#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA9	10350	genome.wustl.edu	37	17	66992115	66992115	+	Missense_Mutation	SNP	T	T	G	rs533072475		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:66992115T>G	ENST00000340001.4	-	26	3687	c.3476A>C	c.(3475-3477)tAt>tCt	p.Y1159S	ABCA9_ENST00000370732.2_Missense_Mutation_p.Y1159S|ABCA9_ENST00000453985.2_Missense_Mutation_p.Y1121S	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1159					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TAGAAATCCATATTCATTTAG	0.363																																																	0													130.0	118.0	122.0					17																	66992115		2203	4300	6503	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3476A>C	17.37:g.66992115T>G	ENSP00000342216:p.Tyr1159Ser		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y1159S	ENST00000340001.4	37	c.3476	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	8.578	0.881544	0.17467	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.81659	-1.52;-1.52	5.43	3.03	0.35002	.	0.182497	0.26499	N	0.024030	T	0.68329	0.2989	L	0.38175	1.15	0.09310	N	1	B;B	0.13594	0.008;0.005	B;B	0.11329	0.006;0.006	T	0.55515	-0.8129	10	0.33940	T	0.23	.	7.2134	0.25947	0.4524:0.0:0.0:0.5476	.	1159;1159	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	1159;1104;1159;1116	ENSP00000342216:Y1159S;ENSP00000359767:Y1159S	ENSP00000342216:Y1159S	Y	-	2	0	ABCA9	64503710	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.557000	0.23454	0.850000	0.35239	0.496000	0.49642	TAT	ABCA9	-	NULL	ENSG00000154258		0.363	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	-	0.00	62	0	T	NM_172386		66992115	-1	tier1	-	no_errors	ENST00000340001	ensembl	human	known	74_37	missense	13.33	52	8	SNP	0.001	G
ABCG2	9429	genome.wustl.edu	37	4	89061143	89061143	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:89061143G>A	ENST00000237612.3	-	2	550	c.5C>T	c.(4-6)tCt>tTt	p.S2F	ABCG2_ENST00000515655.1_Missense_Mutation_p.S2F	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	2					cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	ATTACTGGAAGACATCTGGAG	0.403																																																	0													46.0	45.0	45.0					4																	89061143		2203	4300	6503	SO:0001583	missense	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.5C>T	4.37:g.89061143G>A	ENSP00000237612:p.Ser2Phe		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2F	ENST00000237612.3	37	c.5	CCDS3628.1	4	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043478	0.55003	.	.	ENSG00000118777	ENST00000515655;ENST00000237612;ENST00000505480;ENST00000503830	D;D;T;T	0.87256	-2.23;-2.09;-0.34;-0.41	5.59	3.83	0.44106	.	0.521688	0.21331	N	0.076288	D	0.87943	0.6305	L	0.34521	1.04	0.32026	N	0.600134	D;D	0.76494	0.999;0.978	D;P	0.69824	0.966;0.736	D	0.87038	0.2139	10	0.87932	D	0	-7.9137	7.947	0.29993	0.0818:0.0:0.7588:0.1594	.	2;2	Q9UNQ0-2;Q9UNQ0	.;ABCG2_HUMAN	F	2;2;40;20	ENSP00000426917:S2F;ENSP00000237612:S2F;ENSP00000426916:S40F;ENSP00000426934:S20F	ENSP00000237612:S2F	S	-	2	0	ABCG2	89280167	0.998000	0.40836	0.983000	0.44433	0.504000	0.33889	2.677000	0.46892	0.690000	0.31570	0.650000	0.86243	TCT	ABCG2	-	NULL	ENSG00000118777		0.403	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1		0.00	30	0	G	NM_004827		89061143	-1			no_errors	ENST00000237612	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.973	A
ACACB	32	genome.wustl.edu	37	12	109610096	109610096	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:109610096G>A	ENST00000338432.7	+	6	1171	c.1052G>A	c.(1051-1053)tGg>tAg	p.W351*	ACACB_ENST00000377848.3_Nonsense_Mutation_p.W351*|ACACB_ENST00000377854.5_Nonsense_Mutation_p.W351*			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	351	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.W351*(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TGGGCTGGCTGGGGCCATGCT	0.517																																																	1	Substitution - Nonsense(1)	skin(1)											224.0	244.0	237.0					12																	109610096		2203	4300	6503	SO:0001587	stop_gained	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1052G>A	12.37:g.109610096G>A	ENSP00000341044:p.Trp351*		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Nonsense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.W351*	ENST00000338432.7	37	c.1052	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.210061	0.95069	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7639	0.91864	0.0:0.0:1.0:0.0	.	.	.	.	X	351	.	ENSP00000341044:W351X	W	+	2	0	ACACB	108094479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.957000	0.87870	2.607000	0.88179	0.655000	0.94253	TGG	ACACB	-	pfam_CarbamoylP_synth_lsu_N,superfamily_PreATP-grasp_dom,pfscan_Biotin_carboxylation_dom	ENSG00000076555		0.517	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	-	0.00	51	0	G	NM_001093		109610096	+1	tier1	-	no_errors	ENST00000338432	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	A
ACSM3	6296	genome.wustl.edu	37	16	20787204	20787204	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr16:20787204G>T	ENST00000289416.5	+	3	738	c.263G>T	c.(262-264)aGa>aTa	p.R88I	ACSM3_ENST00000450120.2_Missense_Mutation_p.R43I|ACSM3_ENST00000440284.2_Missense_Mutation_p.R88I	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	88					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						TGGATCAACAGAAATGGAGAA	0.413																																																	0													124.0	135.0	131.0					16																	20787204		2201	4300	6501	SO:0001583	missense	0			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.263G>T	16.37:g.20787204G>T	ENSP00000289416:p.Arg88Ile		O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R88I	ENST00000289416.5	37	c.263	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972864	0.34848	.	.	ENSG00000005187	ENST00000289416;ENST00000440284;ENST00000450120	T;T;T	0.51325	0.71;0.71;0.71	5.92	2.49	0.30216	.	0.380726	0.29002	N	0.013453	T	0.33876	0.0878	N	0.24115	0.695	0.09310	N	1	B;B;B	0.19331	0.035;0.001;0.012	B;B;B	0.24394	0.053;0.001;0.011	T	0.35251	-0.9796	10	0.56958	D	0.05	-25.7958	11.8443	0.52374	0.3028:0.0:0.6972:0.0	.	43;88;88	E7ETR5;Q53FZ2;Q53FZ2-2	.;ACSM3_HUMAN;.	I	88;88;43	ENSP00000289416:R88I;ENSP00000394565:R88I;ENSP00000395297:R43I	ENSP00000289416:R88I	R	+	2	0	ACSM3	20694705	0.797000	0.28877	0.130000	0.21974	0.684000	0.39900	1.197000	0.32211	0.855000	0.35359	0.467000	0.42956	AGA	ACSM3	-	NULL	ENSG00000005187		0.413	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	HGNC	protein_coding	OTTHUMT00000254414.2		0.00	44	0	G	NM_005622		20787204	+1			no_errors	ENST00000289416	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.008	T
ACTA1	58	genome.wustl.edu	37	1	229567270	229567270	+	Silent	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:229567270G>T	ENST00000366684.3	-	7	1212	c.1110C>A	c.(1108-1110)tcC>tcA	p.S370S	ACTA1_ENST00000366683.2_Silent_p.S282S	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	370					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				GGTGGACGATGGAAGGGCCGG	0.607																																																	0													134.0	124.0	127.0					1																	229567270		2203	4300	6503	SO:0001819	synonymous_variant	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.1110C>A	1.37:g.229567270G>T			P02568|P99020|Q5T8M9	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.S370	ENST00000366684.3	37	c.1110	CCDS1578.1	1																																																																																			ACTA1	-	pfam_Actin-related,smart_Actin-related	ENSG00000143632		0.607	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	-	0.00	41	0	G	NM_001100		229567270	-1	tier1	-	no_errors	ENST00000366684	ensembl	human	known	74_37	silent	36.21	37	21	SNP	1.000	T
ADRA1A	148	genome.wustl.edu	37	8	26721840	26721840	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr8:26721840C>T	ENST00000519229.1	-	1	653	c.647G>A	c.(646-648)cGg>cAg	p.R216Q	ADRA1A_ENST00000380582.3_Missense_Mutation_p.R216Q|ADRA1A_ENST00000354550.4_Missense_Mutation_p.R216Q|ADRA1A_ENST00000380573.3_Missense_Mutation_p.R216Q|ADRA1A_ENST00000380581.2_Missense_Mutation_p.R216Q|ADRA1A_ENST00000380587.1_Missense_Mutation_p.R216Q|ADRA1A_ENST00000380586.1_Missense_Mutation_p.R216Q|ADRA1A_ENST00000276393.4_Missense_Mutation_p.R216Q|ADRA1A_ENST00000380572.3_Missense_Mutation_p.R216Q|ADRA1A_ENST00000358857.5_Missense_Mutation_p.R216Q			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	286					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CTTGAGGCCCCGGCTCTCCCT	0.637																																																	0													35.0	33.0	33.0					8																	26721840		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.647G>A	8.37:g.26721840C>T	ENSP00000430793:p.Arg216Gln		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.R216Q	ENST00000519229.1	37	c.647		8	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833522	0.50951	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.36	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.190531	0.39341	N	0.001393	T	0.36468	0.0968	L	0.61036	1.89	0.38933	D	0.957999	P;B;P;P;B;P	0.42518	0.538;0.334;0.694;0.538;0.087;0.782	B;B;B;B;B;B	0.39379	0.131;0.062;0.223;0.092;0.009;0.298	T	0.25984	-1.0116	10	0.36615	T	0.2	.	7.0437	0.25035	0.0:0.7501:0.0:0.2499	.	216;216;216;216;216;216	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	Q	216	ENSP00000369960:R216Q;ENSP00000369961:R216Q;ENSP00000369956:R216Q;ENSP00000369955:R216Q;ENSP00000430793:R216Q;ENSP00000346557:R216Q;ENSP00000276393:R216Q;ENSP00000369947:R216Q;ENSP00000369946:R216Q;ENSP00000351725:R216Q	ENSP00000276393:R216Q	R	-	2	0	ADRA1A	26777757	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.264000	0.33015	2.649000	0.89929	0.563000	0.77884	CGG	ADRA1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000120907		0.637	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	-	0.00	44	0	C	NM_033303		26721840	-1	tier1	-	no_errors	ENST00000380586	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.983	T
AGBL5	60509	genome.wustl.edu	37	2	27275949	27275949	+	Silent	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:27275949C>A	ENST00000360131.4	+	2	282	c.123C>A	c.(121-123)gcC>gcA	p.A41A	AGBL5_ENST00000323064.8_Silent_p.A41A|RP11-503P10.1_ENST00000607407.1_RNA|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	41					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGCGTCAGCCCTGACCAGTG	0.527																																																	0													104.0	100.0	101.0					2																	27275949		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.123C>A	2.37:g.27275949C>A			A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.A41	ENST00000360131.4	37	c.123	CCDS1732.3	2																																																																																			AGBL5	-	NULL	ENSG00000084693		0.527	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	-	0.00	55	0	C	NM_021831		27275949	+1	tier1	-	no_errors	ENST00000360131	ensembl	human	known	74_37	silent	31.91	32	15	SNP	0.975	A
AGAP1	116987	genome.wustl.edu	37	2	237032618	237032618	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:237032618C>T	ENST00000304032.8	+	18	3006	c.2426C>T	c.(2425-2427)gCc>gTc	p.A809V	AGAP1_ENST00000428334.2_Missense_Mutation_p.A648V|AGAP1_ENST00000336665.5_Missense_Mutation_p.A756V|AGAP1_ENST00000409538.1_Missense_Mutation_p.A1021V	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	809					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTGGCCTACGCCCGGCAGGCC	0.637																																																	0													53.0	56.0	55.0					2																	237032618		2203	4300	6503	SO:0001583	missense	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.2426C>T	2.37:g.237032618C>T	ENSP00000307634:p.Ala809Val		B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.A809V	ENST00000304032.8	37	c.2426	CCDS33408.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.071514	0.93950	.	.	ENSG00000157985	ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	4.3	4.3	0.51218	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.85336	0.5673	M	0.85099	2.735	0.80722	D	1	P;D	0.89917	0.846;1.0	B;D	0.83275	0.391;0.996	D	0.87529	0.2451	10	0.51188	T	0.08	.	16.7702	0.85535	0.0:1.0:0.0:0.0	.	756;809	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	V	809;756;1021;648	ENSP00000307634:A809V;ENSP00000338378:A756V;ENSP00000386897:A1021V;ENSP00000411824:A648V	ENSP00000307634:A809V	A	+	2	0	AGAP1	236697357	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.591000	0.82666	1.950000	0.56595	0.655000	0.94253	GCC	AGAP1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000157985		0.637	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	-	0.00	140	0	C	NM_014914		237032618	+1	tier1	-	no_errors	ENST00000304032	ensembl	human	known	74_37	missense	27.46	103	39	SNP	1.000	T
AGTR2	186	genome.wustl.edu	37	X	115304321	115304321	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:115304321T>C	ENST00000371906.4	+	3	978	c.788T>C	c.(787-789)cTg>cCg	p.L263P		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	263					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	GCTGTTGTTCTGGCCTTCATC	0.458																																																	0													247.0	170.0	196.0					X																	115304321		2203	4300	6503	SO:0001583	missense	0			AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.788T>C	X.37:g.115304321T>C	ENSP00000360973:p.Leu263Pro		B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_ATII_AT2_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt,prints_Brdyknn_rcpt,prints_Chemokine_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.L263P	ENST00000371906.4	37	c.788	CCDS14569.1	X	.	.	.	.	.	.	.	.	.	.	T	16.90	3.249603	0.59212	.	.	ENSG00000180772	ENST00000371906	T	0.46451	0.87	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.350085	0.27464	N	0.019254	T	0.71879	0.3392	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79217	-0.1894	10	0.87932	D	0	-2.6468	11.2051	0.48765	0.0:0.0:0.0:1.0	.	263	P50052	AGTR2_HUMAN	P	263	ENSP00000360973:L263P	ENSP00000360973:L263P	L	+	2	0	AGTR2	115218349	1.000000	0.71417	0.983000	0.44433	0.983000	0.72400	3.929000	0.56514	1.771000	0.52183	0.412000	0.27726	CTG	AGTR2	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180772		0.458	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGTR2	HGNC	protein_coding	OTTHUMT00000057984.1	-	0.00	23	0	T	NM_000686		115304321	+1	tier1	-	no_errors	ENST00000371906	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.999	C
ALDH4A1	8659	genome.wustl.edu	37	1	19203999	19203999	+	Missense_Mutation	SNP	C	C	A	rs142969512		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:19203999C>A	ENST00000375341.3	-	10	1305	c.1048G>T	c.(1048-1050)Gcg>Tcg	p.A350S	RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000538309.1_Missense_Mutation_p.A290S|ALDH4A1_ENST00000538839.1_Missense_Mutation_p.A350S|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.A350S	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	350					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)	p.A350T(1)		cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGCGAGCACGCGGAACACTTC	0.647																																																	1	Substitution - Missense(1)	large_intestine(1)						C	SER/ALA,SER/ALA,SER/ALA	1,4403	2.1+/-5.4	0,1,2201	32.0	31.0	32.0		868,1048,1048	4.7	0.9	1	dbSNP_134	32	2,8596	2.2+/-6.3	0,2,4297	yes	missense,missense,missense	ALDH4A1	NM_001161504.1,NM_003748.3,NM_170726.2	99,99,99	0,3,6498	AA,AC,CC		0.0233,0.0227,0.0231	possibly-damaging,possibly-damaging,possibly-damaging	290/504,350/564,350/564	19203999	3,12999	2202	4299	6501	SO:0001583	missense	0			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.1048G>T	1.37:g.19203999C>A	ENSP00000364490:p.Ala350Ser		A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	p.A350S	ENST00000375341.3	37	c.1048	CCDS188.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.417901	0.83449	2.27E-4	2.33E-4	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	4.66	4.66	0.58398	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);Aldehyde dehydrogenase, conserved site (1);	0.115027	0.64402	D	0.000016	T	0.60741	0.2292	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	P	0.61397	0.888	T	0.68957	-0.5272	10	0.87932	D	0	-29.8698	16.1125	0.81273	0.0:1.0:0.0:0.0	.	350	P30038	AL4A1_HUMAN	S	350;350;350;290	ENSP00000290597:A350S;ENSP00000364490:A350S;ENSP00000446071:A350S;ENSP00000442988:A290S	ENSP00000290597:A350S	A	-	1	0	ALDH4A1	19076586	1.000000	0.71417	0.883000	0.34634	0.257000	0.26127	7.225000	0.78051	2.153000	0.67306	0.561000	0.74099	GCG	ALDH4A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	ENSG00000159423		0.647	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1		0.00	33	0	C			19203999	-1			no_errors	ENST00000290597	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.999	A
AMY2B	280	genome.wustl.edu	37	1	104118225	104118225	+	Intron	SNP	C	C	T	rs577319128	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:104118225C>T	ENST00000361355.4	+	9	1717				AMY2B_ENST00000491397.1_Intron	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CTTGTTCTAACTTAATATGAC	0.308													.|||	2	0.000399361	0.0	0.0	5008	,	,		17570	0.0		0.001	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1101+63C>T	1.37:g.104118225C>T			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	SNP	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.308	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	40	0	C	NM_020978		104118225	+1	tier1	-	no_errors	ENST00000462971	ensembl	human	known	74_37	rna	28.57	35	14	SNP	0.000	T
AMPD2	271	genome.wustl.edu	37	1	110172511	110172511	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:110172511delC	ENST00000256578.3	+	15	2478	c.2118delC	c.(2116-2118)aacfs	p.N706fs	AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000342115.4_Frame_Shift_Del_p.N625fs|AMPD2_ENST00000528667.1_Frame_Shift_Del_p.N706fs|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000528454.1_Frame_Shift_Del_p.N588fs|AMPD2_ENST00000393688.3_Frame_Shift_Del_p.N587fs|AMPD2_ENST00000358729.4_Frame_Shift_Del_p.N631fs	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	706					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGGCTGAGAACATTTCCCACG	0.607																																																	0													136.0	130.0	132.0					1																	110172511		2203	4300	6503	SO:0001589	frameshift_variant	0			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2118delC	1.37:g.110172511delC	ENSP00000256578:p.Asn706fs		B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Frame_Shift_Del	DEL	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.N706fs	ENST00000256578.3	37	c.2118	CCDS805.1	1																																																																																			AMPD2	-	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116337		0.607	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPD2	HGNC	protein_coding	OTTHUMT00000390615.1		0.00	91	0	C			110172511	+1	tier1		no_errors	ENST00000256578	ensembl	human	known	74_37	frame_shift_del	22.32	87	25	DEL	1.000	-
AIM2	9447	genome.wustl.edu	37	1	159032497	159032497	+	Silent	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:159032497G>T	ENST00000368130.4	-	6	1305	c.1017C>A	c.(1015-1017)gcC>gcA	p.A339A		NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	339					activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TTTTTTTTTTGGCCTTAATAA	0.403																																																	0													173.0	139.0	150.0					1																	159032497		2203	4300	6503	SO:0001819	synonymous_variant	0			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.1017C>A	1.37:g.159032497G>T			A8K7M7|Q5T3V9|Q96FG9	Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_NA-bd_OB-fold,pfscan_DAPIN,pfscan_HIN200/IF120x	p.A339	ENST00000368130.4	37	c.1017	CCDS1181.1	1																																																																																			AIM2	-	NULL	ENSG00000163568		0.403	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM2	HGNC	protein_coding	OTTHUMT00000090341.1		0.00	43	0	G	NM_004833		159032497	-1			no_errors	ENST00000368130	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.000	T
ANKRD23	200539	genome.wustl.edu	37	2	97508119	97508119	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:97508119C>T	ENST00000318357.4	-	2	198	c.157G>A	c.(157-159)Gaa>Aaa	p.E53K	ANKRD23_ENST00000418232.1_Missense_Mutation_p.E53K|ANKRD23_ENST00000476975.1_5'Flank|ANKRD23_ENST00000331001.2_Missense_Mutation_p.E53K	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	53					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						TTCTTCTCTTCTTCCAATTTC	0.622																																																	0													40.0	46.0	44.0					2																	97508119		2202	4300	6502	SO:0001583	missense	0				CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.157G>A	2.37:g.97508119C>T	ENSP00000321679:p.Glu53Lys		Q711K7|Q8NAJ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E53K	ENST00000318357.4	37	c.157	CCDS2027.1	2	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527337	0.85706	.	.	ENSG00000163126	ENST00000318357;ENST00000418232;ENST00000331001	T;T;T	0.70631	-0.5;-0.5;-0.24	5.07	5.07	0.68467	.	0.000000	0.39985	N	0.001208	T	0.74891	0.3776	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.988	D;P	0.76071	0.987;0.696	T	0.70626	-0.4820	10	0.26408	T	0.33	-23.9401	13.8819	0.63686	0.0:1.0:0.0:0.0	.	53;53	Q86SG2-2;Q86SG2	.;ANR23_HUMAN	K	53	ENSP00000321679:E53K;ENSP00000398987:E53K;ENSP00000333108:E53K	ENSP00000321679:E53K	E	-	1	0	ANKRD23	96871846	0.656000	0.27385	0.984000	0.44739	0.966000	0.64601	2.193000	0.42658	2.637000	0.89404	0.650000	0.86243	GAA	ANKRD23	-	NULL	ENSG00000163126		0.622	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD23	HGNC	protein_coding	OTTHUMT00000252956.1	-	0.00	87	0	C	NM_144994		97508119	-1	tier1	-	no_errors	ENST00000318357	ensembl	human	known	74_37	missense	37.76	61	37	SNP	0.976	T
ANXA11	311	genome.wustl.edu	37	10	81918942	81918943	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr10:81918942_81918943TC>AA	ENST00000438331.1	-	14	1671_1672	c.1189_1190GA>TT	c.(1189-1191)GAg>TTg	p.E397L	ANXA11_ENST00000535999.1_Missense_Mutation_p.E397L|ANXA11_ENST00000360615.4_Missense_Mutation_p.E397L|ANXA11_ENST00000265447.4_Missense_Mutation_p.E397L|ANXA11_ENST00000422982.3_Missense_Mutation_p.E397L|ANXA11_ENST00000537102.1_Missense_Mutation_p.E364L|ANXA11_ENST00000372231.3_Missense_Mutation_p.E397L	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	397					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TCTCTGGTACTCATTGAAAACT	0.505																																																	0																																										SO:0001583	missense	0			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.1189_1190delinsAA	10.37:g.81918942_81918943delinsAA	ENSP00000398610:p.Glu397Leu		B4DVE7	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXI,prints_AnnexinVII	p.E397V|p.E397*	ENST00000438331.1	37	c.1190|c.1189	CCDS7364.1	10																																																																																			ANXA11	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinVII	ENSG00000122359		0.505	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANXA11	HGNC	protein_coding	OTTHUMT00000049044.1	|-	0.00	28|29	0	T|C	NM_145869		81918942|81918943	-1	|tier1	|-	no_errors	ENST00000265447	ensembl	human	known	74_37	missense|nonsense	10.34|12.90	26|27	3|4	SNP	1.000	A
APC	324	genome.wustl.edu	37	5	112175259	112175259	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:112175259T>A	ENST00000457016.1	+	16	4348	c.3968T>A	c.(3967-3969)gTt>gAt	p.V1323D	APC_ENST00000257430.4_Missense_Mutation_p.V1323D|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.V1323D			P25054	APC_HUMAN	adenomatous polyposis coli	1323	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P1324fs*8(3)|p.V1320fs*8(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTGAGCGAAGTTCCAGCAGTG	0.438		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	6	Insertion - Frameshift(3)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(4)|soft_tissue(1)|skin(1)											61.0	63.0	62.0					5																	112175259		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3968T>A	5.37:g.112175259T>A	ENSP00000413133:p.Val1323Asp		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V1323D	ENST00000457016.1	37	c.3968	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	T	8.957	0.969531	0.18659	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89875	-2.58;-2.58;-2.58	6.03	4.86	0.63082	.	0.378758	0.29028	N	0.013365	T	0.79913	0.4528	L	0.27053	0.805	0.54753	D	0.99998	B;B	0.18166	0.026;0.026	B;B	0.20184	0.028;0.028	T	0.70539	-0.4844	9	.	.	.	-10.1462	7.5712	0.27909	0.0:0.2428:0.0:0.7572	.	1325;1323	Q4LE70;P25054	.;APC_HUMAN	D	1323	ENSP00000413133:V1323D;ENSP00000257430:V1323D;ENSP00000427089:V1323D	.	V	+	2	0	APC	112203158	0.961000	0.32948	1.000000	0.80357	0.531000	0.34715	1.596000	0.36718	1.090000	0.41315	0.533000	0.62120	GTT	APC	-	NULL	ENSG00000134982		0.438	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	39	0	T	NM_000038		112175259	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.995	A
APC	324	genome.wustl.edu	37	5	112175285	112175285	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:112175285A>G	ENST00000457016.1	+	16	4374	c.3994A>G	c.(3994-3996)Acc>Gcc	p.T1332A	APC_ENST00000257430.4_Missense_Mutation_p.T1332A|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.T1332A			P25054	APC_HUMAN	adenomatous polyposis coli	1332	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.T1332fs*83(1)|p.K1192fs*3(1)|p.?(1)|p.V1326fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCACCCTAGAACCAAATCCAG	0.448		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	4	Deletion - Frameshift(3)|Unknown(1)	large_intestine(2)|soft_tissue(1)|skin(1)											58.0	61.0	60.0					5																	112175285		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3994A>G	5.37:g.112175285A>G	ENSP00000413133:p.Thr1332Ala		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.T1332A	ENST00000457016.1	37	c.3994	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	A	7.219	0.597056	0.13875	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89343	-2.5;-2.5;-2.5	6.03	3.58	0.41010	.	0.417423	0.28442	N	0.015333	T	0.78880	0.4353	N	0.19112	0.55	0.28264	N	0.924711	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.63603	-0.6600	9	.	.	.	-1.4958	10.3327	0.43831	0.8647:0.0:0.1353:0.0	.	1334;1332	Q4LE70;P25054	.;APC_HUMAN	A	1332	ENSP00000413133:T1332A;ENSP00000257430:T1332A;ENSP00000427089:T1332A	.	T	+	1	0	APC	112203184	1.000000	0.71417	0.998000	0.56505	0.574000	0.36063	2.795000	0.47861	0.495000	0.27882	0.533000	0.62120	ACC	APC	-	NULL	ENSG00000134982		0.448	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	39	0	A	NM_000038		112175285	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	G
APOB	338	genome.wustl.edu	37	2	21233395	21233395	+	Silent	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:21233395C>A	ENST00000233242.1	-	26	6472	c.6345G>T	c.(6343-6345)ctG>ctT	p.L2115L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2115	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGTTTTCCCAGGGCTGCTC	0.388																																																	0													60.0	61.0	61.0					2																	21233395		2203	4300	6503	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6345G>T	2.37:g.21233395C>A			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L2115	ENST00000233242.1	37	c.6345	CCDS1703.1	2																																																																																			APOB	-	NULL	ENSG00000084674		0.388	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	32	0	C			21233395	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.025	A
ARHGAP28	79822	genome.wustl.edu	37	18	6912058	6912058	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr18:6912058G>T	ENST00000383472.4	+	18	2199		c.e18-1		ARHGAP28_ENST00000419673.2_Splice_Site|ARHGAP28_ENST00000314319.3_Splice_Site|ARHGAP28_ENST00000531294.1_Splice_Site			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				CTTTCTTTTAGGAGAGCATTG	0.368																																																	0													48.0	47.0	47.0					18																	6912058		2203	4300	6503	SO:0001630	splice_region_variant	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.2096-1G>T	18.37:g.6912058G>T			A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Splice_Site	SNP	-	e16-1	ENST00000383472.4	37	c.1619-1		18	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178620	0.78564	.	.	ENSG00000088756	ENST00000419673;ENST00000531294;ENST00000314319	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.958	0.92668	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP28	6902058	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.968000	0.70413	2.775000	0.95449	0.655000	0.94253	.	ARHGAP28	-	-	ENSG00000088756		0.368	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3		0.00	19	0	G	XM_371108	Intron	6912058	+1			no_errors	ENST00000314319	ensembl	human	known	74_37	splice_site	17.24	24	5	SNP	1.000	T
ARHGAP6	395	genome.wustl.edu	37	X	11206970	11206970	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:11206970C>A	ENST00000337414.4	-	4	1827	c.955G>T	c.(955-957)Gga>Tga	p.G319*	ARHGAP6_ENST00000380736.1_Nonsense_Mutation_p.G116*|ARHGAP6_ENST00000380732.3_Nonsense_Mutation_p.G351*|ARHGAP6_ENST00000380718.1_Nonsense_Mutation_p.G319*|ARHGAP6_ENST00000303025.6_Nonsense_Mutation_p.G116*|ARHGAP6_ENST00000413512.3_Nonsense_Mutation_p.G128*|ARHGAP6_ENST00000534860.1_Nonsense_Mutation_p.G144*	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	319					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CTTTTATTTCCAAATGGGAGG	0.478																																																	0													120.0	91.0	101.0					X																	11206970		2203	4300	6503	SO:0001587	stop_gained	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.955G>T	X.37:g.11206970C>A	ENSP00000338967:p.Gly319*		B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.G319*	ENST00000337414.4	37	c.955	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	C	46	12.740013	0.99692	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	.	.	.	5.66	5.66	0.87406	.	0.000000	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	18.7976	0.92001	0.0:1.0:0.0:0.0	.	.	.	.	X	144;116;116;319;155;319;128;351	.	ENSP00000302312:G116X	G	-	1	0	ARHGAP6	11116891	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.299000	0.59073	2.385000	0.81259	0.600000	0.82982	GGA	ARHGAP6	-	NULL	ENSG00000047648		0.478	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	-	0.00	22	0	C	NM_013427		11206970	-1	tier1	-	no_errors	ENST00000337414	ensembl	human	known	74_37	nonsense	17.39	19	4	SNP	1.000	A
ARL6IP6	151188	genome.wustl.edu	37	2	153577006	153577006	+	Intron	SNP	T	T	C	rs574413561		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:153577006T>C	ENST00000326446.5	+	2	1111				PRPF40A_ENST00000486100.1_5'Flank|PRPF40A_ENST00000410080.1_5'Flank|ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						TTTCAAATTATAGTATTGCTT	0.393													T|||	1	0.000199681	0.0	0.0	5008	,	,		19796	0.0		0.0	False		,,,				2504	0.001																0													106.0	106.0	106.0					2																	153577006		2203	4300	6503	SO:0001627	intron_variant	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.401-41T>C	2.37:g.153577006T>C			B2RDS6|Q7Z4G7	RNA	SNP	-	NULL	ENST00000326446.5	37	NULL	CCDS2197.1	2																																																																																			ARL6IP6	-	-	ENSG00000177917		0.393	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP6	HGNC	protein_coding	OTTHUMT00000254852.3	-	0.00	50	0	T	NM_152522		153577006	+1	tier1	-	no_errors	ENST00000463690	ensembl	human	putative	74_37	rna	25.35	53	18	SNP	0.000	C
ATP10B	23120	genome.wustl.edu	37	5	160049468	160049468	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:160049468T>A	ENST00000327245.5	-	14	2591	c.1745A>T	c.(1744-1746)gAt>gTt	p.D582V	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	582					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGGAAGAAATCAGCAATGGA	0.567																																																	0													77.0	81.0	80.0					5																	160049468		2002	4180	6182	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1745A>T	5.37:g.160049468T>A	ENSP00000313600:p.Asp582Val		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.D582V	ENST00000327245.5	37	c.1745	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	T	26.1	4.701250	0.88924	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.85955	-2.05;-2.05	5.53	5.53	0.82687	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.92218	0.7532	M	0.80332	2.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92572	0.6067	9	.	.	.	.	14.8695	0.70444	0.0:0.0:0.0:1.0	.	190;582	Q2YDW8;O94823	.;AT10B_HUMAN	V	582;190	ENSP00000313600:D582V;ENSP00000431081:D190V	.	D	-	2	0	ATP10B	159982046	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.946000	0.87746	2.100000	0.63781	0.533000	0.62120	GAT	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000118322		0.567	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	-	0.00	48	0	T	NM_025153		160049468	-1	tier1	-	no_errors	ENST00000327245	ensembl	human	known	74_37	missense	48.72	20	19	SNP	1.000	A
AXIN2	8313	genome.wustl.edu	37	17	63532605	63532605	+	Silent	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:63532605G>A	ENST00000375702.5	-	6	1887	c.1779C>T	c.(1777-1779)agC>agT	p.S593S	AXIN2_ENST00000307078.5_Silent_p.S658S			Q9Y2T1	AXIN2_HUMAN	axin 2	630				Missing (in Ref. 2; AAF22799). {ECO:0000305}.	bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GATGGTGCCGGCTGGCTCGTT	0.637									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								0													30.0	36.0	34.0					17																	63532605		2203	4299	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1779C>T	17.37:g.63532605G>A			Q3MJ88|Q9H3M6|Q9UH84	Silent	SNP	pfam_DIX,pfam_RGS_dom,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S658	ENST00000375702.5	37	c.1974		17																																																																																			AXIN2	-	NULL	ENSG00000168646		0.637	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	-	0.00	44	0	G	NM_004655		63532605	-1	tier1	-	no_errors	ENST00000307078	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.713	A
BIRC6	57448	genome.wustl.edu	37	2	32661251	32661251	+	Splice_Site	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:32661251A>T	ENST00000421745.2	+	15	3764	c.3630A>T	c.(3628-3630)aaA>aaT	p.K1210N		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1210					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AACTTGTTAAAGGTGAAGTAA	0.343																																					Pancreas(94;175 1509 16028 18060 45422)												0													37.0	33.0	34.0					2																	32661251		2198	4276	6474	SO:0001630	splice_region_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3631+1A>T	2.37:g.32661251A>T			Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.K1210N	ENST00000421745.2	37	c.3630	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	A	23.6	4.430863	0.83776	.	.	ENSG00000115760	ENST00000421745;ENST00000444173	T	0.76709	-1.04	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.87299	0.2304	10	0.87932	D	0	.	15.1044	0.72310	1.0:0.0:0.0:0.0	.	1210	Q9NR09	BIRC6_HUMAN	N	1210;96	ENSP00000393596:K1210N	ENSP00000393596:K1210N	K	+	3	2	BIRC6	32514755	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.572000	0.82409	1.966000	0.57179	0.528000	0.53228	AAA	BIRC6	-	NULL	ENSG00000115760		0.343	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	77	0	A	NM_016252	Missense_Mutation	32661251	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	10.89	90	11	SNP	1.000	T
BPIFA2	140683	genome.wustl.edu	37	20	31767414	31767414	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:31767414G>T	ENST00000253362.2	+	7	796	c.650G>T	c.(649-651)tGt>tTt	p.C217F	BPIFA2_ENST00000354932.5_Missense_Mutation_p.C217F			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	217						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										TGTCAGATATGTCCACTGATC	0.512																																																	0													170.0	157.0	162.0					20																	31767414		2203	4300	6503	SO:0001583	missense	0			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.650G>T	20.37:g.31767414G>T	ENSP00000253362:p.Cys217Phe		Q9BQQ0	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.C217F	ENST00000253362.2	37	c.650	CCDS13214.1	20	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138912	0.37728	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.34275	1.37;1.37	3.26	3.26	0.37387	.	0.341742	0.21687	N	0.070637	T	0.46600	0.1401	L	0.36672	1.1	0.09310	N	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.15809	-1.0424	10	0.87932	D	0	-0.2615	10.2867	0.43570	0.0:0.0:1.0:0.0	.	217	Q96DR5	BPIA2_HUMAN	F	217	ENSP00000253362:C217F;ENSP00000347012:C217F	ENSP00000253362:C217F	C	+	2	0	BPIFA2	31231075	0.978000	0.34361	0.142000	0.22268	0.007000	0.05969	3.377000	0.52425	2.138000	0.66242	0.561000	0.74099	TGT	BPIFA2	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	ENSG00000131050		0.512	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA2	HGNC	protein_coding	OTTHUMT00000257117.1		0.00	45	0	G	NM_080574		31767414	+1			no_errors	ENST00000253362	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.144	T
C12orf50	160419	genome.wustl.edu	37	12	88388500	88388500	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:88388500T>A	ENST00000298699.2	-	7	682	c.502A>T	c.(502-504)Aca>Tca	p.T168S	C12orf50_ENST00000550553.1_Missense_Mutation_p.T168S	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	168										NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						CTAAGTTTTGTCGGAACTGTA	0.328																																																	0													142.0	129.0	133.0					12																	88388500		2202	4299	6501	SO:0001583	missense	0			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.502A>T	12.37:g.88388500T>A	ENSP00000298699:p.Thr168Ser		Q6P674	Missense_Mutation	SNP	NULL	p.T168S	ENST00000298699.2	37	c.502	CCDS9031.1	12	.	.	.	.	.	.	.	.	.	.	T	12.71	2.020408	0.35606	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944	T;T	0.33654	1.4;1.41	5.01	3.77	0.43336	.	0.097230	0.45361	D	0.000376	T	0.29389	0.0732	M	0.63428	1.95	0.30351	N	0.784773	P;P	0.40970	0.734;0.734	B;B	0.35470	0.203;0.203	T	0.29579	-1.0007	10	0.32370	T	0.25	.	7.5873	0.27999	0.2766:0.0:0.0:0.7234	.	222;168	G3V208;Q8NA57	.;CL050_HUMAN	S	168;168;222	ENSP00000298699:T168S;ENSP00000448344:T168S	ENSP00000298699:T168S	T	-	1	0	C12orf50	86912631	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	1.167000	0.31847	2.012000	0.59069	0.528000	0.53228	ACA	C12orf50	-	NULL	ENSG00000165805		0.328	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf50	HGNC	protein_coding	OTTHUMT00000406328.1	-	0.00	67	0	T	NM_152589		88388500	-1	tier1	-	no_errors	ENST00000298699	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
CADM1	23705	genome.wustl.edu	37	11	115049492	115049492	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:115049492G>A	ENST00000452722.3	-	9	1102	c.1082C>T	c.(1081-1083)tCc>tTc	p.S361F	CADM1_ENST00000537058.1_Missense_Mutation_p.S372F|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000542447.2_Missense_Mutation_p.S333F|CADM1_ENST00000331581.6_Missense_Mutation_p.S390F|CADM1_ENST00000536727.1_Missense_Mutation_p.S362F	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		ACCTGCTCGGGAATCTGTTAA	0.542																																																	0													76.0	70.0	72.0					11																	115049492		2201	4296	6497	SO:0001583	missense	0			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1082C>T	11.37:g.115049492G>A	ENSP00000395359:p.Ser361Phe			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.S361F	ENST00000452722.3	37	c.1082	CCDS8373.1	11	.	.	.	.	.	.	.	.	.	.	G	19.56	3.849848	0.71603	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	T;T;T;T;T	0.73575	-0.76;-0.08;0.19;-0.11;0.01	5.0	5.0	0.66597	.	0.239499	0.34879	N	0.003601	T	0.80849	0.4702	L	0.46157	1.445	0.58432	D	0.999999	D;D;D;D	0.67145	0.996;0.991;0.99;0.995	P;P;P;P	0.59703	0.8;0.687;0.862;0.829	T	0.81885	-0.0727	10	0.56958	D	0.05	.	18.4828	0.90818	0.0:0.0:1.0:0.0	.	372;334;361;333	F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;CADM1_HUMAN;.	F	333;361;372;362;292;390;46	ENSP00000439176:S333F;ENSP00000395359:S361F;ENSP00000439817:S372F;ENSP00000440322:S362F;ENSP00000329797:S390F	ENSP00000329797:S390F	S	-	2	0	CADM1	114554702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.617000	0.88574	0.655000	0.94253	TCC	CADM1	-	NULL	ENSG00000182985		0.542	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	HGNC	protein_coding	OTTHUMT00000398753.2	-	0.00	38	0	G	NM_014333		115049492	-1	tier1	-	no_errors	ENST00000452722	ensembl	human	known	74_37	missense	16.67	30	6	SNP	1.000	A
CBX6	23466	genome.wustl.edu	37	22	39262318	39262318	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr22:39262318T>C	ENST00000407418.3	-	5	1258	c.1135A>G	c.(1135-1137)Acg>Gcg	p.T379A	CBX6_ENST00000216083.6_Missense_Mutation_p.T361A			O95503	CBX6_HUMAN	chromobox homolog 6	379					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					ATTGTGACCGTCAGGAGGTTG	0.652																																																	0													54.0	55.0	55.0					22																	39262318		2203	4300	6503	SO:0001583	missense	0				CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.1135A>G	22.37:g.39262318T>C	ENSP00000384490:p.Thr379Ala		A8KAH0|Q96EM5	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.T379A	ENST00000407418.3	37	c.1135	CCDS13980.1	22	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161075	0.78226	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	.	.	.	4.23	4.23	0.50019	.	0.000000	0.53938	D	0.000056	T	0.78104	0.4231	M	0.78456	2.415	0.49299	D	0.999777	D	0.76494	0.999	D	0.76071	0.987	T	0.81667	-0.0829	9	0.87932	D	0	.	13.4862	0.61366	0.0:0.0:0.0:1.0	.	379	O95503	CBX6_HUMAN	A	379;361	.	ENSP00000216083:T361A	T	-	1	0	CBX6	37592264	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.207000	0.77899	1.773000	0.52216	0.334000	0.21626	ACG	CBX6	-	NULL	ENSG00000183741		0.652	CBX6-001	KNOWN	basic|CCDS	protein_coding	CBX6	HGNC	protein_coding	OTTHUMT00000318190.1	-	0.00	86	0	T	NM_014292		39262318	-1	tier1	-	no_errors	ENST00000407418	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	C
CCDC109B	55013	genome.wustl.edu	37	4	110606473	110606473	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:110606473C>G	ENST00000394650.4	+	7	1016	c.883C>G	c.(883-885)Cag>Gag	p.Q295E		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	295					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		ATCAAAGCAACAGCACTTTGA	0.348																																																	0													96.0	99.0	98.0					4																	110606473		2203	4300	6503	SO:0001583	missense	0			BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.883C>G	4.37:g.110606473C>G	ENSP00000378145:p.Gln295Glu		A8K4Y3|Q6IAC1	Missense_Mutation	SNP	pfam_Coiled-coil-dom_prot_109_C	p.Q295E	ENST00000394650.4	37	c.883	CCDS3683.2	4	.	.	.	.	.	.	.	.	.	.	C	0.104	-1.148440	0.01714	.	.	ENSG00000005059	ENST00000394650	T	0.29142	1.58	5.28	2.1	0.27182	Coiled-coil domain containing protein 109, C-terminal (1);	0.451358	0.25047	N	0.033558	T	0.24661	0.0598	M	0.66939	2.045	0.09310	N	1	B	0.12013	0.005	B	0.17979	0.02	T	0.31888	-0.9927	10	0.08837	T	0.75	-8.6126	6.1024	0.20055	0.2376:0.5684:0.1224:0.0717	.	295	Q9NWR8	C109B_HUMAN	E	295	ENSP00000378145:Q295E	ENSP00000378145:Q295E	Q	+	1	0	CCDC109B	110825922	0.001000	0.12720	0.006000	0.13384	0.981000	0.71138	1.017000	0.29989	0.528000	0.28580	0.591000	0.81541	CAG	CCDC109B	-	pfam_Coiled-coil-dom_prot_109_C	ENSG00000005059		0.348	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC109B	HGNC	protein_coding	OTTHUMT00000254865.1	-	0.00	49	0	C	NM_017918		110606473	+1	tier1	-	no_errors	ENST00000394650	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.000	G
CCDC110	256309	genome.wustl.edu	37	4	186380437	186380437	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:186380437A>T	ENST00000307588.3	-	6	1379	c.1304T>A	c.(1303-1305)cTa>cAa	p.L435Q	CCDC110_ENST00000510617.1_Missense_Mutation_p.L435Q|CCDC110_ENST00000393540.3_Missense_Mutation_p.L398Q|CCDC110_ENST00000507501.1_5'Flank	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	435						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		AGATTCTTTTAGGTAATTCTG	0.323																																																	0													91.0	95.0	94.0					4																	186380437		2203	4297	6500	SO:0001583	missense	0			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1304T>A	4.37:g.186380437A>T	ENSP00000306776:p.Leu435Gln		Q86YI9|Q8N7W0	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.L435Q	ENST00000307588.3	37	c.1304	CCDS3843.1	4	.	.	.	.	.	.	.	.	.	.	A	14.78	2.637839	0.47049	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.12984	2.63;2.64;2.64	5.81	5.81	0.92471	.	0.000000	0.45606	D	0.000353	T	0.32315	0.0825	M	0.66939	2.045	0.26948	N	0.966107	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.20140	-1.0284	10	0.25751	T	0.34	-9.0474	11.3095	0.49356	0.8483:0.1517:0.0:0.0	.	435;398;435	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	Q	398;435;435	ENSP00000377172:L398Q;ENSP00000306776:L435Q;ENSP00000427246:L435Q	ENSP00000306776:L435Q	L	-	2	0	CCDC110	186617431	0.806000	0.28996	0.963000	0.40424	0.933000	0.57130	2.020000	0.41010	2.224000	0.72417	0.533000	0.62120	CTA	CCDC110	-	NULL	ENSG00000168491		0.323	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	HGNC	protein_coding	OTTHUMT00000360519.2		0.00	29	0	A	NM_152775		186380437	-1			no_errors	ENST00000307588	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.825	T
CCDC169	728591	genome.wustl.edu	37	13	36869957	36869957	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:36869957T>C	ENST00000239859.7	-	2	152	c.121A>G	c.(121-123)Aag>Gag	p.K41E	CCDC169_ENST00000491049.2_Intron|SOHLH2_ENST00000554962.1_Intron|CCDC169-SOHLH2_ENST00000511166.1_Intron|CCDC169_ENST00000379862.2_Intron|CCDC169_ENST00000510088.1_Intron|CCDC169_ENST00000239860.6_Intron|CCDC169_ENST00000503173.1_Missense_Mutation_p.K41E|CCDC169_ENST00000477250.1_5'UTR|CCDC169_ENST00000379864.2_Intron			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169	41										breast(1)|endometrium(1)	2						TCCGTAATCTTGTGTCTTAGT	0.274																																																	0													345.0	278.0	298.0					13																	36869957		692	1590	2282	SO:0001583	missense	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.121A>G	13.37:g.36869957T>C	ENSP00000239859:p.Lys41Glu		A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	Missense_Mutation	SNP	NULL	p.K41E	ENST00000239859.7	37	c.121	CCDS45028.1	13	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785916	0.70337	.	.	ENSG00000242715	ENST00000503173;ENST00000239859	T;T	0.51071	0.72;0.79	4.66	4.66	0.58398	.	.	.	.	.	T	0.59514	0.2199	L	0.46157	1.445	0.26262	N	0.97856	D;D;D	0.69078	0.993;0.997;0.994	P;D;P	0.66196	0.879;0.942;0.879	T	0.51490	-0.8699	9	0.54805	T	0.06	.	12.3729	0.55263	0.0:0.0:0.0:1.0	.	41;41;41	A6NNP5-4;A6NNP5;A6NNP5-2	.;CC169_HUMAN;.	E	41	ENSP00000426174:K41E;ENSP00000239859:K41E	ENSP00000239859:K41E	K	-	1	0	CCDC169	35767957	0.990000	0.36364	0.986000	0.45419	0.916000	0.54674	2.357000	0.44125	2.084000	0.62774	0.533000	0.62120	AAG	CCDC169	-	NULL	ENSG00000242715		0.274	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368255.1		0.00	60	0	T	NM_001144981		36869957	-1			no_errors	ENST00000239859	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.997	C
CCDC37	348807	genome.wustl.edu	37	3	126155278	126155278	+	3'UTR	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:126155278G>T	ENST00000352312.1	+	0	1966				CCDC37_ENST00000506204.1_3'UTR|CCDC37_ENST00000393425.1_3'UTR|CCDC37_ENST00000505024.1_3'UTR	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37											NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		TCTGGCTGAAGGCTTAGCAAA	0.512																																																	0													134.0	128.0	130.0					3																	126155278		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.*31G>T	3.37:g.126155278G>T			D3DNA8|Q494V1|Q494V4|Q8N838	RNA	SNP	-	NULL	ENST00000352312.1	37	NULL	CCDS3037.1	3																																																																																			CCDC37	-	-	ENSG00000163885		0.512	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	-	0.00	37	0	G	NM_182628		126155278	+1	tier1	-	no_errors	ENST00000506204	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.000	T
CCDC74A	90557	genome.wustl.edu	37	2	132287653	132287653	+	Intron	SNP	C	C	G	rs571896019	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:132287653C>G	ENST00000295171.6	+	2	433				CCDC74A_ENST00000409856.3_Intron|CCDC74A_ENST00000467992.2_Missense_Mutation_p.H35D	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A											endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						TCTGAGTCCTCACATGCTGGG	0.617													g|||	3	0.000599042	0.0008	0.0	5008	,	,		19652	0.002		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.295+389C>G	2.37:g.132287653C>G			Q6P4I5	Missense_Mutation	SNP	NULL	p.H35D	ENST00000295171.6	37	c.103	CCDS2167.1	2	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.408579	0.00193	.	.	ENSG00000163040	ENST00000467992	T	0.51574	0.7	1.92	-3.83	0.04269	.	.	.	.	.	T	0.17323	0.0416	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23084	-1.0198	6	0.02654	T	1	.	7.0526	0.25081	0.0:0.4169:0.4477:0.1353	.	.	.	.	D	35	ENSP00000444610:H35D	ENSP00000444610:H35D	H	+	1	0	CCDC74A	132004123	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-2.232000	0.01205	-2.066000	0.00886	-1.042000	0.02369	CAC	CCDC74A	-	NULL	ENSG00000163040		0.617	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74A	HGNC	protein_coding	OTTHUMT00000254570.2		0.00	70	0	C	NM_138770		132287653	+1			no_errors	ENST00000467992	ensembl	human	known	74_37	missense	5.26	90	5	SNP	0.000	G
CCNYL2	414194	genome.wustl.edu	37	10	42965691	42965691	+	RNA	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr10:42965691T>C	ENST00000483242.3	-	0	461					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						ATGATGTAGATCTTGCTTATC	0.383																																																	0																																												0			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42965691T>C				RNA	SNP	-	NULL	ENST00000483242.3	37	NULL		10																																																																																			CCNYL2	-	-	ENSG00000182632		0.383	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	-	0.00	52	0	T	XM_936368		42965691	-1	tier1	-	no_errors	ENST00000483242	ensembl	human	known	74_37	rna	14.81	46	8	SNP	1.000	C
CD3E	916	genome.wustl.edu	37	11	118175687	118175687	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:118175687G>T	ENST00000361763.4	+	2	311	c.20G>T	c.(19-21)tGg>tTg	p.W7L	CD3E_ENST00000528600.1_Missense_Mutation_p.W7L	NM_000733.3	NP_000724.1	P07766	CD3E_HUMAN	CD3e molecule, epsilon (CD3-TCR complex)	7					apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of smoothened signaling pathway (GO:0045879)|negative thymic T cell selection (GO:0045060)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell anergy (GO:0002669)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)|regulation of immune response (GO:0050776)|response to nutrient (GO:0007584)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)|SH3 domain binding (GO:0017124)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|ovary(2)|stomach(1)	8	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GGCACTCACTGGAGAGTTCTG	0.502																																																	0													182.0	189.0	187.0					11																	118175687		2200	4296	6496	SO:0001583	missense	0			X03884	CCDS31685.1	11q23	2014-09-17	2006-03-28		ENSG00000198851	ENSG00000198851		"""CD molecules"""	1674	protein-coding gene	gene with protein product		186830	"""CD3e antigen, epsilon polypeptide (TiT3 complex)"""				Standard	NM_000733		Approved		uc001psq.4	P07766	OTTHUMG00000166968	ENST00000361763.4:c.20G>T	11.37:g.118175687G>T	ENSP00000354566:p.Trp7Leu		A8K997	Missense_Mutation	SNP	pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.W7L	ENST00000361763.4	37	c.20	CCDS31685.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.839819	0.97009	.	.	ENSG00000198851	ENST00000361763;ENST00000528600	T	0.51071	0.72	5.29	5.29	0.74685	.	0.638235	0.15411	N	0.263800	T	0.64724	0.2624	M	0.63169	1.94	0.39186	D	0.962874	D;D	0.89917	1.0;0.995	D;P	0.75020	0.985;0.82	T	0.59910	-0.7365	10	0.29301	T	0.29	0.1887	14.7737	0.69699	0.0:0.0:1.0:0.0	.	7;7	B4DVW0;P07766	.;CD3E_HUMAN	L	7	ENSP00000354566:W7L	ENSP00000354566:W7L	W	+	2	0	CD3E	117680897	1.000000	0.71417	0.938000	0.37757	0.920000	0.55202	4.431000	0.59915	2.640000	0.89533	0.557000	0.71058	TGG	CD3E	-	NULL	ENSG00000198851		0.502	CD3E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD3E	HGNC	protein_coding	OTTHUMT00000392120.1	-	0.00	41	0	G	NM_000733		118175687	+1	tier1	-	no_errors	ENST00000361763	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.997	T
CEBPZ	10153	genome.wustl.edu	37	2	37428939	37428939	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:37428939T>C	ENST00000234170.5	-	16	3278	c.3133A>G	c.(3133-3135)Acc>Gcc	p.T1045A	AC007390.5_ENST00000397064.2_Intron|AC007390.5_ENST00000402297.1_Intron|AC007390.5_ENST00000392061.2_Intron|AC007390.5_ENST00000406711.1_Intron|AC007390.5_ENST00000397226.2_Intron	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	1045					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TTTTGAGTGGTTTTAATCCTC	0.294																																																	0													50.0	48.0	49.0					2																	37428939		2203	4300	6503	SO:0001583	missense	0			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.3133A>G	2.37:g.37428939T>C	ENSP00000234170:p.Thr1045Ala		Q8NE75	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.T1045A	ENST00000234170.5	37	c.3133	CCDS1787.1	2	.	.	.	.	.	.	.	.	.	.	T	10.28	1.305420	0.23736	.	.	ENSG00000115816	ENST00000234170	T	0.13196	2.61	5.73	-8.83	0.00806	.	0.879550	0.10293	N	0.692120	T	0.04497	0.0123	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37407	-0.9707	10	0.87932	D	0	.	2.9416	0.05833	0.1806:0.1163:0.4313:0.2718	.	1045	Q03701	CEBPZ_HUMAN	A	1045	ENSP00000234170:T1045A	ENSP00000234170:T1045A	T	-	1	0	CEBPZ	37282443	0.042000	0.20092	0.000000	0.03702	0.941000	0.58515	0.457000	0.21875	-2.017000	0.00944	0.524000	0.50904	ACC	CEBPZ	-	NULL	ENSG00000115816		0.294	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPZ	HGNC	protein_coding	OTTHUMT00000218569.2	-	0.00	47	0	T	NM_005760		37428939	-1	tier1	-	no_errors	ENST00000234170	ensembl	human	known	74_37	missense	32.86	47	23	SNP	0.001	C
CENPJ	55835	genome.wustl.edu	37	13	25480757	25480757	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:25480757C>T	ENST00000381884.4	-	7	1604	c.1419G>A	c.(1417-1419)ttG>ttA	p.L473L	CENPJ_ENST00000545981.1_Silent_p.L473L	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	473					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCTGTATTTTCAATCCTGACG	0.398																																																	0													82.0	86.0	85.0					13																	25480757		2203	4300	6503	SO:0001819	synonymous_variant	0			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1419G>A	13.37:g.25480757C>T			Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Silent	SNP	pfam_Tcp10_C_dom	p.L473	ENST00000381884.4	37	c.1419	CCDS9310.1	13																																																																																			CENPJ	-	NULL	ENSG00000151849		0.398	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPJ	HGNC	protein_coding	OTTHUMT00000044209.1		0.00	32	0	C	NM_018451		25480757	-1			no_errors	ENST00000381884	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.017	T
CHCHD6	84303	genome.wustl.edu	37	3	126423151	126423151	+	5'UTR	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:126423151T>C	ENST00000290913.3	+	0	89				CHCHD6_ENST00000508789.1_5'UTR	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6						cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						CTGCGGCATCTCGCCATGGGG	0.721																																																	0													12.0	14.0	13.0					3																	126423151		2187	4280	6467	SO:0001623	5_prime_UTR_variant	0			BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.-5T>C	3.37:g.126423151T>C			D6R9U0|D6RIB4|H8Y0Y7	RNA	SNP	-	NULL	ENST00000290913.3	37	NULL	CCDS3041.1	3																																																																																			CHCHD6	-	-	ENSG00000159685		0.721	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD6	HGNC	protein_coding	OTTHUMT00000356432.1	-	0.00	43	0	T	NM_032343		126423151	+1	tier1	-	no_errors	ENST00000514908	ensembl	human	known	74_37	rna	10.64	42	5	SNP	0.055	C
CHST10	9486	genome.wustl.edu	37	2	101010094	101010094	+	Silent	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:101010094G>A	ENST00000264249.3	-	7	1069	c.684C>T	c.(682-684)aaC>aaT	p.N228N	CHST10_ENST00000542617.1_Silent_p.N276N|CHST10_ENST00000409701.1_Silent_p.N228N	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	228					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						TCTCTGTCCGGTTCCTCCTGT	0.488																																																	0													169.0	167.0	168.0					2																	101010094		2203	4300	6503	SO:0001819	synonymous_variant	0			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.684C>T	2.37:g.101010094G>A			Q53T18	Silent	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.N276	ENST00000264249.3	37	c.828	CCDS2047.1	2																																																																																			CHST10	-	pfam_Sulfotransferase,superfamily_P-loop_NTPase	ENSG00000115526		0.488	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST10	HGNC	protein_coding	OTTHUMT00000253162.1		0.00	31	0	G	NM_004854		101010094	-1			no_errors	ENST00000542617	ensembl	human	known	74_37	silent	11.11	32	4	SNP	1.000	A
CIC	23152	genome.wustl.edu	37	19	42791176	42791177	+	Frame_Shift_Ins	INS	-	-	TGTT	rs145020411		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:42791176_42791177insTGTT	ENST00000575354.2	+	3	276_277	c.236_237insTGTT	c.(235-240)gctgttfs	p.-80fs	CIC_ENST00000572681.2_Frame_Shift_Ins_p.-989fs|CIC_ENST00000160740.3_Frame_Shift_Ins_p.-80fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GAGTCGGCAGCTGTTGCTCATG	0.673			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	0																																										SO:0001589	frameshift_variant	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.237_240dupTGTT	19.37:g.42791177_42791180dupTGTT	ENSP00000458663:p.Val80fs		Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Ins	INS	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A81fs	ENST00000575354.2	37	c.236_237	CCDS12601.1	19																																																																																			CIC	-	NULL	ENSG00000079432		0.673	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2		0.00	84	0	-			42791177	+1	tier1		no_errors	ENST00000575354	ensembl	human	known	74_37	frame_shift_ins	33.78	49	25	INS	0.970:0.968	TGTT
CLDN15	24146	genome.wustl.edu	37	7	100877648	100877648	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:100877648G>A	ENST00000401528.1	-	3	1418	c.293C>T	c.(292-294)gCg>gTg	p.A98V	CLDN15_ENST00000308344.5_Missense_Mutation_p.A98V|CLDN15_ENST00000433422.1_5'UTR	NM_001185080.1	NP_001172009.1	P56746	CLD15_HUMAN	claudin 15	98					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|ion transport (GO:0006811)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.A98V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	10	Lung NSC(181;0.168)|all_lung(186;0.215)					GCGCAGGCCCGCTATGCCTAG	0.657																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											56.0	62.0	60.0					7																	100877648		2203	4300	6503	SO:0001583	missense	0			AJ245738	CCDS5717.1	7q22	2008-07-18			ENSG00000106404	ENSG00000106404		"""Claudins"""	2036	protein-coding gene	gene with protein product		615778					Standard	NM_014343		Approved		uc003uyg.2	P56746	OTTHUMG00000150512	ENST00000401528.1:c.293C>T	7.37:g.100877648G>A	ENSP00000385300:p.Ala98Val		B3KPB5	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin15	p.A98V	ENST00000401528.1	37	c.293	CCDS5717.1	7	.	.	.	.	.	.	.	.	.	.	G	1.572	-0.533838	0.04082	.	.	ENSG00000106404	ENST00000308344;ENST00000401528;ENST00000412417	D;D;T	0.88509	-2.39;-2.39;0.39	5.11	1.11	0.20524	.	1.110160	0.06835	N	0.794648	T	0.65760	0.2722	N	0.00783	-1.19	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57877	-0.7735	10	0.02654	T	1	.	7.9348	0.29923	0.7439:0.0:0.2561:0.0	.	98	P56746	CLD15_HUMAN	V	98;98;75	ENSP00000308870:A98V;ENSP00000385300:A98V;ENSP00000390230:A75V	ENSP00000308870:A98V	A	-	2	0	CLDN15	100664368	0.369000	0.25039	0.154000	0.22540	0.607000	0.37147	2.574000	0.46016	-0.006000	0.14370	-0.672000	0.03802	GCG	CLDN15	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000106404		0.657	CLDN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN15	HGNC	protein_coding	OTTHUMT00000318698.1	-	0.00	42	0	G	NM_014343		100877648	-1	tier1	-	no_errors	ENST00000308344	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.306	A
CLEC4A	50856	genome.wustl.edu	37	12	8276480	8276480	+	Silent	SNP	T	T	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:8276480T>G	ENST00000229332.5	+	1	253	c.6T>G	c.(4-6)acT>acG	p.T2T	CLEC4A_ENST00000352620.3_Silent_p.T2T|CLEC4A_ENST00000360500.3_Silent_p.T2T|CLEC4A_ENST00000345999.3_Silent_p.T2T	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A	2					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		CCATTATGACTTCGGAAATCA	0.383																																																	0													72.0	64.0	67.0					12																	8276480		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.6T>G	12.37:g.8276480T>G			Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.T2	ENST00000229332.5	37	c.6	CCDS8590.1	12																																																																																			CLEC4A	-	NULL	ENSG00000111729		0.383	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4A	HGNC	protein_coding	OTTHUMT00000400257.1	-	0.00	37	0	T	NM_194450		8276480	+1	tier1	-	no_errors	ENST00000229332	ensembl	human	known	74_37	silent	60.00	18	27	SNP	0.001	G
CMYA5	202333	genome.wustl.edu	37	5	79030465	79030465	+	Silent	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:79030465A>G	ENST00000446378.2	+	2	5908	c.5877A>G	c.(5875-5877)caA>caG	p.Q1959Q		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1959					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGTCATCACAAGAAGCAGTAT	0.443																																																	0													72.0	70.0	71.0					5																	79030465		1911	4127	6038	SO:0001819	synonymous_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5877A>G	5.37:g.79030465A>G			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.Q1959	ENST00000446378.2	37	c.5877	CCDS47238.1	5																																																																																			CMYA5	-	NULL	ENSG00000164309		0.443	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	23	0	A	NM_153610		79030465	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	silent	35.71	18	10	SNP	0.031	G
CNNM4	26504	genome.wustl.edu	37	2	97427122	97427122	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:97427122C>A	ENST00000377075.2	+	1	484	c.386C>A	c.(385-387)tCc>tAc	p.S129Y		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	129					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						GGGAACACGTCCGGCGTGCTG	0.657																																																	0													63.0	62.0	62.0					2																	97427122		2203	4300	6503	SO:0001583	missense	0			AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.386C>A	2.37:g.97427122C>A	ENSP00000366275:p.Ser129Tyr		B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	pfam_DUF21,pfam_CBS_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.S129Y	ENST00000377075.2	37	c.386	CCDS2024.2	2	.	.	.	.	.	.	.	.	.	.	c	18.52	3.642476	0.67244	.	.	ENSG00000158158	ENST00000377075	T	0.78246	-1.16	4.72	3.74	0.42951	.	0.608041	0.14430	U	0.320100	T	0.76263	0.3963	M	0.65975	2.015	0.80722	D	1	P	0.46706	0.883	P	0.44772	0.46	T	0.77512	-0.2560	10	0.56958	D	0.05	-19.6042	8.3618	0.32363	0.1673:0.7401:0.0:0.0925	.	129	Q6P4Q7	CNNM4_HUMAN	Y	129	ENSP00000366275:S129Y	ENSP00000366275:S129Y	S	+	2	0	CNNM4	96790849	0.993000	0.37304	0.999000	0.59377	0.998000	0.95712	3.191000	0.50981	2.189000	0.69895	0.550000	0.68814	TCC	CNNM4	-	NULL	ENSG00000158158		0.657	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNNM4	HGNC	protein_coding	OTTHUMT00000252954.1	-	0.00	25	0	C	NM_020184		97427122	+1	tier1	-	no_errors	ENST00000377075	ensembl	human	known	74_37	missense	28.00	18	7	SNP	0.998	A
CNOT2	4848	genome.wustl.edu	37	12	70738008	70738008	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:70738008T>C	ENST00000418359.3	+	15	1842	c.1391T>C	c.(1390-1392)cTt>cCt	p.L464P	CNOT2_ENST00000551483.1_Splice_Site_p.L115P|CNOT2_ENST00000229195.3_Splice_Site_p.L464P	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	464	Repressor domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			GCAGTGGAGCTGTATGTTCAA	0.353																																																	0													124.0	128.0	127.0					12																	70738008		2203	4300	6503	SO:0001630	splice_region_variant	0			AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.1391+1T>C	12.37:g.70738008T>C			Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	pfam_NOT	p.L464P	ENST00000418359.3	37	c.1391	CCDS31857.1	12	.	.	.	.	.	.	.	.	.	.	T	25.0	4.593613	0.86953	.	.	ENSG00000111596	ENST00000229195;ENST00000418359;ENST00000548159;ENST00000551043;ENST00000551483;ENST00000551710	T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.35	5.35	0.76521	NOT2/NOT3/NOT5 (1);	0.000000	0.85682	D	0.000000	D	0.91106	0.7200	H	0.97340	3.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94198	0.7447	10	0.87932	D	0	-5.9026	15.6317	0.76917	0.0:0.0:0.0:1.0	.	464;464	Q9NZN8-4;Q9NZN8	.;CNOT2_HUMAN	P	464;464;455;464;115;47	ENSP00000229195:L464P;ENSP00000412091:L464P;ENSP00000449659:L455P;ENSP00000449260:L464P;ENSP00000448883:L115P;ENSP00000447808:L47P	ENSP00000229195:L464P	L	+	2	0	CNOT2	69024275	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.140000	0.66376	0.533000	0.62120	CTT	CNOT2	-	pfam_NOT	ENSG00000111596		0.353	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT2	HGNC	protein_coding	OTTHUMT00000404260.1	-	0.00	46	0	T		Missense_Mutation	70738008	+1	tier1	-	no_errors	ENST00000229195	ensembl	human	known	74_37	missense	12.31	57	8	SNP	1.000	C
CNTNAP1	8506	genome.wustl.edu	37	17	40842780	40842780	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:40842780C>T	ENST00000264638.4	+	13	2096	c.1879C>T	c.(1879-1881)Cgg>Tgg	p.R627W	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	627	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GACAGTTGTGCGGCATGACAG	0.592																																																	0													134.0	126.0	129.0					17																	40842780		2203	4300	6503	SO:0001583	missense	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1879C>T	17.37:g.40842780C>T	ENSP00000264638:p.Arg627Trp			Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R627W	ENST00000264638.4	37	c.1879	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817876	0.32145	.	.	ENSG00000108797	ENST00000264638	T	0.21361	2.01	5.83	1.44	0.22558	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);	0.090297	0.47852	D	0.000203	T	0.16171	0.0389	L	0.39898	1.24	0.18873	N	0.999985	B	0.23591	0.088	B	0.18871	0.023	T	0.16571	-1.0398	10	0.54805	T	0.06	.	10.0719	0.42339	0.4611:0.4778:0.0:0.0612	.	627	P78357	CNTP1_HUMAN	W	627	ENSP00000264638:R627W	ENSP00000264638:R627W	R	+	1	2	CNTNAP1	38096306	0.078000	0.21339	0.959000	0.39883	0.890000	0.51754	0.246000	0.18160	0.067000	0.16545	-1.028000	0.02416	CGG	CNTNAP1	-	superfamily_Fibrinogen_a/b/g_C_dom	ENSG00000108797		0.592	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1		0.00	34	0	C	NM_003632		40842780	+1			no_errors	ENST00000264638	ensembl	human	known	74_37	missense	6.82	39	3	SNP	0.246	T
COL4A2	1284	genome.wustl.edu	37	13	111077333	111077333	+	Missense_Mutation	SNP	G	G	A	rs374976511		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:111077333G>A	ENST00000360467.5	+	6	655	c.349G>A	c.(349-351)Gat>Aat	p.D117N		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	117					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.D117N(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCCTGGTGCCGATGGAATTCC	0.433																																																	1	Substitution - Missense(1)	urinary_tract(1)						G	ASN/ASP	0,3796		0,0,1898	132.0	131.0	132.0		349	5.2	1.0	13		132	1,8241		0,1,4120	no	missense	COL4A2	NM_001846.2	23	0,1,6018	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	117/1713	111077333	1,12037	1898	4121	6019	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.349G>A	13.37:g.111077333G>A	ENSP00000353654:p.Asp117Asn		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.D117N	ENST00000360467.5	37	c.349	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431376	0.43122	0.0	1.21E-4	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.94232	-3.38	5.18	5.18	0.71444	.	0.000000	0.56097	D	0.000035	D	0.92971	0.7763	L	0.28054	0.825	0.54753	D	0.999988	D	0.63046	0.992	P	0.60068	0.868	D	0.90767	0.4669	10	0.17832	T	0.49	.	18.7701	0.91888	0.0:0.0:1.0:0.0	.	117	P08572	CO4A2_HUMAN	N	117	ENSP00000353654:D117N	ENSP00000257309:D117N	D	+	1	0	COL4A2	109875334	0.990000	0.36364	0.988000	0.46212	0.987000	0.75469	3.690000	0.54713	2.431000	0.82371	0.650000	0.86243	GAT	COL4A2	-	pfam_Collagen	ENSG00000134871		0.433	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2		0.00	74	0	G	NM_001846		111077333	+1			no_errors	ENST00000360467	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.998	A
CPED1	79974	genome.wustl.edu	37	7	120782104	120782104	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:120782104A>G	ENST00000310396.5	+	16	2431	c.1964A>G	c.(1963-1965)gAg>gGg	p.E655G	CPED1_ENST00000423795.1_Missense_Mutation_p.E435G|CPED1_ENST00000450913.2_Missense_Mutation_p.E655G	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	655						endoplasmic reticulum (GO:0005783)											GCACACGGTGAGACTCTGATC	0.473																																																	0													170.0	156.0	160.0					7																	120782104		2203	4299	6502	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1964A>G	7.37:g.120782104A>G	ENSP00000309772:p.Glu655Gly		A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.E655G	ENST00000310396.5	37	c.1964	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	A	2.798	-0.249784	0.05867	.	.	ENSG00000106034	ENST00000310396;ENST00000450913;ENST00000423795	T;T;T	0.24350	2.18;1.86;1.86	5.77	3.3	0.37823	.	0.805350	0.11554	N	0.552469	T	0.23171	0.0560	L	0.47716	1.5	0.19945	N	0.99994	P;P;B	0.35575	0.51;0.51;0.381	B;B;B	0.36666	0.154;0.23;0.183	T	0.14392	-1.0474	10	0.29301	T	0.29	.	8.474	0.33001	0.6243:0.2541:0.0:0.1216	.	435;655;655	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	G	655;655;435	ENSP00000309772:E655G;ENSP00000406122:E655G;ENSP00000415573:E435G	ENSP00000309772:E655G	E	+	2	0	C7orf58	120569340	0.192000	0.23301	0.028000	0.17463	0.013000	0.08279	1.563000	0.36364	0.476000	0.27440	0.533000	0.62120	GAG	CPED1	-	NULL	ENSG00000106034		0.473	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	-	0.00	73	0	A	NM_024913		120782104	+1	tier1	-	no_errors	ENST00000310396	ensembl	human	known	74_37	missense	8.16	89	8	SNP	0.017	G
CROCCP2	84809	genome.wustl.edu	37	1	16945227	16945227	+	lincRNA	SNP	G	G	T	rs9728628	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:16945227G>T	ENST00000412962.1	-	0	2292				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CATTCTTACAGGCATTACCTT	0.373																																																	0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945227G>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.373	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	-	0.00	17	0	G	NR_026752.1		16945227	-1	tier1	rs9728628	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.004	T
CROCCP2	84809	genome.wustl.edu	37	1	16946164	16946164	+	lincRNA	SNP	A	A	G	rs59600364		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:16946164A>G	ENST00000412962.1	-	0	1355				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											catggagcacagcaaagcctc	0.592																																																	0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946164A>G			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.592	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	-	0.00	14	0	A	NR_026752.1		16946164	-1	tier1	rs59600364	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.012	G
CTNND2	1501	genome.wustl.edu	37	5	10973545	10973545	+	3'UTR	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:10973545G>A	ENST00000304623.8	-	0	3887				CTNND2_ENST00000359640.2_3'UTR|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_3'UTR|CTNND2_ENST00000458100.2_3'UTR|CTNND2_ENST00000511377.1_3'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						ACTGTTCCCGGAGCGCCTGTG	0.507																																																	0													43.0	47.0	45.0					5																	10973545		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.*20C>T	5.37:g.10973545G>A			B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	RNA	SNP	-	NULL	ENST00000304623.8	37	NULL	CCDS3881.1	5																																																																																			CTNND2	-	-	ENSG00000169862		0.507	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	-	0.00	53	0	G	NM_001332		10973545	-1	tier1	-	no_errors	ENST00000495388	ensembl	human	known	74_37	rna	13.89	93	15	SNP	0.924	A
DCAF17	80067	genome.wustl.edu	37	2	172305295	172305296	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:172305295_172305296GA>TT	ENST00000375255.3	+	4	753_754	c.426_427GA>TT	c.(424-429)gaGAaa>gaTTaa	p.142_143EK>D*	DCAF17_ENST00000468592.1_3'UTR|DCAF17_ENST00000539783.1_Nonsense_Mutation_p.142_143EK>D*	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	142					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.E142D(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						AAATCCTTGAGAAAATATATCT	0.322																																																	1	Substitution - Missense(1)	lung(1)																																								SO:0001587	stop_gained	0			AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	Exception_encountered	2.37:g.172305295_172305296delinsTT	ENSP00000364404:p.E142_K143delinsD*		B2RTW5|Q53TN3|Q9H908	Missense_Mutation|Nonsense_Mutation	SNP	NULL	p.E142D|p.K143*	ENST00000375255.3	37	c.426|c.427	CCDS2243.2	2																																																																																			DCAF17	-	NULL	ENSG00000115827		0.322	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF17	HGNC	protein_coding	OTTHUMT00000255342.2	-	0.00	85	0	G|A	NM_025000		172305295|172305296	+1	tier1	-	no_errors	ENST00000375255	ensembl	human	known	74_37	missense|nonsense	10.45|11.76	60	7|8	SNP	1.000	T
DGKB	1607	genome.wustl.edu	37	7	14652969	14652969	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:14652969C>T	ENST00000403951.2	-	16	1776	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K	DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.E452K|DGKB_ENST00000399322.3_Missense_Mutation_p.E453K|DGKB_ENST00000258767.5_Missense_Mutation_p.E453K|DGKB_ENST00000444700.2_Missense_Mutation_p.E434K|DGKB_ENST00000406247.3_Missense_Mutation_p.E453K|DGKB_ENST00000407950.1_Missense_Mutation_p.E445K			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	453	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						ACATACCGTTCTCCTTGTTTT	0.313																																																	0													47.0	45.0	45.0					7																	14652969		1814	4067	5881	SO:0001583	missense	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1357G>A	7.37:g.14652969C>T	ENSP00000385780:p.Glu453Lys		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.E453K	ENST00000403951.2	37	c.1357	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408424	0.83340	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.42	5.42	0.78866	Diacylglycerol kinase, catalytic domain (3);	0.126528	0.52532	D	0.000076	T	0.28732	0.0712	N	0.17674	0.51	0.53005	D	0.999961	D;B;B;P	0.53619	0.961;0.149;0.149;0.951	P;B;B;P	0.58780	0.845;0.192;0.192;0.677	T	0.02081	-1.1217	10	0.25106	T	0.35	.	19.5742	0.95434	0.0:1.0:0.0:0.0	.	452;434;453;453	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	K	453;453;453;452;445;434;453	ENSP00000385780:E453K;ENSP00000382260:E453K;ENSP00000258767:E453K;ENSP00000384909:E452K;ENSP00000385031:E445K;ENSP00000388451:E434K;ENSP00000386066:E453K	ENSP00000258767:E453K	E	-	1	0	DGKB	14619494	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.651000	0.74372	2.698000	0.92095	0.591000	0.81541	GAA	DGKB	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000136267		0.313	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	-	0.00	83	0	C	NM_004080		14652969	-1	tier1	-	no_errors	ENST00000258767	ensembl	human	known	74_37	missense	12.69	117	17	SNP	1.000	T
DHX8	1659	genome.wustl.edu	37	17	41601024	41601024	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:41601024A>G	ENST00000262415.3	+	23	3544	c.3472A>G	c.(3472-3474)Acc>Gcc	p.T1158A	DHX8_ENST00000540306.1_Intron	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1158					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GGTGCTCACCACCAAGGAATA	0.537																																					NSCLC(56;1548 1661 49258 49987)												0													135.0	115.0	122.0					17																	41601024		2203	4300	6503	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.3472A>G	17.37:g.41601024A>G	ENSP00000262415:p.Thr1158Ala			Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T1158A	ENST00000262415.3	37	c.3472	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	A	23.3	4.402815	0.83230	.	.	ENSG00000067596	ENST00000262415	T	0.02498	4.27	6.17	6.17	0.99709	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	M	0.84773	2.715	0.80722	D	1	B	0.20459	0.045	B	0.31245	0.126	T	0.01136	-1.1440	10	0.62326	D	0.03	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	1158	Q14562	DHX8_HUMAN	A	1158	ENSP00000262415:T1158A	ENSP00000262415:T1158A	T	+	1	0	DHX8	38956550	1.000000	0.71417	0.994000	0.49952	0.914000	0.54420	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	ACC	DHX8	-	pfam_DUF1605,superfamily_P-loop_NTPase	ENSG00000067596		0.537	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	61	0	A			41601024	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	missense	17.50	66	14	SNP	1.000	G
DNAH14	127602	genome.wustl.edu	37	1	225237932	225237932	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:225237932C>A	ENST00000445597.2	+	12	1846	c.1846C>A	c.(1846-1848)Caa>Aaa	p.Q616K	DNAH14_ENST00000439375.2_Missense_Mutation_p.Q645K|DNAH14_ENST00000430092.1_Missense_Mutation_p.Q645K			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	616					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TCCTCTTTGCCAAGATCCCCA	0.343																																																	0													136.0	112.0	120.0					1																	225237932		692	1591	2283	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.1846C>A	1.37:g.225237932C>A	ENSP00000409472:p.Gln616Lys		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.Q645K	ENST00000445597.2	37	c.1933		1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607964	0.46527	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.27256	2.72;1.68;1.68	5.49	4.57	0.56435	.	.	.	.	.	T	0.12263	0.0298	N	0.08118	0	0.80722	D	1	B	0.19073	0.033	B	0.23419	0.046	T	0.07654	-1.0761	9	0.02654	T	1	.	13.2576	0.60087	0.1593:0.8407:0.0:0.0	.	645	Q0VDD8-4	.	K	616;645;645	ENSP00000409472:Q616K;ENSP00000414402:Q645K;ENSP00000392061:Q645K	ENSP00000414402:Q645K	Q	+	1	0	DNAH14	223304555	0.998000	0.40836	1.000000	0.80357	0.696000	0.40369	2.550000	0.45811	1.429000	0.47314	0.411000	0.27672	CAA	DNAH14	-	NULL	ENSG00000185842		0.343	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	61	0	C	XM_059166		225237932	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	53.60	58	67	SNP	0.999	A
DNAH5	1767	genome.wustl.edu	37	5	13870950	13870950	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:13870950G>C	ENST00000265104.4	-	24	3864	c.3760C>G	c.(3760-3762)Cgg>Ggg	p.R1254G	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1254	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATTGCAATCCGAATATCATCT	0.348									Kartagener syndrome																																								0													91.0	90.0	90.0					5																	13870950		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3760C>G	5.37:g.13870950G>C	ENSP00000265104:p.Arg1254Gly		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1254G	ENST00000265104.4	37	c.3760	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828754	0.32329	.	.	ENSG00000039139	ENST00000265104	T	0.24908	1.83	5.58	2.52	0.30459	.	0.000000	0.85682	D	0.000000	T	0.44265	0.1285	M	0.83774	2.66	0.58432	D	0.999997	P	0.38729	0.644	P	0.53490	0.727	T	0.31336	-0.9947	10	0.49607	T	0.09	.	7.6764	0.28488	0.0847:0.0:0.3888:0.5265	.	1254	Q8TE73	DYH5_HUMAN	G	1254	ENSP00000265104:R1254G	ENSP00000265104:R1254G	R	-	1	2	DNAH5	13923950	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	3.879000	0.56138	0.700000	0.31782	-0.126000	0.14955	CGG	DNAH5	-	NULL	ENSG00000039139		0.348	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	75	0	G	NM_001369		13870950	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	21.92	114	32	SNP	1.000	C
DPYD	1806	genome.wustl.edu	37	1	97771865	97771865	+	Intron	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:97771865G>T	ENST00000370192.3	-	17	2159				DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase						beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TGTTCAAATAGGTCGGTTAAA	0.428																																																	0													91.0	94.0	93.0					1																	97771865		2203	4300	6503	SO:0001627	intron_variant	0			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2059-12C>A	1.37:g.97771865G>T			A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	RNA	SNP	-	NULL	ENST00000370192.3	37	NULL	CCDS30777.1	1																																																																																			DPYD-AS1	-	-	ENSG00000232878		0.428	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD-AS1	HGNC	protein_coding	OTTHUMT00000095698.3	-	0.00	45	0	G	NM_000110		97771865	+1	tier1	-	no_errors	ENST00000422980	ensembl	human	known	74_37	rna	30.77	36	16	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31424578	31424578	+	Splice_Site	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:31424578C>G	ENST00000511367.2	-	27	3461	c.3217G>C	c.(3217-3219)Gac>Cac	p.D1073H	DROSHA_ENST00000513349.1_Splice_Site_p.D1036H|DROSHA_ENST00000344624.3_Splice_Site_p.D1073H|DROSHA_ENST00000442743.1_Splice_Site_p.D1036H	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1073	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TCGCGCAGGTCCTGGAAAATG	0.423																																																	0													100.0	101.0	100.0					5																	31424578		1936	4146	6082	SO:0001630	splice_region_variant	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3217-1G>C	5.37:g.31424578C>G			E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.D1073H	ENST00000511367.2	37	c.3217	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028564	0.54790	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.41	5.41	0.78517	Ribonuclease III (2);	0.000000	0.85682	D	0.000000	D	0.87245	0.6129	L	0.52573	1.65	0.80722	D	1	D;P	0.54397	0.966;0.894	P;P	0.46718	0.525;0.465	D	0.88723	0.3231	10	0.72032	D	0.01	-23.5921	17.7429	0.88412	0.0:1.0:0.0:0.0	.	1036;1073	E7EMP9;Q9NRR4	.;RNC_HUMAN	H	1073;1073;1036;1036;998;1029	ENSP00000425979:D1073H;ENSP00000339845:D1073H;ENSP00000409335:D1036H;ENSP00000424161:D1036H	ENSP00000265075:D998H	D	-	1	0	DROSHA	31460335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.874000	0.63064	2.691000	0.91804	0.650000	0.86243	GAC	DROSHA	-	superfamily_RNase_III_dom,smart_RNase_III_dom	ENSG00000113360		0.423	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	-	0.00	47	0	C	NM_013235	Missense_Mutation	31424578	-1	tier1	-	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	8.74	94	9	SNP	1.000	G
DTHD1	401124	genome.wustl.edu	37	4	36345331	36345331	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:36345331delT	ENST00000456874.2	+	9	2289	c.2231delT	c.(2230-2232)ctgfs	p.L744fs	DTHD1_ENST00000357504.3_Frame_Shift_Del_p.L579fs|DTHD1_ENST00000507598.1_Frame_Shift_Del_p.L784fs|DTHD1_ENST00000503528.1_3'UTR|RP11-431M7.2_ENST00000504344.1_RNA	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	744	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						CTTCGCCTCCTGGCTCGACAT	0.443																																																	0													34.0	32.0	32.0					4																	36345331		692	1591	2283	SO:0001589	frameshift_variant	0			AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.2231delT	4.37:g.36345331delT	ENSP00000401597:p.Leu744fs		B2RXK4|B4E2N7	Frame_Shift_Del	DEL	pfam_Death_domain,superfamily_DEATH-like_dom,pfscan_Death_domain	p.L744fs	ENST00000456874.2	37	c.2231	CCDS54754.1	4																																																																																			DTHD1	-	pfam_Death_domain,superfamily_DEATH-like_dom,pfscan_Death_domain	ENSG00000197057		0.443	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DTHD1	HGNC	protein_coding			0.00	26	0	T	NM_001136536		36345331	+1	tier1		no_errors	ENST00000456874	ensembl	human	known	74_37	frame_shift_del	41.18	10	7	DEL	1.000	-
DUS3L	56931	genome.wustl.edu	37	19	5788046	5788046	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:5788046A>G	ENST00000309061.7	-	5	1180	c.1084T>C	c.(1084-1086)Ttt>Ctt	p.F362L	DUS3L_ENST00000590681.1_5'Flank|DUS3L_ENST00000320699.8_Missense_Mutation_p.F120L|CTB-54O9.9_ENST00000586012.1_5'Flank	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	362							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						TGGACGCCAAAGATGTCCTCA	0.647																																																	0													47.0	42.0	44.0					19																	5788046		2203	4300	6503	SO:0001583	missense	0				CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1084T>C	19.37:g.5788046A>G	ENSP00000311977:p.Phe362Leu		Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	pfam_tRNA_hU_synthase	p.F362L	ENST00000309061.7	37	c.1084	CCDS32880.1	19	.	.	.	.	.	.	.	.	.	.	A	16.12	3.033658	0.54896	.	.	ENSG00000141994	ENST00000309061;ENST00000320699	T;T	0.18174	2.23;2.23	3.74	3.74	0.42951	Aldolase-type TIM barrel (1);	0.000000	0.85682	U	0.000000	T	0.35799	0.0944	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.967	T	0.10965	-1.0607	10	0.87932	D	0	-0.8442	10.4597	0.44572	1.0:0.0:0.0:0.0	.	120;362	Q96G46-3;Q96G46	.;DUS3L_HUMAN	L	362;120	ENSP00000311977:F362L;ENSP00000315558:F120L	ENSP00000311977:F362L	F	-	1	0	DUS3L	5739046	1.000000	0.71417	0.699000	0.30290	0.099000	0.18886	9.167000	0.94773	1.352000	0.45808	0.374000	0.22700	TTT	DUS3L	-	pfam_tRNA_hU_synthase	ENSG00000141994		0.647	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS3L	HGNC	protein_coding	OTTHUMT00000451870.2	-	0.00	55	0	A	NM_020175		5788046	-1	tier1	-	no_errors	ENST00000309061	ensembl	human	known	74_37	missense	53.33	28	32	SNP	1.000	G
DYTN	391475	genome.wustl.edu	37	2	207557996	207557996	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:207557996G>T	ENST00000452335.2	-	9	999	c.883C>A	c.(883-885)Ctt>Att	p.L295I		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	295						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.L295I(2)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CCCTGAAGAAGGTTGTTTCTG	0.507																																																	2	Substitution - Missense(2)	lung(2)											82.0	80.0	80.0					2																	207557996		1942	4157	6099	SO:0001583	missense	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.883C>A	2.37:g.207557996G>T	ENSP00000396593:p.Leu295Ile			Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.L295I	ENST00000452335.2	37	c.883	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452525	0.43531	.	.	ENSG00000232125	ENST00000452335	T	0.15603	2.41	5.2	3.25	0.37280	.	.	.	.	.	T	0.14657	0.0354	L	0.29908	0.895	0.09310	N	0.99999	P	0.48407	0.91	B	0.44163	0.443	T	0.09400	-1.0676	9	0.72032	D	0.01	-0.7607	8.6028	0.33756	0.2448:0.0:0.7552:0.0	.	295	A2CJ06	DYTN_HUMAN	I	295	ENSP00000396593:L295I	ENSP00000396593:L295I	L	-	1	0	DYTN	207266241	1.000000	0.71417	0.904000	0.35570	0.502000	0.33828	1.782000	0.38654	1.419000	0.47118	-0.266000	0.10368	CTT	DYTN	-	NULL	ENSG00000232125		0.507	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1		0.00	34	0	G			207557996	-1			no_errors	ENST00000452335	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.387	T
DZIP1	22873	genome.wustl.edu	37	13	96282275	96282275	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:96282275C>T	ENST00000376829.2	-	7	1629	c.778G>A	c.(778-780)Gca>Aca	p.A260T	DZIP1_ENST00000361396.2_Missense_Mutation_p.A260T|DZIP1_ENST00000361156.3_Missense_Mutation_p.A260T|DZIP1_ENST00000347108.3_Missense_Mutation_p.A260T	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	260					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			GCATGGTGTGCAGCCTCTAGC	0.443																																																	0													102.0	81.0	88.0					13																	96282275		2203	4300	6503	SO:0001583	missense	0			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.778G>A	13.37:g.96282275C>T	ENSP00000366025:p.Ala260Thr		Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A260T	ENST00000376829.2	37	c.778	CCDS9478.1	13	.	.	.	.	.	.	.	.	.	.	C	9.695	1.152958	0.21371	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.24	3.47	0.39725	.	0.380726	0.28748	N	0.014272	T	0.34513	0.0900	L	0.51422	1.61	0.09310	N	1	B;P;P	0.39424	0.391;0.673;0.544	B;B;B	0.33960	0.086;0.173;0.084	T	0.09796	-1.0658	10	0.38643	T	0.18	-5.6257	12.8558	0.57884	0.2955:0.7045:0.0:0.0	.	260;260;260	Q05D25;Q86YF9-2;Q86YF9	.;.;DZIP1_HUMAN	T	260	ENSP00000257312:A260T;ENSP00000355018:A260T;ENSP00000355175:A260T;ENSP00000366025:A260T	ENSP00000257312:A260T	A	-	1	0	DZIP1	95080276	0.652000	0.27349	0.063000	0.19743	0.023000	0.10783	1.869000	0.39519	0.559000	0.29153	0.561000	0.74099	GCA	DZIP1	-	NULL	ENSG00000134874		0.443	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	-	0.00	43	0	C	NM_014934		96282275	-1	tier1	-	no_errors	ENST00000347108	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.262	T
EIF4A1	1973	genome.wustl.edu	37	17	7479902	7479902	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:7479902delG	ENST00000293831.8	+	5	422	c.406delG	c.(406-408)gggfs	p.G137fs	SNORA67_ENST00000384423.1_RNA|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000582746.1_Frame_Shift_Del_p.G137fs|CD68_ENST00000250092.6_5'Flank|EIF4A1_ENST00000577269.1_Frame_Shift_Del_p.G137fs|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000380498.6_5'Flank|SNORA48_ENST00000386847.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	137	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						CGCCTGTATCGGGGGCACCAA	0.562																																					Melanoma(120;278 1668 15796 27423 46368)												0													95.0	82.0	87.0					17																	7479902		2203	4300	6503	SO:0001589	frameshift_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.406delG	17.37:g.7479902delG	ENSP00000293831:p.Gly137fs		B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G137fs	ENST00000293831.8	37	c.406	CCDS11113.1	17																																																																																			EIF4A1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000161960		0.562	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A1	HGNC	protein_coding	OTTHUMT00000226952.6		0.00	35	0	G	NM_001416		7479902	+1	tier1		no_errors	ENST00000293831	ensembl	human	known	74_37	frame_shift_del	6.06	31	2	DEL	1.000	-
EFNB3	1949	genome.wustl.edu	37	17	7611541	7611541	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:7611541C>T	ENST00000226091.2	+	2	785	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	130	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				CCACGAGTTCCGCTCGCACCA	0.577																																																	0													64.0	60.0	62.0					17																	7611541		2203	4300	6503	SO:0001583	missense	0			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.388C>T	17.37:g.7611541C>T	ENSP00000226091:p.Arg130Cys		B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.R130C	ENST00000226091.2	37	c.388	CCDS11120.1	17	.	.	.	.	.	.	.	.	.	.	c	11.78	1.741060	0.30865	.	.	ENSG00000108947	ENST00000226091	D	0.94046	-3.34	4.58	2.56	0.30785	Ephrin, conserved site (1);Cupredoxin (2);	0.079924	0.48767	D	0.000164	D	0.93726	0.7995	L	0.52126	1.63	0.41106	D	0.985701	D	0.89917	1.0	D	0.65874	0.939	D	0.92096	0.5684	10	0.87932	D	0	-2.5583	6.9221	0.24393	0.3054:0.609:0.0:0.0856	.	130	Q15768	EFNB3_HUMAN	C	130	ENSP00000226091:R130C	ENSP00000226091:R130C	R	+	1	0	EFNB3	7552266	0.897000	0.30589	1.000000	0.80357	0.006000	0.05464	0.296000	0.19083	0.523000	0.28482	-0.371000	0.07208	CGC	EFNB3	-	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	ENSG00000108947		0.577	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB3	HGNC	protein_coding	OTTHUMT00000226965.1	-	0.00	47	0	C	NM_001406		7611541	+1	tier1	-	no_errors	ENST00000226091	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.986	T
ELTD1	64123	genome.wustl.edu	37	1	79383662	79383662	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:79383662C>T	ENST00000370742.3	-	11	1598	c.1535G>A	c.(1534-1536)gGc>gAc	p.G512D		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	512					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G512A(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAGATGTATGCCTTCAATGCA	0.378																																																	1	Substitution - Missense(1)	lung(1)											142.0	134.0	136.0					1																	79383662		1882	4114	5996	SO:0001583	missense	0			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1535G>A	1.37:g.79383662C>T	ENSP00000359778:p.Gly512Asp		B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G512D	ENST00000370742.3	37	c.1535	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.064417	0.93898	.	.	ENSG00000162618	ENST00000370742	T	0.60548	0.18	6.08	6.08	0.98989	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.81903	0.4921	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84807	0.0788	9	.	.	.	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	512	Q9HBW9	ELTD1_HUMAN	D	512	ENSP00000359778:G512D	.	G	-	2	0	ELTD1	79156250	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGC	ELTD1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000162618		0.378	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1		0.00	12	0	C	NM_022159		79383662	-1			no_errors	ENST00000370742	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
EMILIN3	90187	genome.wustl.edu	37	20	39990470	39990470	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:39990470A>G	ENST00000332312.3	-	4	1931	c.1739T>C	c.(1738-1740)cTt>cCt	p.L580P		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	580						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CTCGCCTTGAAGTGAGCTGCC	0.592																																																	0													110.0	93.0	99.0					20																	39990470		2203	4300	6503	SO:0001583	missense	0			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1739T>C	20.37:g.39990470A>G	ENSP00000332806:p.Leu580Pro		Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.L580P	ENST00000332312.3	37	c.1739	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499446	0.44455	.	.	ENSG00000183798	ENST00000332312	T	0.78481	-1.18	4.86	4.86	0.63082	.	0.156761	0.44483	D	0.000445	D	0.85128	0.5626	L	0.58101	1.795	0.37898	D	0.930959	D	0.89917	1.0	D	0.87578	0.998	D	0.86571	0.1847	9	.	.	.	-14.3326	14.4539	0.67404	1.0:0.0:0.0:0.0	.	580	Q9NT22	EMIL3_HUMAN	P	580	ENSP00000332806:L580P	.	L	-	2	0	EMILIN3	39423884	0.976000	0.34144	0.818000	0.32626	0.881000	0.50899	8.816000	0.91979	1.811000	0.52892	0.459000	0.35465	CTT	EMILIN3	-	NULL	ENSG00000183798		0.592	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2		0.00	33	0	A	XM_029741		39990470	-1			no_errors	ENST00000332312	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.299	G
EMR1	2015	genome.wustl.edu	37	19	6937659	6937659	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:6937659G>T	ENST00000312053.4	+	20	2692	c.2655G>T	c.(2653-2655)acG>acT	p.T885T	EMR1_ENST00000381407.5_Splice_Site_p.T744T|EMR1_ENST00000450315.3_Splice_Site_p.T708T|EMR1_ENST00000250572.8_Splice_Site_p.T820T|EMR1_ENST00000381404.4_Splice_Site_p.T866T	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	885					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CTTCCAAGACGGTGAGAGACT	0.582																																																	0													123.0	100.0	108.0					19																	6937659		2203	4300	6503	SO:0001630	splice_region_variant	0			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2655+1G>T	19.37:g.6937659G>T			A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.T885	ENST00000312053.4	37	c.2655	CCDS12175.1	19																																																																																			EMR1	-	NULL	ENSG00000174837		0.582	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	HGNC	protein_coding	OTTHUMT00000458485.1		0.00	24	0	G		Silent	6937659	+1			no_errors	ENST00000312053	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.971	T
AL356458.1	0	genome.wustl.edu	37	1	47968307	47968307	+	RNA	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:47968307G>T	ENST00000408419.1	+	0	132																											ggcatcctgtgttttatgtgg	0.363																																																	0																																												0																															1.37:g.47968307G>T				RNA	SNP	-	NULL	ENST00000408419.1	37	NULL		1																																																																																			AL356458.1	-	-	ENSG00000221346		0.363	AL356458.1-201	NOVEL	basic	miRNA	ENSG00000221346	Clone_based_ensembl_gene	miRNA		-	0.00	43	0	G			47968307	+1	tier1	-	no_errors	ENST00000408419	ensembl	human	novel	74_37	rna	7.41	50	4	SNP	0.002	T
RP11-384J4.2	0	genome.wustl.edu	37	14	27396981	27396981	+	lincRNA	SNP	T	T	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:27396981T>A	ENST00000552303.1	+	0	205				AL110292.1_ENST00000410967.1_RNA																							TACCAGTATTTCATTTAATTT	0.289																																																	0																																												0																															14.37:g.27396981T>A				RNA	SNP	-	NULL	ENST00000552303.1	37	NULL		14																																																																																			AL110292.1	-	-	ENSG00000222899		0.289	RP11-384J4.2-002	KNOWN	basic	lincRNA	ENSG00000222899	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000409120.1	-	0.00	200	0	T			27396981	+1	tier1	-	no_errors	ENST00000410967	ensembl	human	novel	74_37	rna	34.48	133	70	SNP	0.000	A
LINC01330	646168	genome.wustl.edu	37	3	167638415	167638415	+	lincRNA	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:167638415G>A	ENST00000481578.1	+	0	634																											CCAGAAGATTGCTTATCACCA	0.303																																																	0																																												0																															3.37:g.167638415G>A				RNA	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			RP11-298O21.5	-	-	ENSG00000244227		0.303	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	-	0.00	71	0	G			167638415	+1	tier1	-	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	28.09	64	25	SNP	0.092	A
EPSTI1	94240	genome.wustl.edu	37	13	43537397	43537397	+	Silent	SNP	T	T	C	rs150771459		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:43537397T>C	ENST00000398762.3	-	5	482	c.483A>G	c.(481-483)agA>agG	p.R161R	EPSTI1_ENST00000476830.2_5'UTR|EPSTI1_ENST00000313640.7_Silent_p.R161R|EPSTI1_ENST00000313624.7_Silent_p.R161R			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	161										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		TTACCTTCTCTCTCTGAATTG	0.313																																																	0								T	,	0,4406		0,0,2203	202.0	194.0	197.0		483,483	4.1	1.0	13	dbSNP_134	197	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	EPSTI1	NM_001002264.1,NM_033255.2	,	0,1,6501	CC,CT,TT		0.0116,0.0,0.0077	,	161/411,161/308	43537397	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	0			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.483A>G	13.37:g.43537397T>C			Q8IVC7|Q8NDQ7	Silent	SNP	NULL	p.R161	ENST00000398762.3	37	c.483	CCDS9387.1	13																																																																																			EPSTI1	-	NULL	ENSG00000133106		0.313	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	EPSTI1	HGNC	protein_coding	OTTHUMT00000400321.1	-	0.00	85	0	T	NM_001002264		43537397	-1	tier1	rs150771459	no_errors	ENST00000313640	ensembl	human	known	74_37	silent	12.00	66	9	SNP	1.000	C
EXD2	55218	genome.wustl.edu	37	14	69701736	69701736	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:69701736G>A	ENST00000409018.3	+	5	1165	c.1037G>A	c.(1036-1038)gGc>gAc	p.G346D	EXD2_ENST00000409949.1_Missense_Mutation_p.G221D|EXD2_ENST00000409014.1_Missense_Mutation_p.G221D|EXD2_ENST00000449989.1_Missense_Mutation_p.G221D|EXD2_ENST00000312994.5_Missense_Mutation_p.G346D|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409242.1_Missense_Mutation_p.G221D|EXD2_ENST00000409675.1_Missense_Mutation_p.G221D	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	346							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CTGGGGGTGGGCTATTCTGCC	0.517																																																	0													23.0	29.0	27.0					14																	69701736		2203	4299	6502	SO:0001583	missense	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1037G>A	14.37:g.69701736G>A	ENSP00000387331:p.Gly346Asp		B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.G346D	ENST00000409018.3	37	c.1037	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513548	0.85389	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.63417	0.34;-0.04;-0.04;-0.04;-0.04;0.34;-0.04	5.56	5.56	0.83823	.	0.046204	0.85682	D	0.000000	T	0.76800	0.4038	M	0.73598	2.24	0.80722	D	1	P;P;P	0.46859	0.876;0.885;0.885	P;B;B	0.56474	0.799;0.443;0.443	T	0.74481	-0.3651	10	0.39692	T	0.17	-9.9255	19.9029	0.96995	0.0:0.0:1.0:0.0	.	346;221;221	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	D	346;221;221;221;221;346;221	ENSP00000387331:G346D;ENSP00000386915:G221D;ENSP00000386762:G221D;ENSP00000386632:G221D;ENSP00000386839:G221D;ENSP00000313140:G346D;ENSP00000392177:G221D	ENSP00000313140:G346D	G	+	2	0	EXD2	68771489	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.578000	0.82498	2.776000	0.95493	0.650000	0.86243	GGC	EXD2	-	NULL	ENSG00000081177		0.517	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	-	0.00	37	0	G			69701736	+1	tier1	-	no_errors	ENST00000312994	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
EVL	51466	genome.wustl.edu	37	14	100599115	100599115	+	Splice_Site	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:100599115T>C	ENST00000402714.2	+	8	1497	c.893T>C	c.(892-894)aTg>aCg	p.M298T	EVL_ENST00000544450.2_Splice_Site_p.M304T|EVL_ENST00000392920.3_Splice_Site_p.M300T			Q9UI08	EVL_HUMAN	Enah/Vasp-like	298	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				GAAAGCCAAATGGTGAGCAAG	0.592																																																	0													167.0	174.0	172.0					14																	100599115		2203	4300	6503	SO:0001630	splice_region_variant	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.894+1T>C	14.37:g.100599115T>C			A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.M300T	ENST00000402714.2	37	c.899		14	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.785996	0.00628	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557384;ENST00000554695	T;T;T;T	0.69040	-0.36;-0.37;-0.36;1.09	4.77	1.74	0.24563	.	0.406946	0.22337	N	0.061391	T	0.24509	0.0594	N	0.00347	-1.61	0.19300	N	0.99998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31943	-0.9925	10	0.13470	T	0.59	-0.1863	6.3385	0.21309	0.1896:0.6044:0.0:0.206	.	304;300;298	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	T	298;304;300;263;194;115	ENSP00000384720:M298T;ENSP00000437904:M304T;ENSP00000376652:M300T;ENSP00000450979:M194T	ENSP00000376652:M300T	M	+	2	0	EVL	99668868	0.981000	0.34729	0.799000	0.32177	0.072000	0.16883	0.139000	0.16036	0.109000	0.17891	-1.972000	0.00464	ATG	EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.592	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	61	0	T		Missense_Mutation	100599115	+1	tier1	-	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	40.00	26	18	SNP	0.984	C
FABP6	2172	genome.wustl.edu	37	5	159640768	159640768	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:159640768G>A	ENST00000393980.4	+	3	223	c.77G>A	c.(76-78)tGc>tAc	p.C26Y	FABP6_ENST00000393982.1_Missense_Mutation_p.C26Y	NM_001130958.1	NP_001124430.1	P51161	FABP6_HUMAN	fatty acid binding protein 6, ileal	0					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.C26Y(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGTCTGCGTGCACATGGGTG	0.493																																					Colon(29;562 677 12756 16385 20992)												1	Substitution - Missense(1)	large_intestine(1)											149.0	157.0	155.0					5																	159640768		2064	4233	6297	SO:0001583	missense	0			U19869	CCDS4349.1, CCDS43393.1	5q23-q35	2013-03-01	2008-08-01		ENSG00000170231	ENSG00000170231		"""Fatty acid binding protein family"""	3561	protein-coding gene	gene with protein product	"""illeal lipid-binding protein"", ""ileal bile acid binding protein"", ""gastrotropin"""	600422				7894165, 7619861	Standard	NM_001130958		Approved	I-15P, ILLBP, I-BAP, ILBP3, I-BABP, ILBP, I-BALB	uc003lxx.1	P51161	OTTHUMG00000130329	ENST00000393980.4:c.77G>A	5.37:g.159640768G>A	ENSP00000377549:p.Cys26Tyr		Q07DR7|Q8TBI3|Q9UGI7	Missense_Mutation	SNP	superfamily_Calycin-like,prints_Fatty_acid-bd	p.C26Y	ENST00000393980.4	37	c.77	CCDS43393.1	5	.	.	.	.	.	.	.	.	.	.	G	5.746	0.322117	0.10900	.	.	ENSG00000170231	ENST00000393980;ENST00000393982	T;T	0.14022	2.54;2.54	2.25	-0.638	0.11500	.	.	.	.	.	T	0.09598	0.0236	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.31861	-0.9928	8	0.87932	D	0	.	5.261	0.15573	0.4367:0.0:0.5633:0.0	.	26	P51161-2	.	Y	26	ENSP00000377549:C26Y;ENSP00000377551:C26Y	ENSP00000377549:C26Y	C	+	2	0	FABP6	159573346	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.352000	0.20113	-0.200000	0.10300	0.549000	0.68633	TGC	FABP6	-	NULL	ENSG00000170231		0.493	FABP6-001	KNOWN	basic|CCDS	protein_coding	FABP6	HGNC	protein_coding	OTTHUMT00000252678.4		0.00	45	0	G	NM_001040442		159640768	+1			no_errors	ENST00000393980	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	A
FAM151A	338094	genome.wustl.edu	37	1	55075032	55075032	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:55075032A>G	ENST00000302250.2	-	8	1827	c.1667T>C	c.(1666-1668)cTg>cCg	p.L556P	ACOT11_ENST00000371316.3_Intron|FAM151A_ENST00000371304.2_Missense_Mutation_p.L369P|ACOT11_ENST00000343744.2_3'UTR|ACOT11_ENST00000481208.1_3'UTR	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	556						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CCTAGCTGCCAGCAATGCTGT	0.622																																																	0													72.0	57.0	62.0					1																	55075032		2203	4300	6503	SO:0001583	missense	0			AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.1667T>C	1.37:g.55075032A>G	ENSP00000306888:p.Leu556Pro		Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	pfam_DUF2181	p.L556P	ENST00000302250.2	37	c.1667	CCDS594.1	1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.961056	0.34565	.	.	ENSG00000162391	ENST00000302250;ENST00000294370	T	0.11277	2.79	4.28	3.13	0.36017	.	0.287311	0.23356	N	0.049064	T	0.24314	0.0589	M	0.66939	2.045	0.80722	D	1	D	0.59767	0.986	P	0.60541	0.876	T	0.00865	-1.1535	10	0.66056	D	0.02	-5.7378	9.3649	0.38219	0.8114:0.1886:0.0:0.0	.	556	Q8WW52	F151A_HUMAN	P	556;369	ENSP00000306888:L556P	ENSP00000294370:L369P	L	-	2	0	FAM151A	54847620	0.919000	0.31177	0.988000	0.46212	0.359000	0.29487	1.008000	0.29872	0.955000	0.37878	0.533000	0.62120	CTG	FAM151A	-	pfam_DUF2181	ENSG00000162391		0.622	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151A	HGNC	protein_coding	OTTHUMT00000027342.1		0.00	39	0	A	NM_176782		55075032	-1			no_errors	ENST00000302250	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.997	G
FAR1	84188	genome.wustl.edu	37	11	13729559	13729559	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:13729559C>T	ENST00000354817.3	+	4	622	c.478C>T	c.(478-480)Cgc>Tgc	p.R160C		NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	160					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						CTACTGTAATCGCAAGCATAT	0.368																																																	0													156.0	142.0	147.0					11																	13729559		2200	4294	6494	SO:0001583	missense	0			AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.478C>T	11.37:g.13729559C>T	ENSP00000346874:p.Arg160Cys		D3DQW8|Q5CZA3	Missense_Mutation	SNP	pfam_Male_sterile_NAD-bd,pfam_FAR,pfam_Epimerase_deHydtase	p.R160C	ENST00000354817.3	37	c.478	CCDS7813.1	11	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060582	0.76074	.	.	ENSG00000197601	ENST00000354817;ENST00000532701;ENST00000355107	T;T	0.49720	0.77;0.77	5.73	3.71	0.42584	NAD(P)-binding domain (1);Male sterility, NAD-binding (1);	0.059681	0.64402	D	0.000004	T	0.71400	0.3335	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.967;0.977	T	0.77493	-0.2567	10	0.56958	D	0.05	-7.1875	13.758	0.62948	0.3068:0.6932:0.0:0.0	.	160;160	E7ETC1;Q8WVX9	.;FACR1_HUMAN	C	160	ENSP00000346874:R160C;ENSP00000437111:R160C	ENSP00000346874:R160C	R	+	1	0	FAR1	13686135	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.953000	0.40352	1.348000	0.45733	0.585000	0.79938	CGC	FAR1	-	pfam_Male_sterile_NAD-bd,pfam_Epimerase_deHydtase	ENSG00000197601		0.368	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR1	HGNC	protein_coding	OTTHUMT00000385990.2	-	0.00	55	0	C	NM_032228		13729559	+1	tier1	-	no_errors	ENST00000354817	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
FARP1	10160	genome.wustl.edu	37	13	99083388	99083388	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:99083388G>C	ENST00000319562.6	+	18	2262	c.1997G>C	c.(1996-1998)aGa>aCa	p.R666T	FARP1_ENST00000376586.2_Missense_Mutation_p.R666T|FARP1_ENST00000595437.1_Missense_Mutation_p.R666T	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	666	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			AACTTCTGCAGAGACTTTGAG	0.612																																																	0													43.0	45.0	44.0					13																	99083388		2203	4300	6503	SO:0001583	missense	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1997G>C	13.37:g.99083388G>C	ENSP00000322926:p.Arg666Thr		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R666T	ENST00000319562.6	37	c.1997	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216234	0.58452	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.62941	-0.01;-0.01	5.72	5.72	0.89469	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	M	0.71206	2.165	0.58432	D	0.999998	D;D	0.60575	0.986;0.988	P;D	0.66979	0.899;0.948	T	0.80341	-0.1423	10	0.87932	D	0	.	19.8737	0.96861	0.0:0.0:1.0:0.0	.	666;666	Q9Y4F1;C9JME2	FARP1_HUMAN;.	T	666	ENSP00000365771:R666T;ENSP00000322926:R666T	ENSP00000322926:R666T	R	+	2	0	FARP1	97881389	0.956000	0.32656	0.055000	0.19348	0.025000	0.11179	5.320000	0.65841	2.693000	0.91896	0.650000	0.86243	AGA	FARP1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000152767		0.612	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	36	0	G	NM_005766		99083388	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.733	C
FCRL5	83416	genome.wustl.edu	37	1	157485719	157485719	+	Intron	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:157485719G>T	ENST00000361835.3	-	16	2970				FCRL5_ENST00000356953.4_Intron|FCRL5_ENST00000461387.1_Intron	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5						negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CTCTTCCCTTGTGCCTGCGCT	0.602																																																	0													159.0	164.0	163.0					1																	157485719		692	1591	2283	SO:0001627	intron_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2813-56C>A	1.37:g.157485719G>T			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	RNA	SNP	-	NULL	ENST00000361835.3	37	NULL	CCDS1165.1	1																																																																																			FCRL5	-	-	ENSG00000143297		0.602	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	-	0.00	19	0	G	NM_031281		157485719	-1	tier1	-	no_errors	ENST00000462218	ensembl	human	known	74_37	rna	45.45	12	10	SNP	0.001	T
FMO3	2328	genome.wustl.edu	37	1	171086361	171086361	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:171086361G>A	ENST00000367755.4	+	9	1489	c.1378G>A	c.(1378-1380)Gaa>Aaa	p.E460K	FMO3_ENST00000538429.1_Missense_Mutation_p.E397K|FMO3_ENST00000392085.2_Missense_Mutation_p.E460K|FMO3_ENST00000542847.1_Missense_Mutation_p.E440K	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	460					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	ATTGGCCATGGAAGTTTATTT	0.512																																																	0													94.0	87.0	89.0					1																	171086361		2203	4300	6503	SO:0001583	missense	0			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1378G>A	1.37:g.171086361G>A	ENSP00000356729:p.Glu460Lys		B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.E460K	ENST00000367755.4	37	c.1378	CCDS1292.1	1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330818	0.24167	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.34	3.41	0.39046	.	0.276439	0.40064	N	0.001195	T	0.14184	0.0343	L	0.33093	0.98	0.35875	D	0.828505	B;B;B	0.24043	0.096;0.003;0.001	B;B;B	0.24006	0.05;0.008;0.009	T	0.07849	-1.0751	10	0.08381	T	0.77	-19.8599	9.9473	0.41616	0.073:0.0:0.7895:0.1376	.	397;440;460	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	K	460;460;440;397	ENSP00000356729:E460K;ENSP00000375935:E460K;ENSP00000444073:E440K;ENSP00000439500:E397K	ENSP00000356729:E460K	E	+	1	0	FMO3	169352985	0.031000	0.19500	0.669000	0.29828	0.612000	0.37316	0.483000	0.22292	0.568000	0.29311	0.655000	0.94253	GAA	FMO3	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000007933		0.512	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO3	HGNC	protein_coding	OTTHUMT00000086219.1	-	0.00	36	0	G	NM_006894		171086361	+1	tier1	-	no_errors	ENST00000367755	ensembl	human	known	74_37	missense	31.11	31	14	SNP	0.996	A
FOXJ1	2302	genome.wustl.edu	37	17	74134094	74134094	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:74134094C>T	ENST00000322957.6	-	3	960	c.606G>A	c.(604-606)gcG>gcA	p.A202A	RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	202					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			GTAGCCGCTCCGCGTACTGGG	0.647																																																	0													26.0	29.0	28.0					17																	74134094		2203	4300	6503	SO:0001819	synonymous_variant	0			X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.606G>A	17.37:g.74134094C>T			O00630	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.A202	ENST00000322957.6	37	c.606	CCDS32739.1	17																																																																																			FOXJ1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129654		0.647	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ1	HGNC	protein_coding	OTTHUMT00000449856.1	-	0.00	66	0	C	NM_001454		74134094	-1	tier1	-	no_errors	ENST00000322957	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.653	T
FRAS1	80144	genome.wustl.edu	37	4	79460559	79460559	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:79460559G>A	ENST00000264895.6	+	73	11850	c.11410G>A	c.(11410-11412)Gat>Aat	p.D3804N		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3800					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GCCAGGTGTGGATGGATTTAC	0.403																																																	0													163.0	161.0	162.0					4																	79460559		1912	4124	6036	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11410G>A	4.37:g.79460559G>A	ENSP00000264895:p.Asp3804Asn		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.D3804N	ENST00000264895.6	37	c.11410	CCDS54771.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.368514|5.368514	0.95900|0.95900	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.67171|.	-0.25|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82912|0.82912	0.5140|0.5140	M|M	0.83384|0.83384	2.64|2.64	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.82847|0.82847	-0.0255|-0.0255	10|5	0.87932|.	D|.	0|.	.|.	20.2191|20.2191	0.98319|0.98319	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3804|.	E9PHH6|.	.|.	N|E	3804|2032	ENSP00000264895:D3804N|.	ENSP00000264895:D3804N|.	D|G	+|+	1|2	0|0	FRAS1|FRAS1	79679583|79679583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.753000|0.753000	0.42808|0.42808	9.662000|9.662000	0.98603|0.98603	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GAT|GGA	FRAS1	-	NULL	ENSG00000138759		0.403	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		-	0.00	33	0	G			79460559	+1	tier1	-	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	45.83	13	11	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39452315	39452315	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:39452315C>A	ENST00000280481.7	+	22	8932	c.8716C>A	c.(8716-8718)Ctg>Atg	p.L2906M		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2906					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGTCCAGAATCTGGGTGACTC	0.403																																																	0													228.0	196.0	207.0					13																	39452315		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8716C>A	13.37:g.39452315C>A	ENSP00000280481:p.Leu2906Met		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L2906M	ENST00000280481.7	37	c.8716	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589576	0.66105	.	.	ENSG00000150893	ENST00000280481	T	0.67345	-0.26	6.08	5.24	0.73138	.	0.000000	0.64402	D	0.000001	D	0.82595	0.5071	M	0.88842	2.985	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	D	0.84890	0.0836	10	0.87932	D	0	.	9.3161	0.37934	0.0:0.7423:0.0:0.2577	.	2906	Q5SZK8	FREM2_HUMAN	M	2906	ENSP00000280481:L2906M	ENSP00000280481:L2906M	L	+	1	2	FREM2	38350315	0.979000	0.34478	0.840000	0.33206	0.901000	0.52897	1.331000	0.33793	1.594000	0.50039	-0.218000	0.12543	CTG	FREM2	-	NULL	ENSG00000150893		0.403	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	54	0	C	NM_207361		39452315	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	5.13	73	4	SNP	1.000	A
FRMPD4	9758	genome.wustl.edu	37	X	12734448	12734448	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:12734448A>G	ENST00000380682.1	+	15	2376	c.1870A>G	c.(1870-1872)Agt>Ggt	p.S624G		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	624					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AGACTACAGAAGTCTAGCTCA	0.517																																																	0													82.0	83.0	83.0					X																	12734448		2203	4300	6503	SO:0001583	missense	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.1870A>G	X.37:g.12734448A>G	ENSP00000370057:p.Ser624Gly		A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_dom	p.S624G	ENST00000380682.1	37	c.1870	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	A	4.958	0.177993	0.09443	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.23348	1.91	5.86	2.13	0.27403	.	0.461374	0.27000	N	0.021431	T	0.10337	0.0253	N	0.04880	-0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24941	-1.0146	10	0.29301	T	0.29	.	5.9851	0.19430	0.6639:0.1385:0.1976:0.0	.	616;624	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	G	624;615;613	ENSP00000370057:S624G	ENSP00000304583:S613G	S	+	1	0	FRMPD4	12644369	0.672000	0.27530	0.126000	0.21872	0.717000	0.41224	0.808000	0.27154	0.305000	0.22832	0.486000	0.48141	AGT	FRMPD4	-	NULL	ENSG00000169933		0.517	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1		0.00	14	0	A	XM_045712		12734448	+1			no_errors	ENST00000380682	ensembl	human	known	74_37	missense	63.64	4	7	SNP	0.122	G
FSIP2	401024	genome.wustl.edu	37	2	186620970	186620970	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:186620970C>G	ENST00000424728.1	+	9	1043	c.1043C>G	c.(1042-1044)cCt>cGt	p.P348R	FSIP2_ENST00000343098.5_Missense_Mutation_p.P437R|FSIP2_ENST00000546113.1_Intron			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	348										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTAGTTTATCCTGCTGGAGAC	0.284																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1043C>G	2.37:g.186620970C>G	ENSP00000401306:p.Pro348Arg		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.P437R	ENST00000424728.1	37	c.1310		2	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142216	0.37825	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.49432	0.78;0.78	4.43	4.43	0.53597	.	1.628260	0.03499	N	0.217812	T	0.52075	0.1712	L	0.27053	0.805	0.09310	N	1	D	0.58268	0.982	P	0.52481	0.7	T	0.52366	-0.8585	10	0.56958	D	0.05	.	12.7231	0.57154	0.0:1.0:0.0:0.0	.	348	Q5CZC0	FSIP2_HUMAN	R	437;348;348	ENSP00000344403:P437R;ENSP00000401306:P348R	ENSP00000321903:P348R	P	+	2	0	FSIP2	186329215	0.001000	0.12720	0.008000	0.14137	0.276000	0.26787	0.465000	0.22004	2.453000	0.82957	0.650000	0.86243	CCT	FSIP2	-	NULL	ENSG00000188738		0.284	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	51	0	C	NM_173651		186620970	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	17.24	48	10	SNP	0.012	G
FTH1P3	2498	genome.wustl.edu	37	5	17354553	17354553	+	lincRNA	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:17354553G>A	ENST00000511821.1	+	0	412				FTH1P10_ENST00000401830.3_RNA																							AAGGAGAGGCGGCTGCGTTCG	0.687																																																	0																																												0																															5.37:g.17354553G>A				RNA	SNP	-	NULL	ENST00000511821.1	37	NULL		5																																																																																			FTH1P10	-	-	ENSG00000223361		0.687	CTD-2139B15.2-001	KNOWN	basic	lincRNA	FTH1P10	HGNC	lincRNA	OTTHUMT00000366261.1	-	0.00	61	0	G			17354553	-1	tier1	-	no_errors	ENST00000401830	ensembl	human	known	74_37	rna	31.58	51	24	SNP	0.006	A
FTO	79068	genome.wustl.edu	37	16	53967949	53967949	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr16:53967949G>C	ENST00000471389.1	+	8	1514	c.1292G>C	c.(1291-1293)aGg>aCg	p.R431T	FTO_ENST00000460382.1_Missense_Mutation_p.R32T|FTO_ENST00000394647.3_Missense_Mutation_p.R135T|FTO_ENST00000431610.2_Missense_Mutation_p.R32T|FTO_ENST00000463855.1_Missense_Mutation_p.R53T	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	431					adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)			endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GTGGAACAAAGGAATGAAATC	0.428																																																	0													97.0	83.0	88.0					16																	53967949		2198	4300	6498	SO:0001583	missense	0			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.1292G>C	16.37:g.53967949G>C	ENSP00000418823:p.Arg431Thr		A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	NULL	p.R431T	ENST00000471389.1	37	c.1292	CCDS32448.1	16	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235686	0.39498	.	.	ENSG00000140718	ENST00000471389;ENST00000394647;ENST00000431610;ENST00000460382;ENST00000476894;ENST00000463855	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.92	3.79	0.43588	Alpha-ketoglutarate-dependent dioxygenase FTO, C-terminal (1);	0.238909	0.40908	D	0.000981	T	0.37348	0.1000	L	0.47716	1.5	0.44508	D	0.997451	B	0.20164	0.042	B	0.28385	0.089	T	0.32025	-0.9922	10	0.56958	D	0.05	-1.5292	10.0685	0.42319	0.2:0.0:0.8:0.0	.	431	Q9C0B1	FTO_HUMAN	T	431;135;32;32;32;53	ENSP00000418823:R431T;ENSP00000378142:R135T;ENSP00000415636:R32T;ENSP00000417422:R32T;ENSP00000417843:R53T	ENSP00000378142:R135T	R	+	2	0	FTO	52525450	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.959000	0.40412	1.521000	0.48983	0.557000	0.71058	AGG	FTO	-	NULL	ENSG00000140718		0.428	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTO	HGNC	protein_coding	OTTHUMT00000352196.1	-	0.00	84	0	G	NM_001080432		53967949	+1	tier1	-	no_errors	ENST00000471389	ensembl	human	known	74_37	missense	51.61	30	32	SNP	1.000	C
GABRA6	2559	genome.wustl.edu	37	5	161115980	161115980	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:161115980G>A	ENST00000274545.5	+	4	684	c.251G>A	c.(250-252)cGc>cAc	p.R84H	GABRA6_ENST00000523217.1_Intron|GABRA6_ENST00000522269.1_3'UTR|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	84					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GTTTTTTTCCGCCAGACCTGG	0.403										TCGA Ovarian(5;0.080)																																							0													82.0	84.0	83.0					5																	161115980		2203	4299	6502	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.251G>A	5.37:g.161115980G>A	ENSP00000274545:p.Arg84His		A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R84H	ENST00000274545.5	37	c.251	CCDS4356.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.191597|5.191597	0.94923|0.94923	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000520000|ENST00000274545;ENST00000517823	.|T;T	.|0.80214	.|-1.35;-1.35	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90714|0.90714	0.7086|0.7086	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91048|0.91048	0.4876|0.4876	5|10	.|0.87932	.|D	.|0	.|.	20.0965|20.0965	0.97849|0.97849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|84	.|Q16445	.|GBRA6_HUMAN	T|H	24|84;31	.|ENSP00000274545:R84H;ENSP00000430212:R31H	.|ENSP00000274545:R84H	A|R	+|+	1|2	0|0	GABRA6|GABRA6	161048558|161048558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.695000|9.695000	0.98691|0.98691	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GCC|CGC	GABRA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000145863		0.403	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2		0.00	55	0	G			161115980	+1			no_errors	ENST00000274545	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	A
GABRB3	2562	genome.wustl.edu	37	15	26806324	26806324	+	Splice_Site	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr15:26806324C>A	ENST00000311550.5	-	8	947		c.e8-1		GABRB3_ENST00000541819.2_Splice_Site|GABRB3_ENST00000299267.4_Splice_Site|GABRB3_ENST00000545868.1_Splice_Site|GABRB3_ENST00000400188.3_Splice_Site	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3						cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTGTGATCCCTAGAAAAGAA	0.428																																																	0													144.0	136.0	138.0					15																	26806324		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.836-1G>T	15.37:g.26806324C>A			B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Splice_Site	SNP	-	e8-1	ENST00000311550.5	37	c.836-1	CCDS10019.1	15	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708832	0.68615	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0894	0.86618	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GABRB3	24357417	1.000000	0.71417	0.996000	0.52242	0.730000	0.41778	7.707000	0.84623	2.261000	0.74972	0.591000	0.81541	.	GABRB3	-	-	ENSG00000166206		0.428	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB3	HGNC	protein_coding	OTTHUMT00000251352.2		0.00	38	0	C		Intron	26806324	-1			no_errors	ENST00000299267	ensembl	human	known	74_37	splice_site	5.45	52	3	SNP	1.000	A
MTX1	4580	genome.wustl.edu	37	1	155185406	155185406	+	IGR	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:155185406A>T	ENST00000368376.3	+	0	1632				GBAP1_ENST00000486869.1_RNA|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCTAGCCGCACACTCTGCTC	0.577																																																	0																																										SO:0001628	intergenic_variant	0				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155185406A>T			B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	SNP	-	NULL	ENST00000368376.3	37	NULL	CCDS1100.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.975|9.975	1.226443|1.226443	0.22542|0.22542	.|.	.|.	ENSG00000160766|ENSG00000160766	ENST00000368374|ENST00000313929	.|.	.|.	.|.	3.34|3.34	3.34|3.34	0.38264|0.38264	.|.	0.422063|.	0.21531|.	U|.	0.073046|.	.|T	.|0.43433	.|0.1247	.|.	.|.	.|.	0.80722|.	A|.	1.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.48864	.|-0.8997	.|4	0.27785|0.66056	T|D	0.31|0.02	.|.	8.2594|8.2594	0.31775|0.31775	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|E	232|269	.|.	ENSP00000357358:C232X|ENSP00000316400:V269E	C|V	-|-	3|2	2|0	GBAP1|GBAP1	153452030|153452030	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.449000|0.449000	0.32228|0.32228	6.478000|6.478000	0.73596|0.73596	1.521000|1.521000	0.48983|0.48983	0.260000|0.260000	0.18958|0.18958	TGT|GTG	GBAP1	-	-	ENSG00000160766		0.577	MTX1-001	KNOWN	basic|CCDS	protein_coding	GBAP1	HGNC	protein_coding	OTTHUMT00000086844.1	-	0.00	65	0	A	NM_198883		155185406	-1	tier1	-	no_errors	ENST00000368374	ensembl	human	known	74_37	rna	9.59	66	7	SNP	1.000	T
GCFC2	6936	genome.wustl.edu	37	2	75921495	75921495	+	Missense_Mutation	SNP	G	G	C	rs533618591		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:75921495G>C	ENST00000321027.3	-	6	1025	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	GCFC2_ENST00000409857.3_Missense_Mutation_p.Q260E|GCFC2_ENST00000541687.1_3'UTR	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	298					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										TTGACATCTTGTACGTATTTT	0.303																																																	0													170.0	179.0	176.0					2																	75921495		2203	4300	6503	SO:0001583	missense	0			AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.892C>G	2.37:g.75921495G>C	ENSP00000318690:p.Gln298Glu		A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	pfam_GCFC_dom	p.Q298E	ENST00000321027.3	37	c.892	CCDS1961.1	2	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.210531	0.01555	.	.	ENSG00000005436	ENST00000321027;ENST00000409857	T;T	0.14391	2.51;2.56	5.29	-0.388	0.12459	.	0.821822	0.11274	N	0.581150	T	0.11707	0.0285	L	0.40543	1.245	0.33971	D	0.646856	B	0.06786	0.001	B	0.08055	0.003	T	0.36089	-0.9762	10	0.15499	T	0.54	-3.5129	14.493	0.67665	0.0:0.6657:0.2227:0.1115	.	298	P16383	GCF_HUMAN	E	298;260	ENSP00000318690:Q298E;ENSP00000386552:Q260E	ENSP00000318690:Q298E	Q	-	1	0	C2orf3	75775003	0.021000	0.18746	0.067000	0.19924	0.068000	0.16541	0.151000	0.16283	-0.314000	0.08716	0.655000	0.94253	CAA	GCFC2	-	NULL	ENSG00000005436		0.303	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC2	HGNC	protein_coding	OTTHUMT00000252255.2	-	0.00	72	0	G	NM_003203		75921495	-1	tier1	-	no_errors	ENST00000321027	ensembl	human	known	74_37	missense	10.53	85	10	SNP	0.018	C
TTC41P	253724	genome.wustl.edu	37	12	104283269	104283269	+	IGR	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:104283269C>T								RP11-650K20.3 (44827 upstream) : RP11-642P15.1 (24535 downstream)																							TGTTTGGTGGCGTTGCGGAAG	0.547																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.104283269C>T				RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.547					GNN	Clone_based_vega_gene			-	0.00	34	0	C			104283269	-1	tier1	-	no_errors	ENST00000548520	ensembl	human	known	74_37	rna	21.95	32	9	SNP	0.094	T
GRIA2	2891	genome.wustl.edu	37	4	158254480	158254480	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:158254480A>C	ENST00000264426.9	+	8	1409	c.1130A>C	c.(1129-1131)gAg>gCg	p.E377A	GRIA2_ENST00000449365.1_Missense_Mutation_p.E330A|GRIA2_ENST00000296526.7_Missense_Mutation_p.E377A|GRIA2_ENST00000393815.2_Missense_Mutation_p.E330A|GRIA2_ENST00000507898.1_Missense_Mutation_p.E330A	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	377					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E377V(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AACATCATGGAGCTCAAAACT	0.398																																																	1	Substitution - Missense(1)	ovary(1)											42.0	45.0	44.0					4																	158254480		2200	4294	6494	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1130A>C	4.37:g.158254480A>C	ENSP00000264426:p.Glu377Ala		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E377A	ENST00000264426.9	37	c.1130	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	A	18.97	3.736305	0.69189	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.42	5.42	0.78866	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90903	0.7141	M	0.78049	2.395	0.80722	D	1	P;D;D	0.89917	0.754;1.0;0.997	P;D;D	0.91635	0.53;0.999;0.995	D	0.92025	0.5629	10	0.72032	D	0.01	.	15.4581	0.75330	1.0:0.0:0.0:0.0	.	377;377;330	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	A	330;330;377;377;330	ENSP00000426845:E330A;ENSP00000377403:E330A;ENSP00000296526:E377A;ENSP00000264426:E377A;ENSP00000389837:E330A	ENSP00000264426:E377A	E	+	2	0	GRIA2	158473930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.049000	0.60858	0.528000	0.53228	GAG	GRIA2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000120251		0.398	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	-	0.00	98	0	A			158254480	+1	tier1	-	no_errors	ENST00000264426	ensembl	human	known	74_37	missense	37.33	47	28	SNP	1.000	C
HGD	3081	genome.wustl.edu	37	3	120365861	120365861	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:120365861C>T	ENST00000283871.5	-	8	967	c.508G>A	c.(508-510)Ggc>Agc	p.G170S		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	170					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		AGCATCTTGCCAAACTCGGTG	0.463																																																	0													181.0	157.0	165.0					3																	120365861		2203	4296	6499	SO:0001583	missense	0				CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.508G>A	3.37:g.120365861C>T	ENSP00000283871:p.Gly170Ser		A8K417|B2R8Z0	Missense_Mutation	SNP	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	p.G170S	ENST00000283871.5	37	c.508	CCDS3000.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.442776	0.96187	.	.	ENSG00000113924	ENST00000283871;ENST00000476082	D;D	0.99816	-6.91;-6.91	6.07	6.07	0.98685	Cupin, RmlC-type (1);	0.048871	0.85682	D	0.000000	D	0.99880	0.9943	H	0.94462	3.54	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.96887	0.9650	10	0.87932	D	0	-8.9247	18.1532	0.89682	0.0:1.0:0.0:0.0	.	170	Q93099	HGD_HUMAN	S	170;129	ENSP00000283871:G170S;ENSP00000419560:G129S	ENSP00000283871:G170S	G	-	1	0	HGD	121848551	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.022000	0.76431	2.885000	0.99019	0.655000	0.94253	GGC	HGD	-	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	ENSG00000113924		0.463	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGD	HGNC	protein_coding	OTTHUMT00000355410.1	-	0.00	38	0	C			120365861	-1	tier1	-	no_errors	ENST00000283871	ensembl	human	known	74_37	missense	26.32	56	20	SNP	1.000	T
HMGXB3	22993	genome.wustl.edu	37	5	149389760	149389760	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:149389760C>T	ENST00000502717.1	+	4	863	c.399C>T	c.(397-399)atC>atT	p.I133I	HMGXB3_ENST00000503427.1_Silent_p.I133I	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	379	Arg-rich.				phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						ATATCATCATCCCCAAGAGCA	0.547																																																	0													59.0	51.0	53.0					5																	149389760		692	1591	2283	SO:0001819	synonymous_variant	0			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.399C>T	5.37:g.149389760C>T			G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I133	ENST00000502717.1	37	c.399	CCDS54935.1	5																																																																																			HMGXB3	-	NULL	ENSG00000113716		0.547	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	-	0.00	44	0	C	XM_001717202		149389760	+1	tier1	-	no_errors	ENST00000502717	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
HK3	3101	genome.wustl.edu	37	5	176308099	176308099	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:176308099C>T	ENST00000292432.5	-	19	2838	c.2747G>A	c.(2746-2748)cGc>cAc	p.R916H		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	916	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGCGCAAGGCGGCAGGCAAC	0.667																																																	0													42.0	43.0	43.0					5																	176308099		2203	4300	6503	SO:0001583	missense	0				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2747G>A	5.37:g.176308099C>T	ENSP00000292432:p.Arg916His		Q8N1E7	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.R916H	ENST00000292432.5	37	c.2747	CCDS4407.1	5	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112651	0.56398	.	.	ENSG00000160883	ENST00000292432	D	0.97089	-4.24	5.22	5.22	0.72569	Hexokinase, C-terminal (1);	0.000000	0.50627	D	0.000114	D	0.98523	0.9507	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99023	1.0818	10	0.87932	D	0	-24.4099	14.1557	0.65417	0.0:1.0:0.0:0.0	.	916	P52790	HXK3_HUMAN	H	916	ENSP00000292432:R916H	ENSP00000292432:R916H	R	-	2	0	HK3	176240705	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	4.316000	0.59178	2.714000	0.92807	0.561000	0.74099	CGC	HK3	-	pfam_Hexokinase_C	ENSG00000160883		0.667	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	HGNC	protein_coding	OTTHUMT00000253428.1	-	0.00	48	0	C			176308099	-1	tier1	-	no_errors	ENST00000292432	ensembl	human	known	74_37	missense	57.69	22	30	SNP	1.000	T
HNRNPR	10236	genome.wustl.edu	37	1	23636857	23636857	+	3'UTR	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:23636857A>T	ENST00000374612.1	-	0	2115				HNRNPR_ENST00000427764.2_3'UTR|HNRNPR_ENST00000374616.3_3'UTR|HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000302271.6_3'UTR|HNRNPR_ENST00000478691.1_3'UTR|HNRNPR_ENST00000606561.1_3'UTR	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		CTACTTAAAGATGAAACAGTT	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.*90T>A	1.37:g.23636857A>T			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	RNA	SNP	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			HNRNPR	-	-	ENSG00000125944		0.328	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	-	0.00	37	0	A	NM_005826		23636857	-1	tier1	-	no_errors	ENST00000476660	ensembl	human	known	74_37	rna	38.46	24	15	SNP	1.000	T
HOXD12	3238	genome.wustl.edu	37	2	176964615	176964615	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:176964615T>C	ENST00000406506.2	+	1	158	c.86T>C	c.(85-87)cTg>cCg	p.L29P	HOXD12_ENST00000404162.2_Missense_Mutation_p.L29P			P35452	HXD12_HUMAN	homeobox D12	29					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		TTCTCCAACCTGAGGCCGAAT	0.662																																																	0													52.0	57.0	55.0					2																	176964615		1852	4072	5924	SO:0001583	missense	0				CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.86T>C	2.37:g.176964615T>C	ENSP00000385586:p.Leu29Pro		B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.L29P	ENST00000406506.2	37	c.86	CCDS46456.1	2	.	.	.	.	.	.	.	.	.	.	T	20.2	3.957634	0.73902	.	.	ENSG00000170178	ENST00000406506;ENST00000404162	T;T	0.49432	0.78;0.78	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.70736	0.3258	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75811	-0.3186	10	0.87932	D	0	.	13.9569	0.64155	0.0:0.0:0.0:1.0	.	29;29	B5MCD3;P35452	.;HXD12_HUMAN	P	29	ENSP00000385586:L29P;ENSP00000385132:L29P	ENSP00000385132:L29P	L	+	2	0	HOXD12	176672861	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.048000	0.76606	2.118000	0.64928	0.533000	0.62120	CTG	HOXD12	-	NULL	ENSG00000170178		0.662	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HOXD12	HGNC	protein_coding	OTTHUMT00000359253.2	-	0.00	27	0	T	NM_021193		176964615	+1	tier1	-	no_errors	ENST00000406506	ensembl	human	known	74_37	missense	23.08	10	3	SNP	1.000	C
IL22RA1	58985	genome.wustl.edu	37	1	24460793	24460793	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:24460793G>A	ENST00000270800.1	-	4	477	c.439C>T	c.(439-441)Cgt>Tgt	p.R147C		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	147	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TCGCCTGCACGGATTGGCGTG	0.532																																																	0													111.0	98.0	102.0					1																	24460793		2203	4300	6503	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.439C>T	1.37:g.24460793G>A	ENSP00000270800:p.Arg147Cys		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.R147C	ENST00000270800.1	37	c.439	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	G	3.578	-0.086198	0.07097	.	.	ENSG00000142677	ENST00000270800	T	0.47869	0.83	4.98	0.436	0.16549	Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	2.876910	0.00941	N	0.002826	T	0.31389	0.0795	N	0.14661	0.345	0.09310	N	1	D;P	0.53745	0.962;0.75	B;B	0.43838	0.433;0.206	T	0.22906	-1.0203	10	0.33940	T	0.23	-12.0866	2.8326	0.05505	0.339:0.0:0.4594:0.2016	.	39;147	B4E2V9;Q8N6P7	.;I22R1_HUMAN	C	147	ENSP00000270800:R147C	ENSP00000270800:R147C	R	-	1	0	IL22RA1	24333380	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.315000	0.19451	0.522000	0.28464	-0.258000	0.10820	CGT	IL22RA1	-	pfam_Interferon_alpha/beta_rcpt_bsu	ENSG00000142677		0.532	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	-	0.00	49	0	G			24460793	-1	tier1	-	no_errors	ENST00000270800	ensembl	human	novel	74_37	missense	36.21	37	21	SNP	0.000	A
ILK	3611	genome.wustl.edu	37	11	6631755	6631755	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:6631755C>T	ENST00000396751.2	+	12	1728	c.1272C>T	c.(1270-1272)ctC>ctT	p.L424L	ILK_ENST00000537806.1_Silent_p.L290L|RP11-732A19.2_ENST00000527398.1_RNA|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000420936.2_Silent_p.L424L|ILK_ENST00000528995.1_Silent_p.L363L|ILK_ENST00000299421.4_Silent_p.L424L	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	424	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TGTGTAAGCTCATGAAGATCT	0.478																																																	0													97.0	97.0	97.0					11																	6631755		2201	4296	6497	SO:0001819	synonymous_variant	0			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1272C>T	11.37:g.6631755C>T			B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Integrin-linked_kinase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L424	ENST00000396751.2	37	c.1272	CCDS7768.1	11																																																																																			ILK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Integrin-linked_kinase,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000166333		0.478	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ILK	HGNC	protein_coding	OTTHUMT00000384519.1	-	0.00	45	0	C	NM_004517		6631755	+1	tier1	-	no_errors	ENST00000299421	ensembl	human	known	74_37	silent	22.73	51	15	SNP	1.000	T
INPP5K	51763	genome.wustl.edu	37	17	1399635	1399635	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:1399635G>T	ENST00000421807.2	-	10	1551	c.1163C>A	c.(1162-1164)tCc>tAc	p.S388Y	INPP5K_ENST00000406424.4_Missense_Mutation_p.S312Y|INPP5K_ENST00000542125.1_Missense_Mutation_p.S292Y|INPP5K_ENST00000397335.3_Missense_Mutation_p.S296Y|INPP5K_ENST00000320345.6_Missense_Mutation_p.S312Y	NM_016532.3	NP_057616.2	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K	388	Required for ruffle localization.				actin cytoskeleton organization (GO:0030036)|cellular response to cAMP (GO:0071320)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hormone stimulus (GO:0032870)|cellular response to insulin stimulus (GO:0032869)|cellular response to tumor necrosis factor (GO:0071356)|dephosphorylation (GO:0016311)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inositol phosphate dephosphorylation (GO:0046855)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of dephosphorylation (GO:0035305)|negative regulation of glucose transport (GO:0010829)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of renal water transport (GO:2001153)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|protein targeting to plasma membrane (GO:0072661)|regulation of glycogen biosynthetic process (GO:0005979)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	inositol bisphosphate phosphatase activity (GO:0016312)|inositol trisphosphate phosphatase activity (GO:0046030)|inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|lipid phosphatase activity (GO:0042577)|phosphatidylinositol phosphate 5-phosphatase activity (GO:0034595)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)|vasopressin receptor activity (GO:0005000)			endometrium(1)|large_intestine(7)|lung(3)|skin(1)	12						GTCGCTGCAGGAGACCTTGCT	0.607																																																	0													90.0	59.0	70.0					17																	1399635		2196	4286	6482	SO:0001583	missense	0				CCDS11004.1, CCDS11005.1	17p13.3	2008-09-09			ENSG00000132376	ENSG00000132376			33882	protein-coding gene	gene with protein product	"""skeletal muscle and kidney enriched inositol phosphatase"""	607875				10753883, 12536145	Standard	NM_016532		Approved	SKIP	uc002fsr.3	Q9BT40	OTTHUMG00000150648	ENST00000421807.2:c.1163C>A	17.37:g.1399635G>T	ENSP00000413937:p.Ser388Tyr		B2R6I2|B2R750|D3DTH8|Q15733|Q9NPJ5|Q9P2R5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.S388Y	ENST00000421807.2	37	c.1163	CCDS11004.1	17	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764565	0.49574	.	.	ENSG00000132376	ENST00000421807;ENST00000406424;ENST00000350761;ENST00000320345;ENST00000397335;ENST00000542125	D;D;D;D	0.98090	-4.71;-4.71;-4.65;-4.61	5.66	4.56	0.56223	.	0.157765	0.64402	D	0.000017	D	0.98235	0.9416	M	0.81942	2.565	0.52099	D	0.999941	P;D	0.69078	0.893;0.997	P;D	0.65987	0.66;0.94	D	0.98327	1.0531	10	0.72032	D	0.01	-9.2083	9.4602	0.38781	0.1229:0.0:0.8771:0.0	.	292;388	F5GXZ0;Q9BT40	.;INP5K_HUMAN	Y	312;312;388;312;296;292	ENSP00000385177:S312Y;ENSP00000318476:S312Y;ENSP00000380496:S296Y;ENSP00000440147:S292Y	ENSP00000318476:S312Y	S	-	2	0	INPP5K	1346385	1.000000	0.71417	0.975000	0.42487	0.271000	0.26615	3.568000	0.53820	1.150000	0.42419	0.555000	0.69702	TCC	INPP5K	-	NULL	ENSG00000132376		0.607	INPP5K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5K	HGNC	protein_coding	OTTHUMT00000319381.4	-	0.00	64	0	G			1399635	-1	tier1	-	no_errors	ENST00000421807	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.995	T
IRS4	8471	genome.wustl.edu	37	X	107977530	107977530	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:107977530G>A	ENST00000372129.2	-	1	2121	c.2045C>T	c.(2044-2046)gCa>gTa	p.A682V	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	682	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						ACCTCGAGCTGCACCTTCTGG	0.507																																																	0													240.0	232.0	235.0					X																	107977530		2203	4300	6503	SO:0001583	missense	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2045C>T	X.37:g.107977530G>A	ENSP00000361202:p.Ala682Val			Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.A682V	ENST00000372129.2	37	c.2045	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353814	0.24512	.	.	ENSG00000133124	ENST00000372129	T	0.35421	1.31	5.22	4.33	0.51752	.	0.270103	0.28834	N	0.013990	T	0.28699	0.0711	L	0.51422	1.61	0.25797	N	0.98455	P	0.42456	0.78	B	0.34590	0.186	T	0.11108	-1.0601	10	0.26408	T	0.33	-4.7217	12.0565	0.53538	0.0:0.1705:0.8295:0.0	.	682	O14654	IRS4_HUMAN	V	682	ENSP00000361202:A682V	ENSP00000361202:A682V	A	-	2	0	IRS4	107864186	1.000000	0.71417	0.592000	0.28758	0.503000	0.33858	2.542000	0.45744	1.122000	0.41944	0.600000	0.82982	GCA	IRS4	-	NULL	ENSG00000133124		0.507	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	-	0.00	51	0	G	NM_003604		107977530	-1	tier1	-	no_errors	ENST00000372129	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.969	A
ITGB4	3691	genome.wustl.edu	37	17	73726332	73726332	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:73726332G>C	ENST00000200181.3	+	8	936	c.749G>C	c.(748-750)gGc>gCc	p.G250A	ITGB4_ENST00000339591.3_Missense_Mutation_p.G250A|ITGB4_ENST00000579662.1_Missense_Mutation_p.G250A|ITGB4_ENST00000449880.2_Missense_Mutation_p.G250A|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000450894.3_Missense_Mutation_p.G250A	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	250	VWFA.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGGACATTGGCTGGCGCCCG	0.667																																																	0													40.0	36.0	38.0					17																	73726332		2201	4286	6487	SO:0001583	missense	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.749G>C	17.37:g.73726332G>C	ENSP00000200181:p.Gly250Ala		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.G250A	ENST00000200181.3	37	c.749	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	13.00	2.104991	0.37145	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.96427	-4.01;-4.01;-4.01	5.29	5.29	0.74685	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	H	0.96301	3.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.991;0.998;1.0;1.0	D	0.99628	1.0985	10	0.87932	D	0	.	18.9193	0.92519	0.0:0.0:1.0:0.0	.	250;250;250;250	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	A	166;250;250;250	ENSP00000200181:G250A;ENSP00000344079:G250A;ENSP00000400217:G250A	ENSP00000200181:G250A	G	+	2	0	ITGB4	71237927	1.000000	0.71417	1.000000	0.80357	0.399000	0.30720	9.184000	0.94893	2.465000	0.83290	0.467000	0.42956	GGC	ITGB4	-	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000132470		0.667	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	-	0.00	63	0	G			73726332	+1	tier1	-	no_errors	ENST00000200181	ensembl	human	known	74_37	missense	13.33	78	12	SNP	1.000	C
KCNA4	3739	genome.wustl.edu	37	11	30034735	30034735	+	5'UTR	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:30034735G>A	ENST00000328224.6	-	0	724				KCNA4_ENST00000526518.1_5'UTR	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TCTAGTGATGGCTCGAACCAT	0.378																																																	0																																										SO:0001623	5_prime_UTR_variant	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.-510C>T	11.37:g.30034735G>A				RNA	SNP	-	NULL	ENST00000328224.6	37	NULL	CCDS41629.1	11																																																																																			KCNA4	-	-	ENSG00000182255		0.378	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	-	0.00	75	0	G	NM_002233		30034735	-1	tier1	-	no_errors	ENST00000526518	ensembl	human	putative	74_37	rna	5.88	64	4	SNP	0.002	A
KCNH7	90134	genome.wustl.edu	37	2	163302673	163302673	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:163302673A>G	ENST00000332142.5	-	7	1508	c.1409T>C	c.(1408-1410)tTc>tCc	p.F470S	KCNH7_ENST00000328032.4_Missense_Mutation_p.F463S	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	470					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.F470C(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TGTTGTTCTGAAGTTTATTAA	0.358																																					GBM(196;1492 2208 17507 24132 45496)												1	Substitution - Missense(1)	ovary(1)											99.0	92.0	94.0					2																	163302673		2203	4300	6503	SO:0001583	missense	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1409T>C	2.37:g.163302673A>G	ENSP00000331727:p.Phe470Ser		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.F470S	ENST00000332142.5	37	c.1409	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	A	23.9	4.474598	0.84640	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.96011	-3.88;-3.88	5.7	5.7	0.88788	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98308	0.9439	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.986;0.999	D	0.99544	1.0964	10	0.87932	D	0	.	15.9661	0.79970	1.0:0.0:0.0:0.0	.	463;470	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	S	470;463	ENSP00000331727:F470S;ENSP00000333781:F463S	ENSP00000333781:F463S	F	-	2	0	KCNH7	163010919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.182000	0.69389	0.528000	0.53228	TTC	KCNH7	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000184611		0.358	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1		0.00	28	0	A	NM_033272		163302673	-1			no_errors	ENST00000332142	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	G
KIAA0319	9856	genome.wustl.edu	37	6	24588968	24588968	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr6:24588968T>C	ENST00000378214.3	-	4	1371	c.847A>G	c.(847-849)Agc>Ggc	p.S283G	KIAA0319_ENST00000543707.1_Missense_Mutation_p.S283G|KIAA0319_ENST00000537886.1_Missense_Mutation_p.S283G|KIAA0319_ENST00000535378.1_Missense_Mutation_p.S274G|KIAA0319_ENST00000430948.2_Missense_Mutation_p.S238G	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	283					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GTGACTGAGCTGAGCTCCAGG	0.507																																																	0													122.0	103.0	109.0					6																	24588968		2203	4300	6503	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.847A>G	6.37:g.24588968T>C	ENSP00000367459:p.Ser283Gly		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.S283G	ENST00000378214.3	37	c.847	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	T	4.348	0.064088	0.08388	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.07800	3.16;3.17;3.17;3.17;3.17	4.3	4.3	0.51218	.	0.219163	0.32343	N	0.006222	T	0.02119	0.0066	L	0.36672	1.1	0.09310	N	1	B;B;B	0.24823	0.041;0.112;0.068	B;B;B	0.22601	0.04;0.04;0.018	T	0.38286	-0.9668	10	0.36615	T	0.2	-11.9033	5.0163	0.14337	0.1944:0.0:0.1736:0.632	.	283;274;283	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	G	283;274;238;283;283	ENSP00000439700:S283G;ENSP00000442403:S274G;ENSP00000401086:S238G;ENSP00000367459:S283G;ENSP00000437656:S283G	ENSP00000367459:S283G	S	-	1	0	KIAA0319	24696947	0.553000	0.26513	0.333000	0.25482	0.224000	0.24922	1.621000	0.36986	1.795000	0.52594	0.477000	0.44152	AGC	KIAA0319	-	NULL	ENSG00000137261		0.507	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	-	0.00	40	0	T	NM_014809		24588968	-1	tier1	-	no_errors	ENST00000378214	ensembl	human	known	74_37	missense	38.67	46	29	SNP	0.087	C
KIAA1731	85459	genome.wustl.edu	37	11	93416746	93416746	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:93416746G>C	ENST00000325212.6	+	8	949	c.787G>C	c.(787-789)Gaa>Caa	p.E263Q	KIAA1731_ENST00000411936.1_Missense_Mutation_p.E263Q|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	263						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACTAATGAAAGAACTCAAACA	0.388																																																	0													103.0	87.0	92.0					11																	93416746		692	1591	2283	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.787G>C	11.37:g.93416746G>C	ENSP00000316681:p.Glu263Gln		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.E263Q	ENST00000325212.6	37	c.787	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734159	0.89482	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.16196	2.36;2.36	5.45	5.45	0.79879	.	0.157818	0.29830	N	0.011097	T	0.41627	0.1167	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	T	0.15235	-1.0444	10	0.72032	D	0.01	-6.3097	19.6502	0.95798	0.0:0.0:1.0:0.0	.	263	Q9C0D2	K1731_HUMAN	Q	263	ENSP00000316681:E263Q;ENSP00000406505:E263Q	ENSP00000316681:E263Q	E	+	1	0	KIAA1731	93056394	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.435000	0.90297	2.714000	0.92807	0.650000	0.86243	GAA	KIAA1731	-	NULL	ENSG00000166004		0.388	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	-	0.00	33	0	G	NM_033395		93416746	+1	tier1	-	no_errors	ENST00000411936	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	C
KIRREL	55243	genome.wustl.edu	37	1	158063493	158063493	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:158063493C>T	ENST00000359209.6	+	13	1727	c.1660C>T	c.(1660-1662)Cgg>Tgg	p.R554W	KIRREL_ENST00000360089.4_Missense_Mutation_p.R390W|KIRREL_ENST00000368173.3_Missense_Mutation_p.R570W|KIRREL_ENST00000392272.2_Missense_Mutation_p.R451W|KIRREL_ENST00000368172.1_Missense_Mutation_p.R368W|KIRREL_ENST00000416935.2_Missense_Mutation_p.R454W			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	554					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.R554R(1)|p.R390R(1)|p.R570R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GCATTCTGACCGGGAGGATGA	0.607																																																	3	Substitution - coding silent(3)	endometrium(3)											101.0	84.0	90.0					1																	158063493		2203	4300	6503	SO:0001583	missense	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1660C>T	1.37:g.158063493C>T	ENSP00000352138:p.Arg554Trp		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R570W	ENST00000359209.6	37	c.1708	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851202	0.71719	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.70164	0.48;-0.46;0.15;-0.1;-0.01;0.33	5.5	5.5	0.81552	.	0.000000	0.39210	N	0.001438	T	0.72581	0.3478	L	0.59436	1.845	0.41253	D	0.986729	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;P;P	0.77557	0.974;0.99;0.586;0.586	T	0.76130	-0.3072	10	0.87932	D	0	-25.6875	11.9109	0.52739	0.1739:0.826:0.0:0.0	.	454;390;368;554	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	W	390;570;451;554;454;368	ENSP00000353202:R390W;ENSP00000357155:R570W;ENSP00000376098:R451W;ENSP00000352138:R554W;ENSP00000389674:R454W;ENSP00000357154:R368W	ENSP00000352138:R554W	R	+	1	2	KIRREL	156330117	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	0.825000	0.27393	2.588000	0.87417	0.491000	0.48974	CGG	KIRREL	-	NULL	ENSG00000183853		0.607	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	-	0.00	36	0	C	NM_018240		158063493	+1	tier1	-	no_errors	ENST00000368173	ensembl	human	known	74_37	missense	18.42	31	7	SNP	1.000	T
KLC1	3831	genome.wustl.edu	37	14	104123994	104123994	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:104123994G>A	ENST00000348520.6	+	3	692	c.373G>A	c.(373-375)Gcc>Acc	p.A125T	KLC1_ENST00000380038.3_Missense_Mutation_p.A125T|KLC1_ENST00000389744.4_Missense_Mutation_p.A125T|RP11-73M18.2_ENST00000472726.2_Missense_Mutation_p.A297T|KLC1_ENST00000347839.6_Missense_Mutation_p.A125T|KLC1_ENST00000553286.1_Missense_Mutation_p.A125T|KLC1_ENST00000554280.1_Missense_Mutation_p.A125T|KLC1_ENST00000452929.2_Missense_Mutation_p.A125T|KLC1_ENST00000246489.7_Missense_Mutation_p.A125T|KLC1_ENST00000334553.6_Missense_Mutation_p.A125T|KLC1_ENST00000555836.1_Missense_Mutation_p.A125T|KLC1_ENST00000445352.4_Missense_Mutation_p.A125T|KLC1_ENST00000557450.1_Missense_Mutation_p.A125T|KLC1_ENST00000557575.1_Missense_Mutation_p.A125T	NM_182923.3	NP_891553.2	Q07866	KLC1_HUMAN	kinesin light chain 1	125					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|stress granule disassembly (GO:0035617)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|growth cone (GO:0030426)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)|motor activity (GO:0003774)		KLC1/ALK(2)	NS(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	12		Melanoma(154;0.155)|all_epithelial(191;0.19)				GGATGAACTGGCCAACACGCA	0.493																																																	0													103.0	83.0	90.0					14																	104123994		2203	4300	6503	SO:0001583	missense	0			AF267530	CCDS32165.1, CCDS41996.1, CCDS45168.1	14q32.3	2013-01-10	2007-03-09	2007-03-09	ENSG00000126214	ENSG00000126214		"""Tetratricopeptide (TTC) repeat domain containing"""	6387	protein-coding gene	gene with protein product		600025	"""kinesin 2 60/70kDa"", ""kinesin 2"""	KNS2		8274221, 11106729	Standard	NM_005552		Approved	KNS2A, KLC, hKLC1S, hKLC1N, hKLC1P, hKLC1G, hKLC1R, hKLC1J, hKLC1B	uc010tyf.2	Q07866	OTTHUMG00000169227	ENST00000348520.6:c.373G>A	14.37:g.104123994G>A	ENSP00000341154:p.Ala125Thr		A6NF62|F8VTM4|Q7RTM2|Q7RTM3|Q7RTM5|Q7RTP9|Q7RTQ3|Q7RTQ5|Q7RTQ6|Q86SF5|Q86TF5|Q86V74|Q86V75|Q86V76|Q86V77|Q86V78|Q86V79|Q96H62	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.A125T	ENST00000348520.6	37	c.373	CCDS41996.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.700060	0.96802	.	.	ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000256500	ENST00000557172;ENST00000348520;ENST00000443396;ENST00000380038;ENST00000389744;ENST00000557575;ENST00000553286;ENST00000347839;ENST00000555836;ENST00000334553;ENST00000246489;ENST00000557450;ENST00000554280;ENST00000452929;ENST00000445352;ENST00000472726	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.49	5.49	0.81192	Rabaptin, GTPase-Rab5 binding (1);	0.000000	0.85682	D	0.000000	T	0.67202	0.2868	L	0.60067	1.865	0.80722	D	1	D;D;P;D;D	0.89917	1.0;0.966;0.786;0.999;0.996	D;P;P;D;D	0.91635	0.999;0.852;0.771;0.995;0.955	T	0.64888	-0.6301	10	0.46703	T	0.11	-11.1201	19.7433	0.96241	0.0:0.0:1.0:0.0	.	125;125;297;125;125	F8VTM4;F8W6L3;E7EVH7;Q07866;G5E9S8	.;.;.;KLC1_HUMAN;.	T	125;125;125;125;125;125;125;125;125;125;125;125;125;125;125;297	ENSP00000450786:A125T;ENSP00000341154:A125T;ENSP00000369377:A125T;ENSP00000374394:A125T;ENSP00000450617:A125T;ENSP00000452487:A125T;ENSP00000334618:A125T;ENSP00000452481:A125T;ENSP00000334523:A125T;ENSP00000246489:A125T;ENSP00000450648:A125T;ENSP00000451242:A125T;ENSP00000414982:A125T;ENSP00000412693:A125T;ENSP00000439065:A297T	ENSP00000246489:A125T	A	+	1	0	KLC1;RP11-73M18.2	103193747	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.813000	0.99286	2.733000	0.93635	0.655000	0.94253	GCC	KLC1	-	pfam_Rabaptin_Rab5-bd_dom,prints_Kinesin_light	ENSG00000126214		0.493	KLC1-001	KNOWN	basic|CCDS	protein_coding	KLC1	HGNC	protein_coding	OTTHUMT00000402947.2	-	0.00	54	0	G	NM_005552		104123994	+1	tier1	-	no_errors	ENST00000334553	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
KLHDC7A	127707	genome.wustl.edu	37	1	18809629	18809629	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:18809629C>T	ENST00000400664.1	+	1	2206	c.2154C>T	c.(2152-2154)tgC>tgT	p.C718C		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	718						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTCCAGTGCGCCGTGGTGG	0.657																																																	0													92.0	77.0	82.0					1																	18809629		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.2154C>T	1.37:g.18809629C>T			Q8N8W6	Silent	SNP	pfam_Kelch_1,smart_Kelch_1	p.C718	ENST00000400664.1	37	c.2154	CCDS185.2	1																																																																																			KLHDC7A	-	NULL	ENSG00000179023		0.657	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3		0.00	45	0	C	NM_152375		18809629	+1			no_errors	ENST00000400664	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.998	T
KMT2C	58508	genome.wustl.edu	37	7	151962134	151962134	+	Nonsense_Mutation	SNP	G	G	T	rs146238849		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:151962134G>T	ENST00000262189.6	-	8	1391	c.1173C>A	c.(1171-1173)tgC>tgA	p.C391*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C391*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	391					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C391*(2)									TGCAGTTCTGGCACACTTTGC	0.408																																																	2	Substitution - Nonsense(2)	NS(2)											230.0	213.0	219.0					7																	151962134		2203	4297	6500	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1173C>A	7.37:g.151962134G>T	ENSP00000262189:p.Cys391*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.C391*	ENST00000262189.6	37	c.1173	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.887843	0.98545	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	4.53	3.62	0.41486	.	0.000000	0.45867	U	0.000330	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2395	0.54534	0.0835:0.0:0.9165:0.0	.	.	.	.	X	391	.	ENSP00000262189:C391X	C	-	3	2	MLL3	151593067	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.718000	0.74713	2.206000	0.71126	0.460000	0.39030	TGC	KMT2C	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger	ENSG00000055609		0.408	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	145	0	G			151962134	-1	tier1	rs146238849	no_errors	ENST00000355193	ensembl	human	known	74_37	nonsense	7.14	117	9	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151962168	151962168	+	Missense_Mutation	SNP	C	C	A	rs138908625	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:151962168C>A	ENST00000262189.6	-	8	1357	c.1139G>T	c.(1138-1140)cGt>cTt	p.R380L	KMT2C_ENST00000355193.2_Missense_Mutation_p.R380L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	380					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R380L(4)									CCAACCTGCACGTTTTAATGG	0.443																																																	4	Substitution - Missense(4)	skin(4)						C	LEU/ARG	29,4377	25.3+/-52.1	0,29,2174	410.0	369.0	383.0		1139	4.7	1.0	7	dbSNP_134	383	15,8585	3.7+/-12.6	0,15,4285	no	missense	MLL3	NM_170606.2	102	0,44,6459	AA,AC,CC		0.1744,0.6582,0.3383	probably-damaging	380/4912	151962168	44,12962	2203	4300	6503	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1139G>T	7.37:g.151962168C>A	ENSP00000262189:p.Arg380Leu		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R380L	ENST00000262189.6	37	c.1139	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688003	0.48097	0.006582	0.001744	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98876	-5.2;-5.2	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38548	U	0.001645	D	0.98560	0.9519	M	0.74881	2.28	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	D	0.96263	0.9192	10	0.52906	T	0.07	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	380	Q8NEZ4	MLL3_HUMAN	L	380	ENSP00000262189:R380L;ENSP00000347325:R380L	ENSP00000262189:R380L	R	-	2	0	MLL3	151593101	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	6.039000	0.70972	2.271000	0.75665	0.557000	0.71058	CGT	KMT2C	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger,pfscan_Znf_RING	ENSG00000055609		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	183	0	C			151962168	-1	tier1	rs138908625	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	8.65	169	16	SNP	1.000	A
KNDC1	85442	genome.wustl.edu	37	10	135015007	135015007	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr10:135015007A>G	ENST00000304613.3	+	17	3013	c.2992A>G	c.(2992-2994)Aaa>Gaa	p.K998E	KNDC1_ENST00000368571.2_Missense_Mutation_p.K933E|KNDC1_ENST00000368572.2_Missense_Mutation_p.K1000E			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	998					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CTTTCAAGGAAAAGAGAAGCC	0.627																																																	0													51.0	63.0	59.0					10																	135015007		2203	4299	6502	SO:0001583	missense	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2992A>G	10.37:g.135015007A>G	ENSP00000304437:p.Lys998Glu		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.K1000E	ENST00000304613.3	37	c.2998	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	A	8.994	0.978368	0.18812	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.12984	2.63;2.63;2.63	4.24	3.09	0.35607	.	0.769026	0.11833	N	0.525011	T	0.14442	0.0349	L	0.57536	1.79	0.23550	N	0.997431	B;B;B	0.33044	0.154;0.395;0.073	B;B;B	0.35470	0.203;0.159;0.046	T	0.22977	-1.0201	10	0.31617	T	0.26	-13.6145	6.1044	0.20065	0.7845:0.0:0.2154:0.0	.	998;933;998	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	E	998;1000;933	ENSP00000304437:K998E;ENSP00000357561:K1000E;ENSP00000357560:K933E	ENSP00000304437:K998E	K	+	1	0	KNDC1	134864997	0.167000	0.22975	0.594000	0.28785	0.276000	0.26787	2.057000	0.41365	0.749000	0.32854	0.260000	0.18958	AAA	KNDC1	-	NULL	ENSG00000171798		0.627	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	-	0.00	51	0	A	NM_152643		135015007	+1	tier1	-	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.951	G
LIFR	3977	genome.wustl.edu	37	5	38490352	38490352	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:38490352C>A	ENST00000263409.4	-	15	2269	c.2107G>T	c.(2107-2109)Gga>Tga	p.G703*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.G703*|LIFR_ENST00000503088.1_5'Flank	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	703	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTTCTGCATCCATACAGGAAA	0.294			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													97.0	107.0	104.0					5																	38490352		2202	4296	6498	SO:0001587	stop_gained	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2107G>T	5.37:g.38490352C>A	ENSP00000263409:p.Gly703*		Q6LCD9	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G703*	ENST00000263409.4	37	c.2107	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.899966	0.98551	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	6.05	6.05	0.98169	.	0.262972	0.45126	D	0.000393	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.1781	15.3331	0.74229	0.1397:0.8603:0.0:0.0	.	.	.	.	X	703	.	ENSP00000263409:G703X	G	-	1	0	LIFR	38526109	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.869000	0.63028	2.878000	0.98634	0.650000	0.86243	GGA	LIFR	-	superfamily_Fibronectin_type3	ENSG00000113594		0.294	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	-	0.00	89	0	C	NM_002310		38490352	-1	tier1	-	no_errors	ENST00000263409	ensembl	human	known	74_37	nonsense	9.49	143	15	SNP	1.000	A
LINC00612	253128	genome.wustl.edu	37	12	9208308	9208308	+	RNA	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:9208308A>G	ENST00000538094.1	-	0	2086					NR_034140.1		Q8N6U2	CL033_HUMAN	long intergenic non-protein coding RNA 612																		TATAGACACAAGCCTCAAACA	0.418																																																	0																																												0			BC028195		12p13.31	2012-10-12	2012-05-30	2012-05-30	ENSG00000214851	ENSG00000214851		"""Long non-coding RNAs"""	28621	non-coding RNA	RNA, long non-coding			"""chromosome 12 open reading frame 33"""	C12orf33		12477932	Standard	NR_034140		Approved	MGC40170, FLJ41814	uc009zgh.2	Q8N6U2	OTTHUMG00000168288		12.37:g.9208308A>G			B3KW01	RNA	SNP	-	NULL	ENST00000538094.1	37	NULL		12																																																																																			LINC00612	-	-	ENSG00000214851		0.418	LINC00612-001	KNOWN	basic	processed_transcript	LINC00612	HGNC	processed_transcript	OTTHUMT00000399174.1	-	0.00	58	0	A	NR_034140		9208308	-1	tier1	-	no_errors	ENST00000538094	ensembl	human	known	74_37	rna	47.46	31	28	SNP	0.000	G
LLGL1	3996	genome.wustl.edu	37	17	18137986	18137986	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:18137986A>G	ENST00000316843.4	+	8	970	c.874A>G	c.(874-876)Aac>Gac	p.N292D		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	292					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					CAAGGCCATTAACAAGATTCT	0.587																																																	0													115.0	99.0	104.0					17																	18137986		2203	4300	6503	SO:0001583	missense	0				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.874A>G	17.37:g.18137986A>G	ENSP00000321537:p.Asn292Asp		A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.N292D	ENST00000316843.4	37	c.874	CCDS32586.1	17	.	.	.	.	.	.	.	.	.	.	A	31	5.072148	0.93950	.	.	ENSG00000131899	ENST00000316843	T	0.04862	3.54	5.61	5.61	0.85477	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.088789	0.85682	D	0.000000	T	0.13114	0.0318	L	0.57536	1.79	0.54753	D	0.999986	P	0.48834	0.916	P	0.49085	0.6	T	0.03249	-1.1056	10	0.32370	T	0.25	-35.6874	14.8227	0.70085	1.0:0.0:0.0:0.0	.	292	Q15334	L2GL1_HUMAN	D	292	ENSP00000321537:N292D	ENSP00000321537:N292D	N	+	1	0	LLGL1	18078711	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.343000	0.59348	2.156000	0.67533	0.524000	0.50904	AAC	LLGL1	-	pfam_LLGL2,superfamily_WD40_repeat_dom	ENSG00000131899		0.587	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLGL1	HGNC	protein_coding	OTTHUMT00000132067.3	-	0.00	74	0	A			18137986	+1	tier1	-	no_errors	ENST00000316843	ensembl	human	known	74_37	missense	29.07	61	25	SNP	1.000	G
LMTK3	114783	genome.wustl.edu	37	19	49002994	49002994	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:49002994C>T	ENST00000600059.1	-	11	1559	c.1332G>A	c.(1330-1332)ccG>ccA	p.P444P	LMTK3_ENST00000270238.3_Silent_p.P473P			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	444	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		AGAGGGTCCCCGGGCGGGGCG	0.736																																																	0													2.0	2.0	2.0					19																	49002994		1334	3128	4462	SO:0001819	synonymous_variant	0			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.1332G>A	19.37:g.49002994C>T			Q4G0U1	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P473	ENST00000600059.1	37	c.1419		19																																																																																			LMTK3	-	smart_Ser/Thr_dual-sp_kinase_dom	ENSG00000142235		0.736	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	LMTK3	HGNC	protein_coding	OTTHUMT00000466137.1		0.00	37	0	C	NM_052895		49002994	-1			no_errors	ENST00000270238	ensembl	human	known	74_37	silent	6.67	42	3	SNP	0.935	T
LOC100128317	100128317	genome.wustl.edu	37	7	81218218	81218218	+	lincRNA	SNP	A	A	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:81218218A>C	ENST00000413944.2	-	0	694																											TAATCTAACAACATCACTTAT	0.338																																																	0																																												0																															7.37:g.81218218A>C				RNA	SNP	-	NULL	ENST00000413944.2	37	NULL		7																																																																																			AC010091.1	-	-	ENSG00000233491		0.338	AC010091.1-002	KNOWN	basic	lincRNA	LOC100128317	Clone_based_vega_gene	lincRNA	OTTHUMT00000339912.2	-	0.00	38	0	A			81218218	-1	tier1	-	no_errors	ENST00000413944	ensembl	human	known	74_37	rna	17.54	47	10	SNP	0.787	C
BZW1	9689	genome.wustl.edu	37	2	201676577	201676577	+	5'UTR	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:201676577C>T	ENST00000409600.1	+	0	309				BZW1_ENST00000452790.2_5'Flank|BZW1_ENST00000409226.1_5'Flank|AC007163.6_ENST00000447972.3_RNA	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						GGGAAGAAATCTCGCGATAGG	0.647																																																	0																																										SO:0001623	5_prime_UTR_variant	0			D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.-147C>T	2.37:g.201676577C>T			B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	RNA	SNP	-	NULL	ENST00000409600.1	37	NULL	CCDS56156.1	2																																																																																			AC007163.6	-	-	ENSG00000230408		0.647	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927795	Clone_based_vega_gene	protein_coding	OTTHUMT00000335975.1	-	0.00	59	0	C	NM_014670		201676577	-1	tier1	-	no_errors	ENST00000447972	ensembl	human	known	74_37	rna	15.62	54	10	SNP	0.998	T
LOC100287934	100287934	genome.wustl.edu	37	1	745347	745347	+	RNA	SNP	T	T	C	rs373594198		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:745347T>C	ENST00000435300.1	-	0	804				RP11-206L10.8_ENST00000447500.1_RNA																							GTTATTTACATATTTGTATCA	0.299																																																	0																																												0																															1.37:g.745347T>C				RNA	SNP	-	NULL	ENST00000435300.1	37	NULL		1																																																																																			RP11-206L10.9	-	-	ENSG00000237491		0.299	RP11-206L10.10-001	KNOWN	basic	processed_transcript	LOC101930657	Clone_based_vega_gene	processed_transcript	OTTHUMT00000007014.1	-	0.00	25	0	T			745347	+1	tier1	-	no_errors	ENST00000412115	ensembl	human	known	74_37	rna	23.68	29	9	SNP	0.005	C
FAR2P1	440905	genome.wustl.edu	37	2	130808123	130808124	+	RNA	INS	-	-	CT	rs550426101|rs200739541|rs374920497	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:130808123_130808124insCT	ENST00000325390.3	-	0	580_581					NR_026758.1																						ACCCCTAACCCGAGCTAGGGAT	0.515														1516	0.302716	0.0772	0.4323	5008	,	,		12798	0.3978		0.3539	False		,,,				2504	0.365																0																																												0																															2.37:g.130808123_130808124insCT				RNA	INS	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			AC018865.8	-	-	ENSG00000180178		0.515	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	Clone_based_vega_gene	pseudogene	OTTHUMT00000331630.3		0.00	12	0	-			130808124	-1	tier1		no_errors	ENST00000325390	ensembl	human	known	74_37	rna	28.57	5	2	INS	0.180:0.170	CT
LRRIQ1	84125	genome.wustl.edu	37	12	85492759	85492759	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:85492759A>T	ENST00000393217.2	+	13	3257	c.3196A>T	c.(3196-3198)Atc>Ttc	p.I1066F		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1066										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAATATTACTATCTCTCAAAA	0.289																																																	0													70.0	71.0	70.0					12																	85492759		2203	4295	6498	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3196A>T	12.37:g.85492759A>T	ENSP00000376910:p.Ile1066Phe		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.I1066F	ENST00000393217.2	37	c.3196	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	3.429	-0.116461	0.06838	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.60797	0.16	5.39	-10.8	0.00216	.	0.650315	0.14654	N	0.306411	T	0.46367	0.1389	L	0.43554	1.36	0.09310	N	1	B;B	0.30455	0.28;0.188	B;B	0.33799	0.049;0.17	T	0.54351	-0.8307	10	0.40728	T	0.16	.	18.8974	0.92429	0.0896:0.7625:0.1478:0.0	.	1066;1041	Q96JM4;C9JI57	LRIQ1_HUMAN;.	F	1066;1041;1066	ENSP00000376910:I1066F	ENSP00000256007:I1066F	I	+	1	0	LRRIQ1	84016890	0.000000	0.05858	0.001000	0.08648	0.245000	0.25701	-2.349000	0.01093	-4.098000	0.00074	-3.811000	0.00019	ATC	LRRIQ1	-	NULL	ENSG00000133640		0.289	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	34	0	A	NM_032165		85492759	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	12.90	54	8	SNP	0.000	T
LTBP1	4052	genome.wustl.edu	37	2	33413734	33413734	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:33413734C>A	ENST00000404816.2	+	7	1870	c.1517C>A	c.(1516-1518)cCa>cAa	p.P506Q	LTBP1_ENST00000407925.1_Missense_Mutation_p.P180Q|LTBP1_ENST00000418533.2_Missense_Mutation_p.P180Q|LTBP1_ENST00000354476.3_Missense_Mutation_p.P506Q|LTBP1_ENST00000402934.1_Missense_Mutation_p.P180Q|LTBP1_ENST00000404525.1_Missense_Mutation_p.P180Q|LTBP1_ENST00000390003.4_Missense_Mutation_p.P180Q			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	506					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ATTGATGGCCCAACAGGCCAG	0.463																																																	0													105.0	98.0	100.0					2																	33413734		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1517C>A	2.37:g.33413734C>A	ENSP00000386043:p.Pro506Gln		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P506Q	ENST00000404816.2	37	c.1517	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006042	0.74932	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	T;T;T;T;T;T;T	0.79653	-1.29;-1.28;-1.24;-1.19;-1.23;-1.21;-1.2	5.69	5.69	0.88448	.	.	.	.	.	T	0.75882	0.3910	L	0.34521	1.04	0.80722	D	1	B;P;B;B;P;P	0.48089	0.411;0.716;0.007;0.404;0.905;0.547	B;B;B;B;P;B	0.44518	0.192;0.203;0.004;0.249;0.452;0.353	T	0.71932	-0.4443	9	0.18276	T	0.48	.	19.889	0.96921	0.0:1.0:0.0:0.0	.	506;180;180;180;180;506	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	Q	506;506;195;180;180;180;180;180	ENSP00000386043:P506Q;ENSP00000346467:P506Q;ENSP00000374653:P180Q;ENSP00000393057:P180Q;ENSP00000384373:P180Q;ENSP00000385359:P180Q;ENSP00000384091:P180Q	ENSP00000346467:P506Q	P	+	2	0	LTBP1	33267238	0.996000	0.38824	0.934000	0.37439	0.959000	0.62525	5.464000	0.66719	2.719000	0.93026	0.556000	0.70494	CCA	LTBP1	-	NULL	ENSG00000049323		0.463	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	45	0	C	NM_206943		33413734	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	38.00	31	19	SNP	0.971	A
MALAT1	378938	genome.wustl.edu	37	11	65271488	65271488	+	lincRNA	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:65271488G>C	ENST00000534336.1	+	0	6256					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TCCAAAGTTTGCATGTTAACT	0.353																																																	0													29.0	31.0	30.0					11																	65271488		874	1987	2861			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271488G>C				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.353	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	31	0	G	NR_002819		65271488	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	44.44	15	12	SNP	1.000	C
MASP1	5648	genome.wustl.edu	37	3	186953887	186953887	+	Intron	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:186953887G>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000392472.2_Missense_Mutation_p.A478D|MASP1_ENST00000296280.6_Missense_Mutation_p.A591D|MASP1_ENST00000495249.1_5'UTR	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GCCCCAGCCGGCCACCAGGCC	0.617																																																	0													58.0	61.0	60.0					3																	186953887		2203	4300	6503	SO:0001627	intron_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5381C>A	3.37:g.186953887G>T			A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.A591D	ENST00000337774.5	37	c.1772	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039351	0.93630	.	.	ENSG00000127241	ENST00000296280;ENST00000392472	D;D	0.93906	-3.31;-3.31	6.17	6.17	0.99709	.	0.309199	0.38897	N	0.001538	D	0.96710	0.8926	M	0.79926	2.475	0.80722	D	1	D;D	0.59767	0.975;0.986	P;D	0.63957	0.837;0.92	D	0.96476	0.9352	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	478;591	P48740-4;P48740-2	.;.	D	591;478	ENSP00000296280:A591D;ENSP00000376264:A478D	ENSP00000296280:A591D	A	-	2	0	MASP1	188436581	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	6.731000	0.74785	2.941000	0.99782	0.655000	0.94253	GCC	MASP1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000127241		0.617	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	-	0.00	21	0	G	NM_001879		186953887	-1	tier1	-	no_errors	ENST00000296280	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
MT-CO1	4512	genome.wustl.edu	37	M	2928	2928	+	5'Flank	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrM:2928C>T	ENST00000361624.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-ND1_ENST00000361390.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GGAACAAGTTACCCTAGGGAT	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2928C>T	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.463	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	119	0	C	YP_003024028		2928	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	82.95	37	180	SNP	NULL	T
MTIF2	4528	genome.wustl.edu	37	2	55490859	55490859	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:55490859C>T	ENST00000263629.4	-	4	451	c.136G>A	c.(136-138)Gct>Act	p.A46T	MTIF2_ENST00000394600.3_Missense_Mutation_p.A46T|MTIF2_ENST00000446660.1_5'UTR|MTIF2_ENST00000403721.1_Missense_Mutation_p.A46T	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	46					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CACAGTTGAGCTGTCCACACA	0.453																																																	0													161.0	138.0	146.0					2																	55490859		2203	4300	6503	SO:0001583	missense	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.136G>A	2.37:g.55490859C>T	ENSP00000263629:p.Ala46Thr		D6W5D0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,superfamily_TIF_IF2_dom3,superfamily_Transl_B-barrel,tigrfam_Small_GTP-bd_dom	p.A46T	ENST00000263629.4	37	c.136	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014143	0.35511	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000535023;ENST00000366137;ENST00000441307;ENST00000404297	T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.81;0.81;0.81	5.18	3.38	0.38709	.	0.414276	0.23696	N	0.045473	T	0.43590	0.1254	L	0.50333	1.59	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.33445	-0.9868	10	0.39692	T	0.17	-2.6354	8.5319	0.33340	0.0:0.7315:0.1264:0.1421	.	46	P46199	IF2M_HUMAN	T	46	ENSP00000384481:A46T;ENSP00000263629:A46T;ENSP00000378099:A46T;ENSP00000393337:A46T;ENSP00000388640:A46T;ENSP00000383880:A46T	ENSP00000263629:A46T	A	-	1	0	MTIF2	55344363	0.004000	0.15560	0.003000	0.11579	0.193000	0.23685	0.234000	0.17930	0.689000	0.31550	0.555000	0.69702	GCT	MTIF2	-	NULL	ENSG00000085760		0.453	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	-	0.00	51	0	C	NM_002453		55490859	-1	tier1	-	no_errors	ENST00000263629	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.004	T
MUC12	10071	genome.wustl.edu	37	7	100644340	100644340	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:100644340G>A	ENST00000379442.3	+	5	10925	c.10925G>A	c.(10924-10926)gGc>gAc	p.G3642D	MUC12_ENST00000536621.1_Missense_Mutation_p.G3499D			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3642	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGCCGACCAGGCTCAACGCAC	0.582																																																	0													12.0	14.0	13.0					7																	100644340		356	883	1239	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.10925G>A	7.37:g.100644340G>A	ENSP00000368755:p.Gly3642Asp		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.G3499D	ENST00000379442.3	37	c.10496		7	.	.	.	.	.	.	.	.	.	.	g	0.956	-0.704871	0.03255	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.16457	2.35;2.34	0.849	-1.7	0.08159	.	.	.	.	.	T	0.05547	0.0146	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.39623	-0.9605	7	0.12766	T	0.61	.	2.359	0.04302	0.2722:0.3279:0.3999:0.0	.	.	.	.	D	3642;3499	ENSP00000368755:G3642D;ENSP00000441929:G3499D	ENSP00000368755:G3642D	G	+	2	0	MUC12	100431060	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.322000	0.08007	-0.713000	0.04981	-0.547000	0.04224	GGC	MUC12	-	NULL	ENSG00000205277		0.582	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	107	0	G	XM_379904		100644340	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	18.27	85	19	SNP	0.001	A
MUC19	283463	genome.wustl.edu	37	12	40919410	40919410	+	3'UTR	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:40919410C>T	ENST00000474954.1	+	0	2108				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TAACAAGAGCCGAAGTAATCA	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*2105C>T	12.37:g.40919410C>T			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.363	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	86	0	C	XM_003403524		40919410	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	41.90	59	44	SNP	0.000	T
MYBPC3	4607	genome.wustl.edu	37	11	47362785	47362785	+	Silent	SNP	G	G	A	rs397515926		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:47362785G>A	ENST00000545968.1	-	19	1855	c.1801C>T	c.(1801-1803)Ctg>Ttg	p.L601L	MYBPC3_ENST00000256993.4_Silent_p.L600L|MYBPC3_ENST00000399249.2_Silent_p.L601L	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	601	Ig-like C2-type 4.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		TCAATGGTCAGTTTGTGGACC	0.637																																																	0													28.0	30.0	29.0					11																	47362785		1986	4161	6147	SO:0001819	synonymous_variant	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.1801C>T	11.37:g.47362785G>A			A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L601	ENST00000545968.1	37	c.1801	CCDS53621.1	11																																																																																			MYBPC3	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000134571		0.637	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	-	0.00	37	0	G			47362785	-1	tier1	-	no_errors	ENST00000399249	ensembl	human	known	74_37	silent	28.57	25	10	SNP	1.000	A
MYT1	4661	genome.wustl.edu	37	20	62871250	62871250	+	Silent	SNP	G	G	A	rs149774713		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:62871250G>A	ENST00000328439.1	+	22	3595	c.3231G>A	c.(3229-3231)ccG>ccA	p.P1077P	MYT1_ENST00000536311.1_Silent_p.P1104P	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TCCGCCTTCCGCACATGGTAG	0.622																																					GBM(59;481 1041 20555 21139 33705)												0								G		1,4405	2.1+/-5.4	0,1,2202	88.0	93.0	92.0		3231	-11.6	0.1	20	dbSNP_134	92	0,8600		0,0,4300	no	coding-synonymous	MYT1	NM_004535.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1077/1122	62871250	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.3231G>A	20.37:g.62871250G>A			B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.P1104	ENST00000328439.1	37	c.3312	CCDS13558.1	20																																																																																			MYT1	-	NULL	ENSG00000196132		0.622	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	-	0.00	68	0	G	NM_004535		62871250	+1	tier1	rs149774713	no_errors	ENST00000536311	ensembl	human	known	74_37	silent	10.17	53	6	SNP	0.018	A
NAV3	89795	genome.wustl.edu	37	12	78392116	78392116	+	Splice_Site	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:78392116G>T	ENST00000397909.2	+	7	913		c.e7-1		NAV3_ENST00000266692.7_Splice_Site|NAV3_ENST00000228327.6_Splice_Site|NAV3_ENST00000536525.2_Splice_Site			Q8IVL0	NAV3_HUMAN	neuron navigator 3							membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TACTATTTCAGGCTTCCAGGG	0.408										HNSCC(70;0.22)																																							0													35.0	33.0	34.0					12																	78392116		1818	4082	5900	SO:0001630	splice_region_variant	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.741-1G>T	12.37:g.78392116G>T			Q8NFW7|Q9Y2E7	Splice_Site	SNP	-	e7-1	ENST00000397909.2	37	c.741-1		12	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520397	0.85495	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000550503	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5543	0.95335	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAV3	76916247	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.221000	0.95188	2.617000	0.88574	0.655000	0.94253	.	NAV3	-	-	ENSG00000067798		0.408	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	27	0	G	NM_001024383	Intron	78392116	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	splice_site	42.42	19	14	SNP	1.000	T
NCL	4691	genome.wustl.edu	37	2	232320317	232320317	+	Silent	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:232320317G>A	ENST00000322723.4	-	13	2091	c.1851C>T	c.(1849-1851)ttC>ttT	p.F617F	SNORA75_ENST00000384158.1_RNA|SNORD20_ENST00000384550.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	617	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.F617F(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCTCACTGTTGAAGTCTACAA	0.448																																																	1	Substitution - coding silent(1)	ovary(1)											152.0	162.0	158.0					2																	232320317		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.1851C>T	2.37:g.232320317G>A			Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.F617	ENST00000322723.4	37	c.1851	CCDS33397.1	2																																																																																			NCL	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000115053		0.448	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCL	HGNC	protein_coding	OTTHUMT00000332731.1		0.00	20	0	G	NM_005381		232320317	-1			no_errors	ENST00000322723	ensembl	human	known	74_37	silent	8.33	22	2	SNP	1.000	A
NCOA6	23054	genome.wustl.edu	37	20	33330742	33330742	+	Silent	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:33330742T>C	ENST00000374796.2	-	12	5888	c.3318A>G	c.(3316-3318)ggA>ggG	p.G1106G	NCOA6_ENST00000359003.2_Silent_p.G1106G			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1106	NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TTGAATTGCTTCCCAAGGGAG	0.542																																																	0													91.0	92.0	92.0					20																	33330742		2203	4300	6503	SO:0001819	synonymous_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3318A>G	20.37:g.33330742T>C			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NULL	p.G1106	ENST00000374796.2	37	c.3318	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.542	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	-	0.00	50	0	T	NM_014071		33330742	-1	tier1	-	no_errors	ENST00000359003	ensembl	human	known	74_37	silent	5.97	63	4	SNP	1.000	C
NDST1	3340	genome.wustl.edu	37	5	149900924	149900924	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:149900924C>T	ENST00000261797.6	+	2	610	c.108C>T	c.(106-108)taC>taT	p.Y36Y	NDST1_ENST00000523767.1_Silent_p.Y36Y	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	36					carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCGGCCTACTACCTATATG	0.662																																																	0													129.0	119.0	122.0					5																	149900924		2203	4300	6503	SO:0001819	synonymous_variant	0			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.108C>T	5.37:g.149900924C>T			Q96E57	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.Y36	ENST00000261797.6	37	c.108	CCDS34277.1	5																																																																																			NDST1	-	pfam_Heparan_SO4_deacetylase	ENSG00000070614		0.662	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST1	HGNC	protein_coding	OTTHUMT00000374314.2	-	0.00	51	0	C	NM_001543		149900924	+1	tier1	-	no_errors	ENST00000261797	ensembl	human	known	74_37	silent	30.36	39	17	SNP	1.000	T
NPM1	4869	genome.wustl.edu	37	5	170817096	170817096	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:170817096G>C	ENST00000296930.5	+	2	401	c.100G>C	c.(100-102)Gat>Cat	p.D34H	NPM1_ENST00000517671.1_Missense_Mutation_p.D34H|NPM1_ENST00000351986.6_Missense_Mutation_p.D34H|NPM1_ENST00000393820.2_Missense_Mutation_p.D34H	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	34	Necessary for interaction with APEX1.|Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTAAGGTGGATAATGATGA	0.318			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																			Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	0													74.0	73.0	74.0					5																	170817096		2203	4299	6502	SO:0001583	missense	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.100G>C	5.37:g.170817096G>C	ENSP00000296930:p.Asp34His		A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	superfamily_Nucleoplasmin_core_dom	p.D34H	ENST00000296930.5	37	c.100	CCDS4376.1	5	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690029	0.68271	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000351986;ENST00000393820;ENST00000523622	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	4.74	3.86	0.44501	Nucleoplasmin core (2);	0.131424	0.50627	U	0.000108	T	0.66577	0.2803	M	0.91920	3.255	0.33455	D	0.584246	D;D;D	0.57899	0.978;0.98;0.981	P;P;P	0.56474	0.776;0.74;0.799	T	0.78831	-0.2049	10	0.87932	D	0	.	8.6163	0.33833	0.0858:0.1565:0.7577:0.0	.	34;34;34	P06748-2;P06748;Q9BYG9	.;NPM_HUMAN;.	H	34;34;34;34;26	ENSP00000428755:D34H;ENSP00000296930:D34H;ENSP00000341168:D34H;ENSP00000377408:D34H;ENSP00000428647:D26H	ENSP00000296930:D34H	D	+	1	0	NPM1	170749701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.424000	0.52764	1.092000	0.41356	0.655000	0.94253	GAT	NPM1	-	superfamily_Nucleoplasmin_core_dom	ENSG00000181163		0.318	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	HGNC	protein_coding	OTTHUMT00000252858.2	-	0.00	82	0	G	NM_002520		170817096	+1	tier1	-	no_errors	ENST00000296930	ensembl	human	known	74_37	missense	19.23	41	10	SNP	1.000	C
NRXN3	9369	genome.wustl.edu	37	14	80158529	80158529	+	Intron	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:80158529T>C	ENST00000557594.1	+	4	1554				NRXN3_ENST00000281127.7_Intron|RP11-242P2.1_ENST00000553322.1_RNA|NRXN3_ENST00000428277.2_Silent_p.N205N|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000556003.1_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ACACTGATAATGAACGCTTCC	0.328																																																	0													58.0	55.0	56.0					14																	80158529		1803	4074	5877	SO:0001627	intron_variant	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.602-5444T>C	14.37:g.80158529T>C			A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.N1199	ENST00000557594.1	37	c.3597		14																																																																																			NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.328	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	39	0	T	NM_001105250		80158529	+1	tier1	-	no_errors	ENST00000554738	ensembl	human	known	74_37	silent	50.00	11	11	SNP	1.000	C
NUDT16	131870	genome.wustl.edu	37	3	131102146	131102146	+	Silent	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:131102146T>C	ENST00000521288.1	+	3	580	c.549T>C	c.(547-549)tcT>tcC	p.S183S	NUDT16_ENST00000502852.1_3'UTR|NUDT16_ENST00000359850.3_Silent_p.S150S|RP11-933H2.4_ENST00000502521.1_RNA|NUDT16_ENST00000537561.1_Intron			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	183					adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)			large_intestine(1)|lung(6)	7						TGCTGCAGTCTGGCTCTATTT	0.537																																																	0													87.0	77.0	80.0					3																	131102146		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.549T>C	3.37:g.131102146T>C			B4E3B4|E9PED4|F5GYJ1|Q96N82	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.S183	ENST00000521288.1	37	c.549	CCDS3070.2	3																																																																																			NUDT16	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000198585		0.537	NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT16	HGNC	protein_coding	OTTHUMT00000356537.9	-	0.00	40	0	T	NM_152395		131102146	+1	tier1	-	no_errors	ENST00000521288	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.378	C
NUPR1	26471	genome.wustl.edu	37	16	28549406	28549406	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr16:28549406C>T	ENST00000324873.6	-	2	449	c.183G>A	c.(181-183)ggG>ggA	p.G61G	NUPR1_ENST00000395641.2_Silent_p.G79G	NM_001042483.1|NM_012385.2	NP_001035948.1|NP_036517.1	O60356	NUPR1_HUMAN	nuclear protein, transcriptional regulator, 1	61					acute inflammatory response (GO:0002526)|cell growth (GO:0016049)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male gonad development (GO:0008584)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein modification process (GO:0031401)|protein acetylation (GO:0006473)|protein complex assembly (GO:0006461)|regulation of female gonad development (GO:2000194)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(1)	3						TCCTCTCGTGCCCGCCAGGGC	0.622																																																	0													120.0	136.0	130.0					16																	28549406		2197	4300	6497	SO:0001819	synonymous_variant	0			AF069073	CCDS10634.1, CCDS42137.1	16p11.2	2012-07-04	2012-07-04		ENSG00000176046	ENSG00000176046			29990	protein-coding gene	gene with protein product	"""candidate of metastasis 1"""	614812				9405444, 10493524, 10092851	Standard	NM_012385		Approved	COM1, p8	uc002dqd.1	O60356	OTTHUMG00000131764	ENST00000324873.6:c.183G>A	16.37:g.28549406C>T			B2R5C4|O60357|Q6FGG3	Silent	SNP	pfam_Nuclear_phosphoprot_p8_DNA-bd	p.G61	ENST00000324873.6	37	c.183	CCDS10634.1	16																																																																																			NUPR1	-	pfam_Nuclear_phosphoprot_p8_DNA-bd	ENSG00000176046		0.622	NUPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPR1	HGNC	protein_coding	OTTHUMT00000254692.2	-	0.00	31	0	C	NM_012385		28549406	-1	tier1	-	no_errors	ENST00000324873	ensembl	human	known	74_37	silent	12.20	36	5	SNP	1.000	T
OR5AR1	219493	genome.wustl.edu	37	11	56431333	56431333	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:56431333C>T	ENST00000302969.2	+	1	196	c.172C>T	c.(172-174)Ccc>Tcc	p.P58S		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GCTTCACACACCCATGTATTT	0.448																																																	0													288.0	284.0	285.0					11																	56431333		2201	4296	6497	SO:0001583	missense	0			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.172C>T	11.37:g.56431333C>T	ENSP00000302639:p.Pro58Ser		Q6IF61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P58S	ENST00000302969.2	37	c.172	CCDS31535.1	11	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460246	0.84317	.	.	ENSG00000172459	ENST00000302969	T	0.02015	4.5	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.144556	0.32386	N	0.006172	T	0.18215	0.0437	M	0.92880	3.355	0.47905	D	0.999545	D	0.65815	0.995	D	0.67900	0.954	T	0.01198	-1.1421	10	0.72032	D	0.01	.	18.0183	0.89248	0.0:1.0:0.0:0.0	.	58	Q8NGP9	O5AR1_HUMAN	S	58	ENSP00000302639:P58S	ENSP00000302639:P58S	P	+	1	0	OR5AR1	56187909	0.999000	0.42202	0.998000	0.56505	0.988000	0.76386	4.387000	0.59626	2.738000	0.93877	0.637000	0.83480	CCC	OR5AR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172459		0.448	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	HGNC	protein_coding	OTTHUMT00000334434.1	-	0.00	67	0	C	NM_001004730		56431333	+1	tier1	-	no_errors	ENST00000302969	ensembl	human	known	74_37	missense	22.86	54	16	SNP	1.000	T
OR5H2	79310	genome.wustl.edu	37	3	98002101	98002101	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:98002101G>A	ENST00000355273.2	+	1	370	c.370G>A	c.(370-372)Gca>Aca	p.A124T	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						GGCAACAATGGCATATGATCG	0.378																																																	0													108.0	102.0	104.0					3																	98002101		2203	4300	6503	SO:0001583	missense	0				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.370G>A	3.37:g.98002101G>A	ENSP00000347418:p.Ala124Thr		Q6IF87	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A124T	ENST00000355273.2	37	c.370	CCDS33801.1	3	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026031	0.75390	.	.	ENSG00000197938	ENST00000355273	T	0.13307	2.6	3.2	2.31	0.28768	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39475	U	0.001352	T	0.42017	0.1184	H	0.97051	3.93	0.34760	D	0.732656	D	0.58268	0.982	P	0.58454	0.839	T	0.62383	-0.6866	10	0.87932	D	0	.	8.3081	0.32055	0.1244:0.0:0.8756:0.0	.	124	Q8NGV7	OR5H2_HUMAN	T	124	ENSP00000347418:A124T	ENSP00000347418:A124T	A	+	1	0	OR5H2	99484791	1.000000	0.71417	0.032000	0.17829	0.939000	0.58152	4.921000	0.63397	0.679000	0.31345	0.543000	0.68304	GCA	OR5H2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197938		0.378	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	-	0.00	48	0	G			98002101	+1	tier1	-	no_errors	ENST00000355273	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
OR6B2	389090	genome.wustl.edu	37	2	240968939	240968939	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:240968939T>C	ENST00000402971.2	-	1	967	c.908A>G	c.(907-909)aAg>aGg	p.K303R		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GCCCAAGGCCTTTTTCAAGGC	0.418																																																	0													123.0	117.0	119.0					2																	240968939		1862	4101	5963	SO:0001583	missense	0				CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.908A>G	2.37:g.240968939T>C	ENSP00000384563:p.Lys303Arg		B2RPR3|Q8NGW0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K303R	ENST00000402971.2	37	c.908	CCDS46559.1	2	.	.	.	.	.	.	.	.	.	.	T	8.529	0.870581	0.17322	.	.	ENSG00000182083	ENST00000402971	T	0.37915	1.17	4.24	-0.904	0.10530	.	0.672229	0.12875	N	0.431958	T	0.16599	0.0399	N	0.11560	0.145	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.26883	-1.0090	10	0.21540	T	0.41	.	7.9699	0.30122	0.0:0.4008:0.0:0.5992	.	303	Q6IFH4	OR6B2_HUMAN	R	303	ENSP00000384563:K303R	ENSP00000384563:K303R	K	-	2	0	OR6B2	240617612	0.004000	0.15560	0.002000	0.10522	0.300000	0.27592	0.055000	0.14229	-0.248000	0.09583	-0.353000	0.07706	AAG	OR6B2	-	NULL	ENSG00000182083		0.418	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B2	HGNC	protein_coding	OTTHUMT00000326079.1	-	0.00	61	0	T	NM_001005853		240968939	-1	tier1	-	no_errors	ENST00000402971	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.018	C
OR8G5	219865	genome.wustl.edu	37	11	124135465	124135465	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:124135465C>T	ENST00000524943.2	+	1	743	c.743C>T	c.(742-744)aCc>aTc	p.T248I	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		CCCAGCCTGACCATCCTCAGC	0.448																																					Ovarian(169;523 1969 8640 31295 51256)												0													132.0	132.0	132.0					11																	124135465		2157	4271	6428	SO:0001583	missense	0			BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.743C>T	11.37:g.124135465C>T	ENSP00000477014:p.Thr248Ile		B2RND3|Q6IEU6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T248I	ENST00000524943.2	37	c.743		11																																																																																			OR8G5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000255298		0.448	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	OR8G5	HGNC	protein_coding	OTTHUMT00000387283.2	-	0.00	98	0	C	NM_001005198		124135465	+1	tier1	-	no_errors	ENST00000524943	ensembl	human	known	74_37	missense	25.95	97	34	SNP	0.002	T
PARP4	143	genome.wustl.edu	37	13	25016071	25016072	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:25016071_25016072delTT	ENST00000381989.3	-	30	3683_3684	c.3578_3579delAA	c.(3577-3579)aaafs	p.K1193fs		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1193					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GTTCAGAAACTTTTGGAATATC	0.401																																																	0																																										SO:0001589	frameshift_variant	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3578_3579delAA	13.37:g.25016073_25016074delTT	ENSP00000371419:p.Lys1193fs		O75903|Q14682|Q5QNZ9|Q9H1M6	Frame_Shift_Del	DEL	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.K1193fs	ENST00000381989.3	37	c.3579_3578	CCDS9307.1	13																																																																																			PARP4	-	NULL	ENSG00000102699		0.401	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1		0.00	42	0	TT	NM_006437		25016072	-1	tier1		no_errors	ENST00000381989	ensembl	human	known	74_37	frame_shift_del	13.89	31	5	DEL	0.338:0.838	-
PCDHGB1	56104	genome.wustl.edu	37	5	140729955	140729955	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:140729955C>T	ENST00000523390.1	+	1	128	c.128C>T	c.(127-129)tCa>tTa	p.S43L	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	43	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAACGGCTCACGGGTGGGG	0.527											OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													51.0	51.0	51.0					5																	140729955		1886	4126	6012	SO:0001583	missense	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.128C>T	5.37:g.140729955C>T	ENSP00000429273:p.Ser43Leu	1658	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S43L	ENST00000523390.1	37	c.128	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	17.29	3.352699	0.61293	.	.	ENSG00000254221	ENST00000523390	T	0.38722	1.12	5.52	4.63	0.57726	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.60996	0.2312	M	0.92555	3.32	0.35126	D	0.767462	B;B	0.30664	0.214;0.289	B;B	0.40477	0.299;0.33	T	0.74297	-0.3711	9	0.72032	D	0.01	.	13.5199	0.61561	0.0:0.9209:0.0:0.0791	.	43;43	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	L	43	ENSP00000429273:S43L	ENSP00000429273:S43L	S	+	2	0	PCDHGB1	140710139	0.825000	0.29262	0.865000	0.33974	0.855000	0.48748	2.836000	0.48183	1.402000	0.46780	0.563000	0.77884	TCA	PCDHGB1	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254221		0.527	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	-	0.00	76	0	C	NM_018922		140729955	+1	tier1	-	no_errors	ENST00000523390	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.998	T
PHF19	26147	genome.wustl.edu	37	9	123625142	123625142	+	Intron	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr9:123625142C>T	ENST00000373896.3	-	11	1221				PHF19_ENST00000419155.1_Intron|PHF19_ENST00000487555.1_Intron	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19						chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGCTAAAATCCGGATGGTCTC	0.582																																																	0																																										SO:0001627	intron_variant	0			BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.969-115G>A	9.37:g.123625142C>T			Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	RNA	SNP	-	NULL	ENST00000373896.3	37	NULL	CCDS35116.1	9																																																																																			PHF19	-	-	ENSG00000119403		0.582	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF19	HGNC	protein_coding	OTTHUMT00000053838.3	-	0.00	12	0	C	XM_045308		123625142	-1	tier1	-	no_errors	ENST00000467266	ensembl	human	known	74_37	rna	33.33	14	7	SNP	0.000	T
PHKA2	5256	genome.wustl.edu	37	X	18954191	18954191	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:18954191G>C	ENST00000379942.4	-	11	1784	c.1119C>G	c.(1117-1119)taC>taG	p.Y373*		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	373					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCGGGACAGCGTAGAGTTCAG	0.522																																																	0													121.0	87.0	98.0					X																	18954191		2203	4300	6503	SO:0001587	stop_gained	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1119C>G	X.37:g.18954191G>C	ENSP00000369274:p.Tyr373*		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Nonsense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.Y373*	ENST00000379942.4	37	c.1119	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.050366	0.98629	.	.	ENSG00000044446	ENST00000379942	.	.	.	5.61	-5.04	0.02964	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.8795	13.66	0.62361	0.4514:0.0:0.5486:0.0	.	.	.	.	X	373	.	ENSP00000369274:Y373X	Y	-	3	2	PHKA2	18864112	0.002000	0.14202	0.986000	0.45419	0.108000	0.19459	-1.137000	0.03219	-0.621000	0.05633	-0.443000	0.05667	TAC	PHKA2	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	ENSG00000044446		0.522	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	-	0.00	18	0	G	NM_000292		18954191	-1	tier1	-	no_errors	ENST00000379942	ensembl	human	known	74_37	nonsense	42.86	8	6	SNP	0.986	C
PIGO	84720	genome.wustl.edu	37	9	35092618	35092618	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr9:35092618C>T	ENST00000378617.3	-	7	1660	c.1266G>A	c.(1264-1266)ccG>ccA	p.P422P	PIGO_ENST00000341666.3_Silent_p.P422P|PIGO_ENST00000298004.5_Silent_p.P422P|PIGO_ENST00000361778.2_Silent_p.P422P|PIGO_ENST00000492770.1_5'Flank	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	422					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.P422P(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAATCACAGTCGGCAGTGTCG	0.607																																																	1	Substitution - coding silent(1)	large_intestine(1)											68.0	71.0	70.0					9																	35092618		2200	4292	6492	SO:0001819	synonymous_variant	0			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1266G>A	9.37:g.35092618C>T			B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P422	ENST00000378617.3	37	c.1266	CCDS6575.1	9																																																																																			PIGO	-	NULL	ENSG00000165282		0.607	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGO	HGNC	protein_coding	OTTHUMT00000052284.1		0.00	27	0	C	NM_032634		35092618	-1			no_errors	ENST00000341666	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.884	T
PIKFYVE	200576	genome.wustl.edu	37	2	209150489	209150489	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:209150489T>C	ENST00000264380.4	+	6	811	c.653T>C	c.(652-654)tTa>tCa	p.L218S	PIKFYVE_ENST00000392202.3_Missense_Mutation_p.L121S|PIKFYVE_ENST00000407449.1_Missense_Mutation_p.L218S|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.L132S	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	218					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AAAATAGCCTTAAGTTATGCT	0.383																																																	0													123.0	121.0	121.0					2																	209150489		2203	4300	6503	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.653T>C	2.37:g.209150489T>C	ENSP00000264380:p.Leu218Ser		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.L218S	ENST00000264380.4	37	c.653	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849415	0.91277	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000422495;ENST00000452564	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	6.06	6.06	0.98353	Zinc finger, FYVE-type (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000007	T	0.62282	0.2415	M	0.77406	2.37	0.80722	D	1	P;D;D;P;D	0.62365	0.879;0.991;0.99;0.872;0.962	P;P;P;P;P	0.62089	0.511;0.898;0.858;0.659;0.662	T	0.59600	-0.7424	10	0.21540	T	0.41	-5.0846	16.6093	0.84858	0.0:0.0:0.0:1.0	.	218;218;132;218;121	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	S	121;218;218;132;230;218	ENSP00000264380:L218S;ENSP00000384356:L218S;ENSP00000414477:L230S;ENSP00000405736:L218S	ENSP00000264380:L218S	L	+	2	0	PIKFYVE	208858734	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.324000	0.78689	0.533000	0.62120	TTA	PIKFYVE	-	superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000115020		0.383	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	-	0.00	40	0	T	NM_015040		209150489	+1	tier1	-	no_errors	ENST00000264380	ensembl	human	known	74_37	missense	20.00	52	13	SNP	1.000	C
PKD1L2	114780	genome.wustl.edu	37	16	81219257	81219257	+	RNA	SNP	G	G	A	rs199529211		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr16:81219257G>A	ENST00000525539.1	-	0	1836				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGGTCTGTGCGAAGCAGCTGC	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14398	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG,CYS/ARG	12,4022		0,12,2005	22.0	29.0	26.0		1837,1837	0.9	0.0	16		26	0,8378		0,0,4189	yes	missense,missense	PKD1L2	NM_001076780.1,NM_052892.3	180,180	0,12,6194	AA,AG,GG		0.0,0.2975,0.0967	possibly-damaging,possibly-damaging	613/992,613/2460	81219257	12,12400	2017	4189	6206			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81219257G>A			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	pfam_Lectin_gal-bd_dom,pfam_C-type_lectin,pfam_PKD/REJ-like,superfamily_C-type_lectin_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_PKD_dom,smart_C-type_lectin,pfscan_C-type_lectin,pfscan_Lectin_gal-bd_dom,pfscan_REJ-like	p.R613C	ENST00000525539.1	37	c.1837		16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.356|3.356	-0.131421|-0.131421	0.06753|0.06753	0.002975|0.002975	0.0|0.0	ENSG00000166473|ENSG00000166473	ENST00000337114|ENST00000526632	T|.	0.70045|.	-0.45|.	4.83|4.83	0.915|0.915	0.19366|0.19366	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);|.	0.945790|.	0.08895|.	N|.	0.878032|.	T|T	0.30916|0.30916	0.0780|0.0780	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B;B|.	0.20052|.	0.033;0.041|.	B;B|.	0.10450|.	0.005;0.005|.	T|T	0.24512|0.24512	-1.0158|-1.0158	9|4	0.54805|.	T|.	0.06|.	-0.1295|-0.1295	6.0978|6.0978	0.20031|0.20031	0.2086:0.0:0.643:0.1484|0.2086:0.0:0.643:0.1484	.|.	613;613|.	Q7Z442-3;Q7Z442|.	.;PK1L2_HUMAN|.	C|L	613|140	ENSP00000337397:R613C|.	ENSP00000337397:R613C|.	R|S	-|-	1|2	0|0	PKD1L2|PKD1L2	79776758|79776758	0.024000|0.024000	0.19004|0.19004	0.000000|0.000000	0.03702|0.03702	0.007000|0.007000	0.05969|0.05969	0.145000|0.145000	0.16157|0.16157	0.351000|0.351000	0.24027|0.24027	0.551000|0.551000	0.68910|0.68910	CGC|TCG	PKD1L2	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000166473		0.602	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	-	0.00	73	0	G			81219257	-1	tier1	rs199529211	no_errors	ENST00000337114	ensembl	human	known	74_37	missense	47.19	47	42	SNP	0.000	A
PLXNA2	5362	genome.wustl.edu	37	1	208218548	208218548	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:208218548delT	ENST00000367033.3	-	19	4260	c.3503delA	c.(3502-3504)aacfs	p.N1168fs		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1168	IPT/TIG 4.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGGGCAGAGGTTTTTGCCCTG	0.498																																																	0													118.0	106.0	110.0					1																	208218548		2203	4300	6503	SO:0001589	frameshift_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3503delA	1.37:g.208218548delT	ENSP00000356000:p.Asn1168fs		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Frame_Shift_Del	DEL	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.N1168fs	ENST00000367033.3	37	c.3503	CCDS31013.1	1																																																																																			PLXNA2	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000076356		0.498	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6		0.00	31	0	T	NM_025179		208218548	-1	tier1		no_errors	ENST00000367033	ensembl	human	known	74_37	frame_shift_del	10.71	25	3	DEL	1.000	-
POLD1	5424	genome.wustl.edu	37	19	50905960	50905960	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:50905960G>C	ENST00000440232.2	+	8	985	c.932G>C	c.(931-933)cGc>cCc	p.R311P	POLD1_ENST00000595904.1_Missense_Mutation_p.R311P|POLD1_ENST00000599857.1_Missense_Mutation_p.R311P	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	311					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GCGCCCTTGCGCGTGCTCAGC	0.672								DNA polymerases (catalytic subunits)																																									0													27.0	26.0	26.0					19																	50905960		2202	4297	6499	SO:0001583	missense	0				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.932G>C	19.37:g.50905960G>C	ENSP00000406046:p.Arg311Pro		Q8NER3|Q96H98	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.R311P	ENST00000440232.2	37	c.932	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294904	0.60086	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.12774	2.65	4.69	2.32	0.28847	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.068072	0.64402	N	0.000019	T	0.44726	0.1307	M	0.92268	3.29	0.58432	D	0.999999	D;D	0.89917	0.973;1.0	P;D	0.91635	0.906;0.999	T	0.60791	-0.7193	10	0.87932	D	0	-11.8143	13.4259	0.61026	0.0:0.3003:0.6997:0.0	.	311;311	E7EVW0;P28340	.;DPOD1_HUMAN	P	311;312	ENSP00000406046:R311P	ENSP00000366129:R312P	R	+	2	0	POLD1	55597772	1.000000	0.71417	0.976000	0.42696	0.203000	0.24098	5.595000	0.67563	1.084000	0.41184	0.491000	0.48974	CGC	POLD1	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000062822		0.672	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	HGNC	protein_coding	OTTHUMT00000464732.1	-	0.00	39	0	G			50905960	+1	tier1	-	no_errors	ENST00000440232	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.992	C
POU4F2	5458	genome.wustl.edu	37	4	147561259	147561261	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	CAC	CAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:147561259_147561261delCAC	ENST00000281321.3	+	2	777_779	c.529_531delCAC	c.(529-531)cacdel	p.H182del	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	182	Poly-His.			Missing (in Ref. 6; CAA50589). {ECO:0000305}.	axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ccaccaccatcaccaccaccacc	0.69																																																	0																																										SO:0001651	inframe_deletion	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.529_531delCAC	4.37:g.147561268_147561270delCAC	ENSP00000281321:p.His182del		B1PJR6|B2RC84|Q13883|Q14987	In_Frame_Del	DEL	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.H180in_frame_del	ENST00000281321.3	37	c.529_531	CCDS34074.1	4																																																																																			POU4F2	-	NULL	ENSG00000151615		0.690	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1		0.00	52	0	CAC	NM_004575		147561261	+1	tier1		no_errors	ENST00000281321	ensembl	human	known	74_37	in_frame_del	6.45	29	2	DEL	1.000:1.000:0.999	-
PRAMEF6	440561	genome.wustl.edu	37	1	13001384	13001384	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:13001384A>C	ENST00000376189.1	-	3	398	c.299T>G	c.(298-300)cTt>cGt	p.L100R	PRAMEF6_ENST00000376192.5_Intron|PRAMEF6_ENST00000415464.2_Missense_Mutation_p.L100R	NM_001010889.2	NP_001010889.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	100					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCACTTGAAGTTTCCACCT	0.478																																																	0													25.0	48.0	40.0					1																	13001384		1315	2506	3821	SO:0001583	missense	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376189.1:c.299T>G	1.37:g.13001384A>C	ENSP00000365360:p.Leu100Arg		A0AUJ9	Missense_Mutation	SNP	NULL	p.L100R	ENST00000376189.1	37	c.299	CCDS30594.1	1	.	.	.	.	.	.	.	.	.	.	.	10.38	1.333675	0.24167	.	.	ENSG00000232423	ENST00000376189;ENST00000415464;ENST00000355096	T;T;T	0.04758	3.56;3.56;3.56	1.54	1.54	0.23209	.	0.000000	0.64402	D	0.000015	T	0.15955	0.0384	M	0.90425	3.115	0.18873	N	0.999987	D	0.57899	0.981	P	0.56700	0.804	T	0.03374	-1.1043	10	0.87932	D	0	.	5.2293	0.15412	1.0:0.0:0.0:0.0	.	100	Q5VXH4	PRAM6_HUMAN	R	100	ENSP00000365360:L100R;ENSP00000401281:L100R;ENSP00000347211:L100R	ENSP00000347211:L100R	L	-	2	0	PRAMEF6	12923971	0.014000	0.17966	0.005000	0.12908	0.017000	0.09413	2.014000	0.40951	0.961000	0.38030	0.329000	0.21502	CTT	PRAMEF6	-	NULL	ENSG00000232423		0.478	PRAMEF6-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAMEF6	HGNC	protein_coding			0.00	214	0	A	NM_001010889		13001384	-1			no_errors	ENST00000355096	ensembl	human	known	74_37	missense	8.70	167	16	SNP	0.007	C
PRAMEF5	343068	genome.wustl.edu	37	1	13365855	13365855	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:13365855T>G	ENST00000376168.1	+	3	399	c.299T>G	c.(298-300)cTt>cGt	p.L100R		NM_001013407.1	NP_001013425.1	Q5TYX0	PRAM5_HUMAN	PRAME family member 5	100					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					central_nervous_system(1)|kidney(3)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTGGAAACTTCAAGTGCTG	0.458																																																	0																																										SO:0001583	missense	0				CCDS72708.1	1p36.21	2014-07-15			ENSG00000204502			"""-"""	27995	protein-coding gene	gene with protein product			"""PRAME family member 23"""	PRAMEF23			Standard	NM_001013407		Approved	PRAMEF5L	uc001auu.1	Q5TYX0	OTTHUMG00000009505	ENST00000376168.1:c.299T>G	1.37:g.13365855T>G	ENSP00000365338:p.Leu100Arg		A2BDD6|A4FU31	Missense_Mutation	SNP	NULL	p.L100R	ENST00000376168.1	37	c.299	CCDS30596.1	1	.	.	.	.	.	.	.	.	.	.	.	9.766	1.171432	0.21621	.	.	ENSG00000204502	ENST00000376168	T	0.04758	3.56	1.15	1.15	0.20763	.	0.000000	0.64402	D	0.000015	T	0.14485	0.0350	M	0.90483	3.12	0.09310	N	1	.	.	.	.	.	.	T	0.03112	-1.1071	8	0.87932	D	0	.	4.512	0.11915	0.0:0.0:0.0:1.0	.	.	.	.	R	100	ENSP00000365338:L100R	ENSP00000365338:L100R	L	+	2	0	PRAMEF5	13238442	0.002000	0.14202	0.002000	0.10522	0.023000	0.10783	1.417000	0.34770	0.777000	0.33496	0.155000	0.16302	CTT	PRAMEF5	-	NULL	ENSG00000204502		0.458	PRAMEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF5	HGNC	protein_coding	OTTHUMT00000026271.1		0.00	130	0	T	NM_001013407		13365855	+1			no_errors	ENST00000376168	ensembl	human	known	74_37	missense	9.33	68	7	SNP	0.003	G
PROS1	5627	genome.wustl.edu	37	3	93593094	93593094	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:93593094A>T	ENST00000394236.3	-	15	2342	c.2026T>A	c.(2026-2028)Tct>Act	p.S676T	PROS1_ENST00000407433.1_Missense_Mutation_p.S545T	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	676					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ATGCCTTAAGAATTCTTTGTC	0.328																																																	0													92.0	88.0	89.0					3																	93593094		2203	4299	6502	SO:0001583	missense	0				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.2026T>A	3.37:g.93593094A>T	ENSP00000377783:p.Ser676Thr		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,pfam_GLA_domain,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.S676T	ENST00000394236.3	37	c.2026	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	A	4.735	0.136733	0.09032	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.90069	-2.61;-2.08	4.61	0.777	0.18538	.	0.574898	0.16246	N	0.222923	T	0.71550	0.3353	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.56498	-0.7969	10	0.21540	T	0.41	.	4.0638	0.09851	0.5726:0.0:0.0927:0.3346	.	676	P07225	PROS_HUMAN	T	676;545	ENSP00000377783:S676T;ENSP00000385794:S545T	ENSP00000377783:S676T	S	-	1	0	PROS1	95075784	0.670000	0.27512	0.139000	0.22197	0.396000	0.30629	0.523000	0.22925	-0.018000	0.14079	0.454000	0.30748	TCT	PROS1	-	NULL	ENSG00000184500		0.328	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	-	0.00	80	0	A	NM_000313		93593094	-1	tier1	-	no_errors	ENST00000394236	ensembl	human	known	74_37	missense	16.79	109	22	SNP	0.065	T
PTCHD3	374308	genome.wustl.edu	37	10	27702567	27702567	+	Missense_Mutation	SNP	C	C	T	rs201665328	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr10:27702567C>T	ENST00000438700.3	-	1	730	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	205					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.E205K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AAATTGGCTTCGGTGCTCCTC	0.632													C|||	3	0.000599042	0.0008	0.0	5008	,	,		18251	0.001		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)											54.0	57.0	56.0					10																	27702567		2203	4300	6503	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.613G>A	10.37:g.27702567C>T	ENSP00000417658:p.Glu205Lys		I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.E205K	ENST00000438700.3	37	c.613	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	C	5.699	0.313452	0.10789	.	.	ENSG00000182077	ENST00000438700	D	0.85411	-1.98	3.65	2.74	0.32292	.	0.390448	0.27739	N	0.018051	T	0.77267	0.4105	M	0.61703	1.905	0.09310	N	1	B	0.26975	0.165	B	0.23419	0.046	T	0.58418	-0.7640	10	0.07482	T	0.82	-5.6038	7.3213	0.26529	0.0:0.7915:0.0:0.2085	.	205	Q3KNS1	PTHD3_HUMAN	K	205	ENSP00000417658:E205K	ENSP00000417658:E205K	E	-	1	0	PTCHD3	27742573	0.146000	0.22672	0.001000	0.08648	0.004000	0.04260	2.489000	0.45285	0.742000	0.32697	0.555000	0.69702	GAA	PTCHD3	-	pfam_Patched	ENSG00000182077		0.632	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3		0.00	20	0	C	XM_370541		27702567	-1			no_errors	ENST00000438700	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.004	T
RAD17	5884	genome.wustl.edu	37	5	68692375	68692376	+	Splice_Site	INS	-	-	A	rs377737971|rs34097088|rs75928221		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:68692375_68692376insA	ENST00000509734.1	+	15	2283		c.e15+2		RAD17_ENST00000521422.1_Splice_Site|RAD17_ENST00000354312.3_Splice_Site|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000354868.5_Splice_Site|RAD17_ENST00000305138.4_Splice_Site|RAD17_ENST00000361732.2_Splice_Site|RAD17_ENST00000282891.6_Splice_Site|RAD17_ENST00000380774.3_Splice_Site|RAD17_ENST00000358030.2_Splice_Site|RAD17_ENST00000345306.6_Splice_Site			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)						cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		AATAAAAAGGTAAAAAAAAAAA	0.322								Other conserved DNA damage response genes																																									0																																										SO:0001630	splice_region_variant	0			AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.1605+2->A	5.37:g.68692386_68692386dupA			A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Splice_Site	INS	-	e13+2	ENST00000509734.1	37	c.1605+2_1605+1	CCDS4003.1	5																																																																																			RAD17	-	-	ENSG00000152942		0.322	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RAD17	HGNC	protein_coding	OTTHUMT00000369171.1		0.00	17	0	-	NM_133344	Intron	68692376	+1	tier1		no_errors	ENST00000380774	ensembl	human	known	74_37	splice_site_ins	23.81	16	5	INS	1.000:0.992	A
RANBP1	5902	genome.wustl.edu	37	22	20109826	20109826	+	Silent	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr22:20109826C>G	ENST00000331821.3	+	3	294	c.192C>G	c.(190-192)ctC>ctG	p.L64L	RANBP1_ENST00000402752.1_Silent_p.L64L|RANBP1_ENST00000430524.1_5'UTR	NM_002882.2	NP_002873.1	P43487	RANG_HUMAN	RAN binding protein 1	64	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|positive regulation of mitotic centrosome separation (GO:0046604)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|spindle organization (GO:0007051)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Ran GTPase binding (GO:0008536)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4	Colorectal(54;0.0993)					AGAACGATCTCCCAGAATGGA	0.577																																																	0													77.0	67.0	70.0					22																	20109826		2202	4299	6501	SO:0001819	synonymous_variant	0			D38076	CCDS13775.1, CCDS63408.1, CCDS74823.1	22q11.21	2008-06-16			ENSG00000099901	ENSG00000099901			9847	protein-coding gene	gene with protein product		601180				7616957, 10330396	Standard	NM_001278639		Approved	HTF9A	uc002zro.1	P43487	OTTHUMG00000150490	ENST00000331821.3:c.192C>G	22.37:g.20109826C>G			Q53EY3	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.L64	ENST00000331821.3	37	c.192	CCDS13775.1	22																																																																																			RANBP1	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000099901		0.577	RANBP1-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP1	HGNC	protein_coding	OTTHUMT00000343733.1	-	0.00	27	0	C	NM_002882		20109826	+1	tier1	-	no_errors	ENST00000331821	ensembl	human	known	74_37	silent	34.29	22	12	SNP	0.833	G
RASL11B	65997	genome.wustl.edu	37	4	53729447	53729447	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:53729447G>A	ENST00000248706.3	+	2	373	c.155G>A	c.(154-156)cGg>cAg	p.R52Q		NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			CTGGTGGTCCGGTTCCTCACC	0.483																																																	0													126.0	103.0	111.0					4																	53729447		2203	4300	6503	SO:0001583	missense	0			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.155G>A	4.37:g.53729447G>A	ENSP00000248706:p.Arg52Gln			Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R52Q	ENST00000248706.3	37	c.155	CCDS3490.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.176778	0.97348	.	.	ENSG00000128045	ENST00000248706	D	0.81739	-1.53	5.51	5.51	0.81932	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.83718	0.5315	L	0.41415	1.275	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77094	-0.2715	10	0.02654	T	1	.	18.3899	0.90479	0.0:0.0:1.0:0.0	.	52	Q9BPW5	RSLBB_HUMAN	Q	52	ENSP00000248706:R52Q	ENSP00000248706:R52Q	R	+	2	0	RASL11B	53424204	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	9.403000	0.97302	2.571000	0.86741	0.655000	0.94253	CGG	RASL11B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000128045		0.483	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11B	HGNC	protein_coding	OTTHUMT00000219931.2	-	0.00	69	0	G	NM_023940		53729447	+1	tier1	-	no_errors	ENST00000248706	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.998	A
RAPGEF2	9693	genome.wustl.edu	37	4	160189325	160189325	+	Silent	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:160189325C>A	ENST00000264431.4	+	1	437	c.18C>A	c.(16-18)atC>atA	p.I6I	RAPGEF2_ENST00000504604.1_Intron	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	6					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CACTAGCAATCCCAGCTAACC	0.413																																																	0													127.0	120.0	122.0					4																	160189325		1941	4138	6079	SO:0001819	synonymous_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.18C>A	4.37:g.160189325C>A			D3DP27	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.I6	ENST00000264431.4	37	c.18	CCDS43277.1	4																																																																																			RAPGEF2	-	NULL	ENSG00000109756		0.413	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	-	0.00	49	0	C	NM_014247		160189325	+1	tier1	-	no_errors	ENST00000264431	ensembl	human	known	74_37	silent	7.35	63	5	SNP	0.999	A
RBM48	84060	genome.wustl.edu	37	7	92163945	92163945	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:92163945G>T	ENST00000265732.5	+	4	719	c.678G>T	c.(676-678)aaG>aaT	p.K226N	RBM48_ENST00000481551.1_Missense_Mutation_p.K226N	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	226						nucleus (GO:0005634)	RNA binding (GO:0003723)										ACTCCTCTAAGGATGGTAGAA	0.423																																																	0													117.0	103.0	108.0					7																	92163945		1890	4104	5994	SO:0001583	missense	0			AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.678G>T	7.37:g.92163945G>T	ENSP00000265732:p.Lys226Asn		B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	NULL	p.K226N	ENST00000265732.5	37	c.678	CCDS43615.1	7	.	.	.	.	.	.	.	.	.	.	G	5.945	0.358349	0.11239	.	.	ENSG00000127993	ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	5.19	3.34	0.38264	.	0.628423	0.18212	N	0.148143	T	0.23846	0.0577	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23547	-1.0185	9	0.09843	T	0.71	3.9867	4.7799	0.13197	0.0829:0.1442:0.614:0.1589	.	226;226	B7Z2K5;Q5RL73	.;CG064_HUMAN	N	226	.	ENSP00000265732:K226N	K	+	3	2	C7orf64	92001881	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.361000	0.20267	0.716000	0.32124	0.591000	0.81541	AAG	RBM48	-	NULL	ENSG00000127993		0.423	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM48	HGNC	protein_coding	OTTHUMT00000356076.1		0.00	51	0	G	NM_032120		92163945	+1			no_errors	ENST00000265732	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.000	T
RGSL1	353299	genome.wustl.edu	37	1	182443066	182443066	+	Missense_Mutation	SNP	G	G	T	rs531534371		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:182443066G>T	ENST00000294854.8	+	6	840	c.820G>T	c.(820-822)Gct>Tct	p.A274S	RGSL1_ENST00000542961.1_Missense_Mutation_p.A309S	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	274					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						CAAGCCAGATGCTATTGGTAT	0.453													G|||	1	0.000199681	0.0	0.0014	5008	,	,		24028	0.0		0.0	False		,,,				2504	0.0				Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													127.0	119.0	121.0					1																	182443066		692	1591	2283	SO:0001583	missense	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.820G>T	1.37:g.182443066G>T	ENSP00000457748:p.Ala274Ser		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.A274S	ENST00000294854.8	37	c.820	CCDS58049.1	1																																																																																			RGSL1	-	NULL	ENSG00000121446		0.453	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	-	0.00	29	0	G	NM_181572		182443066	+1	tier1	-	no_errors	ENST00000294854	ensembl	human	known	74_37	missense	33.33	24	12	SNP	0.000	T
RGS2	5997	genome.wustl.edu	37	1	192778269	192778269	+	Missense_Mutation	SNP	G	G	A	rs148489044		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:192778269G>A	ENST00000235382.5	+	1	99	c.68G>A	c.(67-69)gGc>gAc	p.G23D	RGS2_ENST00000483295.1_3'UTR	NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	23					brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			large_intestine(3)|lung(1)|urinary_tract(1)	5						GCAGGCAGTGGCCACAAGAGC	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17289	0.0		0.0	False		,,,				2504	0.0				Pancreas(71;51 2183 4981)												0								G	ASP/GLY	0,4406		0,0,2203	194.0	169.0	177.0		68	3.4	0.1	1	dbSNP_134	177	9,8591	7.1+/-27.0	0,9,4291	yes	missense	RGS2	NM_002923.3	94	0,9,6494	AA,AG,GG		0.1047,0.0,0.0692	benign	23/212	192778269	9,12997	2203	4300	6503	SO:0001583	missense	0			L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.68G>A	1.37:g.192778269G>A	ENSP00000235382:p.Gly23Asp		Q6I9U5	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.G23D	ENST00000235382.5	37	c.68	CCDS1377.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.84	1.757369	0.31137	0.0	0.001047	ENSG00000116741	ENST00000235382	T	0.69685	-0.42	5.4	3.36	0.38483	.	1.122870	0.06734	N	0.777255	T	0.49201	0.1543	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.33497	-0.9866	10	0.13470	T	0.59	.	7.5677	0.27890	0.0935:0.0:0.7374:0.1691	.	23	P41220	RGS2_HUMAN	D	23	ENSP00000235382:G23D	ENSP00000235382:G23D	G	+	2	0	RGS2	191044892	0.188000	0.23250	0.105000	0.21289	0.822000	0.46500	3.154000	0.50693	1.466000	0.48025	0.655000	0.94253	GGC	RGS2	-	NULL	ENSG00000116741		0.567	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS2	HGNC	protein_coding	OTTHUMT00000086396.1		0.00	71	0	G	NM_002923		192778269	+1			no_errors	ENST00000235382	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.061	A
RNF167	26001	genome.wustl.edu	37	17	4846522	4846522	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:4846522C>T	ENST00000262482.6	+	7	1175	c.519C>T	c.(517-519)taC>taT	p.Y173Y	SLC25A11_ENST00000225665.7_5'Flank|RNF167_ENST00000572430.1_Silent_p.Y173Y|RNF167_ENST00000571816.1_Silent_p.Y173Y|RNF167_ENST00000570492.1_Intron|RNF167_ENST00000576229.1_Silent_p.Y138Y|RNF167_ENST00000575111.1_Silent_p.Y173Y	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167	173					negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						TGGGCTATTACCTCATCCCTT	0.537																																																	0													79.0	69.0	72.0					17																	4846522		2203	4300	6503	SO:0001819	synonymous_variant	0			AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.519C>T	17.37:g.4846522C>T			D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.Y173	ENST00000262482.6	37	c.519	CCDS11060.1	17																																																																																			RNF167	-	NULL	ENSG00000108523		0.537	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF167	HGNC	protein_coding	OTTHUMT00000216854.3	-	0.00	70	0	C	NM_015528		4846522	+1	tier1	-	no_errors	ENST00000262482	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
RSPH10B	222967	genome.wustl.edu	37	7	6000459	6000459	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:6000459C>T	ENST00000405415.1	-	5	822	c.436G>A	c.(436-438)Gtg>Atg	p.V146M	RSPH10B_ENST00000337579.3_Missense_Mutation_p.V146M|RSPH10B_ENST00000441023.2_Missense_Mutation_p.V146M|RSPH10B_ENST00000539903.1_5'Flank|RSPH10B_ENST00000404406.1_Missense_Mutation_p.V146M|RSPH10B_ENST00000535104.1_5'UTR			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	146										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		CACGTGTACACGCCGTGGTTC	0.587																																																	0													5.0	6.0	5.0					7																	6000459		882	2461	3343	SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.436G>A	7.37:g.6000459C>T	ENSP00000385443:p.Val146Met		A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.V146M	ENST00000405415.1	37	c.436	CCDS34598.1	7	.	.	.	.	.	.	.	.	.	.	C	2.340	-0.351302	0.05173	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	4.07	-5.04	0.02964	.	1.935030	0.02710	N	0.112725	T	0.40448	0.1117	L	0.41236	1.265	0.09310	N	1	P	0.40602	0.723	B	0.27262	0.078	T	0.42430	-0.9452	10	0.33940	T	0.23	.	9.0561	0.36405	0.108:0.2358:0.0:0.6561	.	146	P0C881	R10B1_HUMAN	M	146;146;146;5;146	ENSP00000385443:V146M;ENSP00000384097:V146M;ENSP00000338556:V146M;ENSP00000400988:V146M	ENSP00000338556:V146M	V	-	1	0	RSPH10B	5966985	0.000000	0.05858	0.002000	0.10522	0.146000	0.21551	-1.675000	0.01947	-1.162000	0.02797	-0.367000	0.07326	GTG	RSPH10B	-	pfam_MORN,smart_MORN	ENSG00000155026		0.587	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	HGNC	protein_coding	OTTHUMT00000325465.2	-	0.00	48	0	C	NM_173565		6000459	-1	tier1	-	no_errors	ENST00000337579	ensembl	human	known	74_37	missense	38.75	49	31	SNP	0.000	T
S1PR1	1901	genome.wustl.edu	37	1	101704654	101704654	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:101704654C>T	ENST00000305352.6	+	2	489	c.114C>T	c.(112-114)agC>agT	p.S38S	S1PR1_ENST00000475821.1_3'UTR|RP4-575N6.4_ENST00000432195.1_RNA	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	38					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						TGAATATCAGCGCGGACAAGG	0.502											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													116.0	110.0	112.0					1																	101704654		2203	4300	6503	SO:0001819	synonymous_variant	0			M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.114C>T	1.37:g.101704654C>T		1360	D3DT66|Q9BYY4|Q9NYN8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_EDG1_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.S38	ENST00000305352.6	37	c.114	CCDS777.1	1																																																																																			S1PR1	-	prints_EDG1_rcpt	ENSG00000170989		0.502	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR1	HGNC	protein_coding	OTTHUMT00000029908.1	-	0.00	61	0	C	NM_001400		101704654	+1	tier1	-	no_errors	ENST00000305352	ensembl	human	known	74_37	silent	31.82	30	14	SNP	0.021	T
SACS	26278	genome.wustl.edu	37	13	23915230	23915230	+	Missense_Mutation	SNP	G	G	A	rs373613604		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr13:23915230G>A	ENST00000382292.3	-	9	3058	c.2785C>T	c.(2785-2787)Cgc>Tgc	p.R929C	SACS_ENST00000402364.1_Missense_Mutation_p.R179C|SACS_ENST00000382298.3_Missense_Mutation_p.R929C			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	929					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGGTTAATGCGCTTGAATATT	0.393																																																	0								G	CYS/ARG	0,4406		0,0,2203	118.0	117.0	117.0		2785	2.9	0.9	13		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	SACS	NM_014363.4	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	929/4580	23915230	1,13005	2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2785C>T	13.37:g.23915230G>A	ENSP00000371729:p.Arg929Cys		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.R929C	ENST00000382292.3	37	c.2785	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	18.66	3.670955	0.67814	0.0	1.16E-4	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87491	-2.11;-2.26;-2.11	6.05	2.93	0.34026	.	0.121425	0.53938	D	0.000058	T	0.76758	0.4032	N	0.24115	0.695	0.35915	D	0.8314	D	0.53151	0.958	B	0.36989	0.238	T	0.81927	-0.0709	10	0.62326	D	0.03	.	14.202	0.65710	0.0:0.0:0.274:0.726	.	929	Q9NZJ4	SACS_HUMAN	C	929;179;929	ENSP00000371729:R929C;ENSP00000385844:R179C;ENSP00000371735:R929C	ENSP00000371729:R929C	R	-	1	0	SACS	22813230	1.000000	0.71417	0.927000	0.36925	0.819000	0.46315	4.343000	0.59348	0.790000	0.33803	0.650000	0.86243	CGC	SACS	-	NULL	ENSG00000151835		0.393	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	39	0	G	NM_014363		23915230	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	27.27	32	12	SNP	0.995	A
SCAMP4	113178	genome.wustl.edu	37	19	1917794	1917794	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:1917794G>A	ENST00000316097.8	+	3	376	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	SCAMP4_ENST00000414057.2_3'UTR|SCAMP4_ENST00000409472.1_Missense_Mutation_p.V37M	NM_079834.2	NP_524558.1	Q969E2	SCAM4_HUMAN	secretory carrier membrane protein 4	37					protein transport (GO:0015031)	integral component of membrane (GO:0016021)							Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGTCCTGGTGAAGAGGAT	0.617																																																	0													55.0	63.0	61.0					19																	1917794		2054	4193	6247	SO:0001583	missense	0			AK091166	CCDS45903.1	19p13.3	2013-02-21			ENSG00000227500	ENSG00000227500		"""Secretory carrier membrane proteins"""	30385	protein-coding gene	gene with protein product		613764					Standard	NM_079834		Approved	FLJ33847	uc002luj.4	Q969E2	OTTHUMG00000154590	ENST00000316097.8:c.109G>A	19.37:g.1917794G>A	ENSP00000316007:p.Val37Met		Q8N2N1|Q8NAV0	Missense_Mutation	SNP	pfam_SCAMP	p.V37M	ENST00000316097.8	37	c.109	CCDS45903.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.340|9.340	1.062773|1.062773	0.19987|0.19987	.|.	.|.	ENSG00000227500|ENSG00000227500	ENST00000316097;ENST00000409472;ENST00000411971|ENST00000414057	T;T|.	0.19669|.	2.13;2.13|.	4.3|4.3	3.26|3.26	0.37387|0.37387	.|.	.|.	.|.	.|.	.|.	T|.	0.72187|.	0.3429|.	M|M	0.79614|0.79614	2.46|2.46	0.51767|0.51767	D|D	0.999933|0.999933	P;P;B|.	0.38395|.	0.575;0.629;0.202|.	B;B;B|.	0.44044|.	0.406;0.439;0.132|.	T|.	0.72424|.	-0.4298|.	9|.	0.41790|.	T|.	0.15|.	-11.8782|-11.8782	11.3838|11.3838	0.49773|0.49773	0.0899:0.0:0.9101:0.0|0.0899:0.0:0.9101:0.0	.|.	37;37;37|.	Q969E2-2;Q969E2;F8WDW4|.	.;SCAM4_HUMAN;.|.	M|X	37;37;109|46	ENSP00000316007:V37M;ENSP00000386865:V37M|.	ENSP00000316007:V37M|.	V|W	+|+	1|3	0|0	SCAMP4|SCAMP4	1868794|1868794	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.002000|0.002000	0.02628|0.02628	4.973000|4.973000	0.63763|0.63763	0.916000|0.916000	0.36871|0.36871	-0.339000|-0.339000	0.08088|0.08088	GTG|TGG	SCAMP4	-	pfam_SCAMP	ENSG00000227500		0.617	SCAMP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP4	HGNC	protein_coding	OTTHUMT00000336210.3		0.00	40	0	G	NM_079834		1917794	+1			no_errors	ENST00000316097	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.992	A
SERPINB11	89778	genome.wustl.edu	37	18	61377452	61377452	+	RNA	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr18:61377452G>A	ENST00000382749.5	+	0	270				SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000536691.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				CACAGCTAACGTTGAATTTTG	0.403											OREG0003822	type=REGULATORY REGION|Gene=SERPINB11|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Ovarian(27;496 784 5942 8975 23930)												0													108.0	97.0	100.0					18																	61377452		1920	4139	6059			0					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61377452G>A		1053	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V9I	ENST00000382749.5	37	c.25		18	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370029	0.24771	.	.	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.84223	-1.82;-1.82	5.14	0.19	0.15125	Serpin domain (2);	1.043170	0.07628	N	0.928062	T	0.75191	0.3816	L	0.35593	1.075	0.09310	N	1	P;B	0.43314	0.803;0.075	B;B	0.35727	0.209;0.027	T	0.61681	-0.7013	10	0.46703	T	0.11	.	8.5652	0.33536	0.4233:0.0:0.5767:0.0	.	9;9	F5GY69;Q96P15	.;SPB11_HUMAN	I	9	ENSP00000441497:V9I;ENSP00000440795:V9I	ENSP00000421854:V9I	V	+	1	0	SERPINB11	59528432	0.000000	0.05858	0.002000	0.10522	0.892000	0.51952	0.018000	0.13422	-0.197000	0.10350	0.655000	0.94253	GTT	SERPINB11	-	pfam_Serpin_dom,superfamily_Serpin_dom	ENSG00000206072		0.403	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3	-	0.00	61	0	G	NM_080475		61377452	+1	tier1	-	no_errors	ENST00000538847	ensembl	human	known	74_37	missense	8.75	73	7	SNP	0.003	A
SLC41A2	84102	genome.wustl.edu	37	12	105198776	105198777	+	3'UTR	INS	-	-	A	rs537277458		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:105198776_105198777insA	ENST00000258538.3	-	0	2002_2003				SLC41A2_ENST00000549713.1_5'UTR	NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						ACAAATTCCTTAAAAAAAAATT	0.322																																					Esophageal Squamous(195;176 2919 4272 35572)												0																																										SO:0001624	3_prime_UTR_variant	0			BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.*154->T	12.37:g.105198785_105198785dupA			Q3KP68|Q9H0E5	RNA	INS	-	NULL	ENST00000258538.3	37	NULL	CCDS9100.2	12																																																																																			SLC41A2	-	-	ENSG00000136052		0.322	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A2	HGNC	protein_coding	OTTHUMT00000346850.3		0.00	36	0	-	NM_032148		105198777	-1	tier1		no_errors	ENST00000549713	ensembl	human	known	74_37	rna	10.00	36	4	INS	0.757:0.849	A
SETD1B	23067	genome.wustl.edu	37	12	122257764	122257764	+	Silent	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:122257764G>C	ENST00000604567.1	+	11	3941	c.3873G>C	c.(3871-3873)gtG>gtC	p.V1291V	SETD1B_ENST00000542440.1_Silent_p.V1248V|SETD1B_ENST00000267197.5_Silent_p.V1248V			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1291	Glu-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CCAAGGAGGTGGAGGCTCGAC	0.642																																																	0													14.0	19.0	17.0					12																	122257764		692	1590	2282	SO:0001819	synonymous_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.3873G>C	12.37:g.122257764G>C			F6MFW1	Silent	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.V1248	ENST00000604567.1	37	c.3744		12																																																																																			SETD1B	-	NULL	ENSG00000139718		0.642	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	-	0.00	80	0	G	XM_037523		122257764	+1	tier1	-	no_errors	ENST00000267197	ensembl	human	known	74_37	silent	40.51	47	32	SNP	0.089	C
SLC8A2	6543	genome.wustl.edu	37	19	47960551	47960551	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:47960551G>A	ENST00000236877.6	-	3	1371	c.976C>T	c.(976-978)Cac>Tac	p.H326Y	SLC8A2_ENST00000542837.1_Missense_Mutation_p.H82Y|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	326					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TTGTCCGGGTGCTTCTGCTTG	0.692																																																	0													9.0	7.0	8.0					19																	47960551		1995	3846	5841	SO:0001583	missense	0			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.976C>T	19.37:g.47960551G>A	ENSP00000236877:p.His326Tyr		B4DYQ9	Missense_Mutation	SNP	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.H326Y	ENST00000236877.6	37	c.976	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	G	9.656	1.142790	0.21205	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000542837	T;T	0.38560	1.35;1.13	3.55	3.55	0.40652	.	0.213761	0.41396	D	0.000889	T	0.25121	0.0610	N	0.21545	0.675	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.09377	0.0;0.004	T	0.06661	-1.0814	10	0.23302	T	0.38	.	8.1555	0.31167	0.1157:0.0:0.8843:0.0	.	154;326	E9PGS7;Q9UPR5	.;NAC2_HUMAN	Y	154;326;82	ENSP00000236877:H326Y;ENSP00000437536:H82Y	ENSP00000236877:H326Y	H	-	1	0	SLC8A2	52652363	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.353000	0.34045	1.823000	0.53134	0.313000	0.20887	CAC	SLC8A2	-	tigrfam_Na_Ca_Ex	ENSG00000118160		0.692	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	HGNC	protein_coding	OTTHUMT00000466997.1	-	0.00	13	0	G			47960551	-1	tier1	-	no_errors	ENST00000236877	ensembl	human	known	74_37	missense	66.67	5	10	SNP	1.000	A
SLCO1A2	6579	genome.wustl.edu	37	12	21447016	21447016	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr12:21447016C>G	ENST00000307378.6	-	12	2020	c.1300G>C	c.(1300-1302)Gac>Cac	p.D434H	SLCO1A2_ENST00000458504.1_Missense_Mutation_p.D302H|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.D432H|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.D302H|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.D434H	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	434	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	GCAAAGATGTCATTTTCCACA	0.343																																																	0													62.0	57.0	58.0					12																	21447016		2203	4300	6503	SO:0001583	missense	0				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1300G>C	12.37:g.21447016C>G	ENSP00000305974:p.Asp434His		Q9UGP7|Q9UL38	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.D434H	ENST00000307378.6	37	c.1300	CCDS8686.1	12	.	.	.	.	.	.	.	.	.	.	C	6.068	0.380950	0.11466	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	3.79	-4.27	0.03744	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.300840	0.01481	N	0.016666	T	0.49762	0.1576	L	0.36672	1.1	0.09310	N	1	B;B	0.30542	0.051;0.284	B;B	0.30029	0.015;0.11	T	0.41106	-0.9527	10	0.56958	D	0.05	.	5.7358	0.18065	0.1277:0.3901:0.0:0.4822	.	432;434	P46721-2;P46721	.;SO1A2_HUMAN	H	434;434;302;302;432	ENSP00000305974:D434H;ENSP00000393973:D434H;ENSP00000394854:D302H;ENSP00000439401:D302H;ENSP00000375088:D432H	ENSP00000305974:D434H	D	-	1	0	SLCO1A2	21338283	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.062000	0.14389	-1.136000	0.02892	-1.222000	0.01597	GAC	SLCO1A2	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000084453		0.343	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	HGNC	protein_coding	OTTHUMT00000343648.3	-	0.00	47	0	C	NM_021094		21447016	-1	tier1	-	no_errors	ENST00000307378	ensembl	human	known	74_37	missense	51.43	17	18	SNP	0.000	G
SMARCA4	6597	genome.wustl.edu	37	19	11152145	11152145	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:11152145C>T	ENST00000429416.3	+	31	4614	c.4333C>T	c.(4333-4335)Cgg>Tgg	p.R1445W	SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1412W|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1415W|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1415W|SMARCA4_ENST00000538456.3_3'UTR|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1412W|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1415W|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1477W|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1415W|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1445W	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1445					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GAAGCGCGGGCGGCCGCCTGC	0.612			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											48.0	50.0	49.0					19																	11152145		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.4333C>T	19.37:g.11152145C>T	ENSP00000395654:p.Arg1445Trp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R1477W	ENST00000429416.3	37	c.4429	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757243	0.69648	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29	4.44	3.35	0.38373	Bromodomain (1);	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	L	0.49778	1.585	0.53005	D	0.999969	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.973;0.973;0.982;0.982;0.999;0.982	T	0.53401	-0.8444	10	0.87932	D	0	-33.5392	11.4906	0.50379	0.2311:0.7689:0.0:0.0	.	1415;1412;1412;1477;1415;1445	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;P51532	.;.;.;.;.;SMCA4_HUMAN	W	1445;1477;1479;1445;1412;1412;1415;1415	ENSP00000395654:R1445W;ENSP00000350720:R1477W;ENSP00000343896:R1445W;ENSP00000392837:R1412W;ENSP00000397783:R1415W;ENSP00000414727:R1415W	ENSP00000343896:R1445W	R	+	1	2	SMARCA4	11013145	0.865000	0.29922	0.997000	0.53966	0.685000	0.39939	1.734000	0.38166	2.308000	0.77769	0.467000	0.42956	CGG	SMARCA4	-	superfamily_Bromodomain	ENSG00000127616		0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	69	0	C	NM_003072		11152145	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	70.92	35	100	SNP	1.000	T
SRGAP3	9901	genome.wustl.edu	37	3	9100060	9100060	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:9100060C>A	ENST00000383836.3	-	7	1325	c.898G>T	c.(898-900)Gat>Tat	p.D300Y	SRGAP3_ENST00000360413.3_Missense_Mutation_p.D300Y|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	300	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TCAATGACATCCAGCCCTTCG	0.537			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													225.0	190.0	202.0					3																	9100060		2203	4300	6503	SO:0001583	missense	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.898G>T	3.37:g.9100060C>A	ENSP00000373347:p.Asp300Tyr		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.D300Y	ENST00000383836.3	37	c.898	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900950	0.92035	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.16457	2.34;2.34	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.38001	-0.9681	10	0.72032	D	0.01	.	19.4226	0.94727	0.0:1.0:0.0:0.0	.	169;300;300	Q9ULR4;O43295-2;O43295	.;.;SRGP2_HUMAN	Y	300;300;180	ENSP00000373347:D300Y;ENSP00000353587:D300Y	ENSP00000353587:D300Y	D	-	1	0	SRGAP3	9075060	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.663000	0.83820	2.684000	0.91462	0.650000	0.86243	GAT	SRGAP3	-	NULL	ENSG00000196220		0.537	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	-	0.00	64	0	C			9100060	-1	tier1	-	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	38.57	43	27	SNP	1.000	A
SRP54	6729	genome.wustl.edu	37	14	35483965	35483965	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:35483965A>G	ENST00000556994.1	+	12	1299	c.902A>G	c.(901-903)gAa>gGa	p.E301G	SRP54_ENST00000555557.1_Missense_Mutation_p.E237G|SRP54_ENST00000546080.1_Missense_Mutation_p.E252G|SRP54_ENST00000216774.6_Missense_Mutation_p.E301G			P61011	SRP54_HUMAN	signal recognition particle 54kDa	301	M-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		GGCGACATTGAAGGACTGATA	0.328																																																	0													141.0	140.0	140.0					14																	35483965		2203	4299	6502	SO:0001583	missense	0			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.902A>G	14.37:g.35483965A>G	ENSP00000451818:p.Glu301Gly		B2R759|B4DUW6|P13624	Missense_Mutation	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.E301G	ENST00000556994.1	37	c.902	CCDS9652.1	14	.	.	.	.	.	.	.	.	.	.	A	17.25	3.341891	0.61073	.	.	ENSG00000100883	ENST00000556994;ENST00000216774;ENST00000546080;ENST00000555557	.	.	.	5.85	5.85	0.93711	Signal recognition particle, SRP54 subunit, M-domain (1);	0.000000	0.85682	D	0.000000	T	0.55816	0.1944	L	0.45352	1.415	0.80722	D	1	B;B	0.20052	0.041;0.041	B;B	0.19666	0.026;0.018	T	0.50508	-0.8820	9	0.25106	T	0.35	-28.2414	16.2317	0.82347	1.0:0.0:0.0:0.0	.	252;301	B4DUW6;P61011	.;SRP54_HUMAN	G	301;301;252;237	.	ENSP00000216774:E301G	E	+	2	0	SRP54	34553716	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.943000	0.92975	2.237000	0.73441	0.528000	0.53228	GAA	SRP54	-	superfamily_Signal_recog_particle_SRP54_M,tigrfam_SRP54_euk	ENSG00000100883		0.328	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2	-	0.00	42	0	A	NM_003136		35483965	+1	tier1	-	no_errors	ENST00000216774	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	G
SRRM2	23524	genome.wustl.edu	37	16	2812116	2812116	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr16:2812116G>T	ENST00000301740.8	+	11	2136	c.1587G>T	c.(1585-1587)caG>caT	p.Q529H		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	529	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GAAGCCCCCAGCGACGTGGCC	0.607																																																	0													64.0	58.0	60.0					16																	2812116		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1587G>T	16.37:g.2812116G>T	ENSP00000301740:p.Gln529His		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.Q529H	ENST00000301740.8	37	c.1587	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	11.07	1.529782	0.27387	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.25749	1.78	5.91	4.96	0.65561	.	0.000000	0.64402	D	0.000020	T	0.33440	0.0863	N	0.24115	0.695	0.27860	N	0.940448	D	0.65815	0.995	D	0.77557	0.99	T	0.10359	-1.0633	10	0.56958	D	0.05	-11.4675	9.0577	0.36416	0.1649:0.0:0.8351:0.0	.	529	Q9UQ35	SRRM2_HUMAN	H	529;529;494	ENSP00000301740:Q529H	ENSP00000301740:Q529H	Q	+	3	2	SRRM2	2752117	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.938000	0.48987	1.514000	0.48869	0.655000	0.94253	CAG	SRRM2	-	NULL	ENSG00000167978		0.607	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1		0.00	46	0	G			2812116	+1			no_errors	ENST00000301740	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.986	T
SUN5	140732	genome.wustl.edu	37	20	31571644	31571644	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:31571644G>T	ENST00000356173.3	-	13	1188	c.1096C>A	c.(1096-1098)Ccc>Acc	p.P366T	SUN5_ENST00000375523.3_Missense_Mutation_p.P341T	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	366					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						TGCTCTCTGGGCGGGGCCACA	0.557																																																	0													74.0	85.0	81.0					20																	31571644		2203	4300	6503	SO:0001583	missense	0			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.1096C>A	20.37:g.31571644G>T	ENSP00000348496:p.Pro366Thr		A6NJ82|Q5T9R0	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.P366T	ENST00000356173.3	37	c.1096	CCDS13209.1	20	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962831	0.53507	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.12147	2.71;2.74	5.16	5.16	0.70880	.	0.161766	0.40144	N	0.001166	T	0.25044	0.0608	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01617	-1.1311	10	0.66056	D	0.02	-26.7185	14.1711	0.65510	0.0:0.0:1.0:0.0	.	366	Q8TC36	SUN5_HUMAN	T	366;341	ENSP00000348496:P366T;ENSP00000364673:P341T	ENSP00000348496:P366T	P	-	1	0	SUN5	31035305	0.995000	0.38212	0.095000	0.20976	0.004000	0.04260	2.587000	0.46128	2.408000	0.81797	0.655000	0.94253	CCC	SUN5	-	NULL	ENSG00000167098		0.557	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN5	HGNC	protein_coding	OTTHUMT00000078659.1	-	0.00	74	0	G	NM_080675		31571644	-1	tier1	-	no_errors	ENST00000356173	ensembl	human	known	74_37	missense	10.10	89	10	SNP	0.451	T
TACC2	10579	genome.wustl.edu	37	10	123987479	123987479	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr10:123987479C>T	ENST00000369005.1	+	14	8192	c.7852C>T	c.(7852-7854)Ctg>Ttg	p.L2618L	TACC2_ENST00000369004.3_Silent_p.L708L|TACC2_ENST00000453444.2_Silent_p.L2622L|TACC2_ENST00000358010.1_Silent_p.L764L|TACC2_ENST00000360561.3_Silent_p.L696L|TACC2_ENST00000334433.3_Silent_p.L2618L|TACC2_ENST00000515273.1_Silent_p.L2622L|TACC2_ENST00000369001.1_Silent_p.L322L|TACC2_ENST00000515603.1_Silent_p.L2573L|TACC2_ENST00000368999.1_Silent_p.L708L|TACC2_ENST00000369000.1_Silent_p.L318L|TACC2_ENST00000513429.1_Silent_p.L764L|TACC2_ENST00000260733.3_Silent_p.L696L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2618					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCAGAAGGAGCTGGAGGCCAT	0.572																																																	0													84.0	88.0	86.0					10																	123987479		2203	4300	6503	SO:0001819	synonymous_variant	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.7852C>T	10.37:g.123987479C>T			Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	pfam_TACC	p.L2618	ENST00000369005.1	37	c.7852	CCDS7626.1	10																																																																																			TACC2	-	NULL	ENSG00000138162		0.572	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1		0.00	35	0	C			123987479	+1			no_errors	ENST00000334433	ensembl	human	known	74_37	silent	7.89	35	3	SNP	1.000	T
TANC1	85461	genome.wustl.edu	37	2	160086369	160086369	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:160086369C>T	ENST00000263635.6	+	27	4669	c.4432C>T	c.(4432-4434)Cag>Tag	p.Q1478*	TANC1_ENST00000454300.1_Nonsense_Mutation_p.Q1372*	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1478					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TCCCAGGTCCCAGCCATCCTC	0.537																																																	0													96.0	104.0	102.0					2																	160086369		1984	4152	6136	SO:0001587	stop_gained	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4432C>T	2.37:g.160086369C>T	ENSP00000263635:p.Gln1478*		C9JD88|Q49AI8	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.Q1478*	ENST00000263635.6	37	c.4432	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.856207	0.98980	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	.	.	.	5.89	5.89	0.94794	.	0.711471	0.14722	N	0.302271	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4457	0.61140	0.0:0.9288:0.0:0.0712	.	.	.	.	X	1372;1478	.	.	Q	+	1	0	TANC1	159794615	0.930000	0.31532	0.531000	0.27976	0.025000	0.11179	3.180000	0.50895	2.781000	0.95711	0.655000	0.94253	CAG	TANC1	-	NULL	ENSG00000115183		0.537	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1		0.00	26	0	C			160086369	+1			no_errors	ENST00000263635	ensembl	human	known	74_37	nonsense	13.64	19	3	SNP	0.569	T
TBCEL	219899	genome.wustl.edu	37	11	120930683	120930683	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:120930683C>G	ENST00000529397.1	+	7	945	c.845C>G	c.(844-846)cCa>cGa	p.P282R	TBCEL_ENST00000422003.2_Missense_Mutation_p.P282R	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	282	LRRCT.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)			TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		TATAGATTGCCATCAGTTTCC	0.328																																																	0													65.0	61.0	62.0					11																	120930683		2201	4297	6498	SO:0001583	missense	0			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.845C>G	11.37:g.120930683C>G	ENSP00000437184:p.Pro282Arg		Q0VAN6	Missense_Mutation	SNP	pfscan_Ubiquitin_supergroup	p.P282R	ENST00000529397.1	37	c.845	CCDS31692.1	11	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325030	0.81580	.	.	ENSG00000154114	ENST00000529397;ENST00000422003;ENST00000533134;ENST00000533169	T;T;T	0.35048	1.94;1.94;1.33	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.59752	-0.7395	10	0.34782	T	0.22	-38.6485	19.6038	0.95573	0.0:1.0:0.0:0.0	.	282	Q5QJ74	TBCEL_HUMAN	R	282;282;49;85	ENSP00000437184:P282R;ENSP00000403925:P282R;ENSP00000436419:P49R	ENSP00000403925:P282R	P	+	2	0	TBCEL	120435893	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	7.452000	0.80683	2.628000	0.89032	0.460000	0.39030	CCA	TBCEL	-	NULL	ENSG00000154114		0.328	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TBCEL	HGNC	protein_coding	OTTHUMT00000387688.1	-	0.00	72	0	C	NM_152715		120930683	+1	tier1	-	no_errors	ENST00000422003	ensembl	human	known	74_37	missense	23.53	65	20	SNP	1.000	G
TBX20	57057	genome.wustl.edu	37	7	35284578	35284578	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:35284578G>T	ENST00000408931.3	-	4	1163	c.637C>A	c.(637-639)Ctg>Atg	p.L213M		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	213					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGTTGATCCAGTTCATTGTTG	0.458																																																	0													214.0	163.0	180.0					7																	35284578		2203	4300	6503	SO:0001583	missense	0			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.637C>A	7.37:g.35284578G>T	ENSP00000386170:p.Leu213Met		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.L213M	ENST00000408931.3	37	c.637	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364921	0.61513	.	.	ENSG00000164532	ENST00000408931	D	0.90261	-2.64	5.47	4.6	0.57074	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.82162	0.4977	N	0.03084	-0.415	0.80722	D	1	B	0.22683	0.073	B	0.36464	0.225	T	0.76389	-0.2977	10	0.25106	T	0.35	.	14.2254	0.65855	0.072:0.0:0.928:0.0	.	213	Q9UMR3	TBX20_HUMAN	M	213	ENSP00000386170:L213M	ENSP00000386170:L213M	L	-	1	2	TBX20	35251103	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.220000	0.58567	1.314000	0.45095	0.591000	0.81541	CTG	TBX20	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000164532		0.458	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	-	0.00	83	0	G	NM_020417		35284578	-1	tier1	-	no_errors	ENST00000408931	ensembl	human	known	74_37	missense	9.68	83	9	SNP	1.000	T
TC2N	123036	genome.wustl.edu	37	14	92251624	92251624	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:92251624C>T	ENST00000435962.2	-	11	1567	c.1244G>A	c.(1243-1245)gGa>gAa	p.G415E	TC2N_ENST00000360594.5_Missense_Mutation_p.G415E|TC2N_ENST00000556018.1_Missense_Mutation_p.G351E|TC2N_ENST00000340892.5_Missense_Mutation_p.G415E	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	415	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		CTTGACTCTTCCATTGGAGGC	0.358																																																	0													187.0	204.0	198.0					14																	92251624		2203	4300	6503	SO:0001583	missense	0			AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.1244G>A	14.37:g.92251624C>T	ENSP00000387882:p.Gly415Glu			Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.G415E	ENST00000435962.2	37	c.1244	CCDS9897.1	14	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334535	0.81801	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018;ENST00000556590	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	5.5	5.5	0.81552	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.75213	0.3819	L	0.29908	0.895	0.52501	D	0.999958	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	T	0.77219	-0.2668	10	0.62326	D	0.03	-22.7926	19.3998	0.94623	0.0:1.0:0.0:0.0	.	351;415	Q8N9U0-2;Q8N9U0	.;TAC2N_HUMAN	E	415;415;415;351;167	ENSP00000387882:G415E;ENSP00000343199:G415E;ENSP00000353802:G415E;ENSP00000451317:G351E;ENSP00000450922:G167E	ENSP00000343199:G415E	G	-	2	0	TC2N	91321377	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	6.465000	0.73538	2.586000	0.87340	0.655000	0.94253	GGA	TC2N	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000165929		0.358	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	HGNC	protein_coding	OTTHUMT00000411778.1	-	0.00	56	0	C	NM_152332		92251624	-1	tier1	-	no_errors	ENST00000340892	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
TCF4	6925	genome.wustl.edu	37	18	53017598	53017598	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr18:53017598G>A	ENST00000356073.4	-	8	1152	c.541C>T	c.(541-543)Cca>Tca	p.P181S	TCF4_ENST00000561992.1_Missense_Mutation_p.P51S|TCF4_ENST00000565018.2_Missense_Mutation_p.P181S|TCF4_ENST00000543082.1_Missense_Mutation_p.P139S|TCF4_ENST00000568673.1_Missense_Mutation_p.P157S|TCF4_ENST00000564999.1_Missense_Mutation_p.P181S|TCF4_ENST00000564228.1_Missense_Mutation_p.P110S|TCF4_ENST00000566286.1_Missense_Mutation_p.P179S|TCF4_ENST00000544241.2_Missense_Mutation_p.P110S|TCF4_ENST00000570177.2_Missense_Mutation_p.P51S|TCF4_ENST00000537578.1_Missense_Mutation_p.P157S|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000398339.1_Missense_Mutation_p.P283S|TCF4_ENST00000568740.1_Missense_Mutation_p.P156S|TCF4_ENST00000354452.3_Missense_Mutation_p.P181S|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000564403.2_Missense_Mutation_p.P181S|TCF4_ENST00000540999.1_Missense_Mutation_p.P157S|TCF4_ENST00000537856.3_Missense_Mutation_p.P51S	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	181					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		ACTGAAGATGGCAAACCTGGA	0.378																																																	0													146.0	126.0	132.0					18																	53017598		2203	4300	6503	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.541C>T	18.37:g.53017598G>A	ENSP00000348374:p.Pro181Ser		B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P283S	ENST00000356073.4	37	c.847	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468585	0.63625	.	.	ENSG00000196628	ENST00000354452;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	D;D;D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.89591	0.6759	L	0.58510	1.815	0.48135	D	0.99959	P;B;P;B;P;P;P	0.51933	0.949;0.395;0.745;0.068;0.572;0.949;0.949	P;B;B;B;B;P;B	0.46885	0.53;0.259;0.222;0.018;0.164;0.53;0.391	D	0.89865	0.4019	10	0.49607	T	0.09	-29.5256	18.1047	0.89516	0.0:0.0:1.0:0.0	.	157;181;157;283;181;139;110	B7Z5M6;G0LNT9;B7Z6Y1;E9PH57;P15884;B3KUC0;B3KT62	.;.;.;.;ITF2_HUMAN;.;.	S	181;181;139;157;157;110;51;283	ENSP00000346440:P181S;ENSP00000348374:P181S;ENSP00000439656:P139S;ENSP00000445202:P157S;ENSP00000440731:P157S;ENSP00000441562:P110S;ENSP00000439827:P51S;ENSP00000381382:P283S	ENSP00000346440:P181S	P	-	1	0	TCF4	51168596	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.490000	0.81461	2.582000	0.87167	0.491000	0.48974	CCA	TCF4	-	NULL	ENSG00000196628		0.378	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	-	0.00	45	0	G	NM_003199		53017598	-1	tier1	-	no_errors	ENST00000398339	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
TIGD2	166815	genome.wustl.edu	37	4	90034819	90034819	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:90034819delA	ENST00000317005.2	+	1	852	c.694delA	c.(694-696)aaafs	p.K233fs	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	233	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		GGGGAAGGCCAAAAAGCCCCG	0.433																																																	0													64.0	65.0	65.0					4																	90034819		2203	4300	6503	SO:0001589	frameshift_variant	0			AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.694delA	4.37:g.90034819delA	ENSP00000317170:p.Lys233fs			Frame_Shift_Del	DEL	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.K233fs	ENST00000317005.2	37	c.694	CCDS3633.1	4																																																																																			TIGD2	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000180346		0.433	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD2	HGNC	protein_coding	OTTHUMT00000253545.2		0.00	43	0	A	NM_145715		90034819	+1	tier1		no_errors	ENST00000317005	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.931	-
TIGD6	81789	genome.wustl.edu	37	5	149375184	149375187	+	Frame_Shift_Del	DEL	GAAT	GAAT	-			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	GAAT	GAAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr5:149375184_149375187delGAAT	ENST00000296736.3	-	2	1499_1502	c.725_728delATTC	c.(724-729)cattccfs	p.HS242fs	TIGD6_ENST00000515406.2_Frame_Shift_Del_p.HS242fs	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	242	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ACAAGGGAGGGAATGAATGTTCTT	0.505																																																	0																																										SO:0001589	frameshift_variant	0			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.725_728delATTC	5.37:g.149375188_149375191delGAAT	ENSP00000296736:p.His242fs		B3KTZ8|Q96MQ4|Q9H0X7	Frame_Shift_Del	DEL	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.H242fs	ENST00000296736.3	37	c.728_725	CCDS4301.1	5																																																																																			TIGD6	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000164296		0.505	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD6	HGNC	protein_coding	OTTHUMT00000252324.1		0.00	49	0	GAAT	NM_030953		149375187	-1	tier1		no_errors	ENST00000296736	ensembl	human	known	74_37	frame_shift_del	20.97	49	13	DEL	0.917:0.791:0.794:0.949	-
TMED10	10972	genome.wustl.edu	37	14	75601711	75601712	+	Splice_Site	INS	-	-	A	rs200389497	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr14:75601711_75601712insA	ENST00000303575.4	-	5	590		c.e5-2		RP11-950C14.7_ENST00000556236.1_RNA|TMED10_ENST00000557670.1_Splice_Site	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)						beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		TTGTTGACTCTAAAAAAAAACA	0.426																																																	0																																										SO:0001630	splice_region_variant	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.539-2->T	14.37:g.75601720_75601720dupA			B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Splice_Site	INS	-	e5-2	ENST00000303575.4	37	c.539-3_539-2	CCDS9840.1	14																																																																																			TMED10	-	-	ENSG00000170348		0.426	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1		0.00	35	0	-	NM_006827	Intron	75601712	-1	tier1		no_errors	ENST00000303575	ensembl	human	known	74_37	splice_site_ins	11.11	32	4	INS	1.000:0.961	A
TMEM132E	124842	genome.wustl.edu	37	17	32953491	32953491	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:32953491C>T	ENST00000321639.5	+	2	741	c.413C>T	c.(412-414)tCg>tTg	p.S138L		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	138						integral component of membrane (GO:0016021)		p.S138L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTGCCCGCCTCGCAGCCCGTG	0.701																																																	1	Substitution - Missense(1)	kidney(1)											20.0	22.0	21.0					17																	32953491		2201	4293	6494	SO:0001583	missense	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.413C>T	17.37:g.32953491C>T	ENSP00000316532:p.Ser138Leu		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.S138L	ENST00000321639.5	37	c.413	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	c	16.78	3.217163	0.58560	.	.	ENSG00000181291	ENST00000321639	T	0.43688	0.94	5.17	5.17	0.71159	.	0.245363	0.37906	N	0.001899	T	0.35856	0.0946	M	0.62723	1.935	0.24406	N	0.994687	P	0.46327	0.876	B	0.34652	0.187	T	0.51044	-0.8755	10	0.66056	D	0.02	-14.8854	10.6378	0.45575	0.1468:0.7113:0.1419:0.0	.	138	Q6IEE7	T132E_HUMAN	L	138	ENSP00000316532:S138L	ENSP00000316532:S138L	S	+	2	0	TMEM132E	29977604	0.998000	0.40836	1.000000	0.80357	0.965000	0.64279	0.791000	0.26915	2.403000	0.81681	0.543000	0.68304	TCG	TMEM132E	-	NULL	ENSG00000181291		0.701	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	-	0.00	80	0	C	NM_207313		32953491	+1	tier1	-	no_errors	ENST00000321639	ensembl	human	known	74_37	missense	48.48	34	32	SNP	1.000	T
TMEM185B	79134	genome.wustl.edu	37	2	120980160	120980160	+	Silent	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:120980160G>C	ENST00000426077.2	-	1	824	c.393C>G	c.(391-393)gtC>gtG	p.V131V		NM_024121.2	NP_077026.2	Q9H7F4	T185B_HUMAN	transmembrane protein 185B	131						integral component of membrane (GO:0016021)											GAAAGCCCCAGACGCAGGCAG	0.582																																																	0																																										SO:0001819	synonymous_variant	0			AK024632	CCDS58722.1	2q14.2	2012-08-10	2011-05-27	2007-02-05	ENSG00000226479	ENSG00000226479			18896	protein-coding gene	gene with protein product			"""family with sequence similarity 11, member B"", ""transmembrane protein 185B (pseudogene)"""	FAM11B		12404111	Standard	NM_024121		Approved	FLJ20979	uc002tmj.2	Q9H7F4	OTTHUMG00000154402	ENST00000426077.2:c.393C>G	2.37:g.120980160G>C			A8K1G5|Q53T33|Q66K44|Q8IZ77	Silent	SNP	pfam_TM_Fragile-X-F-assoc	p.V131	ENST00000426077.2	37	c.393	CCDS58722.1	2																																																																																			TMEM185B	-	pfam_TM_Fragile-X-F-assoc	ENSG00000226479		0.582	TMEM185B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM185B	HGNC	protein_coding	OTTHUMT00000335069.4	-	0.00	32	0	G	NM_024121.2		120980160	-1	tier1	-	no_errors	ENST00000426077	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.987	C
TMEM200C	645369	genome.wustl.edu	37	18	5892004	5892004	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr18:5892004G>C	ENST00000581347.2	-	3	704	c.59C>G	c.(58-60)cCc>cGc	p.P20R	RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.P20R|RP11-945C19.4_ENST00000582939.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	20						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CTGGCTTGGGGGGCGGAGTGG	0.612																																																	0													66.0	70.0	68.0					18																	5892004		2063	4207	6270	SO:0001583	missense	0				CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.59C>G	18.37:g.5892004G>C	ENSP00000463375:p.Pro20Arg			Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.P20R	ENST00000581347.2	37	c.59	CCDS45825.1	18	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780782	0.70222	.	.	ENSG00000206432	ENST00000383490	.	.	.	4.3	4.3	0.51218	.	0.125586	0.56097	D	0.000034	T	0.61850	0.2380	L	0.44542	1.39	0.34847	D	0.741283	D	0.64830	0.994	D	0.66497	0.944	T	0.72371	-0.4314	9	0.72032	D	0.01	-6.42	12.4449	0.55645	0.0:0.0:0.8325:0.1675	.	20	A6NKL6	T200C_HUMAN	R	20	.	ENSP00000372982:P20R	P	-	2	0	TMEM200C	5882004	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	7.507000	0.81676	2.376000	0.81061	0.557000	0.71058	CCC	TMEM200C	-	pfam_DUF2371_TMEM200	ENSG00000206432		0.612	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200C	HGNC	protein_coding	OTTHUMT00000441917.4	-	0.00	44	0	G	NM_001080209		5892004	-1	tier1	-	no_errors	ENST00000383490	ensembl	human	known	74_37	missense	12.07	51	7	SNP	0.958	C
TOP2B	7155	genome.wustl.edu	37	3	25672379	25672379	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:25672379C>T	ENST00000264331.4	-	11	1317	c.1318G>A	c.(1318-1320)Gct>Act	p.A440T	TOP2B_ENST00000435706.2_Missense_Mutation_p.A435T	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	440					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TGAGTCTGAGCCTTAAATTTC	0.333																																																	0													130.0	117.0	121.0					3																	25672379		1843	4088	5931	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1318G>A	3.37:g.25672379C>T	ENSP00000264331:p.Ala440Thr		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.A440T	ENST00000264331.4	37	c.1318		3	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335062	0.81801	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.54479	0.57;0.57	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	M	0.84433	2.695	0.80722	D	1	P	0.37398	0.593	B	0.34093	0.175	T	0.68131	-0.5490	10	0.59425	D	0.04	-7.1156	18.9987	0.92824	0.0:1.0:0.0:0.0	.	435	Q02880-2	.	T	435;440;435	ENSP00000396704:A435T;ENSP00000264331:A440T	ENSP00000264331:A440T	A	-	1	0	TOP2B	25647383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.501000	0.84356	0.555000	0.69702	GCT	TOP2B	-	pfam_Topo_IIA_bsu_dom2,smart_Topo_IIA	ENSG00000077097		0.333	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		-	0.00	42	0	C			25672379	-1	tier1	-	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	52.94	24	27	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	G	C	rs17849781		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr17:7577106G>C	ENST00000269305.4	-	8	1021	c.832C>G	c.(832-834)Cct>Gct	p.P278A	TP53_ENST00000455263.2_Missense_Mutation_p.P278A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.P278A|TP53_ENST00000359597.4_Missense_Mutation_p.P278A|TP53_ENST00000420246.2_Missense_Mutation_p.P278A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278S(55)|p.P278A(24)|p.P278T(23)|p.0?(8)|p.P278F(3)|p.P278fs*67(3)|p.?(2)|p.P278fs*28(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C277_P278insXXXXXXX(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCTCCCAGGACAGGCACAA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	131	Substitution - Missense(105)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	upper_aerodigestive_tract(19)|breast(18)|skin(16)|large_intestine(14)|oesophagus(11)|lung(11)|central_nervous_system(7)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|kidney(3)|endometrium(3)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|eye(1)|biliary_tract(1)|liver(1)|prostate(1)	GRCh37	CM011015|CM052927	TP53	M	rs17849781						72.0	62.0	65.0					17																	7577106		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.832C>G	17.37:g.7577106G>C	ENSP00000269305:p.Pro278Ala		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P278A	ENST00000269305.4	37	c.832	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954842	0.92726	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99880	-7.46;-7.46;-7.46;-7.46;-7.46;-7.46	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	D	0.000000	D	0.99894	0.9949	M	0.88570	2.965	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.992;1.0;0.991;0.988	D	0.96234	0.9170	10	0.72032	D	0.01	-13.7877	16.1198	0.81342	0.0:0.0:1.0:0.0	rs17849781	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	A	278;278;278;278;278;267;146	ENSP00000352610:P278A;ENSP00000269305:P278A;ENSP00000398846:P278A;ENSP00000391127:P278A;ENSP00000391478:P278A;ENSP00000425104:P146A	ENSP00000269305:P278A	P	-	1	0	TP53	7517831	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.573000	0.98181	2.667000	0.90743	0.462000	0.41574	CCT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	31	0	G	NM_000546		7577106	-1	tier1	rs17849781	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	51.16	21	22	SNP	1.000	C
TRAPPC9	83696	genome.wustl.edu	37	8	141461322	141461322	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr8:141461322G>A	ENST00000438773.2	-	2	284	c.151C>T	c.(151-153)Cga>Tga	p.R51*	TRAPPC9_ENST00000389327.3_Nonsense_Mutation_p.R51*|TRAPPC9_ENST00000389328.4_Nonsense_Mutation_p.R149*	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	51					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TAGAGGACTCGCTGGGAGTCC	0.577																																																	0													57.0	51.0	53.0					8																	141461322		2203	4300	6503	SO:0001587	stop_gained	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.151C>T	8.37:g.141461322G>A	ENSP00000405060:p.Arg51*		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Nonsense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.R149*	ENST00000438773.2	37	c.445	CCDS55278.1	8	.	.	.	.	.	.	.	.	.	.	G	40	8.286226	0.98742	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	5.26	4.39	0.52855	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9017	0.63809	0.0735:0.0:0.9265:0.0	.	.	.	.	X	149;51;51	.	ENSP00000373978:R51X	R	-	1	2	TRAPPC9	141530504	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	6.300000	0.72776	1.210000	0.43336	0.650000	0.86243	CGA	TRAPPC9	-	NULL	ENSG00000167632		0.577	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	-	0.00	23	0	G	NM_031466		141461322	-1	tier1	-	no_errors	ENST00000389328	ensembl	human	known	74_37	nonsense	46.00	27	23	SNP	1.000	A
TRIM26	7726	genome.wustl.edu	37	6	30154080	30154082	+	In_Frame_Del	DEL	TCC	TCC	-	rs577858642|rs59539207	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr6:30154080_30154082delTCC	ENST00000454678.2	-	10	1627_1629	c.1191_1193delGGA	c.(1189-1194)gaggaa>gaa	p.397_398EE>E	TRIM26_ENST00000453195.1_In_Frame_Del_p.397_398EE>E|TRIM26_ENST00000437089.1_In_Frame_Del_p.397_398EE>E	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	397	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Poly-Glu.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						GGcctcctcttcctcctcctcct	0.571														3	0.000599042	0.0023	0.0	5008	,	,		19881	0.0		0.0	False		,,,				2504	0.0																0									,	14,3674		2,10,1832					,	-7.8	0.0		dbSNP_129	92	17,7589		2,13,3788	no	coding,coding	TRIM26	NM_003449.4,NM_001242783.1	,	4,23,5620	A1A1,A1R,RR		0.2235,0.3796,0.2745	,	,		31,11263				SO:0001651	inframe_deletion	0			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.1191_1193delGGA	6.37:g.30154089_30154091delTCC	ENSP00000410446:p.Glu400del		A6NG96|Q5SRL2	In_Frame_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E400in_frame_del	ENST00000454678.2	37	c.1193_1191	CCDS4678.1	6																																																																																			TRIM26	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000234127		0.571	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	HGNC	protein_coding	OTTHUMT00000253442.1		0.00	26	0	TCC	NM_003449		30154082	-1	tier1		no_errors	ENST00000437089	ensembl	human	known	74_37	in_frame_del	6.45	29	2	DEL	0.559:0.740:0.761	-
TRNT1	51095	genome.wustl.edu	37	3	3179029	3179029	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:3179029A>G	ENST00000251607.6	+	3	336	c.234A>G	c.(232-234)atA>atG	p.I78M	TRNT1_ENST00000280591.6_Missense_Mutation_p.I78M	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	78					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		CTCAGGATATAGATTTTGCCA	0.403																																																	0													91.0	90.0	91.0					3																	3179029		2203	4300	6503	SO:0001583	missense	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.234A>G	3.37:g.3179029A>G	ENSP00000251607:p.Ile78Met		A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	pfam_PolA_pol_head_dom	p.I78M	ENST00000251607.6	37	c.234	CCDS2561.2	3	.	.	.	.	.	.	.	.	.	.	A	16.34	3.094820	0.56075	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.21734	1.99;1.99	5.25	2.33	0.28932	Poly A polymerase, head domain (1);	0.055638	0.64402	D	0.000001	T	0.41050	0.1142	M	0.82716	2.605	0.80722	D	1	B;D	0.54772	0.035;0.968	B;D	0.66497	0.127;0.944	T	0.12915	-1.0529	10	0.59425	D	0.04	2.0383	5.0412	0.14460	0.0711:0.1175:0.4544:0.357	.	78;78	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	M	78	ENSP00000251607:I78M;ENSP00000280591:I78M	ENSP00000251607:I78M	I	+	3	3	TRNT1	3154029	1.000000	0.71417	0.998000	0.56505	0.626000	0.37791	1.283000	0.33237	0.158000	0.19367	-0.242000	0.12053	ATA	TRNT1	-	pfam_PolA_pol_head_dom	ENSG00000072756		0.403	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	HGNC	protein_coding	OTTHUMT00000337616.1		0.00	68	0	A			3179029	+1			no_errors	ENST00000251607	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.999	G
TRPC1	7220	genome.wustl.edu	37	3	142511809	142511809	+	Splice_Site	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr3:142511809G>A	ENST00000476941.1	+	9	2067	c.1581G>A	c.(1579-1581)caG>caA	p.Q527Q	TRPC1_ENST00000273482.6_Splice_Site_p.Q493Q	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	527					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						GTCCATTACAGGTAAATAATT	0.333																																																	0													73.0	70.0	71.0					3																	142511809		2203	4300	6503	SO:0001630	splice_region_variant	0			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1581+1G>A	3.37:g.142511809G>A			Q14CE4	Silent	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.Q527	ENST00000476941.1	37	c.1581	CCDS58856.1	3																																																																																			TRPC1	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000144935		0.333	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	-	0.00	41	0	G	NM_003304	Silent	142511809	+1	tier1	-	no_errors	ENST00000476941	ensembl	human	known	74_37	silent	42.47	42	31	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179428350	179428350	+	Silent	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:179428350G>T	ENST00000591111.1	-	276	77810	c.77586C>A	c.(77584-77586)ggC>ggA	p.G25862G	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Silent_p.G24935G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.G27503G|TTN_ENST00000342175.6_Silent_p.G18630G|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Silent_p.G18438G|TTN_ENST00000359218.5_Silent_p.G18563G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25862	Fibronectin type-III 88. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGAATGTAGCCCTCAATTT	0.483																																																	0													130.0	128.0	129.0					2																	179428350		1980	4163	6143	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77586C>A	2.37:g.179428350G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G24935	ENST00000591111.1	37	c.74805		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	75	0	G	NM_133378		179428350	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	28.92	59	24	SNP	0.746	T
TUT1	64852	genome.wustl.edu	37	11	62346473	62346473	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr11:62346473C>T	ENST00000476907.1	-	5	1411	c.720G>A	c.(718-720)tcG>tcA	p.S240S	TUT1_ENST00000308436.7_Silent_p.S278S|MIR3654_ENST00000496634.2_Silent_p.S240S			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	240	Pro-rich.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCGAGTCCAGCGATGGAGATT	0.542																																																	0													30.0	35.0	34.0					11																	62346473		2202	4299	6501	SO:0001819	synonymous_variant	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.720G>A	11.37:g.62346473C>T			A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Silent	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S278	ENST00000476907.1	37	c.834		11																																																																																			TUT1	-	NULL	ENSG00000149016		0.542	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2		0.00	65	0	C	NM_022830		62346473	-1			no_errors	ENST00000308436	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.506	T
UBIAD1	29914	genome.wustl.edu	37	1	11333870	11333870	+	Silent	SNP	G	G	A	rs144106336		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:11333870G>A	ENST00000376810.5	+	1	608	c.282G>A	c.(280-282)gtG>gtA	p.V94V	UBIAD1_ENST00000376804.2_Silent_p.V94V	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	94					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		TCCTGGCTGTGCACGGGGCCG	0.567																																																	0													115.0	112.0	113.0					1																	11333870		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.282G>A	1.37:g.11333870G>A			B3KQG3|Q53GX3|Q5THD4	Silent	SNP	pfam_UbiA_prenyltransferase	p.V94	ENST00000376810.5	37	c.282	CCDS129.1	1																																																																																			UBIAD1	-	pfam_UbiA_prenyltransferase	ENSG00000120942		0.567	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBIAD1	HGNC	protein_coding	OTTHUMT00000005773.1	-	0.00	74	0	G	NM_013319		11333870	+1	tier1	-	no_errors	ENST00000376810	ensembl	human	known	74_37	silent	7.14	65	5	SNP	1.000	A
ULK4P3	89837	genome.wustl.edu	37	15	30406189	30406189	+	RNA	SNP	G	G	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr15:30406189G>T	ENST00000568486.1	+	0	402				U8_ENST00000384701.1_RNA	NR_026859.1				ULK4 pseudogene 3																		GATCATAAAGGACTTATCGAA	0.294																																																	0																																												0			BC023564		15q13.2	2014-03-20	2013-09-12	2011-11-25	ENSG00000178081	ENSG00000178081			15777	pseudogene	pseudogene			"""family with sequence similarity 7, member A3"", ""unc-51-like kinase 4 (C. elegans) pseudogene 3"""	FAM7A3		11829490	Standard	NR_026859		Approved	D-X	uc001zdk.3		OTTHUMG00000175637		15.37:g.30406189G>T				RNA	SNP	-	NULL	ENST00000568486.1	37	NULL		15																																																																																			ULK4P3	-	-	ENSG00000178081		0.294	ULK4P3-002	PUTATIVE	basic	processed_transcript	ULK4P3	HGNC	pseudogene	OTTHUMT00000430688.1	-	0.00	78	0	G			30406189	+1	tier1	-	no_errors	ENST00000566138	ensembl	human	putative	74_37	rna	32.93	55	27	SNP	0.001	T
UNCX	340260	genome.wustl.edu	37	7	1273157	1273157	+	Splice_Site	SNP	C	C	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:1273157C>A	ENST00000316333.8	+	2	387	c.276C>A	c.(274-276)gaC>gaA	p.D92E		NM_001080461.1	NP_001073930.1	A6NJT0	UNC4_HUMAN	UNC homeobox	92					cartilage condensation (GO:0001502)|common myeloid progenitor cell proliferation (GO:0035726)|dorsal spinal cord development (GO:0021516)|olfactory bulb interneuron differentiation (GO:0021889)|pattern specification process (GO:0007389)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|skin(1)|upper_aerodigestive_tract(1)	4		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TGCCCGCAGACTCGGGGGACC	0.741																																																	0													12.0	15.0	14.0					7																	1273157		2188	4276	6464	SO:0001630	splice_region_variant	0				CCDS34583.1	7p22.3	2011-06-20			ENSG00000164853	ENSG00000164853		"""Homeoboxes / PRD class"""	33194	protein-coding gene	gene with protein product							Standard	NM_001080461		Approved	Uncx4.1	uc011jvw.2	A6NJT0	OTTHUMG00000152022	ENST00000316333.8:c.275-1C>A	7.37:g.1273157C>A			A4D221	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.D92E	ENST00000316333.8	37	c.276	CCDS34583.1	7	.	.	.	.	.	.	.	.	.	.	c	14.83	2.653787	0.47362	.	.	ENSG00000164853	ENST00000316333	D	0.95554	-3.74	3.0	3.0	0.34707	Homeodomain-related (1);Homeodomain-like (1);	0.071629	0.52532	U	0.000064	D	0.91365	0.7276	L	0.33753	1.03	0.80722	D	1	B	0.26744	0.158	B	0.26094	0.066	D	0.89840	0.4002	10	0.45353	T	0.12	.	13.5542	0.61749	0.0:1.0:0.0:0.0	.	92	A6NJT0	UNC4_HUMAN	E	92	ENSP00000314480:D92E	ENSP00000314480:D92E	D	+	3	2	UNCX	1239683	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	2.131000	0.42074	1.741000	0.51731	0.473000	0.43528	GAC	UNCX	-	superfamily_Homeodomain-like	ENSG00000164853		0.741	UNCX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	UNCX	HGNC	protein_coding	OTTHUMT00000324910.2	-	0.00	101	0	C	NM_001080461	Missense_Mutation	1273157	+1	tier1	-	no_errors	ENST00000316333	ensembl	human	known	74_37	missense	7.69	120	10	SNP	1.000	A
UTP3	57050	genome.wustl.edu	37	4	71554761	71554761	+	Missense_Mutation	SNP	G	G	A	rs139549167		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:71554761G>A	ENST00000254803.2	+	1	566	c.367G>A	c.(367-369)Gtg>Atg	p.V123M		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	123	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V123M(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			TGAGGCCTCTGTGGATCCCAG	0.562																																																	1	Substitution - Missense(1)	lung(1)											76.0	72.0	73.0					4																	71554761		2203	4300	6503	SO:0001583	missense	0			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.367G>A	4.37:g.71554761G>A	ENSP00000254803:p.Val123Met		Q6FI82	Missense_Mutation	SNP	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.V123M	ENST00000254803.2	37	c.367	CCDS3546.1	4	.	.	.	.	.	.	.	.	.	.	g	7.175	0.588414	0.13812	.	.	ENSG00000132467	ENST00000254803	T	0.29917	1.55	5.34	3.59	0.41128	.	0.560078	0.18387	N	0.142789	T	0.25005	0.0607	L	0.44542	1.39	0.09310	N	1	B	0.33448	0.412	B	0.31614	0.133	T	0.11155	-1.0599	10	0.49607	T	0.09	-13.1546	9.568	0.39411	0.073:0.2672:0.6598:0.0	.	123	Q9NQZ2	SAS10_HUMAN	M	123	ENSP00000254803:V123M	ENSP00000254803:V123M	V	+	1	0	UTP3	71773625	0.049000	0.20398	0.898000	0.35279	0.380000	0.30137	1.502000	0.35704	0.601000	0.29879	-0.177000	0.13119	GTG	UTP3	-	NULL	ENSG00000132467		0.562	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2	-	0.00	35	0	G	NM_020368		71554761	+1	tier1	-	no_errors	ENST00000254803	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.003	A
CFAP57	149465	genome.wustl.edu	37	1	43664319	43664320	+	Splice_Site	INS	-	-	A	rs10711519|rs557637660|rs77016489|rs200448793	byFrequency	TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr1:43664319_43664320insA	ENST00000372492.4	+	8	1752		c.e8+2		RNA5SP46_ENST00000362370.1_RNA|WDR65_ENST00000528956.1_Splice_Site	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN												NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGCGGAGAGGTAAAAAAAAAAC	0.401																																																	0																																										SO:0001630	splice_region_variant	0																														ENST00000372492.4:c.1428+2->A	1.37:g.43664329_43664329dupA			A6NKQ3|Q17RI9|Q5TAI0	Splice_Site	INS	-	e7+2	ENST00000372492.4	37	c.1428+2_1428+1		1																																																																																			WDR65	-	-	ENSG00000243710		0.401	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1		0.00	31	0	-		Intron	43664320	+1	tier1		no_errors	ENST00000528956	ensembl	human	known	74_37	splice_site_ins	12.16	65	9	INS	1.000:0.995	A
XKR4	114786	genome.wustl.edu	37	8	56436193	56436193	+	Missense_Mutation	SNP	C	C	T	rs372636201		TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr8:56436193C>T	ENST00000327381.6	+	3	1460	c.1360C>T	c.(1360-1362)Cgc>Tgc	p.R454C	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	454						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AGGCAGGACACGCTGCAGGCT	0.448																																																	0													161.0	154.0	157.0					8																	56436193		2203	4300	6503	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1360C>T	8.37:g.56436193C>T	ENSP00000328326:p.Arg454Cys		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R454C	ENST00000327381.6	37	c.1360	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484853	0.63962	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.70399	-0.48	5.69	4.81	0.61882	.	0.048023	0.85682	D	0.000000	D	0.85066	0.5612	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.87803	0.2626	10	0.87932	D	0	-18.4212	16.6446	0.85173	0.0:0.8699:0.1301:0.0	.	454	Q5GH76	XKR4_HUMAN	C	454	ENSP00000328326:R454C	ENSP00000328326:R454C	R	+	1	0	XKR4	56598747	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.279000	0.58953	1.389000	0.46526	0.655000	0.94253	CGC	XKR4	-	pfam_Transport_prot_XK	ENSG00000206579		0.448	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	57	0	C	NM_052898		56436193	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	29.33	53	22	SNP	1.000	T
XRCC2	7516	genome.wustl.edu	37	7	152345900	152345900	+	Nonsense_Mutation	SNP	T	T	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr7:152345900T>A	ENST00000359321.1	-	3	755	c.670A>T	c.(670-672)Aga>Tga	p.R224*	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	224					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		AGATAAGGTCTGTAGTCTATG	0.428								Homologous recombination																																									0													173.0	169.0	170.0					7																	152345900		2203	4300	6503	SO:0001587	stop_gained	0			Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.670A>T	7.37:g.152345900T>A	ENSP00000352271:p.Arg224*		B2R925	Nonsense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.R224*	ENST00000359321.1	37	c.670	CCDS5933.1	7	.	.	.	.	.	.	.	.	.	.	T	19.20	3.782479	0.70222	.	.	ENSG00000196584	ENST00000359321	.	.	.	5.06	2.6	0.31112	.	0.150969	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.7136	12.2623	0.54658	0.0:0.0:0.4062:0.5938	.	.	.	.	X	224	.	ENSP00000352271:R224X	R	-	1	2	XRCC2	151976833	0.998000	0.40836	0.248000	0.24265	0.258000	0.26162	1.724000	0.38064	0.245000	0.21373	0.383000	0.25322	AGA	XRCC2	-	superfamily_P-loop_NTPase	ENSG00000196584		0.428	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC2	HGNC	protein_coding	OTTHUMT00000322783.1	-	0.00	55	0	T	NM_005431		152345900	-1	tier1	-	no_errors	ENST00000359321	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	0.996	A
ZBTB7A	51341	genome.wustl.edu	37	19	4048040	4048040	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:4048040C>T	ENST00000322357.4	-	3	1743	c.1465G>A	c.(1465-1467)Ggc>Agc	p.G489S	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.G489S	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	489					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTTGCAGCCGTCTTTCTTG	0.761																																																	0													39.0	36.0	37.0					19																	4048040		2203	4300	6503	SO:0001583	missense	0			AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.1465G>A	19.37:g.4048040C>T	ENSP00000323670:p.Gly489Ser		D6W619|O00456|Q14D41|Q5XG86	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G489S	ENST00000322357.4	37	c.1465	CCDS12119.1	19	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384641	0.61845	.	.	ENSG00000178951	ENST00000322357	T	0.12361	2.69	4.0	4.0	0.46444	Zinc finger, C2H2 (1);	0.000000	0.64402	U	0.000001	T	0.05044	0.0135	N	0.11560	0.145	0.41225	D	0.986533	P	0.48162	0.906	B	0.35182	0.197	T	0.45498	-0.9257	10	0.16896	T	0.51	.	7.6673	0.28439	0.0:0.8809:0.0:0.1191	.	489	O95365	ZBT7A_HUMAN	S	489	ENSP00000323670:G489S	ENSP00000323670:G489S	G	-	1	0	ZBTB7A	3999040	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.472000	0.45136	1.785000	0.52413	0.549000	0.68633	GGC	ZBTB7A	-	pfscan_Znf_C2H2	ENSG00000178951		0.761	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7A	HGNC	protein_coding	OTTHUMT00000457621.2		0.00	30	0	C	NM_015898		4048040	-1			no_errors	ENST00000322357	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
ZDBF2	57683	genome.wustl.edu	37	2	207174427	207174428	+	Frame_Shift_Ins	INS	-	-	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr2:207174427_207174428insA	ENST00000374423.3	+	5	5561_5562	c.5175_5176insA	c.(5176-5178)aaafs	p.K1726fs		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1726							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GAAGGGCTGATAAAAAAAAACG	0.45																																																	0																																										SO:0001589	frameshift_variant	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5184dupA	2.37:g.207174436_207174436dupA	ENSP00000363545:p.Lys1726fs		Q6ZNP7|Q6ZSN8	Frame_Shift_Ins	INS	pfam_Znf_DBF,smart_Znf_DBF	p.R1728fs	ENST00000374423.3	37	c.5175_5176	CCDS46501.1	2																																																																																			ZDBF2	-	NULL	ENSG00000204186		0.450	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1		0.00	29	0	-	NM_020923		207174428	+1	tier1		no_errors	ENST00000374423	ensembl	human	known	74_37	frame_shift_ins	6.90	27	2	INS	0.000:0.000	A
ZFP14	57677	genome.wustl.edu	37	19	36831606	36831606	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:36831606C>T	ENST00000270001.7	-	5	1237	c.1122G>A	c.(1120-1122)ggG>ggA	p.G374G		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TAAAAGTCTTCCCACATTCCT	0.378																																																	0													105.0	98.0	100.0					19																	36831606		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1122G>A	19.37:g.36831606C>T			A7MD23	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G374	ENST00000270001.7	37	c.1122	CCDS33002.1	19																																																																																			ZFP14	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000142065		0.378	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP14	HGNC	protein_coding	OTTHUMT00000452528.1	-	0.00	57	0	C	NM_020917		36831606	-1	tier1	-	no_errors	ENST00000270001	ensembl	human	known	74_37	silent	8.33	44	4	SNP	1.000	T
ZFP64	55734	genome.wustl.edu	37	20	50701305	50701305	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr20:50701305G>A	ENST00000361387.2	-	9	1789	c.1729C>T	c.(1729-1731)Cag>Tag	p.Q577*	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Nonsense_Mutation_p.Q358*	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						AAGGCCCTCTGCGTCACGATC	0.612																																																	0													58.0	47.0	50.0					20																	50701305		2203	4300	6503	SO:0001587	stop_gained	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1729C>T	20.37:g.50701305G>A	ENSP00000355179:p.Gln577*		Q9NTS7|Q9NVH4	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q577*	ENST00000361387.2	37	c.1729	CCDS13439.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.632900	0.96682	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	.	.	.	4.4	3.37	0.38596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	10.1624	0.42860	0.0:0.0:0.6061:0.3939	.	.	.	.	X	358;577	.	ENSP00000355179:Q577X	Q	-	1	0	ZFP64	50134712	1.000000	0.71417	0.978000	0.43139	0.954000	0.61252	3.974000	0.56852	2.440000	0.82611	0.655000	0.94253	CAG	ZFP64	-	NULL	ENSG00000020256		0.612	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	-	0.00	33	0	G	NM_018197		50701305	-1	tier1	-	no_errors	ENST00000361387	ensembl	human	known	74_37	nonsense	10.81	33	4	SNP	0.994	A
ZMAT1	84460	genome.wustl.edu	37	X	101186955	101186955	+	5'Flank	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chrX:101186955G>A	ENST00000372782.3	-	0	0				ZMAT1_ENST00000458570.1_5'UTR	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1							nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						CCGCCAGCGGGGTGACTGTGC	0.706																																																	0																																										SO:0001631	upstream_gene_variant	0			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044		X.37:g.101186955G>A	Exception_encountered		Q8NDS3|Q96JN6	RNA	SNP	-	NULL	ENST00000372782.3	37	NULL	CCDS35348.1	X																																																																																			ZMAT1	-	-	ENSG00000166432		0.706	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	HGNC	protein_coding	OTTHUMT00000057598.1	-	0.00	10	0	G			101186955	-1	tier1	-	no_errors	ENST00000488347	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.000	A
ZNF536	9745	genome.wustl.edu	37	19	30936428	30936428	+	Silent	SNP	C	C	T			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:30936428C>T	ENST00000355537.3	+	2	2106	c.1959C>T	c.(1957-1959)caC>caT	p.H653H		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	653					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCCGTGTCCACAAGCGGGACC	0.677																																																	0													61.0	68.0	65.0					19																	30936428		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1959C>T	19.37:g.30936428C>T			A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H653	ENST00000355537.3	37	c.1959	CCDS32984.1	19																																																																																			ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198597		0.677	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	105	0	C	NM_014717		30936428	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	silent	35.71	54	30	SNP	1.000	T
ZNF160	90338	genome.wustl.edu	37	19	53571879	53571879	+	Silent	SNP	A	A	G			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:53571879A>G	ENST00000429604.1	-	7	2323	c.1908T>C	c.(1906-1908)ctT>ctC	p.L636L	ZNF160_ENST00000599056.1_Silent_p.L636L|ZNF160_ENST00000418871.1_Silent_p.L636L|ZNF160_ENST00000601421.1_Silent_p.L600L	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	636					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		GATGAGTTGCAAGGTATGAAT	0.408																																																	0													108.0	106.0	107.0					19																	53571879		2203	4300	6503	SO:0001819	synonymous_variant	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1908T>C	19.37:g.53571879A>G			Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L636	ENST00000429604.1	37	c.1908	CCDS12859.1	19																																																																																			ZNF160	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170949		0.408	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	-	0.00	104	0	A	NM_033288		53571879	-1	tier1	-	no_errors	ENST00000418871	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.002	G
ZNF70	7621	genome.wustl.edu	37	22	24087105	24087105	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr22:24087105G>A	ENST00000341976.3	-	2	683	c.223C>T	c.(223-225)Cag>Tag	p.Q75*		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						CTTTGATGCTGAACAGGGCTT	0.493																																																	0													133.0	129.0	130.0					22																	24087105		2203	4300	6503	SO:0001587	stop_gained	0			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.223C>T	22.37:g.24087105G>A	ENSP00000339314:p.Gln75*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q75*	ENST00000341976.3	37	c.223	CCDS13812.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.682611	0.97759	.	.	ENSG00000187792	ENST00000341976	.	.	.	3.48	2.42	0.29668	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9002	0.47047	0.0:0.1934:0.8065:0.0	.	.	.	.	X	75	.	ENSP00000339314:Q75X	Q	-	1	0	ZNF70	22417105	0.000000	0.05858	0.047000	0.18901	0.959000	0.62525	-0.897000	0.04110	1.010000	0.39314	0.585000	0.79938	CAG	ZNF70	-	NULL	ENSG00000187792		0.493	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF70	HGNC	protein_coding	OTTHUMT00000319881.1	-	0.00	65	0	G	NM_021916		24087105	-1	tier1	-	no_errors	ENST00000341976	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	0.143	A
ZNF876P	642280	genome.wustl.edu	37	4	206477	206477	+	RNA	SNP	T	T	C			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr4:206477T>C	ENST00000356347.3	+	0	79					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCCTCAGTGATTCGGCCACAG	0.612																																																	0																																												0			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.206477T>C				RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-	ENSG00000198155		0.612	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	-	0.00	91	0	T	NR_027481		206477	+1	tier1	-	no_errors	ENST00000356347	ensembl	human	known	74_37	rna	32.31	44	21	SNP	0.003	C
ZSCAN5C	649137	genome.wustl.edu	37	19	56720435	56720435	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-A8Q7-01A-11D-A37C-09	TCGA-VR-A8Q7-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d7145197-3b67-4711-9569-3fee8911f214	b97bffec-210a-4795-a4f5-4711185cba7c	g.chr19:56720435G>A	ENST00000534327.1	+	5	1506	c.1357G>A	c.(1357-1359)Gca>Aca	p.A453T	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.A453T			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	453					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						CACCTACAAGGCAAATCTGAA	0.517																																																	0																																										SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1357G>A	19.37:g.56720435G>A	ENSP00000435234:p.Ala453Thr			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A453T	ENST00000534327.1	37	c.1357		19	.	.	.	.	.	.	.	.	.	.	G	11.33	1.608191	0.28623	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.60548	0.18;0.18	1.96	0.642	0.17765	.	.	.	.	.	T	0.51176	0.1659	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47328	-0.9126	6	0.46703	T	0.11	.	7.0308	0.24967	0.0:0.0:0.7336:0.2664	.	.	.	.	T	453	ENSP00000435234:A453T;ENSP00000365443:A453T	ENSP00000365443:A453T	A	+	1	0	ZSCAN5C	61412247	0.000000	0.05858	0.005000	0.12908	0.271000	0.26615	-4.145000	0.00286	1.098000	0.41479	0.195000	0.17529	GCA	ZSCAN5C	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204532		0.517	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	-	0.00	50	0	G	XM_001131980		56720435	+1	tier1	-	no_errors	ENST00000376267	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	A
