37	frame_shift_del	14.29	12	2	DEL	1.000	-
DAPK2	23604	genome.wustl.edu	37	15	64200718	64200718	+	3'UTR	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr15:64200718G>T	ENST00000457488.1	-	0	1144				DAPK2_ENST00000261891.3_3'UTR	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2						anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		GGTCAGGCCAGTTAGGAGGTG	0.617																																																	0													45.0	32.0	36.0					15																	64200718		2201	4299	6500	SO:0001624	3_prime_UTR_variant	0			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.*1C>A	15.37:g.64200718G>T			E9JGM7|O75892|Q24JS1	RNA	SNP	-	NULL	ENST00000457488.1	37	NULL	CCDS10188.1	15																																																																																			DAPK2	-	-	ENSG00000035664		0.617	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	-	0.00	72	0	G	NM_014326		64200718	-1	tier1	-	no_errors	ENST00000559731	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.001	T
DCT	1638	genome.wustl.edu	37	13	95131226	95131226	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr13:95131226C>A	ENST00000377028.5	-	1	697	c.284G>T	c.(283-285)tGc>tTc	p.C95F	DCT_ENST00000446125.1_Missense_Mutation_p.C95F	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	95					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TGTGCACTTGCAGGTCCGGTG	0.567																																																	0													82.0	71.0	75.0					13																	95131226		2203	4300	6503	SO:0001583	missense	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.284G>T	13.37:g.95131226C>A	ENSP00000366227:p.Cys95Phe		Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.C95F	ENST00000377028.5	37	c.284	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455773	0.84209	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.86097	-2.07;-2.07	5.32	5.32	0.75619	Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.95037	0.8393	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.96338	0.9249	10	0.87932	D	0	-20.5188	19.0	0.92829	0.0:1.0:0.0:0.0	.	95;95	Q09GT4;P40126	.;TYRP2_HUMAN	F	95	ENSP00000366227:C95F;ENSP00000392762:C95F	ENSP00000366227:C95F	C	-	2	0	DCT	93929227	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.298000	0.78815	2.482000	0.83794	0.650000	0.86243	TGC	DCT	-	superfamily_Unchr_di-copper_centre	ENSG00000080166		0.567	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	-	0.00	49	0	C			95131226	-1	tier1	-	no_errors	ENST00000446125	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
DEPTOR	64798	genome.wustl.edu	37	8	121013914	121013914	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr8:121013914G>T	ENST00000286234.5	+	5	885	c.755G>T	c.(754-756)aGc>aTc	p.S252I	DEPTOR_ENST00000523492.1_Missense_Mutation_p.S151I|DEPTOR_ENST00000518057.1_3'UTR	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	252	Ser-rich.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						AGGAAGCAGAGCCATGACAAT	0.498																																																	0													99.0	92.0	95.0					8																	121013914		2203	4300	6503	SO:0001583	missense	0				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.755G>T	8.37:g.121013914G>T	ENSP00000286234:p.Ser252Ile		B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	pfam_DEP_dom,superfamily_PDZ,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ	p.S252I	ENST00000286234.5	37	c.755	CCDS6331.1	8	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367367	0.41902	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	T;T	0.15139	2.45;2.45	6.17	3.12	0.35913	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.357349	0.38326	N	0.001723	T	0.13543	0.0328	L	0.29908	0.895	0.32128	N	0.587122	P;P	0.48998	0.918;0.8	P;B	0.47645	0.553;0.365	T	0.10177	-1.0641	10	0.19147	T	0.46	-24.8053	7.1298	0.25493	0.3774:0.0:0.6226:0.0	.	151;252	E7EV87;Q8TB45	.;DPTOR_HUMAN	I	151;252	ENSP00000430457:S151I;ENSP00000286234:S252I	ENSP00000286234:S252I	S	+	2	0	DEPTOR	121083095	1.000000	0.71417	0.998000	0.56505	0.197000	0.23852	3.236000	0.51336	0.962000	0.38057	-0.742000	0.03525	AGC	DEPTOR	-	NULL	ENSG00000155792		0.498	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPTOR	HGNC	protein_coding	OTTHUMT00000381601.1	-	0.00	81	0	G	NM_022783		121013914	+1	tier1	-	no_errors	ENST00000286234	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.993	T
DOK5	55816	genome.wustl.edu	37	20	53092463	53092463	+	5'UTR	DEL	G	G	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr20:53092463delG	ENST00000262593.5	+	0	328				DOK5_ENST00000491469.1_3'UTR|DOK5_ENST00000395939.1_Intron	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5						MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			CTTGGGTAAAGGGGGGGTCAC	0.582																																																	0										722,4,3,3535		58,0,0,606,2,0,0,1,1,1464	34.0	37.0	36.0			-5.1	0.0	20	dbSNP_130	35	827,7,2,7418		50,0,0,727,1,0,5,0,2,3342	no	utr-5	DOK5	NM_018431.3		108,0,0,1333,3,0,5,1,3,4806	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		10.1284,17.0966,12.502			53092463	1549,11,5,10953	2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.-23G>-	20.37:g.53092463delG			Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	RNA	DEL	-	NULL	ENST00000262593.5	37	NULL	CCDS13446.1	20																																																																																			DOK5	-	-	ENSG00000101134		0.582	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK5	HGNC	protein_coding	OTTHUMT00000079777.2		0.00	29	0	G			53092463	+1	tier1		no_errors	ENST00000491469	ensembl	human	known	74_37	rna	7.69	24	2	DEL	0.001	-
EIF4E2	9470	genome.wustl.edu	37	2	233445900	233445900	+	3'UTR	DEL	G	G	-	rs563646087		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:233445900delG	ENST00000409514.1	+	0	1073				EIF4E2_ENST00000409098.1_3'UTR|AC073254.1_ENST00000595732.1_RNA|AC073254.1_ENST00000601434.2_RNA|AC073254.1_ENST00000447488.2_RNA|AC073254.1_ENST00000608132.1_RNA|AC073254.1_ENST00000415506.2_RNA	NM_001282958.1	NP_001269887.1	O60573	IF4E2_HUMAN	eukaryotic translation initiation factor 4E family member 2						cytokine-mediated signaling pathway (GO:0019221)|in utero embryonic development (GO:0001701)|negative regulation of translation (GO:0017148)	cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGGGTTCCATGGGGGGGCGTT	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF038957	CCDS2496.1, CCDS63158.1, CCDS63159.1, CCDS74671.1	2q37.1	2008-02-05	2006-11-13	2004-10-30	ENSG00000135930	ENSG00000135930			3293	protein-coding gene	gene with protein product		605895	"""eukaryotic translation initiation factor 4E-like 3"""	EIF4EL3		9653160, 9582349	Standard	XM_005246975		Approved	IF4e, 4EHP	uc002vta.3	O60573	OTTHUMG00000133256	ENST00000409514.1:c.*320G>-	2.37:g.233445900delG			B8ZZJ9|O75349	RNA	DEL	-	NULL	ENST00000409514.1	37	NULL		2																																																																																			AC073254.1	-	-	ENSG00000237126		0.498	EIF4E2-003	PUTATIVE	basic	protein_coding	ENSG00000237126	Clone_based_vega_gene	protein_coding	OTTHUMT00000330695.1		0.00	55	0	G	NM_004846		233445900	-1	tier1		no_errors	ENST00000415506	ensembl	human	known	74_37	rna	7.69	24	2	DEL	0.002	-
FBXO16	157574	genome.wustl.edu	37	8	28309933	28309933	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr8:28309933C>A	ENST00000380254.2	-	6	716	c.568G>T	c.(568-570)Gag>Tag	p.E190*	FBXO16_ENST00000518734.1_Nonsense_Mutation_p.E178*|RP11-181B11.2_ENST00000518819.1_RNA|FBXO16_ENST00000517436.1_Intron|RP11-181B11.2_ENST00000523935.1_RNA|FBXO16_ENST00000346498.2_Nonsense_Mutation_p.E178*	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	190										large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		TGTTTTTCCTCTGGAGAATTG	0.408																																																	0													84.0	88.0	86.0					8																	28309933		2203	4300	6503	SO:0001587	stop_gained	0			AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.568G>T	8.37:g.28309933C>A	ENSP00000369604:p.Glu190*		Q3T1B2|Q3T1B3|Q3T1B4	Nonsense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.E190*	ENST00000380254.2	37	c.568	CCDS6068.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.98|13.98	2.399467|2.399467	0.42512|0.42512	.|.	.|.	ENSG00000214050|ENSG00000214050	ENST00000380254;ENST00000346498;ENST00000518734;ENST00000517673|ENST00000518248	.|.	.|.	.|.	5.27|5.27	4.39|4.39	0.52855|0.52855	.|.	0.651982|.	0.14054|.	U|.	0.344539|.	.|T	.|0.63733	.|0.2536	.|.	.|.	.|.	0.41085|0.41085	D|D	0.985556|0.985556	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62581	.|-0.6824	.|4	0.38643|.	T|.	0.18|.	-26.2905|-26.2905	12.5055|12.5055	0.55979|0.55979	0.0:0.9182:0.0:0.0818|0.0:0.9182:0.0:0.0818	.|.	.|.	.|.	.|.	X|H	190;178;178;135|34	.|.	ENSP00000341416:E178X|.	E|Q	-|-	1|3	0|2	FBXO16|FBXO16	28365852|28365852	0.769000|0.769000	0.28531|0.28531	0.040000|0.040000	0.18447|0.18447	0.172000|0.172000	0.22775|0.22775	2.376000|2.376000	0.44292|0.44292	1.209000|1.209000	0.43321|0.43321	-0.218000|-0.218000	0.12543|0.12543	GAG|CAG	FBXO16	-	superfamily_F-box_dom	ENSG00000214050		0.408	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO16	HGNC	protein_coding	OTTHUMT00000219988.2		0.00	90	0	C	NM_172366		28309933	-1			no_errors	ENST00000521548	ensembl	human	known	74_37	nonsense	5.26	72	4	SNP	0.106	A
FOXR1	283150	genome.wustl.edu	37	11	118850248	118850248	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:118850248C>T	ENST00000317011.3	+	4	706	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W		NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	161					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R161W(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		TCGGAGGCTTCGGCAAGCCAG	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											42.0	48.0	46.0					11																	118850248		2200	4295	6495	SO:0001583	missense	0			AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.481C>T	11.37:g.118850248C>T	ENSP00000314806:p.Arg161Trp		B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R161W	ENST00000317011.3	37	c.481	CCDS31688.1	11	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396586	0.62177	.	.	ENSG00000176302	ENST00000317011	D	0.95377	-3.69	5.61	5.61	0.85477	.	0.915017	0.09436	N	0.802382	D	0.95778	0.8626	L	0.45698	1.435	0.26818	N	0.968843	D	0.76494	0.999	P	0.53689	0.732	D	0.90523	0.4490	10	0.48119	T	0.1	.	15.5123	0.75793	0.0:1.0:0.0:0.0	.	161	Q6PIV2	FOXR1_HUMAN	W	161	ENSP00000314806:R161W	ENSP00000314806:R161W	R	+	1	2	FOXR1	118355458	1.000000	0.71417	0.967000	0.41034	0.998000	0.95712	2.724000	0.47285	2.826000	0.97356	0.655000	0.94253	CGG	FOXR1	-	NULL	ENSG00000176302		0.607	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR1	HGNC	protein_coding	OTTHUMT00000389312.1		0.00	49	0	C	NM_181721		118850248	+1			no_errors	ENST00000317011	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.778	T
GORASP2	26003	genome.wustl.edu	37	2	171818224	171818224	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:171818224C>T	ENST00000234160.4	+	8	1690	c.875C>T	c.(874-876)tCt>tTt	p.S292F	GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Missense_Mutation_p.S304F	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	292	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TCCCTCACTTCTGTGCCACCA	0.393																																																	0													263.0	219.0	234.0					2																	171818224		2203	4300	6503	SO:0001583	missense	0				CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.875C>T	2.37:g.171818224C>T	ENSP00000234160:p.Ser292Phe		B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	pfam_GRASP55/65_PDZ,superfamily_PDZ	p.S304F	ENST00000234160.4	37	c.911	CCDS33325.1	2	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239087	0.79800	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.48836	0.82;0.8	6.16	5.27	0.74061	.	0.171432	0.56097	D	0.000036	T	0.46678	0.1405	M	0.65975	2.015	0.46131	D	0.998885	B;B;B	0.31680	0.22;0.335;0.22	B;B;B	0.23852	0.03;0.049;0.03	T	0.49072	-0.8977	10	0.59425	D	0.04	-15.3443	15.1706	0.72869	0.1411:0.8589:0.0:0.0	.	248;304;292	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	F	292;304	ENSP00000234160:S292F;ENSP00000410208:S304F	ENSP00000234160:S292F	S	+	2	0	GORASP2	171526470	0.792000	0.28813	0.996000	0.52242	0.993000	0.82548	3.416000	0.52707	1.580000	0.49851	0.650000	0.86243	TCT	GORASP2	-	pfam_GRASP55/65_PDZ	ENSG00000115806		0.393	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP2	HGNC	protein_coding	OTTHUMT00000333719.2		0.00	58	0	C			171818224	+1			no_errors	ENST00000452526	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.989	T
FZD7	8324	genome.wustl.edu	37	2	202899867	202899867	+	Missense_Mutation	SNP	C	C	T	rs185267840		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:202899867C>T	ENST00000286201.1	+	1	558	c.497C>T	c.(496-498)tCg>tTg	p.S166L	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	166					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CAGAACACGTCGGACGGCTCC	0.721											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													15.0	18.0	17.0					2																	202899867		2180	4272	6452	SO:0001583	missense	0			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.497C>T	2.37:g.202899867C>T	ENSP00000286201:p.Ser166Leu	2133	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S166L	ENST00000286201.1	37	c.497	CCDS2351.1	2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	16.11	3.030812	0.54790	.	.	ENSG00000155760	ENST00000286201	T	0.76709	-1.04	5.54	5.54	0.83059	Frizzled domain (1);	0.437679	0.24752	N	0.035892	T	0.74974	0.3787	L	0.58810	1.83	0.80722	D	1	P	0.42757	0.789	B	0.36092	0.217	T	0.76578	-0.2908	10	0.41790	T	0.15	.	19.4956	0.95070	0.0:1.0:0.0:0.0	.	166	O75084	FZD7_HUMAN	L	166	ENSP00000286201:S166L	ENSP00000286201:S166L	S	+	2	0	FZD7	202608112	0.980000	0.34600	0.943000	0.38184	0.478000	0.33099	4.079000	0.57613	2.607000	0.88179	0.563000	0.77884	TCG	FZD7	-	superfamily_Frizzled_dom	ENSG00000155760		0.721	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD7	HGNC	protein_coding	OTTHUMT00000256314.1		0.00	56	0	C	NM_003507		202899867	+1			no_errors	ENST00000286201	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.999	T
GZMK	3003	genome.wustl.edu	37	5	54320619	54320619	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:54320619delG	ENST00000231009.2	+	2	266	c.196delG	c.(196-198)gccfs	p.A66fs	CTD-2313F11.1_ENST00000371487.3_RNA|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000607910.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|ESM1_ENST00000598310.1_5'Flank|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000596909.2_RNA|CTD-2313F11.1_ENST00000595218.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	66	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				GCTGACAGCAGCCCACTGCCA	0.473																																																	0													51.0	52.0	52.0					5																	54320619		2203	4300	6503	SO:0001589	frameshift_variant	0			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.196delG	5.37:g.54320619delG	ENSP00000231009:p.Ala66fs		B2R563	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A66fs	ENST00000231009.2	37	c.196	CCDS3964.1	5																																																																																			GZMK	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000113088		0.473	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMK	HGNC	protein_coding	OTTHUMT00000214098.1		0.00	44	0	G	NM_002104		54320619	+1	tier1		no_errors	ENST00000231009	ensembl	human	known	74_37	frame_shift_del	5.56	34	2	DEL	0.999	-
HIVEP2	3097	genome.wustl.edu	37	6	143095479	143095479	+	Missense_Mutation	SNP	C	C	T	rs374725107		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr6:143095479C>T	ENST00000367604.1	-	4	1036	c.397G>A	c.(397-399)Gtt>Att	p.V133I	HIVEP2_ENST00000367603.2_Missense_Mutation_p.V133I|HIVEP2_ENST00000012134.2_Missense_Mutation_p.V133I			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V79I(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TCAGAGGCAACGGATGGCAAA	0.502													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22060	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(107;843 1510 13293 16805 42198)												1	Substitution - Missense(1)	central_nervous_system(1)						C	ILE/VAL	1,4027		0,1,2013	122.0	129.0	126.0		397	3.6	0.7	6		126	0,8334		0,0,4167	no	missense	HIVEP2	NM_006734.3	29	0,1,6180	TT,TC,CC		0.0,0.0248,0.0081	benign	133/2447	143095479	1,12361	2014	4167	6181	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.397G>A	6.37:g.143095479C>T	ENSP00000356576:p.Val133Ile		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V133I	ENST00000367604.1	37	c.397	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	4.443	0.081982	0.08533	2.48E-4	0.0	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02369	4.32;4.32;4.32	5.69	3.59	0.41128	.	0.165679	0.40818	N	0.001011	T	0.00906	0.0030	L	0.31294	0.92	0.27778	N	0.94326	B	0.23990	0.095	B	0.15052	0.012	T	0.46652	-0.9176	10	0.19590	T	0.45	-15.8629	13.4532	0.61182	0.0:0.851:0.0:0.149	.	133	P31629	ZEP2_HUMAN	I	133	ENSP00000356576:V133I;ENSP00000356575:V133I;ENSP00000012134:V133I	ENSP00000012134:V133I	V	-	1	0	HIVEP2	143137172	0.997000	0.39634	0.668000	0.29813	0.924000	0.55760	2.584000	0.46102	1.400000	0.46741	0.655000	0.94253	GTT	HIVEP2	-	NULL	ENSG00000010818		0.502	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1		0.00	39	0	C			143095479	-1			no_errors	ENST00000012134	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.726	T
HRH4	59340	genome.wustl.edu	37	18	22057140	22057140	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr18:22057140T>C	ENST00000256906.4	+	3	887	c.787T>C	c.(787-789)Tca>Cca	p.S263P	HRH4_ENST00000426880.2_Missense_Mutation_p.S175P	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	263					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	CATGTTTTCCTCAAGAACCAA	0.418																																																	0													114.0	114.0	114.0					18																	22057140		2203	4300	6503	SO:0001583	missense	0			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.787T>C	18.37:g.22057140T>C	ENSP00000256906:p.Ser263Pro		B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H4_rcpt,prints_GPCR_Rhodpsn	p.S263P	ENST00000256906.4	37	c.787	CCDS11887.1	18	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441983	0.25900	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	T;T	0.71222	-0.55;-0.44	5.79	-0.999	0.10208	GPCR, rhodopsin-like superfamily (1);	0.928471	0.09112	N	0.846918	T	0.47710	0.1460	N	0.17082	0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.0;0.003	T	0.23154	-1.0196	10	0.27082	T	0.32	-1.7183	4.0167	0.09647	0.4118:0.3044:0.0:0.2838	.	175;263	B2KJ48;Q9H3N8	.;HRH4_HUMAN	P	263;175	ENSP00000256906:S263P;ENSP00000402526:S175P	ENSP00000256906:S263P	S	+	1	0	HRH4	20311138	0.000000	0.05858	0.026000	0.17262	0.028000	0.11728	0.043000	0.13971	-0.153000	0.11137	0.533000	0.62120	TCA	HRH4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H4_rcpt	ENSG00000134489		0.418	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH4	HGNC	protein_coding	OTTHUMT00000254904.1		0.00	25	0	T			22057140	+1			no_errors	ENST00000256906	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.002	C
HSD3B7	80270	genome.wustl.edu	37	16	30998318	30998318	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr16:30998318A>T	ENST00000297679.5	+	6	782	c.689A>T	c.(688-690)tAt>tTt	p.Y230F	HSD3B7_ENST00000353250.5_Intron|AC135048.1_ENST00000602217.1_5'Flank|HSD3B7_ENST00000262520.6_Intron	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	230					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GGCCGGGTCTATGTGGGTGAG	0.637																																																	0													21.0	24.0	23.0					16																	30998318		2196	4298	6494	SO:0001583	missense	0			AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.689A>T	16.37:g.30998318A>T	ENSP00000297679:p.Tyr230Phe		Q96M28|Q9BSN9	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Polysac_CapD-like,pfam_dTDP_dehydrorham_reduct,pfam_NmrA	p.Y230F	ENST00000297679.5	37	c.689	CCDS10698.1	16	.	.	.	.	.	.	.	.	.	.	A	35	5.482090	0.96307	.	.	ENSG00000099377	ENST00000297679	D	0.94046	-3.34	5.54	5.54	0.83059	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96516	0.8863	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96610	0.9451	10	0.52906	T	0.07	-16.3523	14.6522	0.68805	1.0:0.0:0.0:0.0	.	230	Q9H2F3	3BHS7_HUMAN	F	230	ENSP00000297679:Y230F	ENSP00000297679:Y230F	Y	+	2	0	HSD3B7	30905819	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.093000	0.89531	2.098000	0.63641	0.459000	0.35465	TAT	HSD3B7	-	pfam_3Beta_OHSteriod_DH/Estase	ENSG00000099377		0.637	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B7	HGNC	protein_coding	OTTHUMT00000255554.2		0.00	14	0	A			30998318	+1			no_errors	ENST00000297679	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	T
INTS7	25896	genome.wustl.edu	37	1	212142051	212142052	+	Splice_Site	INS	-	-	G	rs201458058		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr1:212142051_212142052insG	ENST00000366994.3	-	14	1920		c.e14-2		INTS7_ENST00000366993.3_Splice_Site|INTS7_ENST00000469606.1_Splice_Site|INTS7_ENST00000366992.3_Splice_Site|INTS7_ENST00000440600.2_Splice_Site	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7						cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		ACTAGCTGCCTGGGAAAAAAAA	0.366																																																	0									,,,	327,3939		18,291,1824					,,,	4.1	0.9		dbSNP_132	41	301,7953		13,275,3839	no	splice-3,splice-3,splice-3,splice-3	INTS7	NM_015434.3,NM_001199812.1,NM_001199811.1,NM_001199809.1	,,,	31,566,5663	A1A1,A1R,RR		3.6467,7.6653,5.016	,,,	,,,		628,11892				SO:0001630	splice_region_variant	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1816-2->C	1.37:g.212142054_212142054dupG			B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Splice_Site	INS	-	e13-2	ENST00000366994.3	37	c.1669-3_1669-2	CCDS1501.1	1																																																																																			INTS7	-	-	ENSG00000143493		0.366	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1		0.00	14	0	-	NM_015434	Intron	212142052	-1	tier1		no_errors	ENST00000440600	ensembl	human	known	74_37	splice_site_ins	28.57	10	4	INS	0.998:0.652	G
IRX6	79190	genome.wustl.edu	37	16	55362817	55362817	+	Silent	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr16:55362817C>T	ENST00000290552.7	+	5	2259	c.927C>T	c.(925-927)tgC>tgT	p.C309C	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	309					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.C309C(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						GCAGGGAGTGCGGCCTGGCTG	0.657																																																	1	Substitution - coding silent(1)	large_intestine(1)											45.0	49.0	47.0					16																	55362817		2195	4294	6489	SO:0001819	synonymous_variant	0			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.927C>T	16.37:g.55362817C>T			B2RN06|Q7Z2K0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.C309	ENST00000290552.7	37	c.927	CCDS32449.1	16																																																																																			IRX6	-	NULL	ENSG00000159387		0.657	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX6	HGNC	protein_coding	OTTHUMT00000417445.4		0.00	34	0	C	NM_024335		55362817	+1			no_errors	ENST00000290552	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.170	T
JAKMIP2	9832	genome.wustl.edu	37	5	147040519	147040519	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:147040519G>A	ENST00000265272.5	-	3	1086	c.619C>T	c.(619-621)Cgg>Tgg	p.R207W	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R165W|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R207W	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	207						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAGCCTCCGAATATCCCGC	0.502																																																	0													130.0	123.0	125.0					5																	147040519		2203	4300	6503	SO:0001583	missense	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.619C>T	5.37:g.147040519G>A	ENSP00000265272:p.Arg207Trp		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	NULL	p.R207W	ENST00000265272.5	37	c.619	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397496	0.83120	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.37058	1.22;1.22;1.22	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.988;0.988;0.988	T	0.63985	-0.6513	10	0.87932	D	0	.	14.3424	0.66636	0.0:0.0:0.8515:0.1485	.	165;207;207;207	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	W	207;207;165;207	ENSP00000421398:R207W;ENSP00000265272:R207W;ENSP00000328989:R165W	ENSP00000265272:R207W	R	-	1	2	JAKMIP2	147020712	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.818000	0.86416	2.777000	0.95525	0.655000	0.94253	CGG	JAKMIP2	-	NULL	ENSG00000176049		0.502	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	52	0	G	NM_014790		147040519	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	missense	17.14	29	6	SNP	1.000	A
KAT7	11143	genome.wustl.edu	37	17	47893185	47893185	+	Silent	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr17:47893185G>T	ENST00000259021.4	+	8	1153	c.873G>T	c.(871-873)ggG>ggT	p.G291G	KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000503935.2_Silent_p.G135G|KAT7_ENST00000510819.1_Silent_p.G122G|KAT7_ENST00000509773.1_Silent_p.G181G|KAT7_ENST00000424009.2_Silent_p.G261G|KAT7_ENST00000435742.2_Silent_p.G105G|KAT7_ENST00000454930.2_Silent_p.G152G	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	291					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										AGACCTATGGGAACACACGGG	0.423																																																	0													101.0	102.0	101.0					17																	47893185		2203	4300	6503	SO:0001819	synonymous_variant	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.873G>T	17.37:g.47893185G>T			B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.G291	ENST00000259021.4	37	c.873	CCDS11554.1	17																																																																																			KAT7	-	NULL	ENSG00000136504		0.423	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	-	0.00	76	0	G	NM_007067		47893185	+1	tier1	-	no_errors	ENST00000259021	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
KIAA0922	23240	genome.wustl.edu	37	4	154395024	154395024	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr4:154395024C>A	ENST00000409663.3	+	3	275	c.223C>A	c.(223-225)Cct>Act	p.P75T	KIAA0922_ENST00000440693.1_Missense_Mutation_p.P75T|KIAA0922_ENST00000409959.3_Missense_Mutation_p.P75T	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	75						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCTGGAGGAGCCTTCTCAAGA	0.453																																																	0													138.0	165.0	157.0					4																	154395024		692	1591	2283	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.223C>A	4.37:g.154395024C>A	ENSP00000386574:p.Pro75Thr		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.P75T	ENST00000409663.3	37	c.223	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	C	8.412	0.844390	0.16963	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959	T;T;T	0.16743	2.58;2.32;2.58	5.1	4.26	0.50523	.	.	.	.	.	T	0.11324	0.0276	N	0.22421	0.69	0.20638	N	0.999876	B;B	0.17465	0.022;0.006	B;B	0.15870	0.014;0.006	T	0.30822	-0.9965	9	0.15066	T	0.55	.	10.7136	0.46000	0.0:0.9103:0.0:0.0897	.	75;75	A2VDJ0-5;A2VDJ0	.;T131L_HUMAN	T	75	ENSP00000386574:P75T;ENSP00000409663:P75T;ENSP00000386787:P75T	ENSP00000386574:P75T	P	+	1	0	KIAA0922	154614474	0.204000	0.23447	0.851000	0.33527	0.898000	0.52572	1.837000	0.39201	1.289000	0.44618	0.561000	0.74099	CCT	KIAA0922	-	NULL	ENSG00000121210		0.453	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	-	0.00	79	0	C	NM_015196		154395024	+1	tier1	-	no_errors	ENST00000409959	ensembl	human	known	74_37	missense	16.67	55	11	SNP	0.982	A
KRT38	8687	genome.wustl.edu	37	17	39596806	39596806	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr17:39596806C>T	ENST00000246646.3	-	1	367	c.368G>A	c.(367-369)cGc>cAc	p.R123H		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	123	Coil 1A.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R123H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				CTCCAGCTGGCGCACCTTCTC	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											127.0	111.0	117.0					17																	39596806		2203	4300	6503	SO:0001583	missense	0			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.368G>A	17.37:g.39596806C>T	ENSP00000246646:p.Arg123His		A2RRM5|Q6A164	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.R123H	ENST00000246646.3	37	c.368	CCDS11392.1	17	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429455	0.43122	.	.	ENSG00000171360	ENST00000246646	D	0.91843	-2.92	4.45	2.4	0.29515	Filament (1);	0.000000	0.49305	D	0.000141	D	0.90290	0.6963	M	0.84511	2.7	0.09310	N	1	P	0.51537	0.946	B	0.41571	0.36	D	0.84438	0.0581	10	0.66056	D	0.02	.	4.7923	0.13254	0.1725:0.6503:0.0:0.1772	.	123	O76015	KRT38_HUMAN	H	123	ENSP00000246646:R123H	ENSP00000246646:R123H	R	-	2	0	KRT38	36850332	0.000000	0.05858	0.181000	0.23098	0.989000	0.77384	0.024000	0.13555	0.479000	0.27511	0.650000	0.86243	CGC	KRT38	-	pfam_IF	ENSG00000171360		0.587	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT38	HGNC	protein_coding	OTTHUMT00000257307.2		0.00	64	0	C	NM_006771		39596806	-1			no_errors	ENST00000246646	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.007	T
KRT8	3856	genome.wustl.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																																	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)											12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	0			BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala		A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.S31A	ENST00000552551.1	37	c.91	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	KRT8	-	NULL	ENSG00000170421		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	HGNC	protein_coding	OTTHUMT00000406385.1		0.00	87	0	A	NM_002273		53298675	-1			no_errors	ENST00000293308	ensembl	human	known	74_37	missense	5.36	51	3	SNP	0.000	C
LCN12	286256	genome.wustl.edu	37	9	139846877	139846877	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr9:139846877G>T	ENST00000371633.3	+	1	98	c.98G>T	c.(97-99)aGc>aTc	p.S33I		NM_178536.3	NP_848631.2	Q6JVE5	LCN12_HUMAN	lipocalin 12	33					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		CCGATGCAGAGCTTCCAAGGA	0.642																																																	0													18.0	23.0	21.0					9																	139846877		1910	4106	6016	SO:0001583	missense	0			BC041168	CCDS7018.2	9q34	2011-10-24	2007-12-18		ENSG00000184925	ENSG00000184925		"""Lipocalins"""	28733	protein-coding gene	gene with protein product		612905				15363845	Standard	XM_005266068		Approved	MGC48935	uc004ckb.3	Q6JVE5	OTTHUMG00000020968	ENST00000371633.3:c.98G>T	9.37:g.139846877G>T	ENSP00000360696:p.Ser33Ile		A2AMJ7	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_PstgldnD_synth,prints_N_gelatinase	p.S33I	ENST00000371633.3	37	c.98	CCDS7018.2	9	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858934	0.71834	.	.	ENSG00000184925	ENST00000371633	T	0.46451	0.87	4.01	2.12	0.27331	Calycin-like (1);Calycin (1);	0.197348	0.25205	N	0.032349	T	0.51381	0.1671	L	0.50333	1.59	0.09310	N	0.999999	D;D	0.65815	0.995;0.995	P;D	0.65443	0.906;0.935	T	0.36529	-0.9744	10	0.87932	D	0	-11.3641	7.9665	0.30102	0.2951:0.0:0.7049:0.0	.	33;33	Q8IW14;Q6JVE5	.;LCN12_HUMAN	I	33	ENSP00000360696:S33I	ENSP00000360696:S33I	S	+	2	0	LCN12	138966698	0.000000	0.05858	0.013000	0.15412	0.874000	0.50279	-0.815000	0.04481	0.434000	0.26340	0.561000	0.74099	AGC	LCN12	-	superfamily_Calycin-like,prints_PstgldnD_synth	ENSG00000184925		0.642	LCN12-015	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN12	HGNC	protein_coding	OTTHUMT00000257990.1	-	0.00	148	0	G	NM_178536		139846877	+1	tier1	-	no_errors	ENST00000371633	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.205	T
LRP1	4035	genome.wustl.edu	37	12	57579402	57579402	+	Silent	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr12:57579402C>T	ENST00000243077.3	+	41	7018	c.6552C>T	c.(6550-6552)caC>caT	p.H2184H		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2184	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCTGTGCCCACGGGATGCTGG	0.672																																																	0													37.0	33.0	34.0					12																	57579402		2203	4300	6503	SO:0001819	synonymous_variant	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.6552C>T	12.37:g.57579402C>T			Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H2184	ENST00000243077.3	37	c.6552	CCDS8932.1	12																																																																																			LRP1	-	smart_EG-like_dom	ENSG00000123384		0.672	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2		0.00	27	0	C	NM_002332		57579402	+1			no_errors	ENST00000243077	ensembl	human	known	74_37	silent	14.29	12	2	SNP	0.311	T
MATK	4145	genome.wustl.edu	37	19	3779411	3779411	+	Silent	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr19:3779411G>T	ENST00000310132.6	-	11	1364	c.966C>A	c.(964-966)gcC>gcA	p.A322A	MATK_ENST00000585778.1_Silent_p.A322A|MATK_ENST00000395040.2_Silent_p.A281A|MATK_ENST00000395045.2_Silent_p.A323A	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	322	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTTCACGAGGGCTCGACCCC	0.652																																																	0													45.0	48.0	47.0					19																	3779411		2203	4300	6503	SO:0001819	synonymous_variant	0			L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.966C>A	19.37:g.3779411G>T			B3KNZ9|Q9NST8	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.A323	ENST00000310132.6	37	c.969	CCDS12114.1	19																																																																																			MATK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000007264		0.652	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	HGNC	protein_coding	OTTHUMT00000453639.1	-	0.00	47	0	G	NM_139355		3779411	-1	tier1	-	no_errors	ENST00000395045	ensembl	human	known	74_37	silent	14.29	24	4	SNP	0.860	T
MAG	4099	genome.wustl.edu	37	19	35786626	35786626	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr19:35786626G>A	ENST00000392213.3	+	4	316	c.157G>A	c.(157-159)Gct>Act	p.A53T	MAG_ENST00000361922.4_Missense_Mutation_p.A53T|MAG_ENST00000537831.2_Missense_Mutation_p.A28T|MAG_ENST00000597035.1_Missense_Mutation_p.A53T	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	53	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)	p.A53T(4)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCTGCGGCCCGCTGTGGTGCA	0.622																																																	4	Substitution - Missense(4)	large_intestine(2)|lung(2)											78.0	81.0	80.0					19																	35786626		2203	4300	6503	SO:0001583	missense	0			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.157G>A	19.37:g.35786626G>A	ENSP00000376048:p.Ala53Thr		B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A53T	ENST00000392213.3	37	c.157	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687043	0.29962	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.43294	0.95;0.95;0.95	5.4	3.25	0.37280	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.316454	0.34133	N	0.004234	T	0.13628	0.0330	N	0.05383	-0.06	0.20403	N	0.999909	P;P;P	0.36144	0.48;0.539;0.539	B;B;B	0.21151	0.033;0.024;0.024	T	0.16453	-1.0402	10	0.09843	T	0.71	.	4.9197	0.13864	0.0804:0.1469:0.6207:0.1519	.	90;53;53	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	T	90;53;53;28	ENSP00000355234:A53T;ENSP00000376048:A53T;ENSP00000440695:A28T	ENSP00000262624:A90T	A	+	1	0	MAG	40478466	0.027000	0.19231	0.106000	0.21319	0.842000	0.47809	0.990000	0.29642	0.775000	0.33450	-0.374000	0.07098	GCT	MAG	-	smart_Ig_sub	ENSG00000105695		0.622	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1		0.00	52	0	G	NM_080600		35786626	+1			no_errors	ENST00000392213	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.466	A
MIR3687-2	103504728	genome.wustl.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																																	0																																												0																															21.37:g.9825845_9825847dupGCG				RNA	INS	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			MIR3648	-	-	ENSG00000264462		0.842	MIR3687-201	KNOWN	basic	miRNA	MIR3648	HGNC	miRNA			0.00	37	0	-			9825839	+1	tier1		no_errors	ENST00000581792	ensembl	human	known	74_37	rna	18.18	18	4	INS	0.061:0.061	GCG
AC017002.1	0	genome.wustl.edu	37	2	112252633	112252633	+	lincRNA	DEL	A	A	-	rs147562547		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:112252633delA	ENST00000455309.1	+	0	390				AC017002.2_ENST00000432268.1_lincRNA																							ACTAAGAAGGAAAAAAAAAAA	0.438																																																	0																																												0																															2.37:g.112252633delA				RNA	DEL	-	NULL	ENST00000455309.1	37	NULL		2																																																																																			MIR4435-1HG	-	-	ENSG00000172965		0.438	AC017002.1-001	KNOWN	basic|exp_conf	lincRNA	MIR4435-1HG	HGNC	lincRNA	OTTHUMT00000332149.1		0.00	56	0	A			112252633	-1	tier1		no_errors	ENST00000409569	ensembl	human	known	74_37	rna	10.34	26	3	DEL	0.775	-
MRPS36	92259	genome.wustl.edu	37	5	68522214	68522214	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:68522214A>G	ENST00000256441.4	+	2	162	c.92A>G	c.(91-93)aAt>aGt	p.N31S	MRPS36_ENST00000512880.1_5'UTR|MRPS36_ENST00000507022.1_Intron|MRPS36_ENST00000602380.1_5'UTR	NM_033281.5	NP_150597.1	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	31					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(1)|urinary_tract(1)	7		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		AGAAGAGACAATCCTAAACCC	0.264																																																	0													89.0	88.0	88.0					5																	68522214		2203	4300	6503	SO:0001583	missense	0				CCDS34174.1	5q13.2	2013-09-20			ENSG00000134056	ENSG00000134056		"""Mitochondrial ribosomal proteins / small subunits"""	16631	protein-coding gene	gene with protein product		611996				11279123	Standard	NM_033281		Approved	DC47, MRP-S36	uc003jvq.3	P82909	OTTHUMG00000162443	ENST00000256441.4:c.92A>G	5.37:g.68522214A>G	ENSP00000256441:p.Asn31Ser		Q9H2H4	Missense_Mutation	SNP	NULL	p.N31S	ENST00000256441.4	37	c.92	CCDS34174.1	5	.	.	.	.	.	.	.	.	.	.	A	2.608	-0.291385	0.05568	.	.	ENSG00000134056	ENST00000256441	.	.	.	5.03	3.85	0.44370	.	0.505520	0.21595	N	0.072039	T	0.25232	0.0613	N	0.08118	0	0.80722	D	1	B	0.15930	0.015	B	0.13407	0.009	T	0.05886	-1.0858	9	0.08179	T	0.78	.	5.7991	0.18403	0.6559:0.1757:0.0:0.1684	.	31	P82909	RT36_HUMAN	S	31	.	ENSP00000256441:N31S	N	+	2	0	MRPS36	68557970	1.000000	0.71417	0.998000	0.56505	0.360000	0.29518	2.325000	0.43840	0.916000	0.36871	-0.336000	0.08194	AAT	MRPS36	-	NULL	ENSG00000134056		0.264	MRPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS36	HGNC	protein_coding	OTTHUMT00000368940.1	-	0.00	130	0	A	NM_033281		68522214	+1	tier1	-	no_errors	ENST00000256441	ensembl	human	known	74_37	missense	7.41	74	6	SNP	0.996	G
MT-CO2	4513	genome.wustl.edu	37	M	7678	7678	+	Silent	SNP	T	T	C			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chrM:7678T>C	ENST00000361739.1	+	1	93	c.93T>C	c.(91-93)atT>atC	p.I31I	MT-ATP6_ENST00000361899.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TD_ENST00000387419.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	31					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CTCATAATCATTTTCCTTATC	0.413																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.93T>C	M.37:g.7678T>C			Q37526	Silent	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.I31	ENST00000361739.1	37	c.93		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.413	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	1172	0	T	YP_003024029		7678	+1	tier1	-	no_errors	ENST00000361739	ensembl	human	known	74_37	silent	46.92	371	328	SNP	NULL	C
MYO6	4646	genome.wustl.edu	37	6	76545674	76545674	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr6:76545674G>T	ENST00000369977.3	+	7	692		c.e7+1		MYO6_ENST00000369981.3_Splice_Site|MYO6_ENST00000369985.4_Splice_Site|MYO6_ENST00000369975.1_Splice_Site	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI						actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ATTGTTGAAGGTATTGCTAAT	0.328																																																	0													125.0	123.0	124.0					6																	76545674		2203	4300	6503	SO:0001630	splice_region_variant	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.553+1G>T	6.37:g.76545674G>T			A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Splice_Site	SNP	-	e6+1	ENST00000369977.3	37	c.553+1	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985132	0.74474	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8341	0.85952	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO6	76602394	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.269000	0.95684	2.029000	0.59856	0.460000	0.39030	.	MYO6	-	-	ENSG00000196586		0.328	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2		0.00	62	0	G	NM_004999	Intron	76545674	+1			no_errors	ENST00000369981	ensembl	human	known	74_37	splice_site	6.12	46	3	SNP	1.000	T
MYO7A	4647	genome.wustl.edu	37	11	76917248	76917248	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:76917248G>A	ENST00000409709.3	+	41	6014		c.e41+1		MYO7A_ENST00000409619.2_Splice_Site|MYO7A_ENST00000605744.1_Splice_Site|MYO7A_ENST00000458637.2_Splice_Site	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CACTGACGAGGTGAGGGTCAC	0.602																																																	0													66.0	73.0	71.0					11																	76917248		1970	4143	6113	SO:0001630	splice_region_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5742+1G>A	11.37:g.76917248G>A			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Splice_Site	SNP	-	e40+1	ENST00000409709.3	37	c.5742+1	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	g	12.70	2.016961	0.35606	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3103	0.87207	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO7A	76594896	1.000000	0.71417	0.995000	0.50966	0.124000	0.20399	9.374000	0.97172	2.075000	0.62263	0.556000	0.70494	.	MYO7A	-	-	ENSG00000137474		0.602	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	-	0.00	64	0	G	NM_000260	Intron	76917248	+1	tier1	-	no_errors	ENST00000409709	ensembl	human	known	74_37	splice_site	13.33	26	4	SNP	1.000	A
NCKAP5	344148	genome.wustl.edu	37	2	133540922	133540922	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:133540922C>A	ENST00000409261.1	-	14	3835	c.3462G>T	c.(3460-3462)atG>atT	p.M1154I	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.M1154I|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1154										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGGGAGACTTCATGAGCACTT	0.488																																																	0													101.0	101.0	101.0					2																	133540922		1987	4154	6141	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3462G>T	2.37:g.133540922C>A	ENSP00000387128:p.Met1154Ile		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.M1154I	ENST00000409261.1	37	c.3462	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267658	0.23136	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.09163	3.01;3.01	5.26	0.743	0.18347	.	0.206931	0.23279	U	0.049921	T	0.06005	0.0156	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35201	-0.9798	10	0.29301	T	0.29	.	2.7162	0.05188	0.148:0.2099:0.4845:0.1577	.	1154	O14513	NCKP5_HUMAN	I	1154	ENSP00000387128:M1154I;ENSP00000380603:M1154I	ENSP00000380603:M1154I	M	-	3	0	NCKAP5	133257392	0.926000	0.31397	1.000000	0.80357	0.900000	0.52787	-0.105000	0.10907	0.287000	0.22375	-0.150000	0.13652	ATG	NCKAP5	-	NULL	ENSG00000176771		0.488	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1		0.00	31	0	C	NM_207481		133540922	-1			no_errors	ENST00000317721	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.999	A
NMUR2	56923	genome.wustl.edu	37	5	151784588	151784588	+	Silent	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:151784588G>A	ENST00000255262.3	-	1	252	c.87C>T	c.(85-87)acC>acT	p.T29T	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	29					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GATACTCCTCGGTGCTGTTCA	0.512																																																	0													96.0	99.0	98.0					5																	151784588		2203	4300	6503	SO:0001819	synonymous_variant	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.87C>T	5.37:g.151784588G>A			Q7LC54|Q96AM5|Q9NRA6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_GPCR_Rhodpsn	p.T29	ENST00000255262.3	37	c.87	CCDS4321.1	5																																																																																			NMUR2	-	NULL	ENSG00000132911		0.512	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	HGNC	protein_coding	OTTHUMT00000252439.1		0.00	54	0	G	NM_020167		151784588	-1			no_errors	ENST00000255262	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.004	A
NOL4	8715	genome.wustl.edu	37	18	31599294	31599294	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr18:31599294T>A	ENST00000261592.5	-	6	1341	c.1044A>T	c.(1042-1044)gaA>gaT	p.E348D	NOL4_ENST00000535475.1_Missense_Mutation_p.E193D|NOL4_ENST00000535384.1_Missense_Mutation_p.E63D|NOL4_ENST00000269185.4_Missense_Mutation_p.E234D|NOL4_ENST00000589544.1_Missense_Mutation_p.E348D|NOL4_ENST00000538587.1_Missense_Mutation_p.E274D	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	348						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TGCTTCCATTTTCTCTCGCCT	0.343																																																	0													108.0	95.0	99.0					18																	31599294		2203	4300	6503	SO:0001583	missense	0			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1044A>T	18.37:g.31599294T>A	ENSP00000261592:p.Glu348Asp		B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NULL	p.E348D	ENST00000261592.5	37	c.1044	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485613	0.84854	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75	5.75	4.6	0.57074	.	0.000000	0.64402	D	0.000002	D	0.85444	0.5698	L	0.40543	1.245	0.39868	D	0.97347	D;D;B;P;P;B;D;D	0.63046	0.992;0.99;0.233;0.729;0.815;0.233;0.974;0.99	P;D;B;B;B;B;D;P	0.72982	0.793;0.979;0.065;0.199;0.36;0.065;0.953;0.848	D	0.84549	0.0643	10	0.35671	T	0.21	-23.3998	11.1841	0.48646	0.0:0.0714:0.0:0.9286	.	234;97;63;274;348;63;348;193	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	D	348;234;97;63;193;274	ENSP00000261592:E348D;ENSP00000269185:E234D;ENSP00000445733:E63D;ENSP00000438190:E193D;ENSP00000443472:E274D	ENSP00000261592:E348D	E	-	3	2	NOL4	29853292	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.067000	0.41461	2.204000	0.70986	0.443000	0.29094	GAA	NOL4	-	NULL	ENSG00000101746		0.343	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	HGNC	protein_coding	OTTHUMT00000255386.1	-	0.00	42	0	T	NM_003787		31599294	-1	tier1	-	no_errors	ENST00000261592	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
NRROS	375387	genome.wustl.edu	37	3	196386811	196386811	+	Silent	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr3:196386811C>T	ENST00000328557.4	+	3	500	c.297C>T	c.(295-297)ggC>ggT	p.G99G		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	99					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCAGCCGCGGCGCCTTCCAGG	0.657																																																	0													44.0	42.0	43.0					3																	196386811		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.297C>T	3.37:g.196386811C>T				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G99	ENST00000328557.4	37	c.297	CCDS3319.1	3																																																																																			NRROS	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174004		0.657	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRROS	HGNC	protein_coding	OTTHUMT00000340676.1		0.00	49	0	C	NM_198565		196386811	+1			no_errors	ENST00000328557	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.000	T
NTRK2	4915	genome.wustl.edu	37	9	87317098	87317098	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr9:87317098delA	ENST00000323115.4	+	2	590	c.237delA	c.(235-237)ttafs	p.L79fs	NTRK2_ENST00000277120.3_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000376214.1_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000304053.6_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000376213.1_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000376208.1_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000395882.1_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000359847.3_Frame_Shift_Del_p.L79fs|NTRK2_ENST00000395866.2_5'UTR			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	79					activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AGAAAAGGTTAGAAATCATCA	0.443										TSP Lung(25;0.17)																																							0													101.0	89.0	93.0					9																	87317098		2203	4300	6503	SO:0001589	frameshift_variant	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.237delA	9.37:g.87317098delA	ENSP00000314586:p.Leu79fs		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Frame_Shift_Del	DEL	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.E80fs	ENST00000323115.4	37	c.237	CCDS35050.1	9																																																																																			NTRK2	-	NULL	ENSG00000148053		0.443	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1		0.00	60	0	A			87317098	+1	tier1		no_errors	ENST00000277120	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	1.000	-
OR51A7	119687	genome.wustl.edu	37	11	4929304	4929304	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:4929304G>T	ENST00000359350.4	+	1	705	c.705G>T	c.(703-705)aaG>aaT	p.K235N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K235N(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAGGCTTAAGGCCCTAAATA	0.478																																																	1	Substitution - Missense(1)	lung(1)											233.0	205.0	214.0					11																	4929304		2201	4298	6499	SO:0001583	missense	0			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.705G>T	11.37:g.4929304G>T	ENSP00000352305:p.Lys235Asn		Q6IFH8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K235N	ENST00000359350.4	37	c.705	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	G	4.399	0.073673	0.08485	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.51071	0.72	5.02	-0.522	0.11928	GPCR, rhodopsin-like superfamily (1);	0.266897	0.26369	N	0.024768	T	0.64260	0.2582	H	0.97051	3.93	0.22961	N	0.998503	B	0.25105	0.118	B	0.39771	0.309	T	0.64491	-0.6395	10	0.87932	D	0	.	7.0374	0.25000	0.4708:0.1167:0.4124:0.0	.	235	Q8NH64	O51A7_HUMAN	N	235;235;224	ENSP00000352305:K235N	ENSP00000352305:K235N	K	+	3	2	OR51A7	4885880	0.003000	0.15002	0.007000	0.13788	0.014000	0.08584	-0.034000	0.12225	-0.546000	0.06216	-1.945000	0.00491	AAG	OR51A7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176895		0.478	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	HGNC	protein_coding	OTTHUMT00000142175.1		0.00	34	0	G	NM_001004749		4929304	+1			no_errors	ENST00000359350	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.771	T
OVCH2	341277	genome.wustl.edu	37	11	7718062	7718062	+	RNA	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:7718062G>T	ENST00000533663.1	-	0	0				OVCH2_ENST00000454689.1_RNA|OVCH2_ENST00000534193.2_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		GTGGTGACAAGACTCAACATC	0.478																																																	0													109.0	105.0	107.0					11																	7718062		1959	4150	6109			0			BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7718062G>T				Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S364Y	ENST00000533663.1	37	c.1091		11	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108301	0.37242	.	.	ENSG00000183378	ENST00000454689	T	0.19394	2.15	5.69	2.46	0.29980	CUB (5);	0.667620	0.13176	N	0.407881	T	0.27419	0.0673	M	0.68728	2.09	0.20403	N	0.999906	P	0.46327	0.876	P	0.47864	0.559	T	0.13150	-1.0520	10	0.72032	D	0.01	-3.0714	5.4107	0.16346	0.3852:0.0:0.6148:0.0	.	364	Q7RTZ1	OVCH2_HUMAN	Y	364	ENSP00000407158:S364Y	ENSP00000407158:S364Y	S	-	2	0	OVCH2	7674638	0.979000	0.34478	0.040000	0.18447	0.277000	0.26821	1.440000	0.35024	0.765000	0.33221	0.655000	0.94253	TCT	OVCH2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183378		0.478	OVCH2-002	KNOWN	basic	processed_transcript	OVCH2	HGNC	polymorphic_pseudogene	OTTHUMT00000383928.1		0.00	51	0	G	NM_198185		7718062	-1			no_errors	ENST00000454689	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.830	T
PADI3	51702	genome.wustl.edu	37	1	17596826	17596826	+	Missense_Mutation	SNP	G	G	T	rs371752333		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr1:17596826G>T	ENST00000375460.3	+	7	791	c.751G>T	c.(751-753)Gtg>Ttg	p.V251L		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	251					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GCGCTTCTTCGTGGAAGGCCT	0.572																																																	0													139.0	114.0	123.0					1																	17596826		2203	4300	6503	SO:0001583	missense	0			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.751G>T	1.37:g.17596826G>T	ENSP00000364609:p.Val251Leu		Q58EY7|Q70SX5	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.V251L	ENST00000375460.3	37	c.751	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950447	0.73787	.	.	ENSG00000142619	ENST00000375460	T	0.22945	1.93	5.69	4.77	0.60923	Protein-arginine deiminase (PAD), central domain (2);	0.063731	0.64402	D	0.000006	T	0.33904	0.0879	M	0.80422	2.495	0.49389	D	0.999785	B	0.25850	0.136	B	0.28784	0.094	T	0.16571	-1.0398	10	0.45353	T	0.12	-27.418	13.7133	0.62680	0.0762:0.0:0.9237:0.0	.	251	Q9ULW8	PADI3_HUMAN	L	251	ENSP00000364609:V251L	ENSP00000364609:V251L	V	+	1	0	PADI3	17469413	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	4.550000	0.60733	2.684000	0.91462	0.591000	0.81541	GTG	PADI3	-	pfam_Prot_Arg_deaminase_cen_dom,superfamily_Prot_Arg_deaminase_cen_dom,pirsf_Protein-arginine_deiminase_sub	ENSG00000142619		0.572	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1		0.00	46	0	G			17596826	+1			no_errors	ENST00000375460	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
PPP1R37	284352	genome.wustl.edu	37	19	45641792	45641792	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr19:45641792G>T	ENST00000221462.4	+	2	587	c.223G>T	c.(223-225)Gag>Tag	p.E75*	PPP1R37_ENST00000421905.1_Nonsense_Mutation_p.E75*|AC005757.6_ENST00000591432.1_RNA	NM_019121.1	NP_061994.1	O75864	PPR37_HUMAN	protein phosphatase 1, regulatory subunit 37	75					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GACCGTGGACGAGGTCATCGG	0.652																																																	0																																										SO:0001587	stop_gained	0			BC035704	CCDS56096.1	19q13.32	2012-04-17	2011-10-11	2011-10-11	ENSG00000104866	ENSG00000104866		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	27607	protein-coding gene	gene with protein product			"""leucine rich repeat containing 68"""	LRRC68		12477932	Standard	NM_019121		Approved		uc021uvs.1	O75864	OTTHUMG00000168143	ENST00000221462.4:c.223G>T	19.37:g.45641792G>T	ENSP00000221462:p.Glu75*		B5MDA4|Q8IWK3|Q8TF16	Nonsense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E75*	ENST00000221462.4	37	c.223	CCDS56096.1	19	.	.	.	.	.	.	.	.	.	.	G	41	8.741301	0.98935	.	.	ENSG00000104866	ENST00000421905;ENST00000221462	.	.	.	4.54	4.54	0.55810	.	0.185039	0.45867	D	0.000322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-33.0644	14.8257	0.70110	0.0:0.0:1.0:0.0	.	.	.	.	X	75	.	ENSP00000221462:E75X	E	+	1	0	LRRC68	50333632	1.000000	0.71417	0.987000	0.45799	0.849000	0.48306	9.010000	0.93611	2.369000	0.80426	0.484000	0.47621	GAG	PPP1R37	-	NULL	ENSG00000104866		0.652	PPP1R37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R37	HGNC	protein_coding	OTTHUMT00000398356.2	-	0.00	60	0	G	NM_173634		45641792	+1	tier1	-	no_errors	ENST00000221462	ensembl	human	known	74_37	nonsense	8.00	45	4	SNP	1.000	T
PROM2	150696	genome.wustl.edu	37	2	95943191	95943192	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:95943191_95943192GC>AG	ENST00000317620.9	+	7	985_986	c.852_853GC>AG	c.(850-855)gaGCca>gaAGca	p.P285A	PROM2_ENST00000542147.1_Missense_Mutation_p.P285A|PROM2_ENST00000403131.2_Missense_Mutation_p.P285A|PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000317668.4_Missense_Mutation_p.P285A	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	285					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						AGGACCTGGAGCCAGCCATCCG	0.663																																																	0																																										SO:0001583	missense	0			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	Exception_encountered	2.37:g.95943191_95943192delinsAG	ENSP00000318270:p.Pro285Ala		A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent|Missense_Mutation	SNP	pfam_Prominin	p.E284|p.P285A	ENST00000317620.9	37	c.852|c.853	CCDS2012.1	2																																																																																			PROM2	-	pfam_Prominin	ENSG00000155066		0.663	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PROM2	HGNC	protein_coding	OTTHUMT00000252771.1		0.00	30	0	G|C	NM_144707		95943191|95943192	+1			no_errors	ENST00000317620	ensembl	human	known	74_37	silent|missense	11.11|11.54	24|23	3	SNP	0.001	A|G
RGS3	5998	genome.wustl.edu	37	9	116353678	116353678	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr9:116353678G>T	ENST00000374140.2	+	22	3289		c.e22+1		RGS3_ENST00000394646.3_Splice_Site|RGS3_ENST00000343817.5_Splice_Site|RGS3_ENST00000374134.3_Splice_Site|RGS3_ENST00000462403.1_5'Flank|RGS3_ENST00000350696.5_Splice_Site|RGS3_ENST00000342620.5_Intron|RP11-168K11.2_ENST00000428429.1_RNA|RGS3_ENST00000462143.1_Splice_Site	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GCAAAAACCTGTACGTTGGGA	0.592																																																	0													94.0	86.0	88.0					9																	116353678		2203	4300	6503	SO:0001630	splice_region_variant	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3080+1G>T	9.37:g.116353678G>T			A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Splice_Site	SNP	-	e21+1	ENST00000374140.2	37	c.3080+1	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016327	0.75161	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000394646;ENST00000474719;ENST00000462143;ENST00000374134;ENST00000467805	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7528	0.62917	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGS3	115393499	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.470000	0.73558	2.303000	0.77524	0.555000	0.69702	.	RGS3	-	-	ENSG00000138835		0.592	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3		0.00	46	0	G	NM_017790	Intron	116353678	+1			no_errors	ENST00000350696	ensembl	human	known	74_37	splice_site	5.56	34	2	SNP	1.000	T
SCAMP1	9522	genome.wustl.edu	37	5	77772627	77772628	+	3'UTR	INS	-	-	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:77772627_77772628insA	ENST00000339292.4	+	0	2241_2242				SCAMP1_ENST00000538629.1_3'UTR			O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						endocytosis (GO:0006897)|exocytosis (GO:0006887)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	clathrin-coated vesicle (GO:0030136)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|synaptic vesicle membrane (GO:0030672)|trans-Golgi network (GO:0005802)|zymogen granule membrane (GO:0042589)							all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		TTTCCAGCAATAAAAAAAAAAG	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF038966	CCDS75264.1	5q14.1	2013-02-21			ENSG00000085365	ENSG00000085365		"""Secretory carrier membrane proteins"""	10563	protein-coding gene	gene with protein product		606911				9378760	Standard	NM_004866		Approved	SCAMP37	uc003kfl.3	O15126	OTTHUMG00000162479	ENST00000339292.4:c.*2239->A	5.37:g.77772637_77772637dupA			O43587|Q6FG23|Q96BX1|Q96QK5	RNA	INS	-	NULL	ENST00000339292.4	37	NULL		5																																																																																			SCAMP1	-	-	ENSG00000085365		0.307	SCAMP1-001	KNOWN	sequence_error|basic|exp_conf	processed_transcript	SCAMP1	HGNC	protein_coding	OTTHUMT00000369096.2		0.00	41	0	-	NM_004866		77772628	+1	tier1		no_errors	ENST00000320280	ensembl	human	known	74_37	rna	13.33	26	4	INS	0.258:0.109	A
SLC17A1	6568	genome.wustl.edu	37	6	25813138	25813138	+	Missense_Mutation	SNP	G	G	A	rs144074233		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr6:25813138G>A	ENST00000244527.4	-	8	933	c.818C>T	c.(817-819)aCg>aTg	p.T273M	SLC17A1_ENST00000476801.1_Missense_Mutation_p.T273M|SLC17A1_ENST00000468082.1_Intron|SLC17A1_ENST00000427328.1_Intron	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	273					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						CCAGAAAAACGTAAAACTACC	0.363																																																	0								G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	73.0	73.0	73.0		818	2.8	0.0	6	dbSNP_134	73	0,8600		0,0,4300	no	missense	SLC17A1	NM_005074.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	273/468	25813138	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.818C>T	6.37:g.25813138G>A	ENSP00000244527:p.Thr273Met		A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Pi_cotranspt	p.T273M	ENST00000244527.4	37	c.818	CCDS4565.1	6	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056730	0.36277	2.27E-4	0.0	ENSG00000124568	ENST00000244527;ENST00000476801	T;T	0.58797	0.31;0.31	3.67	2.79	0.32731	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.532611	0.15880	N	0.240089	T	0.47154	0.1430	L	0.39245	1.2	0.09310	N	0.999999	D	0.69078	0.997	P	0.59595	0.86	T	0.27226	-1.0080	10	0.59425	D	0.04	.	9.2344	0.37457	0.0:0.2208:0.7792:0.0	.	273	Q14916	NPT1_HUMAN	M	273	ENSP00000244527:T273M;ENSP00000420614:T273M	ENSP00000244527:T273M	T	-	2	0	SLC17A1	25921117	0.001000	0.12720	0.004000	0.12327	0.002000	0.02628	0.333000	0.19768	1.109000	0.41680	0.655000	0.94253	ACG	SLC17A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Pi_cotranspt	ENSG00000124568		0.363	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A1	HGNC	protein_coding	OTTHUMT00000043647.2	-	0.00	85	0	G			25813138	-1	tier1	rs144074233	no_errors	ENST00000244527	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.004	A
SLC9A5	6553	genome.wustl.edu	37	16	67300017	67300019	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr16:67300017_67300019delGAG	ENST00000299798.11	+	15	2172_2174	c.2107_2109delGAG	c.(2107-2109)gagdel	p.E708del	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	708					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CGTGGAGTCTGAGGAGGAGGAGG	0.571																																																	0																																										SO:0001651	inframe_deletion	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.2107_2109delGAG	16.37:g.67300026_67300028delGAG	ENSP00000299798:p.Glu708del		A5PKY7|Q9Y626	In_Frame_Del	DEL	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.E706in_frame_del	ENST00000299798.11	37	c.2107_2109	CCDS42178.1	16																																																																																			SLC9A5	-	NULL	ENSG00000135740		0.571	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1		0.00	41	0	GAG			67300019	+1	tier1		no_errors	ENST00000299798	ensembl	human	known	74_37	in_frame_del	10.34	26	3	DEL	1.000:1.000:1.000	-
SLITRK1	114798	genome.wustl.edu	37	13	84453964	84453964	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr13:84453964G>A	ENST00000377084.2	-	1	2564	c.1679C>T	c.(1678-1680)aCg>aTg	p.T560M		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	560	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.T560M(2)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GTTCACCGGCGTCTCACACTT	0.537																																																	2	Substitution - Missense(2)	NS(1)|endometrium(1)											61.0	55.0	57.0					13																	84453964		2203	4300	6503	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1679C>T	13.37:g.84453964G>A	ENSP00000366288:p.Thr560Met		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T560M	ENST00000377084.2	37	c.1679	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868672	0.32977	.	.	ENSG00000178235	ENST00000377084	T	0.53423	0.62	5.22	5.22	0.72569	Cysteine-rich flanking region, C-terminal (1);	0.112873	0.64402	D	0.000008	T	0.40956	0.1138	L	0.45352	1.415	0.44432	D	0.99735	B	0.21147	0.052	B	0.23018	0.043	T	0.34800	-0.9814	10	0.66056	D	0.02	-7.8324	11.2346	0.48933	0.0852:0.0:0.9148:0.0	.	560	Q96PX8	SLIK1_HUMAN	M	560	ENSP00000366288:T560M	ENSP00000366288:T560M	T	-	2	0	SLITRK1	83351965	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.008000	0.88588	2.603000	0.88011	0.655000	0.94253	ACG	SLITRK1	-	smart_Cys-rich_flank_reg_C	ENSG00000178235		0.537	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	-	0.00	23	0	G	NM_052910		84453964	-1	tier1	-	no_errors	ENST00000377084	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
SMARCE1	6605	genome.wustl.edu	37	17	38798687	38798687	+	Intron	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr17:38798687G>T	ENST00000348513.6	-	4	937				SMARCE1_ENST00000578044.1_Intron|SMARCE1_ENST00000474246.1_Missense_Mutation_p.T59K|SMARCE1_ENST00000400122.3_Intron|KRT222_ENST00000476049.1_Intron|SMARCE1_ENST00000580419.1_Intron|SMARCE1_ENST00000431889.2_Intron|SMARCE1_ENST00000544009.1_Intron|SMARCE1_ENST00000377808.4_Intron	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				GCCGGATGCTGTAATAGTTGA	0.443																																																	0													85.0	79.0	81.0					17																	38798687		2203	4300	6503	SO:0001627	intron_variant	0			AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.156+19C>A	17.37:g.38798687G>T			B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Missense_Mutation	SNP	NULL	p.T59K	ENST00000348513.6	37	c.176	CCDS11370.1	17																																																																																			SMARCE1	-	NULL	ENSG00000073584		0.443	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCE1	HGNC	protein_coding	OTTHUMT00000257203.1	-	0.00	68	0	G	NM_003079		38798687	-1	tier1	-	no_errors	ENST00000474246	ensembl	human	putative	74_37	missense	5.41	70	4	SNP	1.000	T
SNCAIP	9627	genome.wustl.edu	37	5	121758673	121758673	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr5:121758673C>A	ENST00000261368.8	+	4	503	c.241C>A	c.(241-243)Cca>Aca	p.P81T	SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000379536.2_Missense_Mutation_p.P81T|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000261367.7_Missense_Mutation_p.P128T|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.P128T|SNCAIP_ENST00000503116.2_Missense_Mutation_p.P128T|SNCAIP_ENST00000504884.2_Intron	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	81					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GCGGGTTTCGCCACTGAAACA	0.483																																																	0													63.0	64.0	64.0					5																	121758673		2203	4300	6503	SO:0001583	missense	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.241C>A	5.37:g.121758673C>A	ENSP00000261368:p.Pro81Thr		D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P128T	ENST00000261368.8	37	c.382	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551124	0.86127	.	.	ENSG00000064692	ENST00000514467;ENST00000506272;ENST00000508681;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.66	5.66	0.87406	.	0.052583	0.85682	D	0.000000	T	0.49355	0.1552	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.986	D;D;D;P	0.91635	0.998;0.999;0.996;0.726	T	0.47623	-0.9103	10	0.87932	D	0	-15.9391	19.7538	0.96281	0.0:1.0:0.0:0.0	.	81;128;128;81	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	T	81;128;81;81;81;128;81;128;128	ENSP00000427090:P81T;ENSP00000426551:P128T;ENSP00000422610:P81T;ENSP00000422106:P81T;ENSP00000261368:P81T;ENSP00000368848:P128T;ENSP00000368851:P81T;ENSP00000261367:P128T;ENSP00000423199:P128T	ENSP00000261367:P128T	P	+	1	0	SNCAIP	121786572	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.111000	0.77077	2.690000	0.91761	0.655000	0.94253	CCA	SNCAIP	-	NULL	ENSG00000064692		0.483	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	-	0.00	56	0	C			121758673	+1	tier1	-	no_errors	ENST00000379533	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
ST18	9705	genome.wustl.edu	37	8	53092686	53092686	+	Silent	SNP	G	G	T	rs137908806		TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr8:53092686G>T	ENST00000276480.7	-	9	956	c.273C>A	c.(271-273)acC>acA	p.T91T		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	91					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGCTACCTGCGGTAGAGTGAC	0.517																																																	0													258.0	210.0	226.0					8																	53092686		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.273C>A	8.37:g.53092686G>T			Q17RY1	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.T91	ENST00000276480.7	37	c.273	CCDS6149.1	8																																																																																			ST18	-	NULL	ENSG00000147488		0.517	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1		0.00	55	0	G			53092686	-1			no_errors	ENST00000276480	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.002	T
TAS2R19	259294	genome.wustl.edu	37	12	11175145	11175145	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr12:11175145G>A	ENST00000390673.2	-	1	74	c.26C>T	c.(25-27)tCa>tTa	p.S9L	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	9					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S9L(1)		breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						CAGAATTGATGAAATGATGAG	0.373																																																	1	Substitution - Missense(1)	breast(1)											66.0	61.0	63.0					12																	11175145		2202	4299	6501	SO:0001583	missense	0			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.26C>T	12.37:g.11175145G>A	ENSP00000375091:p.Ser9Leu		Q3MIJ4|Q645X8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S9L	ENST00000390673.2	37	c.26	CCDS8640.1	12	.	.	.	.	.	.	.	.	.	.	.	2.061	-0.415423	0.04766	.	.	ENSG00000212124	ENST00000390673	T	0.00637	6.05	2.45	-0.513	0.11962	.	1.638660	0.05009	U	0.470632	T	0.00328	0.0010	N	0.00864	-1.135	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.41627	-0.9498	10	0.27785	T	0.31	.	4.2575	0.10724	0.6892:0.0:0.1422:0.1686	.	9	P59542	T2R19_HUMAN	L	9	ENSP00000375091:S9L	ENSP00000375091:S9L	S	-	2	0	TAS2R19	11066412	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.206000	0.09398	-0.173000	0.10761	-3.044000	0.00070	TCA	TAS2R19	-	pfam_TAS2_rcpt	ENSG00000212124		0.373	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R19	HGNC	protein_coding	OTTHUMT00000370080.1		0.00	28	0	G	NM_176888		11175145	-1			no_errors	ENST00000390673	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.000	A
TENM4	26011	genome.wustl.edu	37	11	78381103	78381103	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:78381103G>A	ENST00000278550.7	-	32	6749	c.6287C>T	c.(6286-6288)gCt>gTt	p.A2096V		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2096					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTTGATCACAGCCTGCATGCT	0.498																																																	0													67.0	71.0	70.0					11																	78381103		2098	4217	6315	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6287C>T	11.37:g.78381103G>A	ENSP00000278550:p.Ala2096Val		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.A2096V	ENST00000278550.7	37	c.6287	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892578	0.52121	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89270	-2.49;1.02	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.91637	0.7357	L	0.41824	1.3	0.58432	D	0.999999	D	0.69078	0.997	D	0.75020	0.985	D	0.90606	0.4548	9	.	.	.	.	18.1852	0.89790	0.0:0.0:1.0:0.0	.	2096	Q6N022	TEN4_HUMAN	V	2096;560	ENSP00000278550:A2096V;ENSP00000431711:A560V	.	A	-	2	0	ODZ4	78058751	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	6.536000	0.73842	2.597000	0.87782	0.655000	0.94253	GCT	TENM4	-	NULL	ENSG00000149256		0.498	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2		0.00	28	0	G			78381103	-1			no_errors	ENST00000278550	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.999	A
TMPRSS4	56649	genome.wustl.edu	37	11	117988633	117988633	+	3'UTR	SNP	G	G	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr11:117988633G>T	ENST00000437212.3	+	0	1533				TMPRSS4_ENST00000522824.1_3'UTR|TMPRSS4_ENST00000534111.1_3'UTR|TMPRSS4_ENST00000522307.1_3'UTR|TMPRSS4_ENST00000518413.2_3'UTR|TMPRSS4_ENST00000523251.1_3'UTR			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CTGTAATGCTGCTGCCCCTTT	0.532																																																	0													144.0	128.0	133.0					11																	117988633		2200	4296	6496	SO:0001624	3_prime_UTR_variant	0			AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.*5G>T	11.37:g.117988633G>T			A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	RNA	SNP	-	NULL	ENST00000437212.3	37	NULL	CCDS31684.1	11																																																																																			TMPRSS4	-	-	ENSG00000137648		0.532	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS4	HGNC	protein_coding	OTTHUMT00000377328.2	-	0.00	28	0	G	NM_019894		117988633	+1	tier1	-	no_errors	ENST00000518413	ensembl	human	known	74_37	rna	18.75	13	3	SNP	0.035	T
TNPO3	23534	genome.wustl.edu	37	7	128607386	128607386	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr7:128607386C>T	ENST00000265388.5	-	21	2802	c.2659G>A	c.(2659-2661)Gcc>Acc	p.A887T	TNPO3_ENST00000471166.1_Missense_Mutation_p.A921T|TNPO3_ENST00000393245.1_Missense_Mutation_p.A921T|TNPO3_ENST00000471234.1_Missense_Mutation_p.A823T|TNPO3_ENST00000482320.1_Missense_Mutation_p.A821T			Q9Y5L0	TNPO3_HUMAN	transportin 3	887					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						ACTGTGACGGCTCCCACGGTT	0.433																																					Pancreas(147;583 2585 39696 52331)												0													169.0	145.0	153.0					7																	128607386		2203	4300	6503	SO:0001583	missense	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.2659G>A	7.37:g.128607386C>T	ENSP00000265388:p.Ala887Thr		A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.A921T	ENST00000265388.5	37	c.2761	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219468	0.79464	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	.	.	.	5.81	5.81	0.92471	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.44008	0.1273	L	0.29908	0.895	0.80722	D	1	B;B;P;B	0.34864	0.296;0.342;0.473;0.342	B;B;B;B	0.31686	0.027;0.063;0.134;0.063	T	0.35375	-0.9791	9	0.09843	T	0.71	-13.8224	17.5723	0.87937	0.0:1.0:0.0:0.0	.	823;921;887;887	C9IZM0;C9J7E5;Q9Y5L0-3;Q9Y5L0	.;.;.;TNPO3_HUMAN	T	921;887;821;823;921	.	ENSP00000265388:A887T	A	-	1	0	TNPO3	128394622	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.531000	0.81973	2.736000	0.93811	0.655000	0.94253	GCC	TNPO3	-	NULL	ENSG00000064419		0.433	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	-	0.00	65	0	C	NM_012470		128607386	-1	tier1	-	no_errors	ENST00000393245	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179424596	179424596	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr2:179424596C>G	ENST00000591111.1	-	276	81564	c.81340G>C	c.(81340-81342)Gat>Cat	p.D27114H	TTN_ENST00000359218.5_Missense_Mutation_p.D19815H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D28755H|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D19882H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D19690H|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D26187H|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27114	Ig-like 129.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCAATATCAAATAAAGGT	0.433																																																	0													126.0	123.0	124.0					2																	179424596		1938	4138	6076	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81340G>C	2.37:g.179424596C>G	ENSP00000465570:p.Asp27114His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D26187H	ENST00000591111.1	37	c.78559		2	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183275	0.38511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64803	-0.12;0.11;0.09;0.08	5.87	5.87	0.94306	Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75810	0.3900	L	0.55213	1.73	0.58432	D	0.999999	P;P;P;P	0.47484	0.896;0.896;0.896;0.896	P;P;P;P	0.59948	0.866;0.866;0.866;0.866	T	0.75260	-0.3380	9	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	19690;19815;19882;27114	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	26187;19690;19882;19815;19687	ENSP00000343764:D26187H;ENSP00000434586:D19690H;ENSP00000340554:D19882H;ENSP00000352154:D19815H	ENSP00000340554:D19882H	D	-	1	0	TTN	179132842	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.857000	0.62939	2.941000	0.99782	0.655000	0.94253	GAT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Ig-like_dom	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	39	0	C	NM_133378		179424596	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	G
WDTC1	23038	genome.wustl.edu	37	1	27609833	27609833	+	Silent	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr1:27609833C>T	ENST00000319394.3	+	5	719	c.184C>T	c.(184-186)Ctg>Ttg	p.L62L	WDTC1_ENST00000361771.3_Silent_p.L62L	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	62					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		TTTCAGCTTGCTGGCCTCTGG	0.517																																																	0													91.0	80.0	84.0					1																	27609833		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.184C>T	1.37:g.27609833C>T			D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L62	ENST00000319394.3	37	c.184		1																																																																																			WDTC1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000142784		0.517	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	WDTC1	HGNC	protein_coding			0.00	39	0	C	NM_015023		27609833	+1			no_errors	ENST00000319394	ensembl	human	known	74_37	silent	10.00	26	3	SNP	1.000	T
ZBTB20	26137	genome.wustl.edu	37	3	114070249	114070249	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr3:114070249C>T	ENST00000474710.1	-	4	854	c.676G>A	c.(676-678)Gac>Aac	p.D226N	ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000481632.1_Missense_Mutation_p.D153N|ZBTB20_ENST00000357258.3_Missense_Mutation_p.D153N|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000471418.1_Missense_Mutation_p.D153N|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000464560.1_Missense_Mutation_p.D153N|ZBTB20_ENST00000462705.1_Missense_Mutation_p.D153N|ZBTB20_ENST00000393785.2_Missense_Mutation_p.D153N	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	226						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GACTCCGTGTCGCTGCTCTGG	0.667																																					NSCLC(69;748 1344 9802 11203 30933)												0													80.0	71.0	74.0					3																	114070249		2203	4300	6503	SO:0001583	missense	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.676G>A	3.37:g.114070249C>T	ENSP00000419153:p.Asp226Asn		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D226N	ENST00000474710.1	37	c.676	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738772	0.89573	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.09911	2.95;2.95;2.95;2.95;2.93;2.95;2.95	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.01175	-1.1428	10	0.87932	D	0	.	19.3116	0.94189	0.0:1.0:0.0:0.0	.	226	Q9HC78	ZBT20_HUMAN	N	153;153;153;153;226;153;153	ENSP00000420324:D153N;ENSP00000377375:D153N;ENSP00000418092:D153N;ENSP00000419902:D153N;ENSP00000419153:D226N;ENSP00000349803:D153N;ENSP00000417307:D153N	ENSP00000349803:D153N	D	-	1	0	ZBTB20	115552939	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.286000	0.78671	2.808000	0.96608	0.650000	0.86243	GAC	ZBTB20	-	NULL	ENSG00000181722		0.667	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	-	0.00	25	0	C	NM_015642		114070249	-1	tier1	-	no_errors	ENST00000474710	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	T
ZNF609	23060	genome.wustl.edu	37	15	64966761	64966761	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr15:64966761C>T	ENST00000326648.3	+	4	1836	c.1708C>T	c.(1708-1710)Cga>Tga	p.R570*	ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	570						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCCCAAAGTTCGACTTGTAGA	0.522																																																	0													92.0	88.0	89.0					15																	64966761		2203	4299	6502	SO:0001587	stop_gained	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1708C>T	15.37:g.64966761C>T	ENSP00000316527:p.Arg570*		Q0D2I2	Nonsense_Mutation	SNP	pfscan_Znf_C2H2	p.R570*	ENST00000326648.3	37	c.1708	CCDS32270.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.436739	0.96168	.	.	ENSG00000180357	ENST00000326648	.	.	.	5.77	4.83	0.62350	.	0.050765	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8189	15.9634	0.79948	0.1359:0.8641:0.0:0.0	.	.	.	.	X	570	.	ENSP00000316527:R570X	R	+	1	2	ZNF609	62753814	0.996000	0.38824	0.972000	0.41901	0.980000	0.70556	3.230000	0.51286	1.396000	0.46663	0.655000	0.94253	CGA	ZNF609	-	NULL	ENSG00000180357		0.522	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	-	0.00	24	0	C	XM_042833		64966761	+1	tier1	-	no_errors	ENST00000326648	ensembl	human	known	74_37	nonsense	13.04	20	3	SNP	0.983	T
ZNF609	23060	genome.wustl.edu	37	15	64967246	64967247	+	Frame_Shift_Ins	INS	-	-	A			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr15:64967246_64967247insA	ENST00000326648.3	+	4	2321_2322	c.2193_2194insA	c.(2194-2196)aaafs	p.K732fs		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	732	Poly-Lys.					nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.K734fs*12(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAAAGAAAGACAAAAAAAAGAA	0.49																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2201dupA	15.37:g.64967254_64967254dupA	ENSP00000316527:p.Lys732fs		Q0D2I2	Frame_Shift_Ins	INS	pfscan_Znf_C2H2	p.K734fs	ENST00000326648.3	37	c.2193_2194	CCDS32270.1	15																																																																																			ZNF609	-	NULL	ENSG00000180357		0.490	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1		0.00	43	0	-	XM_042833		64967247	+1	tier1		no_errors	ENST00000326648	ensembl	human	known	74_37	frame_shift_ins	6.67	28	2	INS	1.000:1.000	A
ZWINT	11130	genome.wustl.edu	37	10	58119778	58119778	+	Splice_Site	SNP	C	C	T			TCGA-VR-A8ET-01A-11D-A403-09	TCGA-VR-A8ET-10B-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	6c3a0d49-db87-481c-a231-832550107f70	2c8f52f4-5ed0-440b-a6c7-783e59ff7ee2	g.chr10:58119778C>T	ENST00000373944.3	-	3	295		c.e3+1		ZWINT_ENST00000318387.2_5'Flank|ZWINT_ENST00000395405.1_Splice_Site|ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000361148.6_Splice_Site			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein						establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.?(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						TGCCTACTCACGGCTCGTGTC	0.562																																																	1	Unknown(1)	lung(1)											64.0	68.0	67.0					10																	58119778		2203	4300	6503	SO:0001630	splice_region_variant	0			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.256+1G>A	10.37:g.58119778C>T			A6NNV6|Q0D2I3|Q9BWD0	Splice_Site	SNP	-	e3+1	ENST00000373944.3	37	c.256+1	CCDS7249.1	10	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618539	0.28801	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000361148	.	.	.	4.24	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8973	0.35472	0.0:0.8903:0.0:0.1097	.	.	.	.	.	-1	.	.	.	-	.	.	ZWINT	57789784	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	3.626000	0.54245	1.092000	0.41356	0.644000	0.83932	.	ZWINT	-	-	ENSG00000122952		0.562	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZWINT	HGNC	protein_coding	OTTHUMT00000048132.1		0.00	20	0	C		Intron	58119778	-1			no_errors	ENST00000373944	ensembl	human	known	74_37	splice_site	12.50	14	2	SNP	1.000	T
