#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA8	10351	genome.wustl.edu	37	17	66925797	66925797	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:66925797G>T	ENST00000269080.2	-	7	981	c.844C>A	c.(844-846)Ctt>Att	p.L282I	ABCA8_ENST00000430352.2_Missense_Mutation_p.L282I|ABCA8_ENST00000586539.1_Missense_Mutation_p.L282I	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	282					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GCCAAGAAAAGGGCCATAATG	0.383																																																	0													85.0	81.0	82.0					17																	66925797		2203	4300	6503	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.844C>A	17.37:g.66925797G>T	ENSP00000269080:p.Leu282Ile		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L282I	ENST00000269080.2	37	c.844	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	G	2.635	-0.285537	0.05605	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	D;D	0.88277	-2.36;-2.36	4.75	-2.72	0.05968	.	0.479552	0.17627	N	0.167533	T	0.72803	0.3506	L	0.28054	0.825	0.09310	N	1	B;B;B;B;B	0.13594	0.002;0.005;0.008;0.002;0.002	B;B;B;B;B	0.16722	0.006;0.01;0.016;0.009;0.01	T	0.60388	-0.7273	10	0.02654	T	1	.	4.9544	0.14031	0.222:0.0:0.3452:0.4327	.	221;282;282;282;282	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	I	282;282;221	ENSP00000269080:L282I;ENSP00000402814:L282I	ENSP00000269080:L282I	L	-	1	0	ABCA8	64437392	0.000000	0.05858	0.026000	0.17262	0.880000	0.50808	-0.615000	0.05597	-0.167000	0.10871	-0.282000	0.10007	CTT	ABCA8	-	NULL	ENSG00000141338		0.383	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	-	0.00	47	0	G	NM_007168		66925797	-1	tier1	-	no_errors	ENST00000430352	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.005	T
ABCC11	85320	genome.wustl.edu	37	16	48247407	48247407	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:48247407G>A	ENST00000394747.1	-	9	1652	c.1303C>T	c.(1303-1305)Cct>Tct	p.P435S	ABCC11_ENST00000394748.1_Missense_Mutation_p.P435S|ABCC11_ENST00000356608.2_Missense_Mutation_p.P435S|ABCC11_ENST00000353782.5_Missense_Mutation_p.P435S|ABCC11_ENST00000537808.1_Missense_Mutation_p.P435S	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	435	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	ACTGCAATAGGCACAAAGAAC	0.562																																																	0													127.0	101.0	110.0					16																	48247407		2201	4300	6501	SO:0001583	missense	0			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1303C>T	16.37:g.48247407G>A	ENSP00000378230:p.Pro435Ser		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.P435S	ENST00000394747.1	37	c.1303	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269501	0.59540	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	D;D;D;D;D	0.94613	-3.47;-3.37;-3.37;-3.37;-2.79	4.25	4.25	0.50352	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.96451	0.8842	M	0.71581	2.175	0.39045	D	0.960217	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.97250	0.9897	10	0.72032	D	0.01	-23.1065	12.5312	0.56115	0.0:0.0:1.0:0.0	.	435;435	Q96J66-2;Q96J66	.;ABCCB_HUMAN	S	435	ENSP00000311326:P435S;ENSP00000349017:P435S;ENSP00000378231:P435S;ENSP00000378230:P435S;ENSP00000438530:P435S	ENSP00000311326:P435S	P	-	1	0	ABCC11	46804908	0.650000	0.27331	0.159000	0.22649	0.017000	0.09413	2.394000	0.44450	2.071000	0.62044	0.655000	0.94253	CCT	ABCC11	-	superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000121270		0.562	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	-	0.00	51	0	G	NM_032583		48247407	-1	tier1	-	no_errors	ENST00000356608	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.641	A
ABHD17B	51104	genome.wustl.edu	37	9	74489614	74489614	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:74489614G>T	ENST00000333421.6	-	2	494	c.383C>A	c.(382-384)tCt>tAt	p.S128Y	ABHD17B_ENST00000377041.2_Missense_Mutation_p.S128Y	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	128						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										ACCATATCCAGAATAATCATA	0.413																																																	0													85.0	85.0	85.0					9																	74489614		2203	4300	6503	SO:0001583	missense	0			AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.383C>A	9.37:g.74489614G>T	ENSP00000330222:p.Ser128Tyr		A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Dienelactn_hydro	p.S128Y	ENST00000333421.6	37	c.383	CCDS35043.1	9	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675301	0.88445	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.42900	0.96;0.96	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.76485	0.3994	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	T	0.81839	-0.0748	10	0.87932	D	0	-14.981	20.5827	0.99408	0.0:0.0:1.0:0.0	.	128;128	Q5VST6;Q5VST6-2	F108B_HUMAN;.	Y	128	ENSP00000366240:S128Y;ENSP00000330222:S128Y	ENSP00000330222:S128Y	S	-	2	0	FAM108B1	73679434	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	TCT	ABHD17B	-	NULL	ENSG00000107362		0.413	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABHD17B	HGNC	protein_coding	OTTHUMT00000052625.1	-	0.00	33	0	G	NM_016014		74489614	-1	tier1	-	no_errors	ENST00000377041	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
AFG3L2	10939	genome.wustl.edu	37	18	12351111	12351111	+	Missense_Mutation	SNP	G	G	T	rs550200835		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:12351111G>T	ENST00000269143.3	-	12	1756	c.1525C>A	c.(1525-1527)Ctg>Atg	p.L509M		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	509					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	AAAGATGCCAGTTTTCTTGCC	0.413																																																	0													121.0	113.0	116.0					18																	12351111		2203	4300	6503	SO:0001583	missense	0			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1525C>A	18.37:g.12351111G>T	ENSP00000269143:p.Leu509Met		Q6P1L0	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.L509M	ENST00000269143.3	37	c.1525	CCDS11859.1	18	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417569	0.42918	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	D	0.82619	-1.63	6.03	5.16	0.70880	Peptidase M41, FtsH (2);	0.050922	0.85682	D	0.000000	D	0.83394	0.5245	M	0.81802	2.56	0.52501	D	0.999951	B	0.28082	0.2	B	0.25506	0.061	T	0.81093	-0.1089	10	0.35671	T	0.21	-29.7122	15.617	0.76775	0.0663:0.0:0.9337:0.0	.	509	Q9Y4W6	AFG32_HUMAN	M	509;524	ENSP00000269143:L509M	ENSP00000269143:L509M	L	-	1	2	AFG3L2	12341111	1.000000	0.71417	0.983000	0.44433	0.984000	0.73092	5.435000	0.66532	1.540000	0.49301	0.557000	0.71058	CTG	AFG3L2	-	superfamily_P-loop_NTPase,tigrfam_FtsH	ENSG00000141385		0.413	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFG3L2	HGNC	protein_coding	OTTHUMT00000254603.2	-	0.00	98	0	G	NM_006796		12351111	-1	tier1	-	no_errors	ENST00000269143	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
AGBL5	60509	genome.wustl.edu	37	2	27276797	27276797	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:27276797C>A	ENST00000360131.4	+	4	580	c.421C>A	c.(421-423)Cat>Aat	p.H141N	AGBL5_ENST00000323064.8_Missense_Mutation_p.H141N|RP11-503P10.1_ENST00000607407.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	141					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.H141Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCCTTTGTTCATCGTTTCGT	0.552																																																	1	Substitution - Missense(1)	lung(1)											194.0	169.0	177.0					2																	27276797		2203	4300	6503	SO:0001583	missense	0			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.421C>A	2.37:g.27276797C>A	ENSP00000353249:p.His141Asn		A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.H141N	ENST00000360131.4	37	c.421	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515777	0.64634	.	.	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	T;T	0.15256	2.46;2.44	5.51	5.51	0.81932	.	0.084520	0.85682	D	0.000000	T	0.28830	0.0715	M	0.85630	2.765	0.58432	D	0.999996	B;B;B	0.27679	0.185;0.043;0.162	B;B;B	0.27380	0.065;0.047;0.079	T	0.07083	-1.0791	10	0.29301	T	0.29	-6.9724	18.1957	0.89820	0.0:1.0:0.0:0.0	.	141;141;141	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	N	141	ENSP00000323681:H141N;ENSP00000353249:H141N	ENSP00000323681:H141N	H	+	1	0	AGBL5	27130301	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.254000	0.78329	2.590000	0.87494	0.561000	0.74099	CAT	AGBL5	-	NULL	ENSG00000084693		0.552	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	-	0.00	58	0	C	NM_021831		27276797	+1	tier1	-	no_errors	ENST00000360131	ensembl	human	known	74_37	missense	32.81	43	21	SNP	1.000	A
AFTPH	54812	genome.wustl.edu	37	2	64796270	64796270	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:64796270C>T	ENST00000422803.1	+	4	2446	c.2132C>T	c.(2131-2133)gCa>gTa	p.A711V	AFTPH_ENST00000487769.1_Intron|AFTPH_ENST00000409183.1_Missense_Mutation_p.A342V|AFTPH_ENST00000238855.7_Missense_Mutation_p.A711V|AFTPH_ENST00000409933.1_Missense_Mutation_p.A711V|AFTPH_ENST00000238856.4_Missense_Mutation_p.A711V			Q6ULP2	AFTIN_HUMAN	aftiphilin	711					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						ATCCATGATGCACATGGCTTG	0.463																																																	0													165.0	155.0	158.0					2																	64796270		2203	4300	6503	SO:0001583	missense	0			AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.2132C>T	2.37:g.64796270C>T	ENSP00000397726:p.Ala711Val		D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	NULL	p.A711V	ENST00000422803.1	37	c.2132		2	.	.	.	.	.	.	.	.	.	.	C	34	5.324715	0.95708	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.61040	1.12;1.16;1.16;1.16;0.14	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.75817	0.3901	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.997;0.998	D;D;D;D	0.87578	0.994;0.998;0.973;0.955	T	0.78425	-0.2209	10	0.59425	D	0.04	-3.2586	18.2232	0.89907	0.0:1.0:0.0:0.0	.	711;711;711;711	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	V	711;711;711;711;342	ENSP00000238856:A711V;ENSP00000397726:A711V;ENSP00000238855:A711V;ENSP00000387071:A711V;ENSP00000386913:A342V	ENSP00000238855:A711V	A	+	2	0	AFTPH	64649774	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.743000	0.85020	2.362000	0.80069	0.650000	0.86243	GCA	AFTPH	-	NULL	ENSG00000119844		0.463	AFTPH-202	KNOWN	basic	protein_coding	AFTPH	HGNC	protein_coding		-	0.00	62	0	C	NM_017657		64796270	+1	tier1	-	no_errors	ENST00000422803	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ALG10	84920	genome.wustl.edu	37	12	34175557	34175558	+	Frame_Shift_Ins	INS	-	-	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:34175557_34175558insT	ENST00000266483.2	+	1	342_343	c.23_24insT	c.(22-27)tatttcfs	p.YF8fs	RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Frame_Shift_Ins_p.YF8fs	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	8					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				GAAGGTTACTATTTCTCGGCCG	0.564																																																	0																																										SO:0001589	frameshift_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.26dupT	12.37:g.34175560_34175560dupT	ENSP00000266483:p.Tyr8fs		Q6NS98|Q96DU0|Q96SM6	Frame_Shift_Ins	INS	pfam_Alg10,pirsf_Alg10	p.S10fs	ENST00000266483.2	37	c.23_24	CCDS41769.1	12																																																																																			ALG10	-	pirsf_Alg10	ENSG00000139133		0.564	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	HGNC	protein_coding	OTTHUMT00000403309.1		0.00	104	0	-	NM_032834		34175558	+1	tier1		no_errors	ENST00000266483	ensembl	human	known	74_37	frame_shift_ins	21.84	68	19	INS	0.993:0.983	T
ALMS1	7840	genome.wustl.edu	37	2	73718079	73718079	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:73718079A>C	ENST00000264448.6	+	10	9101	c.8990A>C	c.(8989-8991)aAt>aCt	p.N2997T	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.N2955T	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2997					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GTGGAAAAGAATAATCAACAT	0.398																																																	0													105.0	100.0	101.0					2																	73718079		1908	4119	6027	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8990A>C	2.37:g.73718079A>C	ENSP00000264448:p.Asn2997Thr		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.N2997T	ENST00000264448.6	37	c.8990	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	A	11.78	1.740152	0.30865	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06849	3.25;3.25	3.77	3.77	0.43336	.	0.854537	0.09900	N	0.741210	T	0.08846	0.0219	L	0.43152	1.355	0.80722	D	1	P;P;P	0.46512	0.879;0.718;0.718	B;B;B	0.39258	0.295;0.295;0.295	T	0.20840	-1.0263	10	0.72032	D	0.01	.	9.2032	0.37272	1.0:0.0:0.0:0.0	.	2997;2955;2997	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	T	2955;2997	ENSP00000386627:N2955T;ENSP00000264448:N2997T	ENSP00000264448:N2997T	N	+	2	0	ALMS1	73571587	0.977000	0.34250	0.677000	0.29947	0.960000	0.62799	3.303000	0.51858	1.950000	0.56595	0.528000	0.53228	AAT	ALMS1	-	NULL	ENSG00000116127		0.398	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	36	0	A	NM_015120		73718079	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	24.24	25	8	SNP	0.719	C
ALS2CR11	151254	genome.wustl.edu	37	2	202469371	202469371	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:202469371G>T	ENST00000286195.3	-	2	325	c.281C>A	c.(280-282)aCa>aAa	p.T94K	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.T94K|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.T94K|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.T94K	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	94										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CGTCTCCTGTGTTATTTCCAG	0.328																																																	0													149.0	145.0	146.0					2																	202469371		2203	4299	6502	SO:0001583	missense	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.281C>A	2.37:g.202469371G>T	ENSP00000286195:p.Thr94Lys		C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_dom	p.T94K	ENST00000286195.3	37	c.281	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379914	0.42207	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74	5.32	-0.73	0.11154	.	1.195360	0.05928	N	0.634721	D	0.91885	0.7431	L	0.51422	1.61	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.11329	0.006;0.004;0.004	T	0.80365	-0.1413	10	0.54805	T	0.06	.	3.1732	0.06560	0.3291:0.0:0.3722:0.2987	.	94;94;94	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	K	94	ENSP00000286195:T94K;ENSP00000400672:T94K;ENSP00000409937:T94K;ENSP00000399016:T94K	ENSP00000286195:T94K	T	-	2	0	ALS2CR11	202177616	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.046000	0.14035	-0.028000	0.13850	-0.733000	0.03571	ACA	ALS2CR11	-	NULL	ENSG00000155754		0.328	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	-	0.00	72	0	G	NM_152525		202469371	-1	tier1	-	no_errors	ENST00000286195	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.000	T
ARHGAP12	94134	genome.wustl.edu	37	10	32096465	32096466	+	3'UTR	INS	-	-	A	rs200026325	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:32096465_32096466insA	ENST00000344936.2	-	0	2895_2896				ARHGAP12_ENST00000375245.4_3'UTR|ARHGAP12_ENST00000396144.4_3'UTR|ARHGAP12_ENST00000492028.1_5'UTR|ARHGAP12_ENST00000375250.5_3'UTR|ARHGAP12_ENST00000311380.4_3'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				TCTGATCCCTCAAAAAAAAAGT	0.366													?|AAAAAAAAA|AAAAAAAAAA|unsure	44	0.00878594	0.0	0.0014	5008	,	,		18529	0.0387		0.001	False		,,,				2504	0.0031																0																																										SO:0001624	3_prime_UTR_variant	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.*121->T	10.37:g.32096474_32096474dupA			B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	RNA	INS	-	NULL	ENST00000344936.2	37	NULL	CCDS7170.1	10																																																																																			ARHGAP12	-	-	ENSG00000165322		0.366	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1		0.00	43	0	-			32096466	-1	tier1		no_errors	ENST00000492028	ensembl	human	known	74_37	rna	6.67	42	3	INS	0.992:0.771	A
ARMC9	80210	genome.wustl.edu	37	2	232081450	232081450	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:232081450G>T	ENST00000349938.4	+	5	642	c.448G>T	c.(448-450)Gcc>Tcc	p.A150S	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	150						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TCCTTTCTATGCCCTTCCTTT	0.463																																																	0													216.0	194.0	201.0					2																	232081450		2203	4300	6503	SO:0001583	missense	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.448G>T	2.37:g.232081450G>T	ENSP00000258417:p.Ala150Ser		Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.A150S	ENST00000349938.4	37	c.448	CCDS2484.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.458813	0.96240	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000440107	T;T	0.19669	2.13;2.13	5.5	5.5	0.81552	.	0.110233	0.64402	D	0.000009	T	0.51941	0.1704	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55296	-0.8163	10	0.66056	D	0.02	-21.2915	19.3894	0.94574	0.0:0.0:1.0:0.0	.	150	Q7Z3E5	ARMC9_HUMAN	S	150	ENSP00000258417:A150S;ENSP00000387391:A150S	ENSP00000258417:A150S	A	+	1	0	ARMC9	231789694	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	9.504000	0.97986	2.573000	0.86826	0.655000	0.94253	GCC	ARMC9	-	NULL	ENSG00000135931		0.463	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	HGNC	protein_coding	OTTHUMT00000256966.3		0.00	63	0	G	NM_025139		232081450	+1			no_errors	ENST00000349938	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ASB17	127247	genome.wustl.edu	37	1	76397637	76397637	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:76397637G>A	ENST00000284142.6	-	1	479	c.340C>T	c.(340-342)Ctt>Ttt	p.L114F		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	114					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TTCTTGAGAAGCAATTCCACA	0.338																																																	0													64.0	63.0	63.0					1																	76397637		2203	4299	6502	SO:0001583	missense	0			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.340C>T	1.37:g.76397637G>A	ENSP00000284142:p.Leu114Phe		B1APB8|Q8N0X5	Missense_Mutation	SNP	pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_SOCS_C,pfscan_SOCS_C	p.L114F	ENST00000284142.6	37	c.340	CCDS671.1	1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488172	0.64074	.	.	ENSG00000154007	ENST00000284142	T	0.80909	-1.43	5.97	5.04	0.67666	Ankyrin repeat-containing domain (1);	0.000000	0.48286	D	0.000189	T	0.68897	0.3051	L	0.27053	0.805	0.36217	D	0.851711	D	0.59767	0.986	P	0.50970	0.655	T	0.76435	-0.2960	10	0.87932	D	0	.	12.3619	0.55207	0.0:0.0:0.8313:0.1687	.	114	Q8WXJ9	ASB17_HUMAN	F	114	ENSP00000284142:L114F	ENSP00000284142:L114F	L	-	1	0	ASB17	76170225	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.367000	0.44213	1.488000	0.48433	0.655000	0.94253	CTT	ASB17	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000154007		0.338	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB17	HGNC	protein_coding	OTTHUMT00000026982.1		0.00	38	0	G	NM_080868		76397637	-1			no_errors	ENST00000284142	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
ASB17	127247	genome.wustl.edu	37	1	76397722	76397722	+	Silent	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:76397722A>G	ENST00000284142.6	-	1	394	c.255T>C	c.(253-255)ttT>ttC	p.F85F		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	85					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						AGTCGAGGTTAAAACTTACTT	0.373																																																	0													114.0	106.0	109.0					1																	76397722		2203	4300	6503	SO:0001819	synonymous_variant	0			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.255T>C	1.37:g.76397722A>G			B1APB8|Q8N0X5	Silent	SNP	pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_SOCS_C,pfscan_SOCS_C	p.F85	ENST00000284142.6	37	c.255	CCDS671.1	1																																																																																			ASB17	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000154007		0.373	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB17	HGNC	protein_coding	OTTHUMT00000026982.1	-	0.00	55	0	A	NM_080868		76397722	-1	tier1	-	no_errors	ENST00000284142	ensembl	human	known	74_37	silent	34.48	38	20	SNP	1.000	G
ATRNL1	26033	genome.wustl.edu	37	10	116975491	116975491	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:116975491C>T	ENST00000355044.3	+	9	1511	c.1385C>T	c.(1384-1386)gCt>gTt	p.A462V		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	462					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACTAAAGGAGCTATTGTACAA	0.308																																																	0													101.0	88.0	92.0					10																	116975491		2203	4300	6503	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1385C>T	10.37:g.116975491C>T	ENSP00000347152:p.Ala462Val		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.A462V	ENST00000355044.3	37	c.1385	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462230	0.84425	.	.	ENSG00000107518	ENST00000355044	T	0.66815	-0.23	5.33	4.4	0.53042	Kelch-type beta propeller (1);	0.102442	0.64402	N	0.000003	T	0.78898	0.4356	M	0.73217	2.22	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.76107	-0.3080	10	0.18710	T	0.47	-3.5196	15.7393	0.77876	0.0:0.863:0.137:0.0	.	462	Q5VV63	ATRN1_HUMAN	V	462	ENSP00000347152:A462V	ENSP00000347152:A462V	A	+	2	0	ATRNL1	116965481	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.312000	0.59154	1.199000	0.43173	0.536000	0.68110	GCT	ATRNL1	-	NULL	ENSG00000107518		0.308	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	47	0	C	XM_049349		116975491	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	9.09	39	4	SNP	1.000	T
BARX2	8538	genome.wustl.edu	37	11	129312648	129312648	+	Intron	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:129312648G>T	ENST00000281437.4	+	3	584				BARX2_ENST00000526127.1_Intron|BARX2_ENST00000531946.1_Missense_Mutation_p.C14F	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2						cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		GCTGGAGCCTGTCTGGAGCCT	0.537																																																	0																																										SO:0001627	intron_variant	0			AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.489-82G>T	11.37:g.129312648G>T			O43518|Q6NT51	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.C14F	ENST00000281437.4	37	c.41	CCDS8481.1	11	.	.	.	.	.	.	.	.	.	.	G	4.927	0.172233	0.09391	.	.	ENSG00000043039	ENST00000531946	D	0.89939	-2.59	5.05	0.944	0.19537	.	.	.	.	.	D	0.82332	0.5014	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.69416	-0.5151	5	.	.	.	.	5.184	0.15174	0.2699:0.154:0.5762:0.0	.	.	.	.	F	14	ENSP00000450418:C14F	.	C	+	2	0	BARX2	128817858	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.464000	0.06688	0.235000	0.21160	-0.140000	0.14226	TGT	BARX2	-	NULL	ENSG00000043039		0.537	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARX2	HGNC	protein_coding	OTTHUMT00000386153.1	-	0.00	40	0	G	NM_003658		129312648	+1	tier1	-	no_errors	ENST00000531946	ensembl	human	putative	74_37	missense	56.25	14	18	SNP	0.000	T
BEND2	139105	genome.wustl.edu	37	X	18221727	18221727	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrX:18221727G>T	ENST00000380033.4	-	5	933	c.801C>A	c.(799-801)tcC>tcA	p.S267S	BEND2_ENST00000380030.3_Silent_p.S267S	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	267										NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TTGCCAGACTGGATTCTCTTC	0.463																																																	0													149.0	127.0	135.0					X																	18221727		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.801C>A	X.37:g.18221727G>T			E9PFY2|Q4V9S2|Q5JXE5	Silent	SNP	pfam_BEN_domain	p.S267	ENST00000380033.4	37	c.801	CCDS14184.1	X																																																																																			BEND2	-	NULL	ENSG00000177324		0.463	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	-	0.00	67	0	G	NM_153346		18221727	-1	tier1	-	no_errors	ENST00000380033	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.000	T
BMP2K	55589	genome.wustl.edu	37	4	79792166	79792166	+	Missense_Mutation	SNP	C	C	G	rs202184856|rs200441916	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr4:79792166C>G	ENST00000335016.5	+	11	1627	c.1461C>G	c.(1459-1461)caC>caG	p.H487Q	BMP2K_ENST00000502871.1_Missense_Mutation_p.H487Q	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	487	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						agcagcagcaccaccaccacc	0.502													c|||	68	0.0135783	0.0416	0.0043	5008	,	,		11259	0.001		0.007	False		,,,				2504	0.002																0								-	GLN/HIS,GLN/HIS	12,4302		0,12,2145	20.0	24.0	23.0		1461,1461		0.1	4		23	2,8424		0,2,4211	no	missense,missense	BMP2K	NM_017593.3,NM_198892.1	24,24	0,14,6356	GG,GC,CC		0.0237,0.2782,0.1099	possibly-damaging,possibly-damaging	487/663,487/1162	79792166	14,12726	2157	4213	6370	SO:0001583	missense	0			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1461C>G	4.37:g.79792166C>G	ENSP00000334836:p.His487Gln		O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H487Q	ENST00000335016.5	37	c.1461	CCDS47083.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.755|0.755	-0.771272|-0.771272	0.02951|0.02951	0.002782|0.002782	2.37E-4|2.37E-4	ENSG00000138756|ENSG00000138756	ENST00000502871;ENST00000335016;ENST00000264889|ENST00000502613	T;T|.	0.71341|.	1.16;-0.56|.	.|.	.|.	.|.	.|.	3.253760|.	0.01410|.	N|.	0.013962|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.39094|.	0.659;0.404|.	B;B|.	0.18263|.	0.021;0.021|.	T|T	0.24119|0.24119	-1.0169|-1.0169	9|4	0.10902|.	T|.	0.67|.	.|.	3.2348|3.2348	0.06761|0.06761	0.4658:0.5342:0.0:0.0|0.4658:0.5342:0.0:0.0	.|.	487;487|.	Q9NSY1;Q4W5H2|.	BMP2K_HUMAN;.|.	Q|A	487;487;501|180	ENSP00000421768:H487Q;ENSP00000334836:H487Q|.	ENSP00000264889:H501Q|.	H|P	+|+	3|1	2|0	BMP2K|BMP2K	80011190|80011190	0.000000|0.000000	0.05858|0.05858	0.126000|0.126000	0.21872|0.21872	0.030000|0.030000	0.12068|0.12068	-1.617000|-1.617000	0.02051|0.02051	0.372000|0.372000	0.24591|0.24591	0.377000|0.377000	0.23210|0.23210	CAC|CCA	BMP2K	-	NULL	ENSG00000138756		0.502	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	HGNC	protein_coding		-	0.00	61	0	C	NM_017593		79792166	+1	tier1	rs200441916	no_errors	ENST00000335016	ensembl	human	known	74_37	missense	8.77	51	5	SNP	0.883	G
BSG	682	genome.wustl.edu	37	19	581392	581392	+	Silent	SNP	G	G	C	rs147227117		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:581392G>C	ENST00000333511.3	+	6	940	c.870G>C	c.(868-870)ctG>ctC	p.L290L	BSG_ENST00000353555.4_Silent_p.L174L|BSG_ENST00000545507.2_Silent_p.L81L|BSG_ENST00000346916.4_Silent_p.L110L	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	290	Ig-like V-type.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGAGAACCTGAACATGGAGG	0.647																																																	0													46.0	45.0	46.0					19																	581392		2202	4298	6500	SO:0001819	synonymous_variant	0			L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.870G>C	19.37:g.581392G>C			A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L290	ENST00000333511.3	37	c.870	CCDS12033.1	19																																																																																			BSG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000172270		0.647	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSG	HGNC	protein_coding	OTTHUMT00000438630.2	-	0.00	75	0	G	NM_001728		581392	+1	tier1	-	no_errors	ENST00000333511	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.988	C
BTAF1	9044	genome.wustl.edu	37	10	93719887	93719887	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:93719887A>G	ENST00000265990.6	+	11	1547	c.1239A>G	c.(1237-1239)atA>atG	p.I413M	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	413					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGCTGGGAATAAAATATGCTT	0.373																																																	0													162.0	163.0	163.0					10																	93719887		2203	4300	6503	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1239A>G	10.37:g.93719887A>G	ENSP00000265990:p.Ile413Met		B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I413M	ENST00000265990.6	37	c.1239	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814684	0.70912	.	.	ENSG00000095564	ENST00000265990	T	0.68903	-0.36	5.12	3.95	0.45737	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75117	0.3806	L	0.60904	1.88	0.80722	D	1	D	0.67145	0.996	D	0.63877	0.919	T	0.75147	-0.3420	10	0.59425	D	0.04	0.8094	11.117	0.48266	0.8614:0.0:0.0:0.1386	.	413	O14981	BTAF1_HUMAN	M	413	ENSP00000265990:I413M	ENSP00000265990:I413M	I	+	3	3	BTAF1	93709867	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.606000	0.46291	0.748000	0.32831	0.477000	0.44152	ATA	BTAF1	-	superfamily_ARM-type_fold	ENSG00000095564		0.373	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	-	0.00	41	0	A	NM_003972		93719887	+1	tier1	-	no_errors	ENST00000265990	ensembl	human	known	74_37	missense	39.47	23	15	SNP	1.000	G
C10orf76	79591	genome.wustl.edu	37	10	103771512	103771512	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:103771512G>T	ENST00000370033.4	-	11	918	c.799C>A	c.(799-801)Caa>Aaa	p.Q267K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	124.0	124.0					10																	103771512		1823	4079	5902	SO:0001583	missense	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>A	10.37:g.103771512G>T	ENSP00000359050:p.Gln267Lys		Q2TB87|Q9H8Z9	Missense_Mutation	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.Q267K	ENST00000370033.4	37	c.799	CCDS41563.1	10	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258640	0.59321	.	.	ENSG00000120029	ENST00000370033	T	0.65364	-0.15	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	T	0.56202	0.1969	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.24974	0.057	T	0.54456	-0.8291	10	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	267	Q5T2E6	CJ076_HUMAN	K	267	ENSP00000359050:Q267K	ENSP00000359050:Q267K	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	C10orf76	-	superfamily_ARM-type_fold	ENSG00000120029		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1		0.00	36	0	G	NM_024541		103771512	-1			no_errors	ENST00000370033	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
DDIAS	220042	genome.wustl.edu	37	11	82643985	82643985	+	Silent	SNP	G	G	T	rs139413374		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:82643985G>T	ENST00000533655.1	+	6	1817	c.1605G>T	c.(1603-1605)ccG>ccT	p.P535P	C11orf82_ENST00000329143.3_Silent_p.P234P|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Silent_p.P535P	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		535					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						ATTTTTTACCGAATCCTTACC	0.373																																																	0													31.0	30.0	30.0					11																	82643985		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000533655.1:c.1605G>T	11.37:g.82643985G>T			Q96LK6|Q9H856	Silent	SNP	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold	p.P535	ENST00000533655.1	37	c.1605	CCDS8263.1	11																																																																																			C11orf82	-	NULL	ENSG00000165490		0.373	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf82	HGNC	protein_coding	OTTHUMT00000391936.1		0.00	38	0	G			82643985	+1			no_errors	ENST00000430323	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.001	T
CFAP61	26074	genome.wustl.edu	37	20	20258012	20258012	+	Silent	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:20258012C>A	ENST00000245957.5	+	22	2782	c.2706C>A	c.(2704-2706)atC>atA	p.I902I	C20orf26_ENST00000377309.2_Silent_p.I258I	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		902										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GGGATGCGATCCTGGCCCAGT	0.627																																																	0													114.0	104.0	107.0					20																	20258012		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000245957.5:c.2706C>A	20.37:g.20258012C>A			A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.I902	ENST00000245957.5	37	c.2706	CCDS33447.1	20																																																																																			C20orf26	-	NULL	ENSG00000089101		0.627	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	-	0.00	38	0	C			20258012	+1	tier1	-	no_errors	ENST00000245957	ensembl	human	known	74_37	silent	33.33	30	15	SNP	0.152	A
CARF	79800	genome.wustl.edu	37	2	203848307	203848308	+	Frame_Shift_Ins	INS	-	-	A	rs201520695	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:203848307_203848308insA	ENST00000402905.3	+	16	2459_2460	c.2138_2139insA	c.(2137-2142)gcaaaafs	p.AK713fs	CARF_ENST00000545262.1_Frame_Shift_Ins_p.AK637fs|WDR12_ENST00000477723.1_Intron|CARF_ENST00000545253.1_Frame_Shift_Ins_p.AK625fs|CARF_ENST00000428585.1_Frame_Shift_Ins_p.AK637fs|CARF_ENST00000320443.8_Frame_Shift_Ins_p.AK713fs|CARF_ENST00000438828.2_Frame_Shift_Ins_p.AK713fs|CARF_ENST00000414439.1_Frame_Shift_Ins_p.AK611fs	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	713					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCTATGGAAGCAAAAAAAACTG	0.327													aAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	4	0.000798722	0.0	0.0014	5008	,	,		15628	0.0		0.003	False		,,,				2504	0.0																0									,	4,3484		0,4,1740					,	3.1	0.9			85	60,7742		0,60,3841	no	frameshift,frameshift	ALS2CR8	NM_024744.14,NM_001104586.1	,	0,64,5581	A1A1,A1R,RR		0.769,0.1147,0.5669	,	,		64,11226				SO:0001589	frameshift_variant	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.2146dupA	2.37:g.203848315_203848315dupA	ENSP00000384006:p.Ala713fs		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Frame_Shift_Ins	INS	NULL	p.T716fs	ENST00000402905.3	37	c.2138_2139	CCDS42801.1	2																																																																																			CARF	-	NULL	ENSG00000138380		0.327	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARF	HGNC	protein_coding	OTTHUMT00000335768.5		0.00	72	0	-	NM_001104586		203848308	+1	tier1		no_errors	ENST00000320443	ensembl	human	known	74_37	frame_shift_ins	13.11	53	8	INS	0.949:0.979	A
CCDC171	203238	genome.wustl.edu	37	9	15578911	15578911	+	Missense_Mutation	SNP	G	G	T	rs371347398		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:15578911G>T	ENST00000380701.3	+	4	570	c.242G>T	c.(241-243)cGa>cTa	p.R81L	CCDC171_ENST00000297641.3_Missense_Mutation_p.R81L|CCDC171_ENST00000535968.1_Missense_Mutation_p.R81L	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	81																	GAAGCATTGCGACAAAGTCTG	0.468																																																	0													109.0	103.0	105.0					9																	15578911		2203	4300	6503	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.242G>T	9.37:g.15578911G>T	ENSP00000370077:p.Arg81Leu		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	superfamily_STAT_TF_coiled-coil	p.R81L	ENST00000380701.3	37	c.242	CCDS6481.1	9	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581551	0.86748	.	.	ENSG00000164989	ENST00000535968;ENST00000297641;ENST00000380701	T;T;T	0.60424	0.19;0.19;0.19	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	L	0.34521	1.04	0.41623	D	0.988972	D;D;D;P	0.89917	1.0;1.0;1.0;0.943	D;D;D;P	0.85130	0.997;0.997;0.997;0.547	T	0.71062	-0.4701	10	0.62326	D	0.03	-7.8279	17.71	0.88319	0.0:0.0:1.0:0.0	.	81;81;81;81	B7ZM22;Q6TFL3-3;Q6TFL3;Q7Z3F8	.;.;CI093_HUMAN;.	L	81	ENSP00000438838:R81L;ENSP00000297641:R81L;ENSP00000370077:R81L	ENSP00000297641:R81L	R	+	2	0	C9orf93	15568911	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.902000	0.63266	2.477000	0.83638	0.455000	0.32223	CGA	CCDC171	-	NULL	ENSG00000164989		0.468	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4		0.00	36	0	G	NM_173550		15578911	+1			no_errors	ENST00000380701	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
CDC20	991	genome.wustl.edu	37	1	43825769	43825770	+	Splice_Site	INS	-	-	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:43825769_43825770insT	ENST00000372462.1	+	4	759		c.e4+1		RP1-92O14.3_ENST00000424948.1_RNA|CDC20_ENST00000310955.6_Splice_Site|CDC20_ENST00000478882.1_Splice_Site			Q12834	CDC20_HUMAN	cell division cycle 20						activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AATGACTATTGTAAGTGCATCC	0.535																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)												0																																										SO:0001630	splice_region_variant	0			U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.556+1->T	1.37:g.43825770_43825770dupT			B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Splice_Site	INS	-	e4+1	ENST00000372462.1	37	c.556+1_556+1	CCDS484.1	1																																																																																			CDC20	-	-	ENSG00000117399		0.535	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDC20	HGNC	protein_coding	OTTHUMT00000019488.1		0.00	42	0	-	NM_001255	Intron	43825770	+1	tier1		no_errors	ENST00000310955	ensembl	human	known	74_37	splice_site_ins	23.33	23	7	INS	1.000:1.000	T
CDH16	1014	genome.wustl.edu	37	16	66944394	66944394	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:66944394G>T	ENST00000299752.4	-	15	2129	c.1936C>A	c.(1936-1938)Ctg>Atg	p.L646M	CDH16_ENST00000565796.1_Intron|CDH16_ENST00000570262.1_Missense_Mutation_p.L566M|CDH16_ENST00000394055.3_Intron|CDH16_ENST00000568632.1_Missense_Mutation_p.L549M	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GAAGCGCTCAGTCTCGGCTCA	0.657																																																	0													68.0	73.0	71.0					16																	66944394		2200	4300	6500	SO:0001583	missense	0			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1936C>A	16.37:g.66944394G>T	ENSP00000299752:p.Leu646Met		B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L646M	ENST00000299752.4	37	c.1936	CCDS10823.1	16	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971689	0.53614	.	.	ENSG00000166589	ENST00000299752;ENST00000544875	T	0.55234	0.53	4.78	0.441	0.16577	Cadherin (3);Cadherin-like (1);	0.092994	0.44483	N	0.000441	T	0.39436	0.1078	M	0.62723	1.935	0.35302	D	0.783141	P;P	0.43287	0.802;0.802	B;B	0.36922	0.184;0.236	T	0.41466	-0.9507	9	.	.	.	-4.2804	3.7968	0.08743	0.2862:0.0:0.5442:0.1696	.	646;646	B2R7S8;O75309	.;CAD16_HUMAN	M	646;610	ENSP00000299752:L646M	.	L	-	1	2	CDH16	65501895	0.724000	0.28038	0.283000	0.24790	0.798000	0.45092	0.839000	0.27586	0.227000	0.20999	0.455000	0.32223	CTG	CDH16	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166589		0.657	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH16	HGNC	protein_coding	OTTHUMT00000268839.2	-	0.00	66	0	G	NM_004062		66944394	-1	tier1	-	no_errors	ENST00000299752	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.131	T
CDK5RAP2	55755	genome.wustl.edu	37	9	123173662	123173662	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:123173662T>C	ENST00000349780.4	-	29	4567	c.4388A>G	c.(4387-4389)aAt>aGt	p.N1463S	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.N1422S|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.N1431S|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.N1463S	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1463					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						GAGCATTGCATTGAGGGCCTG	0.423																																																	0													154.0	146.0	148.0					9																	123173662		2203	4300	6503	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4388A>G	9.37:g.123173662T>C	ENSP00000343818:p.Asn1463Ser		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.N1463S	ENST00000349780.4	37	c.4388	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	T	13.60	2.285521	0.40394	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.54	4.18	0.49190	.	0.190443	0.36482	N	0.002564	T	0.19927	0.0479	N	0.25426	0.745	0.26717	N	0.970857	B;B;B;B;B;B	0.31193	0.041;0.312;0.141;0.204;0.208;0.019	B;B;B;B;B;B	0.29524	0.011;0.103;0.067;0.046;0.048;0.011	T	0.12734	-1.0536	10	0.45353	T	0.12	.	8.1812	0.31311	0.0:0.1193:0.0:0.8807	.	473;1232;1431;1463;1463;857	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	S	1431;1422;1463;1463;857;473;1235	ENSP00000354065:N1431S;ENSP00000352258:N1422S;ENSP00000343818:N1463S;ENSP00000353317:N1463S;ENSP00000400395:N857S;ENSP00000409941:N473S	ENSP00000341695:N1235S	N	-	2	0	CDK5RAP2	122213483	1.000000	0.71417	0.663000	0.29738	0.824000	0.46624	5.170000	0.64990	0.729000	0.32403	0.459000	0.35465	AAT	CDK5RAP2	-	NULL	ENSG00000136861		0.423	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	-	0.00	43	0	T	NM_018249		123173662	-1	tier1	-	no_errors	ENST00000349780	ensembl	human	known	74_37	missense	70.00	12	28	SNP	0.970	C
CHODL	140578	genome.wustl.edu	37	21	19635169	19635169	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr21:19635169G>A	ENST00000299295.2	+	5	1087	c.696G>A	c.(694-696)ctG>ctA	p.L232L	CHODL_ENST00000543733.1_Silent_p.L213L|CHODL_ENST00000400128.1_Silent_p.L191L|CHODL_ENST00000400131.1_Intron|CHODL_ENST00000400135.1_Intron|CHODL_ENST00000400127.1_Silent_p.L191L|CHODL_ENST00000338326.3_Intron	NM_001204175.1|NM_024944.2	NP_001191104.1|NP_079220.2	Q9H9P2	CHODL_HUMAN	chondrolectin	232					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)	p.L232L(1)		kidney(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		TACTGATACTGGTTGCTTTTG	0.313																																																	1	Substitution - coding silent(1)	lung(1)											127.0	127.0	127.0					21																	19635169		2203	4297	6500	SO:0001819	synonymous_variant	0			AF257472	CCDS13570.1, CCDS56208.1, CCDS56209.1, CCDS56210.1	21q11.2	2006-04-03	2002-07-04		ENSG00000154645	ENSG00000154645			17807	protein-coding gene	gene with protein product		607247	"""chromosome 21 open reading frame 68"""	C21orf68		12079284	Standard	NM_024944		Approved	FLJ12627, PRED12, MT75	uc021whs.1	Q9H9P2	OTTHUMG00000074519	ENST00000299295.2:c.696G>A	21.37:g.19635169G>A			B2R9C0|B4DJB8|Q7Z798|Q7Z799|Q7Z7A0|Q9HCY3	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L232	ENST00000299295.2	37	c.696	CCDS13570.1	21																																																																																			CHODL	-	NULL	ENSG00000154645		0.313	CHODL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHODL	HGNC	protein_coding	OTTHUMT00000158232.1	-	0.00	67	0	G	NM_024944		19635169	+1	tier1	-	no_errors	ENST00000299295	ensembl	human	known	74_37	silent	20.63	50	13	SNP	1.000	A
COL11A2	1302	genome.wustl.edu	37	6	33147260	33147260	+	Missense_Mutation	SNP	G	G	A	rs143965711		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:33147260G>A	ENST00000374708.4	-	12	1451	c.1193C>T	c.(1192-1194)gCg>gTg	p.A398V	COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000395197.1_Missense_Mutation_p.A424V|COL11A2_ENST00000374714.1_Missense_Mutation_p.A458V|COL11A2_ENST00000374712.1_Missense_Mutation_p.A403V|COL11A2_ENST00000341947.2_Missense_Mutation_p.A484V|COL11A2_ENST00000357486.1_Missense_Mutation_p.A463V|COL11A2_ENST00000374713.1_Missense_Mutation_p.A437V|COL11A2_ENST00000361917.1_Missense_Mutation_p.A377V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	484	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TCCACGGAGCGCCAGCTAGGG	0.632																																					Melanoma(1;90 116 3946 5341 17093)												0									VAL/ALA,VAL/ALA,VAL/ALA	1,2969		0,1,1484	24.0	11.0	16.0		1130,1451,1193	4.8	1.0	6	dbSNP_134	16	0,5362		0,0,2681	no	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	64,64,64	0,1,4165	AA,AG,GG		0.0,0.0337,0.012	probably-damaging,probably-damaging,probably-damaging	377/1630,484/1737,398/1651	33147260	1,8331	1485	2681	4166	SO:0001583	missense	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1193C>T	6.37:g.33147260G>A	ENSP00000363840:p.Ala398Val		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A484V	ENST00000374708.4	37	c.1451	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	19.85	3.902925	0.72754	3.37E-4	0.0	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	D;D;D;D;D;D;D;D;D	0.90788	-2.48;-2.41;-2.44;-2.45;-2.45;-2.44;-2.55;-2.44;-2.73	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.94532	0.8239	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.81914	0.962;0.957;0.995	D	0.95062	0.8196	10	0.87932	D	0	.	15.3205	0.74117	0.0:0.0:1.0:0.0	.	377;398;484	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	V	398;484;463;458;437;424;403;377;484	ENSP00000363840:A398V;ENSP00000339915:A484V;ENSP00000350079:A463V;ENSP00000363846:A458V;ENSP00000363845:A437V;ENSP00000378623:A424V;ENSP00000363844:A403V;ENSP00000355123:A377V;ENSP00000405520:A484V	ENSP00000339915:A484V	A	-	2	0	COL11A2	33255238	1.000000	0.71417	0.954000	0.39281	0.213000	0.24496	5.939000	0.70179	2.477000	0.83638	0.549000	0.68633	GCG	COL11A2	-	NULL	ENSG00000204248		0.632	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	74	0	G			33147260	-1	tier1	rs143965711	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	20.27	59	15	SNP	0.998	A
CLVS2	134829	genome.wustl.edu	37	6	123376961	123376961	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:123376961A>C	ENST00000275162.5	+	5	2021	c.686A>C	c.(685-687)cAt>cCt	p.H229P	CLVS2_ENST00000368438.1_Missense_Mutation_p.H83P	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	229	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						ATATTTTTGCATGGTAACAAC	0.448																																																	0													145.0	130.0	135.0					6																	123376961		2203	4300	6503	SO:0001583	missense	0			AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.686A>C	6.37:g.123376961A>C	ENSP00000275162:p.His229Pro		B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.H229P	ENST00000275162.5	37	c.686	CCDS34525.1	6	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389430	0.82902	.	.	ENSG00000146352	ENST00000275162;ENST00000368438	T;T	0.76709	-1.04;-1.04	5.64	5.64	0.86602	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.88945	0.6575	M	0.91872	3.25	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.91572	0.5272	10	0.87932	D	0	-12.9149	15.8713	0.79122	1.0:0.0:0.0:0.0	.	229	Q5SYC1	CLVS2_HUMAN	P	229;83	ENSP00000275162:H229P;ENSP00000357423:H83P	ENSP00000275162:H229P	H	+	2	0	CLVS2	123418660	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.962000	0.93254	2.144000	0.66660	0.533000	0.62120	CAT	CLVS2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	ENSG00000146352		0.448	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLVS2	HGNC	protein_coding	OTTHUMT00000042042.2	-	0.00	37	0	A	NM_001010852		123376961	+1	tier1	-	no_errors	ENST00000275162	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	C
COL22A1	169044	genome.wustl.edu	37	8	139768056	139768056	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:139768056G>T	ENST00000303045.6	-	19	2365	c.1919C>A	c.(1918-1920)gCg>gAg	p.A640E	COL22A1_ENST00000435777.1_Missense_Mutation_p.A640E	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	640	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGTGGCCCCGCAGGTCCCAC	0.552										HNSCC(7;0.00092)																																							0													156.0	120.0	132.0					8																	139768056		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1919C>A	8.37:g.139768056G>T	ENSP00000303153:p.Ala640Glu		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.A640E	ENST00000303045.6	37	c.1919	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	0.317	-0.964400	0.02249	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93712	-3.27;-3.22	4.83	3.05	0.35203	.	0.628927	0.12878	U	0.431695	D	0.88306	0.6401	L	0.45470	1.425	0.09310	N	1	P	0.38827	0.649	B	0.34418	0.182	T	0.78471	-0.2191	10	0.38643	T	0.18	.	6.9299	0.24435	0.205:0.0:0.795:0.0	.	640	Q8NFW1	COMA1_HUMAN	E	640;640;353	ENSP00000303153:A640E;ENSP00000387655:A640E	ENSP00000303153:A640E	A	-	2	0	COL22A1	139837238	0.007000	0.16637	0.196000	0.23383	0.022000	0.10575	0.825000	0.27393	0.645000	0.30675	-0.339000	0.08088	GCG	COL22A1	-	NULL	ENSG00000169436		0.552	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2		0.00	32	0	G	XM_291257		139768056	-1			no_errors	ENST00000303045	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.027	T
COL6A3	1293	genome.wustl.edu	37	2	238259828	238259828	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:238259828C>T	ENST00000295550.4	-	27	7213	c.6761G>A	c.(6760-6762)gGa>gAa	p.G2254E	COL6A3_ENST00000472056.1_Missense_Mutation_p.G1647E|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2048E|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2048E|COL6A3_ENST00000346358.4_Missense_Mutation_p.G2054E|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2053E	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2254	Collagen-like 4.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2254V(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGCGGCACCTCCGCTTCCCTG	0.567																																																	1	Substitution - Missense(1)	large_intestine(1)											88.0	75.0	79.0					2																	238259828		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6761G>A	2.37:g.238259828C>T	ENSP00000295550:p.Gly2254Glu		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G2254E	ENST00000295550.4	37	c.6761	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	6.387	0.439595	0.12104	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.93547	-3.19;-3.19;-3.24;-3.19;-3.24;-3.19	5.42	3.5	0.40072	.	0.246772	0.28322	N	0.015762	D	0.91932	0.7445	L	0.52364	1.645	0.80722	D	1	P;P;D;P	0.55800	0.954;0.883;0.973;0.954	P;B;P;P	0.55923	0.726;0.327;0.787;0.617	D	0.89295	0.3622	10	0.02654	T	1	.	10.565	0.45167	0.1495:0.7067:0.1438:0.0	.	1647;1647;2048;2254	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	E	2254;2053;2048;1647;2048;2054	ENSP00000295550:G2254E;ENSP00000315609:G2053E;ENSP00000315873:G2048E;ENSP00000418285:G1647E;ENSP00000386844:G2048E;ENSP00000295546:G2054E	ENSP00000295550:G2254E	G	-	2	0	COL6A3	237924567	0.975000	0.34042	0.554000	0.28268	0.034000	0.12701	3.315000	0.51951	1.277000	0.44412	-0.175000	0.13238	GGA	COL6A3	-	NULL	ENSG00000163359		0.567	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	47	0	C	NM_004369		238259828	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	40.48	25	17	SNP	0.935	T
COL9A1	1297	genome.wustl.edu	37	6	70992691	70992691	+	Intron	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:70992691G>A	ENST00000357250.6	-	7	939				COL9A1_ENST00000489611.1_5'Flank|COL9A1_ENST00000370496.3_Intron|COL9A1_ENST00000320755.7_Missense_Mutation_p.A22V|COL9A1_ENST00000370499.4_Missense_Mutation_p.A22V	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TACTTGAGCCGCGCACAAGCA	0.642																																																	0													63.0	70.0	68.0					6																	70992691		2203	4300	6503	SO:0001627	intron_variant	0				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.781-70C>T	6.37:g.70992691G>A			Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	pfam_Collagen	p.A22V	ENST00000357250.6	37	c.65	CCDS4971.1	6	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804678	0.31961	.	.	ENSG00000112280	ENST00000320755;ENST00000370499	D;D	0.91686	-2.68;-2.89	5.23	-0.727	0.11166	.	.	.	.	.	T	0.70237	0.3201	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.60167	-0.7316	9	0.28530	T	0.3	.	8.1606	0.31196	0.6697:0.0:0.3303:0.0	.	22	P20849-2	.	V	22	ENSP00000315252:A22V;ENSP00000359530:A22V	ENSP00000315252:A22V	A	-	2	0	COL9A1	71049412	0.002000	0.14202	0.005000	0.12908	0.881000	0.50899	0.427000	0.21379	-0.052000	0.13311	0.561000	0.74099	GCG	COL9A1	-	NULL	ENSG00000112280		0.642	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	HGNC	protein_coding	OTTHUMT00000041131.2		0.00	68	0	G			70992691	-1			no_errors	ENST00000320755	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.019	A
CPT1B	1375	genome.wustl.edu	37	22	51015018	51015018	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr22:51015018G>T	ENST00000360719.2	-	5	645	c.508C>A	c.(508-510)Cag>Aag	p.Q170K	CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000405237.3_Missense_Mutation_p.Q170K|CPT1B_ENST00000457250.1_Intron|CPT1B_ENST00000312108.7_Missense_Mutation_p.Q170K|CPT1B_ENST00000395650.2_Missense_Mutation_p.Q170K|CPT1B_ENST00000434492.2_5'UTR|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000440709.1_Missense_Mutation_p.Q170K	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	170					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		AGAGATGTCTGGAAGCTGTAG	0.587											OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(170;988 1933 25577 30295 48163)												0													39.0	38.0	38.0					22																	51015018		2201	4298	6499	SO:0001583	missense	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.508C>A	22.37:g.51015018G>T	ENSP00000353945:p.Gln170Lys	974	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.Q170K	ENST00000360719.2	37	c.508	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323282	0.81580	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000440709;ENST00000395650	D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.95680	0.8595	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	0.975;1.0	D;D	0.91635	0.953;0.999	D	0.96244	0.9178	10	0.87932	D	0	-23.659	15.4193	0.74997	0.0:0.0:1.0:0.0	.	170;170	E9PCP2;Q92523	.;CPT1B_HUMAN	K	170	ENSP00000385486:Q170K;ENSP00000312189:Q170K;ENSP00000353945:Q170K;ENSP00000414713:Q170K;ENSP00000379011:Q170K	ENSP00000312189:Q170K	Q	-	1	0	CPT1B	49361884	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.149000	0.94659	2.514000	0.84764	0.491000	0.48974	CAG	CPT1B	-	NULL	ENSG00000205560		0.587	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	-	0.00	38	0	G	NM_152246		51015018	-1	tier1	-	no_errors	ENST00000312108	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
CTBS	1486	genome.wustl.edu	37	1	85040024	85040024	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:85040024C>T	ENST00000370630.5	-	1	123	c.75G>A	c.(73-75)ctG>ctA	p.L25L	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	25					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ccagcagcgccagcagcgcTA	0.726																																																	0													3.0	4.0	4.0					1																	85040024		1689	3502	5191	SO:0001819	synonymous_variant	0			M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.75G>A	1.37:g.85040024C>T			Q5VX50	Silent	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.L25	ENST00000370630.5	37	c.75	CCDS698.1	1																																																																																			CTBS	-	NULL	ENSG00000117151		0.726	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBS	HGNC	protein_coding	OTTHUMT00000027457.2		0.00	14	0	C	NM_004388		85040024	-1			no_errors	ENST00000370630	ensembl	human	known	74_37	silent	18.18	9	2	SNP	0.006	T
CTNNB1	1499	genome.wustl.edu	37	3	41278166	41278166	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:41278166C>T	ENST00000349496.5	+	13	2322	c.2042C>T	c.(2041-2043)tCt>tTt	p.S681F	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S681F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S681F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S674F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S681F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	681					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E632_S681>SV(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTGACCAGCTCTCTCTTCAGA	0.458		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	1	Complex - deletion inframe(1)	kidney(1)											133.0	134.0	134.0					3																	41278166		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.2042C>T	3.37:g.41278166C>T	ENSP00000344456:p.Ser681Phe		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.S681F	ENST00000349496.5	37	c.2042	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.370655	0.95900	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.71476	0.3344	M	0.80183	2.485	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.56434	0.792;0.798	T	0.75473	-0.3305	10	0.87932	D	0	-0.5496	19.8246	0.96612	0.0:1.0:0.0:0.0	.	609;681	B4DSW9;P35222	.;CTNB1_HUMAN	F	681;681;681;674;681	ENSP00000385604:S681F;ENSP00000379486:S681F;ENSP00000344456:S681F;ENSP00000411226:S674F;ENSP00000379488:S681F	ENSP00000344456:S681F	S	+	2	0	CTNNB1	41253170	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.676000	0.91093	0.563000	0.77884	TCT	CTNNB1	-	NULL	ENSG00000168036		0.458	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	-	0.00	38	0	C	NM_001098210		41278166	+1	tier1	-	no_errors	ENST00000349496	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	T
CWC22	57703	genome.wustl.edu	37	2	180843003	180843003	+	Silent	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:180843003T>A	ENST00000410053.3	-	6	794	c.495A>T	c.(493-495)tcA>tcT	p.S165S	CWC22_ENST00000295749.6_Silent_p.S165S	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	165	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						GGCCATTAATTGACTTCTTCA	0.308																																																	0													69.0	64.0	65.0					2																	180843003		1807	4074	5881	SO:0001819	synonymous_variant	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.495A>T	2.37:g.180843003T>A			Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.S165	ENST00000410053.3	37	c.495	CCDS46465.1	2																																																																																			CWC22	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000163510		0.308	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	-	0.00	124	0	T	NM_020943		180843003	-1	tier1	-	no_errors	ENST00000295749	ensembl	human	known	74_37	silent	17.95	96	21	SNP	1.000	A
CYP4F12	66002	genome.wustl.edu	37	19	15795665	15795665	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:15795665G>T	ENST00000550308.1	+	8	1338	c.958G>T	c.(958-960)Gca>Tca	p.A320S	CYP4F12_ENST00000324632.10_Missense_Mutation_p.A320S	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	320					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	GGATATAAGAGCAGAGGCTGA	0.522																																																	0													100.0	94.0	96.0					19																	15795665		2201	4300	6501	SO:0001583	missense	0			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.958G>T	19.37:g.15795665G>T	ENSP00000448998:p.Ala320Ser		E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.A320S	ENST00000550308.1	37	c.958	CCDS42517.1	19	.	.	.	.	.	.	.	.	.	.	.	14.59	2.580781	0.46006	.	.	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.71934	-0.61;-0.61	2.58	2.58	0.30949	.	0.000000	0.64402	U	0.000003	T	0.80127	0.4566	M	0.68952	2.095	0.54753	D	0.999985	D	0.76494	0.999	D	0.81914	0.995	T	0.81929	-0.0708	10	0.72032	D	0.01	.	11.2806	0.49192	0.0:0.0:1.0:0.0	.	320	Q9HCS2	CP4FC_HUMAN	S	320	ENSP00000448998:A320S;ENSP00000321821:A320S	ENSP00000321821:A320S	A	+	1	0	CYP4F12	15656665	1.000000	0.71417	0.560000	0.28344	0.127000	0.20565	8.017000	0.88712	1.744000	0.51775	0.313000	0.20887	GCA	CYP4F12	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000186204		0.522	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F12	HGNC	protein_coding	OTTHUMT00000378938.9	-	0.00	52	0	G			15795665	+1	tier1	-	no_errors	ENST00000324632	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.994	T
DCAKD	79877	genome.wustl.edu	37	17	43101979	43101979	+	Missense_Mutation	SNP	C	C	T	rs201376374		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:43101979C>T	ENST00000452796.2	-	4	773	c.518G>A	c.(517-519)cGc>cAc	p.R173H	DCAKD_ENST00000588499.1_Missense_Mutation_p.R173H|DCAKD_ENST00000342350.5_Missense_Mutation_p.R173H			Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing	173	DPCK.				coenzyme A biosynthetic process (GO:0015937)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)	p.R173H(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)	6		Prostate(33;0.155)				TAGGACATGGCGGGCCATGCG	0.647																																																	1	Substitution - Missense(1)	large_intestine(1)											69.0	63.0	65.0					17																	43101979		2203	4300	6503	SO:0001583	missense	0			BC006546	CCDS11493.1	17q21.31	2005-12-20				ENSG00000172992			26238	protein-coding gene	gene with protein product							Standard	XM_005257688		Approved	FLJ22955	uc010daa.1	Q8WVC6		ENST00000452796.2:c.518G>A	17.37:g.43101979C>T	ENSP00000413483:p.Arg173His		A8K3Z0|D3DX60|D3DX62|Q9BR71|Q9H5W1	Missense_Mutation	SNP	pfam_Depp_CoAkinase,superfamily_P-loop_NTPase,tigrfam_Depp_CoAkinase	p.R173H	ENST00000452796.2	37	c.518	CCDS11493.1	17	.	.	.	.	.	.	.	.	.	.	C	10.67	1.415957	0.25552	.	.	ENSG00000172992	ENST00000342350;ENST00000452796	T;T	0.41065	1.01;1.01	4.86	-2.19	0.07015	.	0.666589	0.16246	N	0.222902	T	0.13670	0.0331	N	0.01168	-0.975	0.40900	D	0.984143	B	0.09022	0.002	B	0.04013	0.001	T	0.05869	-1.0859	10	0.39692	T	0.17	-7.4621	8.7676	0.34713	0.0:0.239:0.1268:0.6342	.	173	Q8WVC6	DCAKD_HUMAN	H	173	ENSP00000341504:R173H;ENSP00000413483:R173H	ENSP00000341504:R173H	R	-	2	0	DCAKD	40457505	0.001000	0.12720	0.903000	0.35520	0.990000	0.78478	-0.215000	0.09279	-0.248000	0.09583	0.542000	0.68232	CGC	DCAKD	-	pfam_Depp_CoAkinase,superfamily_P-loop_NTPase,tigrfam_Depp_CoAkinase	ENSG00000172992		0.647	DCAKD-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DCAKD	HGNC	protein_coding	OTTHUMT00000449066.1		0.00	92	0	C	NM_024819		43101979	-1			no_errors	ENST00000342350	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.512	T
DDB1	1642	genome.wustl.edu	37	11	61091537	61091537	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:61091537G>A	ENST00000301764.7	-	7	1232	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W	DDB1_ENST00000450997.2_Intron|DDB1_ENST00000545930.1_5'UTR	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	279	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						ATGAAGAGCCGGCCTTCCATG	0.507								Nucleotide excision repair (NER)																																									0													185.0	181.0	182.0					11																	61091537		2203	4299	6502	SO:0001583	missense	0			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.835C>T	11.37:g.61091537G>A	ENSP00000301764:p.Arg279Trp		A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.R279W	ENST00000301764.7	37	c.835	CCDS31576.1	11	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133056	0.77662	.	.	ENSG00000167986	ENST00000301764;ENST00000535174;ENST00000541513	T;T;T	0.44881	0.91;0.91;0.91	5.72	3.85	0.44370	.	0.050474	0.85682	D	0.000000	T	0.65974	0.2743	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.98;0.988;0.981	T	0.71303	-0.4633	10	0.72032	D	0.01	-19.0615	15.2508	0.73545	0.0:0.0:0.7435:0.2565	.	279;279;279	F5GY55;B7Z2A1;Q16531	.;.;DDB1_HUMAN	W	279;62;94	ENSP00000301764:R279W;ENSP00000446044:R62W;ENSP00000442660:R94W	ENSP00000301764:R279W	R	-	1	2	DDB1	60848113	1.000000	0.71417	0.842000	0.33263	0.846000	0.48090	4.785000	0.62418	0.768000	0.33290	-0.152000	0.13540	CGG	DDB1	-	NULL	ENSG00000167986		0.507	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DDB1	HGNC	protein_coding	OTTHUMT00000398816.1	-	0.00	30	0	G	NM_001923		61091537	-1	tier1	-	no_errors	ENST00000301764	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.996	A
DDX1	1653	genome.wustl.edu	37	2	15768942	15768942	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:15768942G>T	ENST00000381341.2	+	24	2243	c.1854G>T	c.(1852-1854)ctG>ctT	p.L618L	DDX1_ENST00000233084.3_Silent_p.L618L			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	618	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Necessary for interaction with HNRNPK.|Necessary for interaction with replicase polyprotein 1ab nsp14 of IBV.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		CAATTTCCCTGGTGGCAACAG	0.343																																																	0													94.0	95.0	95.0					2																	15768942		2203	4300	6503	SO:0001819	synonymous_variant	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1854G>T	2.37:g.15768942G>T			B4DME8|B4DPN6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_ConA-like_lec_gl_sf,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L618	ENST00000381341.2	37	c.1854	CCDS1686.1	2																																																																																			DDX1	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000079785		0.343	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2		0.00	23	0	G	NM_004939		15768942	+1			no_errors	ENST00000233084	ensembl	human	known	74_37	silent	12.12	29	4	SNP	1.000	T
DIS3L2	129563	genome.wustl.edu	37	2	233198624	233198624	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:233198624G>T	ENST00000409307.1	+	16	2085	c.2085G>T	c.(2083-2085)ctG>ctT	p.L695L	DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000325385.7_Silent_p.L695L					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		ATGTGCCCCTGTACACACACT	0.662																																																	0													60.0	67.0	65.0					2																	233198624		2175	4269	6444	SO:0001819	synonymous_variant	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.2085G>T	2.37:g.233198624G>T				Silent	SNP	NULL	p.L695	ENST00000409307.1	37	c.2085	CCDS42834.1	2																																																																																			DIS3L2	-	NULL	ENSG00000144535		0.662	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1	-	0.00	74	0	G	NM_152383		233198624	+1	tier1	-	no_errors	ENST00000325385	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
DMXL2	23312	genome.wustl.edu	37	15	51773127	51773127	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:51773127G>T	ENST00000251076.5	-	24	6463	c.6176C>A	c.(6175-6177)gCt>gAt	p.A2059D	DMXL2_ENST00000449909.3_Missense_Mutation_p.A1423D|DMXL2_ENST00000543779.2_Missense_Mutation_p.A2059D|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2059						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ATAACCTGTAGCCAATGTTCT	0.363																																																	0													113.0	113.0	113.0					15																	51773127		2196	4293	6489	SO:0001583	missense	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.6176C>A	15.37:g.51773127G>T	ENSP00000251076:p.Ala2059Asp		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A2059D	ENST00000251076.5	37	c.6176	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450444	0.84101	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.79352	-1.26;-1.26;-1.26	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89508	0.6735	M	0.83384	2.64	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.91635	0.999;0.994;0.997;0.951	D	0.90581	0.4529	10	0.87932	D	0	.	19.4072	0.94653	0.0:0.0:1.0:0.0	.	2059;1423;2059;2059	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	D	2059;2059;1423	ENSP00000251076:A2059D;ENSP00000441858:A2059D;ENSP00000400855:A1423D	ENSP00000251076:A2059D	A	-	2	0	DMXL2	49560419	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	9.143000	0.94623	2.578000	0.87016	0.650000	0.86243	GCT	DMXL2	-	NULL	ENSG00000104093		0.363	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	-	0.00	43	0	G	NM_015263		51773127	-1	tier1	-	no_errors	ENST00000543779	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	T
DNAJB1	3337	genome.wustl.edu	37	19	14627668	14627668	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:14627668G>T	ENST00000254322.2	-	2	472	c.402C>A	c.(400-402)ttC>ttA	p.F134L	DNAJB1_ENST00000396969.4_Missense_Mutation_p.F34L	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	134					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		TGCCCATAGGGAAGCCAGAGA	0.572																																																	0													83.0	72.0	76.0					19																	14627668		2203	4300	6503	SO:0001583	missense	0			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.402C>A	19.37:g.14627668G>T	ENSP00000254322:p.Phe134Leu		B4DX52	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.F134L	ENST00000254322.2	37	c.402	CCDS12312.1	19	.	.	.	.	.	.	.	.	.	.	g	14.14	2.447990	0.43429	.	.	ENSG00000132002	ENST00000254322;ENST00000396969	T;T	0.59224	0.28;1.42	4.83	2.69	0.31865	.	0.274240	0.40640	N	0.001045	T	0.45316	0.1336	L	0.43554	1.36	0.58432	D	0.999999	P	0.50943	0.94	P	0.45449	0.481	T	0.38779	-0.9645	10	0.09590	T	0.72	.	7.8106	0.29228	0.2093:0.0:0.7907:0.0	.	134	P25685	DNJB1_HUMAN	L	134;34	ENSP00000254322:F134L;ENSP00000444212:F34L	ENSP00000254322:F134L	F	-	3	2	DNAJB1	14488668	0.473000	0.25878	1.000000	0.80357	0.964000	0.63967	-0.166000	0.09954	0.987000	0.38709	0.561000	0.74099	TTC	DNAJB1	-	NULL	ENSG00000132002		0.572	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB1	HGNC	protein_coding	OTTHUMT00000465987.1	-	0.00	44	0	G	NM_006145		14627668	-1	tier1	-	no_errors	ENST00000254322	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102304638	102304638	+	RNA	SNP	C	C	T	rs137881065		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:102304638C>T	ENST00000561463.1	+	0	12684									DNM1 pseudogene 47																		AACCTGCAGACACTTGTGGAG	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304638C>T				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1		0.00	12	0	C	NG_009149		102304638	+1			no_errors	ENST00000561463	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.994	T
DPY19L3	147991	genome.wustl.edu	37	19	32968498	32968498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:32968498G>T	ENST00000342179.5	+	17	1983	c.1768G>T	c.(1768-1770)Gga>Tga	p.G590*	DPY19L3_ENST00000392250.2_Nonsense_Mutation_p.G590*|DPY19L3_ENST00000586987.1_Nonsense_Mutation_p.G590*	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	590						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					GCTGTGCACGGGAAGGACCCT	0.567																																																	0													132.0	112.0	119.0					19																	32968498		2203	4300	6503	SO:0001587	stop_gained	0				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1768G>T	19.37:g.32968498G>T	ENSP00000344937:p.Gly590*		Q68DC7|Q6ZTB7|Q6ZTS2	Nonsense_Mutation	SNP	pfam_Dpy-19	p.G590*	ENST00000342179.5	37	c.1768	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	G	40	8.066456	0.98638	.	.	ENSG00000178904	ENST00000392250;ENST00000342179	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-15.9982	19.1561	0.93510	0.0:0.0:1.0:0.0	.	.	.	.	X	590	.	ENSP00000344937:G590X	G	+	1	0	DPY19L3	37660338	1.000000	0.71417	0.427000	0.26684	0.837000	0.47467	9.869000	0.99810	2.530000	0.85305	0.563000	0.77884	GGA	DPY19L3	-	pfam_Dpy-19	ENSG00000178904		0.567	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	-	0.00	62	0	G	NM_207325		32968498	+1	tier1	-	no_errors	ENST00000342179	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56489969	56489969	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:56489969G>C	ENST00000361203.3	-	31	4190	c.4183C>G	c.(4183-4185)Ctc>Gtc	p.L1395V	DST_ENST00000446842.2_Missense_Mutation_p.L1069V|DST_ENST00000312431.6_Missense_Mutation_p.L1395V|DST_ENST00000518935.1_Missense_Mutation_p.L1069V|DST_ENST00000370754.5_Missense_Mutation_p.L1573V|DST_ENST00000370788.2_Missense_Mutation_p.L1395V|DST_ENST00000244364.6_Missense_Mutation_p.L1069V|DST_ENST00000370765.6_Missense_Mutation_p.L1069V|DST_ENST00000370769.4_Missense_Mutation_p.L1395V|DST_ENST00000421834.2_Missense_Mutation_p.L1395V			Q03001	DYST_HUMAN	dystonin	1395					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAATAATGAGATCTGCTGAA	0.353																																																	0													133.0	136.0	135.0					6																	56489969		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4183C>G	6.37:g.56489969G>C	ENSP00000354508:p.Leu1395Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L1573V	ENST00000361203.3	37	c.4717		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.076|1.076	-0.668406|-0.668406	0.03403|0.03403	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000522360|ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.78126	.|1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;-1.15;1.82;-1.15	4.99|4.99	0.686|0.686	0.18015|0.18015	.|.	.|0.693493	.|0.12454	.|N	.|0.467504	T|T	0.33904|0.33904	0.0879|0.0879	N|N	0.05306|0.05306	-0.075|-0.075	.|.	.|.	.|.	.|B;P;P;B;B;B;B;B	.|0.45428	.|0.0;0.858;0.473;0.0;0.113;0.04;0.0;0.022	.|B;B;B;B;B;B;B;B	.|0.43386	.|0.0;0.418;0.056;0.001;0.032;0.034;0.0;0.022	T|T	0.08576|0.08576	-1.0715|-1.0715	4|9	.|0.16420	.|T	.|0.52	.|.	5.4189|5.4189	0.16390|0.16390	0.2576:0.4794:0.263:0.0|0.2576:0.4794:0.263:0.0	.|.	.|1395;1395;1573;1069;1069;1069;1395;1069	.|Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.|.;.;.;.;.;.;DYST_HUMAN;.	M|V	66|1069;1573;1395;1395;1069;1395;1395;1395;1069;1435;1069;1069	.|ENSP00000244364:L1069V;ENSP00000359790:L1573V;ENSP00000359805:L1395V;ENSP00000400883:L1395V;ENSP00000393645:L1069V;ENSP00000307959:L1395V;ENSP00000359824:L1395V;ENSP00000354508:L1395V;ENSP00000404924:L1069V;ENSP00000431030:L1435V;ENSP00000359801:L1069V;ENSP00000431003:L1069V	.|ENSP00000244364:L1069V	I|L	-|-	3|1	3|0	DST|DST	56597928|56597928	0.998000|0.998000	0.40836|0.40836	0.991000|0.991000	0.47740|0.47740	0.997000|0.997000	0.91878|0.91878	1.222000|1.222000	0.32515|0.32515	0.196000|0.196000	0.20367|0.20367	0.563000|0.563000	0.77884|0.77884	ATC|CTC	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.353	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	96	0	G	NM_001723		56489969	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	18.89	73	17	SNP	0.441	C
DUSP10	11221	genome.wustl.edu	37	1	221875156	221875157	+	3'UTR	INS	-	-	A	rs571834010		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:221875156_221875157insA	ENST00000366899.3	-	0	2284_2285				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCCAGAGAAGGAAAAAAAAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*598->T	1.37:g.221875167_221875167dupA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	12	0	-	NM_007207		221875157	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	16.67	20	4	INS	0.002:0.000	A
AL512635.1	0	genome.wustl.edu	37	9	20295035	20295036	+	RNA	DEL	TA	TA	-	rs540102456|rs376974566		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:20295035_20295036delTA	ENST00000408817.1	+	0	34_35																											tgtatatatgtatatatatata	0.302																																																	0																																												0																															9.37:g.20295045_20295046delTA				RNA	DEL	-	NULL	ENST00000408817.1	37	NULL		9																																																																																			AL512635.1	-	-	ENSG00000221744		0.302	AL512635.1-201	NOVEL	basic	miRNA	ENSG00000221744	Clone_based_ensembl_gene	miRNA			0.00	11	0	TA			20295036	+1			no_errors	ENST00000408817	ensembl	human	novel	74_37	rna	21.43	11	3	DEL	0.000:0.009	0
RP11-764K9.1	0	genome.wustl.edu	37	9	68400525	68400525	+	lincRNA	SNP	C	C	A	rs79614538	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:68400525C>A	ENST00000417843.2	-	0	1294																											cactttgagacaaattaagga	0.478																																																	0																																												0																															9.37:g.68400525C>A				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.478	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	14	0	C			68400525	-1	tier1	rs79614538	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	31.82	15	7	SNP	0.106	A
EPB41L2	2037	genome.wustl.edu	37	6	131186736	131186736	+	Silent	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:131186736C>G	ENST00000337057.3	-	17	2950	c.2769G>C	c.(2767-2769)ctG>ctC	p.L923L	EPB41L2_ENST00000392427.3_Intron|EPB41L2_ENST00000528282.1_Silent_p.L665L|EPB41L2_ENST00000530481.1_Silent_p.L770L|EPB41L2_ENST00000525193.1_Silent_p.L624L|EPB41L2_ENST00000527411.1_Silent_p.L853L|EPB41L2_ENST00000368128.2_Silent_p.L923L|EPB41L2_ENST00000445890.2_Silent_p.L665L|EPB41L2_ENST00000527659.1_Silent_p.L729L|EPB41L2_ENST00000524581.1_Silent_p.L301L|EPB41L2_ENST00000529208.1_Silent_p.L853L|EPB41L2_ENST00000531410.1_Silent_p.L44L|EPB41L2_ENST00000530757.1_Intron|EPB41L2_ENST00000525271.1_Intron	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	923	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TTTGTGCGGTCAGTAACGTGC	0.463																																																	0													304.0	224.0	251.0					6																	131186736		2203	4300	6503	SO:0001819	synonymous_variant	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2769G>C	6.37:g.131186736C>G			B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain	p.L923	ENST00000337057.3	37	c.2769	CCDS5141.1	6																																																																																			EPB41L2	-	pirsf_Band_41_protein,pfam_Band_4.1_C	ENSG00000079819		0.463	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	-	0.00	70	0	C			131186736	-1	tier1	-	no_errors	ENST00000337057	ensembl	human	known	74_37	silent	35.44	51	28	SNP	1.000	G
EPHA6	285220	genome.wustl.edu	37	3	97356914	97356914	+	Silent	SNP	T	T	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:97356914T>G	ENST00000514100.1	+	11	1190	c.948T>G	c.(946-948)gcT>gcG	p.A316A	EPHA6_ENST00000389672.5_Silent_p.A924A|EPHA6_ENST00000502694.1_Silent_p.A316A	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	830						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CAGAAGCTGCTTATACAACAA	0.368																																																	0													74.0	71.0	72.0					3																	97356914		1875	4116	5991	SO:0001819	synonymous_variant	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.948T>G	3.37:g.97356914T>G			D6RAL5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A924	ENST00000514100.1	37	c.2772		3																																																																																			EPHA6	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000080224		0.368	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	-	0.00	45	0	T	NM_001080448		97356914	+1	tier1	-	no_errors	ENST00000389672	ensembl	human	known	74_37	silent	30.77	27	12	SNP	0.994	G
EVC	2121	genome.wustl.edu	37	4	5800490	5800490	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr4:5800490A>T	ENST00000264956.6	+	15	2459	c.2275A>T	c.(2275-2277)Agc>Tgc	p.S759C	EVC_ENST00000382674.2_Missense_Mutation_p.S759C|EVC_ENST00000515113.1_3'UTR	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	759					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				AGCCACCAAGAGCCGGGCCAA	0.632																																																	0													24.0	20.0	21.0					4																	5800490		2183	4277	6460	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2275A>T	4.37:g.5800490A>T	ENSP00000264956:p.Ser759Cys			Missense_Mutation	SNP	NULL	p.S759C	ENST00000264956.6	37	c.2275	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751280	0.49257	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.56611	0.45;0.45	5.08	2.7	0.31948	.	0.408787	0.27595	N	0.018668	T	0.59676	0.2211	L	0.59436	1.845	0.30742	N	0.746073	D	0.65815	0.995	P	0.60415	0.874	T	0.60969	-0.7157	10	0.66056	D	0.02	.	6.8212	0.23859	0.7995:0.0:0.2005:0.0	.	759	P57679	EVC_HUMAN	C	759	ENSP00000264956:S759C;ENSP00000372120:S759C	ENSP00000264956:S759C	S	+	1	0	EVC	5851391	0.279000	0.24239	0.861000	0.33841	0.486000	0.33341	0.554000	0.23407	0.791000	0.33826	0.459000	0.35465	AGC	EVC	-	NULL	ENSG00000072840		0.632	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	-	0.00	63	0	A			5800490	+1	tier1	-	no_errors	ENST00000264956	ensembl	human	known	74_37	missense	38.46	24	15	SNP	0.504	T
EVL	51466	genome.wustl.edu	37	14	100594903	100594903	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:100594903G>A	ENST00000402714.2	+	6	1133	c.529G>A	c.(529-531)Gtc>Atc	p.V177I	EVL_ENST00000392920.3_Missense_Mutation_p.V179I|EVL_ENST00000544450.2_Missense_Mutation_p.V183I			Q9UI08	EVL_HUMAN	Enah/Vasp-like	177	Pro-rich.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CAGCGCCCCCGTCTCATGTAG	0.692																																																	0													43.0	41.0	42.0					14																	100594903		2203	4300	6503	SO:0001583	missense	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.529G>A	14.37:g.100594903G>A	ENSP00000384720:p.Val177Ile		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.V179I	ENST00000402714.2	37	c.535		14	.	.	.	.	.	.	.	.	.	.	G	8.157	0.788619	0.16258	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557153;ENST00000557384	T;T;T;T;T	0.71103	-0.54;-0.53;-0.49;-0.44;1.8	4.96	-0.947	0.10382	.	1.168000	0.06262	N	0.694062	T	0.50017	0.1591	N	0.22421	0.69	0.09310	N	1	B;B;B	0.13594	0.008;0.005;0.008	B;B;B	0.09377	0.002;0.004;0.001	T	0.20571	-1.0271	10	0.19147	T	0.46	-2.3892	3.2894	0.06944	0.2947:0.2137:0.4062:0.0854	.	183;179;177	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	I	177;183;179;179;164;73	ENSP00000384720:V177I;ENSP00000437904:V183I;ENSP00000376652:V179I;ENSP00000452327:V164I;ENSP00000450979:V73I	ENSP00000376652:V179I	V	+	1	0	EVL	99664656	0.006000	0.16342	0.870000	0.34147	0.610000	0.37248	-0.307000	0.08167	-0.119000	0.11830	-1.332000	0.01269	GTC	EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.692	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	104	0	G			100594903	+1	tier1	-	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.586	A
F2RL1	2150	genome.wustl.edu	37	5	76129237	76129237	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr5:76129237C>G	ENST00000296677.4	+	2	1011	c.805C>G	c.(805-807)Ctg>Gtg	p.L269V		NM_005242.4	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	269					blood coagulation (GO:0007596)|chemokine (C-C motif) ligand 2 secretion (GO:0035926)|chemokine secretion (GO:0090195)|defense response to virus (GO:0051607)|establishment of endothelial barrier (GO:0061028)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|interleukin-1 beta secretion (GO:0050702)|interleukin-10 secretion (GO:0072608)|leukocyte migration (GO:0050900)|leukocyte proliferation (GO:0070661)|mature dendritic cell differentiation (GO:0097029)|negative regulation of chemokine secretion (GO:0090198)|negative regulation of JNK cascade (GO:0046329)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neutrophil activation (GO:0042119)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of cell migration (GO:0030335)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of eosinophil degranulation (GO:0043311)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of neutrophil mediated killing of gram-negative bacterium (GO:0070963)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of blood coagulation (GO:0030193)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of JNK cascade (GO:0046328)|T cell activation involved in immune response (GO:0002286)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	13		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		GATCAGAATGCTGCGATCTTC	0.498																																																	0													138.0	132.0	134.0					5																	76129237		2203	4300	6503	SO:0001583	missense	0			BC018130	CCDS4033.1	5q13	2012-08-08			ENSG00000164251	ENSG00000164251		"""GPCR / Class A : Protease activated receptors"""	3538	protein-coding gene	gene with protein product	"""proteinase-activated receptor-2"""	600933		GPR11		7937743, 7556175	Standard	NM_005242		Approved	PAR2	uc003keo.3	P55085	OTTHUMG00000102118	ENST00000296677.4:c.805C>G	5.37:g.76129237C>G	ENSP00000296677:p.Leu269Val		Q13317|Q13346|Q53XJ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,prints_Pro_rcpt_2,prints_Protea_act_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L269V	ENST00000296677.4	37	c.805	CCDS4033.1	5	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647373	0.29246	.	.	ENSG00000164251	ENST00000296677	T	0.45276	0.9	5.44	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.136550	0.51477	D	0.000083	T	0.68540	0.3012	M	0.89534	3.04	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.73142	-0.4076	9	.	.	.	-20.7769	12.0904	0.53722	0.0:0.8607:0.0:0.1393	.	269	P55085	PAR2_HUMAN	V	269	ENSP00000296677:L269V	.	L	+	1	2	F2RL1	76164993	0.998000	0.40836	0.005000	0.12908	0.016000	0.09150	4.006000	0.57083	0.688000	0.31529	-0.126000	0.14955	CTG	F2RL1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM	ENSG00000164251		0.498	F2RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2RL1	HGNC	protein_coding	OTTHUMT00000219957.2	-	0.00	61	0	C			76129237	+1	tier1	-	no_errors	ENST00000296677	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.950	G
FAM135B	51059	genome.wustl.edu	37	8	139144986	139144986	+	Missense_Mutation	SNP	C	C	A	rs201744533		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:139144986C>A	ENST00000395297.1	-	20	4241	c.4071G>T	c.(4069-4071)aaG>aaT	p.K1357N		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1357								p.K1357N(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AAGTGCAGTCCTTGGCTTCAA	0.537										HNSCC(54;0.14)																																							2	Substitution - Missense(2)	large_intestine(2)											235.0	243.0	240.0					8																	139144986		1982	4163	6145	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4071G>T	8.37:g.139144986C>A	ENSP00000378710:p.Lys1357Asn		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.K1357N	ENST00000395297.1	37	c.4071	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778329	0.70107	.	.	ENSG00000147724	ENST00000395297	T	0.17691	2.26	5.74	3.0	0.34707	.	0.056757	0.64402	D	0.000002	T	0.30355	0.0762	L	0.48986	1.54	0.43255	D	0.995188	D	0.76494	0.999	D	0.66084	0.941	T	0.00768	-1.1574	10	0.52906	T	0.07	-29.2977	9.8146	0.40844	0.0:0.7147:0.0:0.2853	.	1357	Q49AJ0	F135B_HUMAN	N	1357	ENSP00000378710:K1357N	ENSP00000378710:K1357N	K	-	3	2	FAM135B	139214168	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.396000	0.34531	0.370000	0.24538	0.655000	0.94253	AAG	FAM135B	-	NULL	ENSG00000147724		0.537	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3		0.00	32	0	C	NM_015912		139144986	-1			no_errors	ENST00000395297	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	A
FAM135B	51059	genome.wustl.edu	37	8	139165152	139165152	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:139165152T>A	ENST00000395297.1	-	13	1736	c.1566A>T	c.(1564-1566)caA>caT	p.Q522H		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	522										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CATCAGATGTTTGGCCAGTCC	0.458										HNSCC(54;0.14)																																							0													125.0	118.0	120.0					8																	139165152		1949	4149	6098	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1566A>T	8.37:g.139165152T>A	ENSP00000378710:p.Gln522His		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.Q522H	ENST00000395297.1	37	c.1566	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	T	18.68	3.675410	0.67928	.	.	ENSG00000147724	ENST00000395297	T	0.14766	2.48	5.18	-9.54	0.00572	.	1.236530	0.05499	N	0.558011	T	0.14830	0.0358	L	0.51422	1.61	0.09310	N	1	D;P;P	0.54207	0.965;0.924;0.79	P;P;B	0.53313	0.723;0.66;0.365	T	0.25779	-1.0122	10	0.27785	T	0.31	-1.9715	4.5868	0.12285	0.0976:0.4064:0.0999:0.396	.	522;522;522	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	H	522	ENSP00000378710:Q522H	ENSP00000276737:Q522H	Q	-	3	2	FAM135B	139234334	0.000000	0.05858	0.000000	0.03702	0.201000	0.24016	-0.444000	0.06854	-1.379000	0.02118	-0.290000	0.09829	CAA	FAM135B	-	NULL	ENSG00000147724		0.458	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3		0.00	43	0	T	NM_015912		139165152	-1			no_errors	ENST00000395297	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	A
FAM135B	51059	genome.wustl.edu	37	8	139380163	139380163	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:139380163G>T	ENST00000395297.1	-	2	234	c.64C>A	c.(64-66)Ctc>Atc	p.L22I		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	22										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTCTGAAAGAGATCCACATTA	0.393										HNSCC(54;0.14)																																							0													135.0	129.0	131.0					8																	139380163		1870	4111	5981	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.64C>A	8.37:g.139380163G>T	ENSP00000378710:p.Leu22Ile		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.L22I	ENST00000395297.1	37	c.64	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634046	0.87660	.	.	ENSG00000147724	ENST00000395297;ENST00000160713;ENST00000520380	T	0.49720	0.77	5.54	5.54	0.83059	.	0.000000	0.48767	U	0.000163	T	0.70081	0.3183	M	0.75777	2.31	0.52501	D	0.999951	D	0.76494	0.999	D	0.80764	0.994	T	0.72450	-0.4290	10	0.87932	D	0	-5.5976	18.3941	0.90493	0.0:0.0:1.0:0.0	.	22	Q49AJ0	F135B_HUMAN	I	22	ENSP00000378710:L22I	ENSP00000160713:L22I	L	-	1	0	FAM135B	139449345	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.084000	0.94076	2.768000	0.95171	0.561000	0.74099	CTC	FAM135B	-	NULL	ENSG00000147724		0.393	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3		0.00	24	0	G	NM_015912		139380163	-1			no_errors	ENST00000395297	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
ERICH6	131831	genome.wustl.edu	37	3	150421519	150421519	+	Missense_Mutation	SNP	A	A	T	rs573303855	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:150421519A>T	ENST00000295910.6	-	1	219	c.167T>A	c.(166-168)gTg>gAg	p.V56E	RP11-103G8.2_ENST00000471093.1_RNA|FAM194A_ENST00000491361.1_Intron|RP11-103G8.2_ENST00000475393.1_RNA	NM_152394.3	NP_689607.2												p.V56E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctcctccaccacctcctc	0.607													A|||	41	0.0081869	0.0091	0.0144	5008	,	,		1681	0.0069		0.0089	False		,,,				2504	0.0031																1	Substitution - Missense(1)	endometrium(1)											198.0	156.0	171.0					3																	150421519		2203	4299	6502	SO:0001583	missense	0																														ENST00000295910.6:c.167T>A	3.37:g.150421519A>T	ENSP00000295910:p.Val56Glu			Missense_Mutation	SNP	NULL	p.V56E	ENST00000295910.6	37	c.167	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	A	4.695	0.129296	0.08981	.	.	ENSG00000163645	ENST00000295910	T	0.13538	2.58	3.11	-4.8	0.03190	.	1.710190	0.03876	N	0.276462	T	0.04318	0.0119	N	0.08118	0	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.29181	-1.0020	10	0.02654	T	1	-0.1027	0.7864	0.01049	0.1614:0.2002:0.316:0.3224	.	56	Q7L0X2	F194A_HUMAN	E	56	ENSP00000295910:V56E	ENSP00000295910:V56E	V	-	2	0	FAM194A	151904209	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.158000	0.03153	-0.978000	0.03533	-0.472000	0.04984	GTG	FAM194A	-	NULL	ENSG00000163645		0.607	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	-	0.00	26	0	A			150421519	-1	tier1	-	no_errors	ENST00000295910	ensembl	human	known	74_37	missense	11.63	37	5	SNP	0.000	T
FAM214B	80256	genome.wustl.edu	37	9	35106621	35106621	+	Missense_Mutation	SNP	G	G	A	rs373199885	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:35106621G>A	ENST00000378561.1	-	4	4028	c.973C>T	c.(973-975)Cgg>Tgg	p.R325W	FAM214B_ENST00000603301.1_Missense_Mutation_p.R325W|FAM214B_ENST00000378566.1_Missense_Mutation_p.R20W|FAM214B_ENST00000488109.2_Missense_Mutation_p.R325W|FAM214B_ENST00000322813.5_Missense_Mutation_p.R325W|FAM214B_ENST00000378554.2_Missense_Mutation_p.R325W|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000378557.1_Missense_Mutation_p.R325W|FAM214B_ENST00000605244.1_Missense_Mutation_p.R325W			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	325						nucleus (GO:0005634)											GGCCCCTTCCGGAGGCTTCGA	0.627													G|||	5	0.000998403	0.0038	0.0	5008	,	,		16749	0.0		0.0	False		,,,				2504	0.0																0								G	TRP/ARG	1,4335		0,1,2167	8.0	10.0	10.0		973	5.4	1.0	9		10	0,8490		0,0,4245	no	missense	KIAA1539	NM_025182.2	101	0,1,6412	AA,AG,GG		0.0,0.0231,0.0078	probably-damaging	325/539	35106621	1,12825	2168	4245	6413	SO:0001583	missense	0			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.973C>T	9.37:g.35106621G>A	ENSP00000367823:p.Arg325Trp		B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	NULL	p.R325W	ENST00000378561.1	37	c.973	CCDS6578.1	9	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678139	0.68042	2.31E-4	0.0	ENSG00000005238	ENST00000378566;ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	5.37	5.37	0.77165	.	0.126735	0.53938	D	0.000044	T	0.48624	0.1510	L	0.42245	1.32	0.46798	D	0.999203	D	0.60575	0.988	B	0.42386	0.386	T	0.55289	-0.8164	9	0.72032	D	0.01	-21.604	16.6599	0.85238	0.0:0.0:1.0:0.0	.	325	Q7L5A3	K1539_HUMAN	W	20;325;325;325;325	.	ENSP00000319897:R325W	R	-	1	2	KIAA1539	35096621	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.221000	0.51215	2.808000	0.96608	0.650000	0.86243	CGG	FAM214B	-	NULL	ENSG00000005238		0.627	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214B	HGNC	protein_coding	OTTHUMT00000052261.1	-	0.00	82	0	G	NM_025182		35106621	-1	tier1	-	no_errors	ENST00000322813	ensembl	human	known	74_37	missense	44.78	37	30	SNP	1.000	A
FAM220A	84792	genome.wustl.edu	37	7	6370735	6370735	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:6370735C>A	ENST00000313324.4	-	2	518	c.51G>T	c.(49-51)caG>caT	p.Q17H	FAM220A_ENST00000533877.1_5'Flank	NM_001037163.1	NP_001032240.1	Q7Z4H9	F220A_HUMAN	family with sequence similarity 220, member A	17						nucleus (GO:0005634)											CTCCTCCGGCCTGCTGCACTT	0.592																																																	0													27.0	29.0	29.0					7																	6370735		2156	4189	6345	SO:0001583	missense	0			BC006110	CCDS34599.1	7p22.1	2012-03-19	2012-03-19	2012-03-19	ENSG00000178397	ENSG00000178397			22422	protein-coding gene	gene with protein product	"""STAT3-interacting protein as a repressor"""		"""chromosome 7 open reading frame 70"""	C7orf70			Standard	NM_001037163		Approved	SIPAR, MGC12966	uc003spu.3	Q7Z4H9	OTTHUMG00000122091	ENST00000313324.4:c.51G>T	7.37:g.6370735C>A	ENSP00000317289:p.Gln17His		Q75ML2|Q8NA52|Q9BRR7	Missense_Mutation	SNP	NULL	p.Q17H	ENST00000313324.4	37	c.51	CCDS34599.1	7	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453868	0.26161	.	.	ENSG00000178397	ENST00000313324;ENST00000524898;ENST00000530143	T;T;T	0.09255	3.0;3.0;3.0	5.53	-5.06	0.02946	.	1.545160	0.04743	U	0.423204	T	0.09379	0.0231	L	0.34521	1.04	0.09310	N	1	B	0.29188	0.236	B	0.21360	0.034	T	0.20605	-1.0270	10	0.38643	T	0.18	3.054	15.2942	0.73891	0.0:0.256:0.0:0.744	.	17	Q7Z4H9	SIPAR_HUMAN	H	17	ENSP00000317289:Q17H;ENSP00000432444:Q17H;ENSP00000436886:Q17H	ENSP00000317289:Q17H	Q	-	3	2	C7orf70	6337260	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.015000	0.03637	-1.213000	0.02617	-0.140000	0.14226	CAG	FAM220A	-	NULL	ENSG00000178397		0.592	FAM220A-001	KNOWN	basic|CCDS	protein_coding	FAM220A	HGNC	protein_coding	OTTHUMT00000242853.2	-	0.00	54	0	C	NM_001037163		6370735	-1	tier1	-	no_errors	ENST00000313324	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.000	A
FANCA	2175	genome.wustl.edu	37	16	89877149	89877149	+	Missense_Mutation	SNP	C	C	T	rs375648811		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:89877149C>T	ENST00000389301.3	-	5	518	c.488G>A	c.(487-489)cGt>cAt	p.R163H	FANCA_ENST00000563673.1_Missense_Mutation_p.R163H|FANCA_ENST00000389302.3_Missense_Mutation_p.R163H|FANCA_ENST00000543736.1_Intron|FANCA_ENST00000568369.1_Missense_Mutation_p.R163H|FANCA_ENST00000534992.1_Missense_Mutation_p.R163H	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	163					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R163H(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GAAGGAAAGACGGGAGAACAT	0.373			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG,HIS/ARG	1,4395	2.1+/-5.4	0,1,2197	107.0	108.0	108.0		488,488	4.0	0.8	16		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FANCA	NM_000135.2,NM_001018112.1	29,29	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	163/1456,163/298	89877149	2,12994	2198	4300	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.488G>A	16.37:g.89877149C>T	ENSP00000373952:p.Arg163His		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.R163H	ENST00000389301.3	37	c.488	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753202	0.49362	2.27E-4	1.16E-4	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992	T;T;T	0.45668	0.89;0.89;0.89	4.96	4.01	0.46588	.	0.129460	0.35291	N	0.003307	T	0.60843	0.2300	M	0.71581	2.175	0.39878	D	0.973597	D;P;P;P;D	0.89917	1.0;0.779;0.779;0.779;1.0	D;B;B;B;D	0.87578	0.998;0.219;0.219;0.219;0.998	T	0.65504	-0.6152	10	0.72032	D	0.01	-14.5811	10.6982	0.45911	0.0:0.9094:0.0:0.0906	.	163;163;163;163;163	B4DRI7;A0PJU8;F5H8D5;O15360-2;O15360	.;.;.;.;FANCA_HUMAN	H	163	ENSP00000373952:R163H;ENSP00000373953:R163H;ENSP00000443675:R163H	ENSP00000373952:R163H	R	-	2	0	FANCA	88404650	0.973000	0.33851	0.843000	0.33291	0.057000	0.15508	2.457000	0.45005	1.233000	0.43693	0.650000	0.86243	CGT	FANCA	-	NULL	ENSG00000187741		0.373	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1		0.00	48	0	C			89877149	-1			no_errors	ENST00000389301	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.946	T
FBXL13	222235	genome.wustl.edu	37	7	102462523	102462523	+	Missense_Mutation	SNP	C	C	T	rs578059195		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:102462523C>T	ENST00000313221.4	-	19	2408	c.1982G>A	c.(1981-1983)cGg>cAg	p.R661Q	FBXL13_ENST00000393772.2_Missense_Mutation_p.R633Q|FBXL13_ENST00000379308.3_Missense_Mutation_p.R616Q|FBXL13_ENST00000379305.3_Missense_Mutation_p.R633Q|FBXL13_ENST00000455112.2_Missense_Mutation_p.R616Q|FBXL13_ENST00000379306.3_Missense_Mutation_p.R379Q|FBXL13_ENST00000456695.1_Missense_Mutation_p.R379Q|FBXL13_ENST00000436908.1_Missense_Mutation_p.R661Q	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	661										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						CTTAAGGATCCGGAGTTGTTT	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		21418	0.001		0.0	False		,,,				2504	0.0																0													168.0	158.0	161.0					7																	102462523		2203	4300	6503	SO:0001583	missense	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.1982G>A	7.37:g.102462523C>T	ENSP00000321927:p.Arg661Gln		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.R661Q	ENST00000313221.4	37	c.1982	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475986	0.63737	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112	T;T;T;T;T;T;T;T	0.52754	4.71;0.65;2.73;4.71;4.71;4.71;2.73;0.65	6.17	6.17	0.99709	.	0.271361	0.31156	N	0.008146	T	0.33585	0.0868	N	0.20766	0.605	0.20975	N	0.999818	P;P;D;P	0.55800	0.89;0.702;0.973;0.824	B;B;B;B	0.43052	0.275;0.196;0.406;0.098	T	0.30707	-0.9969	10	0.30854	T	0.27	.	11.6036	0.51017	0.0:0.9203:0.0:0.0797	.	616;379;633;661	Q8NEE6-3;Q8NEE6-4;Q8NEE6-2;Q8NEE6	.;.;.;FXL13_HUMAN	Q	633;616;379;382;633;661;661;379;616	ENSP00000377367:R633Q;ENSP00000368610:R616Q;ENSP00000368608:R379Q;ENSP00000368607:R633Q;ENSP00000388608:R661Q;ENSP00000321927:R661Q;ENSP00000409716:R379Q;ENSP00000391550:R616Q	ENSP00000321927:R661Q	R	-	2	0	FBXL13	102249759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.651000	0.37302	2.941000	0.99782	0.655000	0.94253	CGG	FBXL13	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000161040		0.393	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1		0.00	69	0	C	NM_145032		102462523	-1			no_errors	ENST00000313221	ensembl	human	known	74_37	missense	5.62	84	5	SNP	1.000	T
FETUB	26998	genome.wustl.edu	37	3	186364101	186364101	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:186364101A>G	ENST00000265029.3	+	5	760	c.659A>G	c.(658-660)cAg>cGg	p.Q220R	FETUB_ENST00000539949.1_Missense_Mutation_p.Q72R|FETUB_ENST00000382136.3_Missense_Mutation_p.Q183R|FETUB_ENST00000450521.1_Missense_Mutation_p.Q220R|RP11-134F2.2_ENST00000428501.1_RNA|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000382134.3_Missense_Mutation_p.Q155R	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	220	Cystatin fetuin-B-type 2. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		ACTAAATCCCAGGCCAGCAGC	0.408																																																	0													149.0	155.0	153.0					3																	186364101		2203	4300	6503	SO:0001583	missense	0			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.659A>G	3.37:g.186364101A>G	ENSP00000265029:p.Gln220Arg		B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.Q220R	ENST00000265029.3	37	c.659	CCDS3279.1	3	.	.	.	.	.	.	.	.	.	.	A	11.12	1.546285	0.27652	.	.	ENSG00000090512	ENST00000450521;ENST00000431018;ENST00000539949;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62;2.62	4.97	0.855	0.19013	Proteinase inhibitor I25, cystatin (2);	0.772518	0.11763	N	0.531871	T	0.26846	0.0657	M	0.80847	2.515	0.09310	N	1	D;D;P	0.57899	0.981;0.967;0.837	P;P;P	0.55303	0.773;0.704;0.498	T	0.09997	-1.0649	10	0.72032	D	0.01	-0.312	4.8262	0.13417	0.4931:0.1731:0.0:0.3337	.	183;155;220	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	R	220;72;72;220;155;183	ENSP00000404288:Q220R;ENSP00000396581:Q72R;ENSP00000443704:Q72R;ENSP00000265029:Q220R;ENSP00000371569:Q155R;ENSP00000371571:Q183R	ENSP00000265029:Q220R	Q	+	2	0	FETUB	187846795	0.337000	0.24766	0.009000	0.14445	0.108000	0.19459	1.765000	0.38481	0.419000	0.25927	0.533000	0.62120	CAG	FETUB	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000090512		0.408	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FETUB	HGNC	protein_coding	OTTHUMT00000344679.1		0.00	55	0	A	NM_014375		186364101	+1			no_errors	ENST00000265029	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.005	G
FLNC	2318	genome.wustl.edu	37	7	128486412	128486412	+	Missense_Mutation	SNP	G	G	T	rs149641783	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:128486412G>T	ENST00000325888.8	+	23	4283	c.4022G>T	c.(4021-4023)cGa>cTa	p.R1341L	FLNC_ENST00000346177.6_Missense_Mutation_p.R1341L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1341					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGCCCCTTCCGAGTGGGCGTG	0.647																																																	0													51.0	62.0	58.0					7																	128486412		2126	4220	6346	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4022G>T	7.37:g.128486412G>T	ENSP00000327145:p.Arg1341Leu		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R1341L	ENST00000325888.8	37	c.4022	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024411	0.93518	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84516	-1.86;-1.86	5.07	5.07	0.68467	Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89767	0.6810	M	0.77712	2.385	0.49798	D	0.99982	D;P	0.54207	0.965;0.877	P;P	0.52189	0.692;0.541	D	0.89972	0.4094	10	0.44086	T	0.13	.	18.4511	0.90704	0.0:0.0:1.0:0.0	.	1341;1341	Q14315-2;Q14315	.;FLNC_HUMAN	L	1341	ENSP00000327145:R1341L;ENSP00000344002:R1341L	ENSP00000327145:R1341L	R	+	2	0	FLNC	128273648	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.999000	0.88496	2.360000	0.80028	0.555000	0.69702	CGA	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.647	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3		0.00	23	0	G			128486412	+1			no_errors	ENST00000325888	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
FMN1	342184	genome.wustl.edu	37	15	33261259	33261259	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:33261259G>A	ENST00000559047.1	-	5	2642	c.2643C>T	c.(2641-2643)ctC>ctT	p.L881L	FMN1_ENST00000334528.9_Silent_p.L658L|SNORD77_ENST00000391113.1_RNA|FMN1_ENST00000561249.1_Silent_p.L783L			Q68DA7	FMN1_HUMAN	formin 1	881	FH1.|Pro-rich.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GTCCTGAGGGGAGGGGCGGAG	0.627																																																	0													29.0	27.0	27.0					15																	33261259		1968	4148	6116	SO:0001819	synonymous_variant	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2643C>T	15.37:g.33261259G>A			Q3B7I6|Q3ZAR4|Q6ZSY1	Silent	SNP	pfam_FH2_Formin,smart_FH2_Formin,prints_Formin_Cappuccino_subfam	p.L658	ENST00000559047.1	37	c.1974		15																																																																																			FMN1	-	NULL	ENSG00000248905		0.627	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1		0.00	27	0	G	NM_001103184		33261259	-1			no_errors	ENST00000334528	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.000	A
FOLH1	2346	genome.wustl.edu	37	11	49175427	49175427	+	Silent	SNP	A	A	G	rs199517010		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:49175427A>G	ENST00000256999.2	-	17	2201	c.1941T>C	c.(1939-1941)agT>agC	p.S647S	FOLH1_ENST00000533034.1_Silent_p.S632S|FOLH1_ENST00000356696.3_Silent_p.S647S|FOLH1_ENST00000343844.4_Silent_p.S339S|FOLH1_ENST00000340334.7_Silent_p.S632S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	647					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.S647S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGAGTCTCTCACTGAACTTGG	0.294																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											83.0	85.0	84.0					11																	49175427		2201	4296	6497	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1941T>C	11.37:g.49175427A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.S647	ENST00000256999.2	37	c.1941	CCDS7946.1	11																																																																																			FOLH1	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000086205		0.294	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1		0.00	42	0	A	NM_004476		49175427	-1			no_errors	ENST00000256999	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.000	G
FREM1	158326	genome.wustl.edu	37	9	14806713	14806713	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:14806713C>T	ENST00000380880.3	-	18	4003	c.3220G>A	c.(3220-3222)Gaa>Aaa	p.E1074K	FREM1_ENST00000380881.4_Missense_Mutation_p.E1075K|FREM1_ENST00000422223.2_Missense_Mutation_p.E1074K			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1074					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AGTATATTTTCGAGGTAGCCA	0.428																																																	0													51.0	52.0	52.0					9																	14806713		1985	4156	6141	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3220G>A	9.37:g.14806713C>T	ENSP00000370262:p.Glu1074Lys		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.E1075K	ENST00000380880.3	37	c.3223	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039568	0.93630	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.79845	-1.31;-1.31;-1.31	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.93122	0.7810	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93878	0.7168	10	0.62326	D	0.03	-23.2411	20.2182	0.98305	0.0:1.0:0.0:0.0	.	1074	Q5H8C1	FREM1_HUMAN	K	1075;1074;1074	ENSP00000370263:E1075K;ENSP00000412940:E1074K;ENSP00000370262:E1074K	ENSP00000370257:E1077K	E	-	1	0	FREM1	14796713	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.398000	0.79919	2.785000	0.95823	0.655000	0.94253	GAA	FREM1	-	NULL	ENSG00000164946		0.428	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	-	0.00	49	0	C	NM_144966		14806713	-1	tier1	-	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
FXR1	8087	genome.wustl.edu	37	3	180652996	180652996	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:180652996A>G	ENST00000357559.4	+	3	559	c.175A>G	c.(175-177)Att>Gtt	p.I59V	FXR1_ENST00000445140.2_Missense_Mutation_p.I59V|FXR1_ENST00000468861.1_5'UTR|FXR1_ENST00000305586.7_5'UTR|FXR1_ENST00000480918.1_Missense_Mutation_p.I46V|FXR1_ENST00000491062.1_Intron	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	59					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AAAAAAAGAAATTAGTGAAGG	0.308																																																	0													61.0	63.0	62.0					3																	180652996		2203	4300	6503	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.175A>G	3.37:g.180652996A>G	ENSP00000350170:p.Ile59Val		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,superfamily_NA-bd_OB-fold,smart_KH_dom,pfscan_KH_dom_type_1	p.I59V	ENST00000357559.4	37	c.175	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	A	17.61	3.432835	0.62844	.	.	ENSG00000114416	ENST00000357559;ENST00000445140;ENST00000480918;ENST00000484042	T;T;T;T	0.47869	1.83;1.15;1.66;0.83	5.54	5.54	0.83059	Agenet (1);	0.000000	0.85682	D	0.000000	T	0.66557	0.2801	M	0.73598	2.24	0.80722	D	1	B;B;B	0.26708	0.124;0.08;0.157	B;B;P	0.48598	0.269;0.257;0.583	T	0.68845	-0.5301	10	0.72032	D	0.01	-1.9787	15.6264	0.76863	1.0:0.0:0.0:0.0	.	46;59;59	B4DXZ6;P51114-2;P51114	.;.;FXR1_HUMAN	V	59;59;46;63	ENSP00000350170:I59V;ENSP00000388828:I59V;ENSP00000418097:I46V;ENSP00000417513:I63V	ENSP00000350170:I59V	I	+	1	0	FXR1	182135690	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.123000	0.89586	2.230000	0.72887	0.455000	0.32223	ATT	FXR1	-	pfam_Agenet-like_dom,superfamily_NA-bd_OB-fold	ENSG00000114416		0.308	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	-	0.00	94	0	A			180652996	+1	tier1	-	no_errors	ENST00000357559	ensembl	human	known	74_37	missense	41.03	69	48	SNP	1.000	G
GEMIN4	50628	genome.wustl.edu	37	17	650493	650493	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:650493C>T	ENST00000319004.5	-	2	908	c.790G>A	c.(790-792)Gtg>Atg	p.V264M	GEMIN4_ENST00000576778.1_Missense_Mutation_p.V253M|GEMIN4_ENST00000437269.1_Silent_p.P176P	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	264					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCCAGATACACGGTTGCAGAC	0.612																																																	0													111.0	122.0	118.0					17																	650493		2171	4260	6431	SO:0001583	missense	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.790G>A	17.37:g.650493C>T	ENSP00000321706:p.Val264Met		Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.V264M	ENST00000319004.5	37	c.790	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	C	1.846	-0.466137	0.04476	.	.	ENSG00000179409	ENST00000319004	T	0.15487	2.42	5.37	-5.6	0.02497	.	0.824381	0.11210	N	0.587780	T	0.11196	0.0273	L	0.46157	1.445	0.09310	N	0.999999	B	0.22480	0.07	B	0.21546	0.035	T	0.25082	-1.0142	10	0.33141	T	0.24	-7.2753	4.7135	0.12884	0.084:0.5928:0.1672:0.156	.	264	P57678	GEMI4_HUMAN	M	264	ENSP00000321706:V264M	ENSP00000321706:V264M	V	-	1	0	GEMIN4	597243	0.001000	0.12720	0.001000	0.08648	0.237000	0.25408	0.185000	0.16958	-1.393000	0.02079	-2.049000	0.00408	GTG	GEMIN4	-	NULL	ENSG00000179409		0.612	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1		0.00	38	0	C	NM_015721		650493	-1			no_errors	ENST00000319004	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.000	T
GPAM	57678	genome.wustl.edu	37	10	113913356	113913356	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:113913356G>A	ENST00000348367.4	-	22	2636	c.2439C>T	c.(2437-2439)tgC>tgT	p.C813C	GPAM_ENST00000423155.1_Silent_p.C813C			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	813					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TTTGTCGGTTGCATTGAGGTA	0.388																																					Ovarian(161;1017 2606 18293 52943)												0													122.0	127.0	125.0					10																	113913356		2203	4300	6503	SO:0001819	synonymous_variant	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2439C>T	10.37:g.113913356G>A			Q5VW51|Q86TA3	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.C813	ENST00000348367.4	37	c.2439	CCDS7570.1	10																																																																																			GPAM	-	NULL	ENSG00000119927		0.388	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	-	0.00	21	0	G	NM_020918		113913356	-1	tier1	-	no_errors	ENST00000348367	ensembl	human	known	74_37	silent	18.75	13	3	SNP	0.999	A
GPR124	25960	genome.wustl.edu	37	8	37688970	37688970	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:37688970G>T	ENST00000412232.2	+	8	975	c.962G>T	c.(961-963)tGg>tTg	p.W321L	GPR124_ENST00000315215.7_Missense_Mutation_p.W321L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	321	Ig-like.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ATCGGCGTGTGGGCCTCAGGC	0.662																																																	0													122.0	87.0	99.0					8																	37688970		2203	4300	6503	SO:0001583	missense	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.962G>T	8.37:g.37688970G>T	ENSP00000406367:p.Trp321Leu		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.W321L	ENST00000412232.2	37	c.962	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512727	0.44660	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.50277	0.75;0.75	5.07	5.07	0.68467	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.371746	0.25916	N	0.027476	T	0.40719	0.1128	L	0.36672	1.1	0.26551	N	0.973916	B;B	0.17667	0.013;0.023	B;B	0.24541	0.054;0.01	T	0.40156	-0.9578	10	0.59425	D	0.04	-5.508	13.2759	0.60188	0.0:0.2951:0.7049:0.0	.	321;321	Q96PE1-2;Q96PE1	.;GP124_HUMAN	L	314;321;321	ENSP00000323508:W321L;ENSP00000406367:W321L	ENSP00000323508:W321L	W	+	2	0	GPR124	37808128	0.999000	0.42202	1.000000	0.80357	0.876000	0.50452	2.353000	0.44089	2.377000	0.81083	0.449000	0.29647	TGG	GPR124	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000020181		0.662	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2		0.00	61	0	G			37688970	+1			no_errors	ENST00000412232	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
GPR125	166647	genome.wustl.edu	37	4	22390753	22390753	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr4:22390753G>T	ENST00000334304.5	-	18	2950	c.2681C>A	c.(2680-2682)gCa>gAa	p.A894E	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	894					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				AATGTTCGCTGCTGCAGTTAT	0.408																																																	0													218.0	223.0	221.0					4																	22390753		2203	4300	6503	SO:0001583	missense	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2681C>A	4.37:g.22390753G>T	ENSP00000334952:p.Ala894Glu		Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.A894E	ENST00000334304.5	37	c.2681	CCDS33964.1	4	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798676	0.90538	.	.	ENSG00000152990	ENST00000334304	T	0.47177	0.85	5.85	5.85	0.93711	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.74465	0.3720	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.99	T	0.77381	-0.2609	10	0.87932	D	0	-24.2833	20.1496	0.98084	0.0:0.0:1.0:0.0	.	751;894	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	E	894	ENSP00000334952:A894E	ENSP00000334952:A894E	A	-	2	0	GPR125	21999851	1.000000	0.71417	0.951000	0.38953	0.517000	0.34286	9.471000	0.97696	2.755000	0.94549	0.655000	0.94253	GCA	GPR125	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000152990		0.408	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	-	0.00	30	0	G			22390753	-1	tier1	-	no_errors	ENST00000334304	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
GPR156	165829	genome.wustl.edu	37	3	119886565	119886565	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:119886565G>A	ENST00000464295.1	-	10	2204	c.1759C>T	c.(1759-1761)Ccc>Tcc	p.P587S	GPR156_ENST00000461057.1_Missense_Mutation_p.P583S|GPR156_ENST00000315843.3_Missense_Mutation_p.P587S			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	587						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TTGGAGAGGGGCATCTTTTGG	0.607																																																	0													32.0	35.0	34.0					3																	119886565		2202	4297	6499	SO:0001583	missense	0			AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.1759C>T	3.37:g.119886565G>A	ENSP00000417261:p.Pro587Ser		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.P587S	ENST00000464295.1	37	c.1759	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	G	8.994	0.978365	0.18812	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.22336	1.96;1.96;1.96	4.98	1.89	0.25635	.	0.674704	0.14342	N	0.325679	T	0.10766	0.0263	N	0.19112	0.55	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.08055	0.003;0.003	T	0.30909	-0.9962	9	.	.	.	-7.8141	5.0034	0.14275	0.2641:0.1716:0.5643:0.0	.	583;587	E9PFZ4;Q8NFN8	.;GP156_HUMAN	S	587;587;583	ENSP00000417261:P587S;ENSP00000324553:P587S;ENSP00000418758:P583S	.	P	-	1	0	GPR156	121369255	0.375000	0.25089	0.260000	0.24451	0.965000	0.64279	0.710000	0.25748	0.664000	0.31047	0.563000	0.77884	CCC	GPR156	-	NULL	ENSG00000175697		0.607	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	HGNC	protein_coding	OTTHUMT00000355139.1	-	0.00	78	0	G	NM_153002		119886565	-1	tier1	-	no_errors	ENST00000315843	ensembl	human	known	74_37	missense	5.26	90	5	SNP	0.000	A
GPR158	57512	genome.wustl.edu	37	10	25889362	25889363	+	3'UTR	INS	-	-	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:25889362_25889363insA	ENST00000376351.3	+	0	5166_5167				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GTTTGCCTTTCAAAAAAAAACA	0.312																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*1160->A	10.37:g.25889371_25889371dupA			Q6QR81|Q9ULT3	RNA	INS	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			GPR158	-	-	ENSG00000151025		0.312	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2		0.00	9	0	-	XM_166110		25889363	+1	tier1		no_errors	ENST00000490549	ensembl	human	known	74_37	rna	40.00	3	2	INS	0.627:0.417	A
GPR161	23432	genome.wustl.edu	37	1	168066118	168066118	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:168066118T>C	ENST00000367838.1	-	5	1040	c.727A>G	c.(727-729)Agc>Ggc	p.S243G	GPR161_ENST00000539777.1_Missense_Mutation_p.S165G|GPR161_ENST00000271357.5_Missense_Mutation_p.S243G|GPR161_ENST00000367836.1_Missense_Mutation_p.S111G|GPR161_ENST00000546300.1_Missense_Mutation_p.S129G|GPR161_ENST00000537209.1_Missense_Mutation_p.S263G|GPR161_ENST00000361697.2_Missense_Mutation_p.S243G|GPR161_ENST00000367835.1_Missense_Mutation_p.S243G	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	243					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					GTGGAGGTGCTGGAGTTCTTC	0.597																																																	0													104.0	108.0	107.0					1																	168066118		2203	4300	6503	SO:0001583	missense	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.727A>G	1.37:g.168066118T>C	ENSP00000356812:p.Ser243Gly		B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S263G	ENST00000367838.1	37	c.787	CCDS1268.1	1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.395741	0.62177	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;D;T;T;T;T;T	0.82803	-0.15;-0.15;-1.65;-0.15;-1.15;-1.12;-0.06;-0.15	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.075333	0.85682	D	0.000000	T	0.76097	0.3940	M	0.75615	2.305	0.42300	D	0.992179	B;B;B;B;B;B	0.29988	0.102;0.201;0.264;0.154;0.034;0.042	B;B;B;B;B;B	0.31442	0.079;0.13;0.124;0.124;0.036;0.089	T	0.77180	-0.2682	9	0.35671	T	0.21	-40.0045	15.0408	0.71788	0.0:0.0:0.0:1.0	.	263;129;165;263;243;243	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	G	243;243;111;243;129;165;263;243	ENSP00000356812:S243G;ENSP00000271357:S243G;ENSP00000356810:S111G;ENSP00000356809:S243G;ENSP00000444348:S129G;ENSP00000437576:S165G;ENSP00000441039:S263G;ENSP00000355194:S243G	ENSP00000271357:S243G	S	-	1	0	GPR161	166332742	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.854000	0.86942	2.090000	0.63153	0.459000	0.35465	AGC	GPR161	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000143147		0.597	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	-	0.00	26	0	T	NM_007369		168066118	-1	tier1	-	no_errors	ENST00000537209	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	C
GRM3	2913	genome.wustl.edu	37	7	86394858	86394858	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:86394858G>T	ENST00000361669.2	+	2	1496	c.397G>T	c.(397-399)Gcc>Tcc	p.A133S	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000536043.1_Intron|GRM3_ENST00000394720.2_Missense_Mutation_p.A131S|GRM3_ENST00000439827.1_Missense_Mutation_p.A133S	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	133					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGGATCCTATGCCATTCAAGA	0.428																																					GBM(52;969 1098 3139 52280)												0													139.0	126.0	131.0					7																	86394858		2203	4300	6503	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.397G>T	7.37:g.86394858G>T	ENSP00000355316:p.Ala133Ser		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.A133S	ENST00000361669.2	37	c.397	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	18.29	3.592054	0.66219	.	.	ENSG00000198822	ENST00000361669;ENST00000439827;ENST00000394720	D;D;D	0.85013	-1.93;-1.93;-1.93	5.13	5.13	0.70059	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.80954	0.4723	N	0.21194	0.64	0.80722	D	1	P;B	0.36110	0.537;0.399	B;B	0.40782	0.236;0.34	T	0.82839	-0.0259	10	0.66056	D	0.02	.	17.7499	0.88430	0.0:0.0:1.0:0.0	.	133;133	G5E9K2;Q14832	.;GRM3_HUMAN	S	133;133;131	ENSP00000355316:A133S;ENSP00000398767:A133S;ENSP00000378209:A131S	ENSP00000355316:A133S	A	+	1	0	GRM3	86232794	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.701000	0.84566	2.675000	0.91044	0.655000	0.94253	GCC	GRM3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_3	ENSG00000198822		0.428	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	-	0.00	39	0	G			86394858	+1	tier1	-	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
HEMGN	55363	genome.wustl.edu	37	9	100692787	100692787	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:100692787A>G	ENST00000259456.3	-	4	1033	c.890T>C	c.(889-891)cTt>cCt	p.L297P		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	297					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TTTAGGAAAAAGGCCTTCTGT	0.388																																																	0													285.0	269.0	274.0					9																	100692787		2203	4300	6503	SO:0001583	missense	0			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.890T>C	9.37:g.100692787A>G	ENSP00000259456:p.Leu297Pro		Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	NULL	p.L297P	ENST00000259456.3	37	c.890	CCDS6731.1	9	.	.	.	.	.	.	.	.	.	.	A	8.614	0.889842	0.17540	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	5.26	1.37	0.22104	.	1.063840	0.07237	N	0.863593	T	0.23846	0.0577	L	0.29908	0.895	0.09310	N	1	P	0.37276	0.589	B	0.37047	0.24	T	0.18681	-1.0329	9	0.33940	T	0.23	0.5906	2.3189	0.04206	0.6015:0.1595:0.0859:0.1532	.	297	Q9BXL5	HEMGN_HUMAN	P	297	.	ENSP00000259456:L297P	L	-	2	0	HEMGN	99732608	0.000000	0.05858	0.002000	0.10522	0.367000	0.29736	-0.236000	0.09003	0.042000	0.15717	0.459000	0.35465	CTT	HEMGN	-	NULL	ENSG00000136929		0.388	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	HGNC	protein_coding	OTTHUMT00000053344.2		0.00	36	0	A	NM_197978		100692787	-1			no_errors	ENST00000259456	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.004	G
HNRNPA1L2	144983	genome.wustl.edu	37	13	53217214	53217214	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr13:53217214G>A	ENST00000357495.2	+	1	647	c.587G>A	c.(586-588)cGa>cAa	p.R196Q	HNRNPA1L2_ENST00000342657.3_Missense_Mutation_p.R196Q|HNRNPA1L2_ENST00000398039.1_Missense_Mutation_p.R196Q			Q32P51	RA1L2_HUMAN	heterogeneous nuclear ribonucleoprotein A1-like 2	196	Gly-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|mRNA transport (GO:0051028)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			cervix(1)|large_intestine(1)|lung(5)	7						CAAAGAGGTCGAAGGGGTTCT	0.498																																																	0													47.0	41.0	43.0					13																	53217214		2123	4087	6210	SO:0001583	missense	0				CCDS31980.1	13q14.3	2013-02-12			ENSG00000139675	ENSG00000139675		"""RNA binding motif (RRM) containing"""	27067	protein-coding gene	gene with protein product						12477932	Standard	NM_001011724		Approved	LOC144983	uc001vgy.1	Q32P51	OTTHUMG00000016972	ENST00000357495.2:c.587G>A	13.37:g.53217214G>A	ENSP00000350090:p.Arg196Gln		Q5TBS2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.R196Q	ENST00000357495.2	37	c.587	CCDS31980.1	13	.	.	.	.	.	.	.	.	.	.	g	7.264	0.605826	0.14002	.	.	ENSG00000139675	ENST00000342657;ENST00000398039;ENST00000357495	D;D;D	0.85411	-1.98;-1.98;-1.98	0.352	0.352	0.16051	.	421.164000	0.01303	U	0.010341	T	0.75568	0.3867	L	0.36672	1.1	0.09310	N	1	B	0.29188	0.236	B	0.06405	0.002	T	0.60855	-0.7180	10	0.39692	T	0.17	.	2.8612	0.05588	0.4:0.0:0.6:0.0	.	196	Q32P51	RA1L2_HUMAN	Q	196	ENSP00000341285:R196Q;ENSP00000381119:R196Q;ENSP00000350090:R196Q	ENSP00000341285:R196Q	R	+	2	0	HNRNPA1L2	52115215	0.222000	0.23652	0.915000	0.36163	0.267000	0.26476	0.540000	0.23191	0.455000	0.26910	0.089000	0.15464	CGA	HNRNPA1L2	-	NULL	ENSG00000139675		0.498	HNRNPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA1L2	HGNC	protein_coding	OTTHUMT00000045098.1	-	0.00	58	0	G	NM_001011724		53217214	+1	tier1	-	no_errors	ENST00000342657	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.124	A
HP	3240	genome.wustl.edu	37	16	72094632	72094632	+	Missense_Mutation	SNP	C	C	T	rs367968695		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:72094632C>T	ENST00000355906.5	+	7	1122	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V	HP_ENST00000357763.4_Missense_Mutation_p.A391V|HP_ENST00000570083.1_Missense_Mutation_p.A296V|HP_ENST00000562526.1_3'UTR|HP_ENST00000398131.2_Missense_Mutation_p.A296V|HP_ENST00000565574.1_Missense_Mutation_p.A296V|HPR_ENST00000356967.5_Intron|HPR_ENST00000540303.2_5'Flank|HPR_ENST00000561690.1_5'Flank	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin	355	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		TATGGCGATGCGGGCAGTGCC	0.537																																																	0								C	VAL/ALA,VAL/ALA	0,4204		0,0,2102	167.0	165.0	166.0		887,1064	5.2	1.0	16		166	2,8442		0,2,4220	no	missense,missense	HP	NM_001126102.1,NM_005143.3	64,64	0,2,6322	TT,TC,CC		0.0237,0.0,0.0158	probably-damaging,probably-damaging	296/348,355/407	72094632	2,12646	2102	4222	6324	SO:0001583	missense	0				CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.1064C>T	16.37:g.72094632C>T	ENSP00000348170:p.Ala355Val		B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A355V	ENST00000355906.5	37	c.1064	CCDS45524.1	16	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095638	0.36952	0.0	2.37E-4	ENSG00000257017	ENST00000355906;ENST00000398131;ENST00000405951;ENST00000357763	D;D	0.89270	-2.49;-2.49	5.21	5.21	0.72293	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.92459	0.7606	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;0.996	D	0.92654	0.6135	10	0.87932	D	0	.	13.3246	0.60452	0.0:0.8413:0.1587:0.0	.	177;230;296;355	Q6PEJ8;Q6NSB4;Q0VAC5;P00738	.;.;.;HPT_HUMAN	V	355;296;230;331	ENSP00000348170:A355V;ENSP00000381199:A296V	ENSP00000348170:A355V	A	+	2	0	HP	70652133	0.814000	0.29104	0.955000	0.39395	0.887000	0.51463	1.077000	0.30741	2.713000	0.92767	0.650000	0.86243	GCG	HP	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000257017		0.537	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HP	HGNC	protein_coding	OTTHUMT00000421680.1	-	0.00	80	0	C	NM_005143		72094632	+1	tier1	-	no_errors	ENST00000355906	ensembl	human	known	74_37	missense	23.46	62	19	SNP	0.998	T
HP1BP3	50809	genome.wustl.edu	37	1	21076484	21076484	+	Intron	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:21076484T>C	ENST00000312239.5	-	10	1121				HP1BP3_ENST00000375003.2_Intron	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3						nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TTAGCACAGATATGTTTTACA	0.443																																																	0																																										SO:0001627	intron_variant	0			BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.982-109A>G	1.37:g.21076484T>C			A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	RNA	SNP	-	NULL	ENST00000312239.5	37	NULL	CCDS30621.1	1																																																																																			HP1BP3	-	-	ENSG00000127483		0.443	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HP1BP3	HGNC	protein_coding	OTTHUMT00000007457.2	-	0.00	13	0	T	NM_016287		21076484	-1	tier1	-	no_errors	ENST00000491748	ensembl	human	known	74_37	rna	40.00	6	4	SNP	1.000	C
HRH2	3274	genome.wustl.edu	37	5	175110302	175110302	+	Silent	SNP	C	C	A	rs139350514	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr5:175110302C>A	ENST00000231683.2	+	1	1839	c.66C>A	c.(64-66)acC>acA	p.T22T	HRH2_ENST00000377291.2_Silent_p.T22T	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	22					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.T22T(2)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	TCACCATCACCGTGGTCCTTG	0.592																																																	2	Substitution - coding silent(2)	large_intestine(2)											238.0	212.0	221.0					5																	175110302		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.66C>A	5.37:g.175110302C>A			B5BUP7|Q14464|Q7Z5R9	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H2_rcpt,prints_GPCR_Rhodpsn,prints_5HT6_rcpt	p.T22	ENST00000231683.2	37	c.66	CCDS4395.1	5																																																																																			HRH2	-	prints_GPCR_Rhodpsn	ENSG00000113749		0.592	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH2	HGNC	protein_coding	OTTHUMT00000253151.1		0.00	83	0	C			175110302	+1			no_errors	ENST00000377291	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.000	A
IKZF3	22806	genome.wustl.edu	37	17	37922218	37922218	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:37922218T>C	ENST00000346872.3	-	8	1416	c.1355A>G	c.(1354-1356)tAt>tGt	p.Y452C	IKZF3_ENST00000439016.2_Missense_Mutation_p.Y357C|IKZF3_ENST00000394189.2_Missense_Mutation_p.Y270C|IKZF3_ENST00000583368.1_Missense_Mutation_p.Y205C|IKZF3_ENST00000439167.2_Missense_Mutation_p.Y379C|IKZF3_ENST00000377952.2_Missense_Mutation_p.Y231C|IKZF3_ENST00000346243.3_Missense_Mutation_p.Y374C|IKZF3_ENST00000467757.1_Missense_Mutation_p.Y396C|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000351680.3_Missense_Mutation_p.Y413C|IKZF3_ENST00000535189.1_Missense_Mutation_p.Y418C|IKZF3_ENST00000350532.3_Missense_Mutation_p.Y413C|IKZF3_ENST00000377958.2_Missense_Mutation_p.Y365C|IKZF3_ENST00000377945.3_Missense_Mutation_p.Y318C|IKZF3_ENST00000377944.3_Missense_Mutation_p.Y309C	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	452					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GTCACACCGATACACATCCAT	0.552																																																	0													163.0	151.0	155.0					17																	37922218		2203	4300	6503	SO:0001583	missense	0			AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.1355A>G	17.37:g.37922218T>C	ENSP00000344544:p.Tyr452Cys		B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y452C	ENST00000346872.3	37	c.1355	CCDS11346.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.94|17.94	3.510455|3.510455	0.64522|0.64522	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000439167;ENST00000439016|ENST00000488188;ENST00000346872;ENST00000377945;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000377952;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757	.|T;T;T;T;T;T;T;T;T;T	.|0.37235	.|1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.51|5.51	3.17|3.17	0.36434|0.36434	.|Zinc finger, C2H2-like (1);	.|0.121905	.|0.37219	.|N	.|0.002185	T|T	0.68559|0.68559	0.3014|0.3014	H|H	0.96576|0.96576	3.845|3.845	0.45594|0.45594	D|D	0.998531|0.998531	.|D;D;D;D;D;D;P;D;D;D;D;D;D	.|0.76494	.|0.998;0.992;0.985;0.992;0.999;0.986;0.94;0.985;0.998;0.989;0.966;0.966;0.978	.|D;P;P;P;D;P;P;P;D;D;P;P;P	.|0.70935	.|0.937;0.79;0.667;0.79;0.971;0.899;0.844;0.667;0.914;0.914;0.844;0.736;0.882	T|T	0.75631|0.75631	-0.3251|-0.3251	5|10	.|0.87932	.|D	.|0	-6.7039|-6.7039	9.9944|9.9944	0.41891|0.41891	0.3452:0.0:0.0:0.6548|0.3452:0.0:0.0:0.6548	.|.	.|365;231;270;318;309;418;374;357;413;396;413;379;452	.|Q9UKT9-9;Q9UKT9-12;Q9UKT9-11;Q9UKT9-13;Q9UKT9-10;Q9UKT9-7;Q9UKT9-6;Q9UKT9-5;Q9UKT9-4;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9	.|.;.;.;.;.;.;.;.;.;.;.;.;IKZF3_HUMAN	V|C	367;406|452;357;318;270;309;365;231;418;413;374;413;396	.|ENSP00000367180:Y318C;ENSP00000377741:Y270C;ENSP00000367179:Y309C;ENSP00000367194:Y365C;ENSP00000367188:Y231C;ENSP00000438972:Y418C;ENSP00000345622:Y413C;ENSP00000341977:Y374C;ENSP00000344471:Y413C;ENSP00000420463:Y396C	.|ENSP00000341977:Y374C	I|Y	-|-	1|2	0|0	IKZF3|IKZF3	35175744|35175744	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.987000|0.987000	0.75469|0.75469	1.755000|1.755000	0.38379|0.38379	0.886000|0.886000	0.36113|0.36113	0.482000|0.482000	0.46254|0.46254	ATC|TAT	IKZF3	-	smart_Znf_C2H2-like	ENSG00000161405		0.552	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF3	HGNC	protein_coding	OTTHUMT00000257004.2	-	0.00	36	0	T	NM_012481		37922218	-1	tier1	-	no_errors	ENST00000346872	ensembl	human	known	74_37	missense	38.46	32	20	SNP	1.000	C
IL4R	3566	genome.wustl.edu	37	16	27373610	27373610	+	Missense_Mutation	SNP	T	T	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:27373610T>G	ENST00000395762.2	+	11	1196	c.937T>G	c.(937-939)Ttt>Gtt	p.F313V	IL4R_ENST00000543915.2_Missense_Mutation_p.F313V|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000380922.3_Missense_Mutation_p.F298V|IL4R_ENST00000170630.2_Missense_Mutation_p.F313V	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	313					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						CTTGCCCTGTTTTCTGGAGCA	0.463																																																	0													86.0	94.0	91.0					16																	27373610		2197	4300	6497	SO:0001583	missense	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.937T>G	16.37:g.27373610T>G	ENSP00000379111:p.Phe313Val		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	pfam_IL-4_rcpt-alpha_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.F313V	ENST00000395762.2	37	c.937	CCDS10629.1	16	.	.	.	.	.	.	.	.	.	.	T	13.41	2.229511	0.39399	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.8	1.22	0.21188	.	0.461649	0.17048	N	0.189036	T	0.08133	0.0203	L	0.36672	1.1	0.26451	N	0.975602	B;B;B	0.22909	0.077;0.077;0.077	B;B;B	0.20184	0.028;0.016;0.016	T	0.25916	-1.0118	10	0.48119	T	0.1	-28.0519	6.4182	0.21728	0.0:0.3287:0.0:0.6713	.	298;313;313	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	V	313;313;298;313	ENSP00000379111:F313V;ENSP00000441667:F313V;ENSP00000370309:F298V;ENSP00000170630:F313V	ENSP00000170630:F313V	F	+	1	0	IL4R	27281111	0.927000	0.31430	0.462000	0.27118	0.762000	0.43233	0.197000	0.17197	-0.052000	0.13311	0.533000	0.62120	TTT	IL4R	-	NULL	ENSG00000077238		0.463	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	-	0.00	56	0	T			27373610	+1	tier1	-	no_errors	ENST00000170630	ensembl	human	known	74_37	missense	34.72	47	25	SNP	0.934	G
IL21R	50615	genome.wustl.edu	37	16	27460100	27460100	+	Silent	SNP	C	C	T	rs145529117	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:27460100C>T	ENST00000337929.3	+	9	1586	c.1113C>T	c.(1111-1113)taC>taT	p.Y371Y	IL21R_ENST00000395755.1_Silent_p.Y371Y|IL21R_ENST00000395754.4_Silent_p.Y371Y|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Silent_p.Y371Y	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	371					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						ATCGGCCATACGGCCTGGTGT	0.632			T	BCL6	NHL																																			Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0								C	,,	6,4388	11.4+/-27.6	0,6,2191	65.0	62.0	63.0		1113,1113,1179	-10.4	0.0	16	dbSNP_134	63	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	IL21R	NM_021798.3,NM_181078.2,NM_181079.4	,,	0,6,6491	TT,TC,CC		0.0,0.1365,0.0462	,,	371/539,371/539,393/561	27460100	6,12988	2197	4300	6497	SO:0001819	synonymous_variant	0			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1113C>T	16.37:g.27460100C>T			A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	superfamily_Fibronectin_type3	p.Y371	ENST00000337929.3	37	c.1113	CCDS10630.1	16																																																																																			IL21R	-	NULL	ENSG00000103522		0.632	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	HGNC	protein_coding	OTTHUMT00000254578.2		0.00	26	0	C	NM_181078		27460100	+1			no_errors	ENST00000337929	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.010	T
IRF2BPL	64207	genome.wustl.edu	37	14	77492226	77492226	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:77492226G>A	ENST00000238647.3	-	1	2808	c.1910C>T	c.(1909-1911)gCg>gTg	p.A637V		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	637					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GGGCGAGTGCGCTGTGCCCAG	0.682																																																	0													14.0	14.0	14.0					14																	77492226		2157	4199	6356	SO:0001583	missense	0			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.1910C>T	14.37:g.77492226G>A	ENSP00000238647:p.Ala637Val		Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.A637V	ENST00000238647.3	37	c.1910	CCDS9854.1	14	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883119	0.51908	.	.	ENSG00000119669	ENST00000238647	T	0.64991	-0.13	4.48	3.59	0.41128	.	0.070349	0.56097	U	0.000035	T	0.59376	0.2189	L	0.40543	1.245	0.43756	D	0.996261	D	0.67145	0.996	P	0.50270	0.636	T	0.60316	-0.7287	10	0.49607	T	0.09	-0.4619	11.181	0.48627	0.0895:0.0:0.9105:0.0	.	637	Q9H1B7	I2BPL_HUMAN	V	637	ENSP00000238647:A637V	ENSP00000238647:A637V	A	-	2	0	IRF2BPL	76561979	1.000000	0.71417	0.992000	0.48379	0.932000	0.56968	6.422000	0.73357	1.091000	0.41335	0.462000	0.41574	GCG	IRF2BPL	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000119669		0.682	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BPL	HGNC	protein_coding	OTTHUMT00000414298.1	-	0.00	44	0	G	NM_024496		77492226	-1	tier1	-	no_errors	ENST00000238647	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.996	A
ITGA5	3678	genome.wustl.edu	37	12	54795803	54795803	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:54795803G>A	ENST00000293379.4	-	21	2469	c.2208C>T	c.(2206-2208)ccC>ccT	p.P736P	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	736					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CTGCCTTCATGGGGTTGCCCA	0.592																																																	0													61.0	57.0	58.0					12																	54795803		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2208C>T	12.37:g.54795803G>A			Q96HA5	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.P736	ENST00000293379.4	37	c.2208	CCDS8880.1	12																																																																																			ITGA5	-	pfam_Integrin_alpha-2	ENSG00000161638		0.592	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA5	HGNC	protein_coding	OTTHUMT00000406174.1	-	0.00	37	0	G			54795803	-1	tier1	-	no_errors	ENST00000293379	ensembl	human	known	74_37	silent	19.57	37	9	SNP	1.000	A
ITGB1	3688	genome.wustl.edu	37	10	33209186	33209186	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:33209186G>A	ENST00000396033.2	-	10	1391	c.1256C>T	c.(1255-1257)tCc>tTc	p.S419F	ITGB1_ENST00000374956.4_Missense_Mutation_p.S419F|ITGB1_ENST00000302278.3_Missense_Mutation_p.S419F|ITGB1_ENST00000423113.1_Missense_Mutation_p.S419F	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	419					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	ATCTCCAATGGAAATATTGGA	0.323																																																	0													122.0	105.0	111.0					10																	33209186		2203	4300	6503	SO:0001583	missense	0			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1256C>T	10.37:g.33209186G>A	ENSP00000379350:p.Ser419Phe		A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.S419F	ENST00000396033.2	37	c.1256	CCDS7174.1	10	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975935	0.74360	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.19	5.19	0.71726	Integrin beta subunit, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.82116	0.4967	M	0.86028	2.79	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.996;0.953;0.994	D	0.85276	0.1059	10	0.87932	D	0	.	18.7147	0.91671	0.0:0.0:1.0:0.0	.	419;419;419;419;419	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	F	419	ENSP00000379350:S419F;ENSP00000388694:S419F;ENSP00000303351:S419F;ENSP00000364094:S419F	ENSP00000303351:S419F	S	-	2	0	ITGB1	33249192	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.830000	0.86741	2.427000	0.82271	0.467000	0.42956	TCC	ITGB1	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000150093		0.323	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB1	HGNC	protein_coding	OTTHUMT00000047496.1	-	0.00	35	0	G	NM_002211		33209186	-1	tier1	-	no_errors	ENST00000374956	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	A
KCNA7	3743	genome.wustl.edu	37	19	49573965	49573965	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:49573965C>T	ENST00000221444.1	-	2	1081	c.726G>A	c.(724-726)atG>atA	p.M242I		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	242					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CGATGAGGTTCATCACGTTCT	0.562																																					Colon(74;686 1235 3793 23366 48562)												0													150.0	113.0	126.0					19																	49573965		2203	4300	6503	SO:0001583	missense	0			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.726G>A	19.37:g.49573965C>T	ENSP00000221444:p.Met242Ile		A1KYX7|Q9BYS4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.M242I	ENST00000221444.1	37	c.726	CCDS12755.1	19	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415934	0.83449	.	.	ENSG00000104848	ENST00000221444	D	0.98400	-4.91	4.49	4.49	0.54785	Ion transport (1);	0.042128	0.85682	D	0.000000	D	0.98934	0.9638	M	0.87547	2.89	0.58432	D	0.999998	P	0.52170	0.951	D	0.66351	0.943	D	0.99686	1.1000	10	0.87932	D	0	.	16.3041	0.82841	0.0:1.0:0.0:0.0	.	242	Q96RP8	KCNA7_HUMAN	I	242	ENSP00000221444:M242I	ENSP00000221444:M242I	M	-	3	0	KCNA7	54265777	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.073000	0.71245	2.234000	0.73211	0.313000	0.20887	ATG	KCNA7	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000104848		0.562	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	HGNC	protein_coding	OTTHUMT00000466263.1	-	0.00	54	0	C	NM_031886		49573965	-1	tier1	-	no_errors	ENST00000221444	ensembl	human	known	74_37	missense	26.15	48	17	SNP	1.000	T
KCNJ8	3764	genome.wustl.edu	37	12	21918742	21918742	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:21918742G>T	ENST00000240662.2	-	3	1535	c.1190C>A	c.(1189-1191)tCt>tAt	p.S397Y	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	397					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CCTTCGGATAGAATTGTTCCT	0.418																																																	0													149.0	144.0	146.0					12																	21918742		2203	4300	6503	SO:0001583	missense	0			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.1190C>A	12.37:g.21918742G>T	ENSP00000240662:p.Ser397Tyr		O00657	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	p.S397Y	ENST00000240662.2	37	c.1190	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457861	0.43634	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	T	0.79352	-1.26	5.86	5.86	0.93980	.	0.353219	0.32719	N	0.005738	T	0.65249	0.2673	N	0.08118	0	0.53688	D	0.999972	P	0.50943	0.94	B	0.41571	0.36	T	0.73260	-0.4039	10	0.72032	D	0.01	.	20.2019	0.98263	0.0:0.0:1.0:0.0	.	397	Q15842	IRK8_HUMAN	Y	397	ENSP00000240662:S397Y	ENSP00000240662:S397Y	S	-	2	0	KCNJ8	21810009	1.000000	0.71417	0.969000	0.41365	0.813000	0.45954	4.879000	0.63100	2.776000	0.95493	0.655000	0.94253	TCT	KCNJ8	-	pirsf_K_chnl_inward-rec_Kir	ENSG00000121361		0.418	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1		0.00	45	0	G	NM_004982		21918742	-1			no_errors	ENST00000240662	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	T
KCTD9	54793	genome.wustl.edu	37	8	25297211	25297211	+	Intron	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:25297211C>A	ENST00000221200.4	-	5	532				KCTD9_ENST00000518067.1_5'UTR	NM_017634.3	NP_060104.2	Q7L273	KCTD9_HUMAN	potassium channel tetramerization domain containing 9						protein homooligomerization (GO:0051260)					breast(1)|endometrium(2)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	12		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		ATTGATTTCTCCATTTGTCTT	0.388																																																	0													56.0	54.0	55.0					8																	25297211		2203	4300	6503	SO:0001627	intron_variant	0			BC021216	CCDS6048.1	8p21.1	2013-06-20	2013-06-20		ENSG00000104756	ENSG00000104756		"""BTB/POZ domain containing"""	22401	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 9"""			11483580	Standard	NM_017634		Approved	FLJ20038, BTBD27	uc003xeo.3	Q7L273	OTTHUMG00000099428	ENST00000221200.4:c.312-31G>T	8.37:g.25297211C>A			Q6NUM8|Q9NXV4	RNA	SNP	-	NULL	ENST00000221200.4	37	NULL	CCDS6048.1	8																																																																																			KCTD9	-	-	ENSG00000104756		0.388	KCTD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD9	HGNC	protein_coding	OTTHUMT00000216890.1	-	0.00	45	0	C	NM_017634		25297211	-1	tier1	-	no_errors	ENST00000518067	ensembl	human	known	74_37	rna	40.62	19	13	SNP	1.000	A
KIAA1715	80856	genome.wustl.edu	37	2	176804367	176804367	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:176804367G>T	ENST00000272748.4	-	10	972	c.725C>A	c.(724-726)cCa>cAa	p.P242Q	KIAA1715_ENST00000535310.1_Missense_Mutation_p.P167Q|KIAA1715_ENST00000544803.1_Missense_Mutation_p.P273Q	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	242	Pro-rich.				blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			TGCTAAAGGTGGACCTGGAGG	0.328																																																	0													66.0	66.0	66.0					2																	176804367		2203	4300	6503	SO:0001583	missense	0			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.725C>A	2.37:g.176804367G>T	ENSP00000272748:p.Pro242Gln		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	pfam_DUF2296	p.P273Q	ENST00000272748.4	37	c.818	CCDS33332.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179571	0.78564	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.83852	0.5344	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;1.0	D;D;D;D	0.76575	0.951;0.988;0.928;0.987	D	0.85930	0.1451	9	0.87932	D	0	-10.7249	19.3572	0.94420	0.0:0.0:1.0:0.0	.	244;273;239;242	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	Q	242;244;119;273;167	.	ENSP00000272748:P242Q	P	-	2	0	KIAA1715	176512613	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.383000	0.79741	2.653000	0.90120	0.467000	0.42956	CCA	KIAA1715	-	NULL	ENSG00000144320		0.328	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1715	HGNC	protein_coding	OTTHUMT00000333949.3	-	0.00	35	0	G	XM_042834		176804367	-1	tier1	-	no_errors	ENST00000544803	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	T
KIAA1875	340390	genome.wustl.edu	37	8	145169799	145169799	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:145169799G>T	ENST00000323662.8	+	21	4087	c.4062G>T	c.(4060-4062)atG>atT	p.M1354I				A6NE52	K1875_HUMAN	KIAA1875	1354										large_intestine(1)	1						TGGAGGACATGATCCAGGAGC	0.622																																																	0																																										SO:0001583	missense	0			AB058778		8q24.3	2013-01-10			ENSG00000179698	ENSG00000179698		"""WD repeat domain containing"""	26959	protein-coding gene	gene with protein product						11347906	Standard	NR_024207		Approved		uc011lky.1	A6NE52	OTTHUMG00000165245	ENST00000323662.8:c.4062G>T	8.37:g.145169799G>T	ENSP00000320648:p.Met1354Ile		Q96JF2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1354I	ENST00000323662.8	37	c.4062		8	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890039	0.33348	.	.	ENSG00000179698	ENST00000323662	T	0.62498	0.02	5.35	0.136	0.14780	.	.	.	.	.	T	0.40932	0.1137	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.21143	-1.0254	8	0.32370	T	0.25	.	1.8052	0.03079	0.1658:0.1307:0.4202:0.2833	.	1354	A6NE52	K1875_HUMAN	I	1354	ENSP00000320648:M1354I	ENSP00000320648:M1354I	M	+	3	0	KIAA1875	145241787	0.838000	0.29461	0.001000	0.08648	0.193000	0.23685	1.453000	0.35167	0.030000	0.15379	-0.310000	0.09108	ATG	KIAA1875	-	NULL	ENSG00000179698		0.622	KIAA1875-007	PUTATIVE	basic|appris_principal	protein_coding	KIAA1875	HGNC	protein_coding	OTTHUMT00000382917.1	-	0.00	74	0	G	NM_032529		145169799	+1	tier1	-	no_errors	ENST00000323662	ensembl	human	putative	74_37	missense	5.41	70	4	SNP	0.000	T
KIF26A	26153	genome.wustl.edu	37	14	104639512	104639512	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:104639512G>A	ENST00000423312.2	+	8	1619	c.1619G>A	c.(1618-1620)gGc>gAc	p.G540D	KIF26A_ENST00000315264.7_Missense_Mutation_p.G401D	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	540	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCCCCTGGCAGCCTCCAG	0.726																																																	0													13.0	19.0	17.0					14																	104639512		2003	4138	6141	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1619G>A	14.37:g.104639512G>A	ENSP00000388241:p.Gly540Asp		Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.G540D	ENST00000423312.2	37	c.1619	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420196	0.62622	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.80909	-1.43;-1.41	5.18	4.29	0.51040	Kinesin, motor domain (4);	.	.	.	.	T	0.77685	0.4167	L	0.56280	1.765	0.58432	D	0.999996	B	0.33477	0.413	B	0.35607	0.206	T	0.76846	-0.2808	9	0.51188	T	0.08	.	13.5354	0.61644	0.0758:0.0:0.9242:0.0	.	540	Q9ULI4	KI26A_HUMAN	D	540;401	ENSP00000388241:G540D;ENSP00000325452:G401D	ENSP00000325452:G401D	G	+	2	0	KIF26A	103709265	1.000000	0.71417	0.498000	0.27564	0.196000	0.23810	5.235000	0.65348	1.164000	0.42652	0.462000	0.41574	GGC	KIF26A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000066735		0.726	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	-	0.00	42	0	G			104639512	+1	tier1	-	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
KIF6	221458	genome.wustl.edu	37	6	39693181	39693181	+	5'UTR	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:39693181C>T	ENST00000287152.7	-	0	0				KIF6_ENST00000373216.3_5'UTR|KIF6_ENST00000373215.3_5'Flank|KIF6_ENST00000538893.1_5'Flank	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTCTTAGCAACAGTAGCTAGG	0.627																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.-95G>A	6.37:g.39693181C>T			Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	RNA	SNP	-	NULL	ENST00000287152.7	37	NULL	CCDS4844.1	6																																																																																			KIF6	-	-	ENSG00000164627		0.627	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	-	0.00	29	0	C	NM_145027		39693181	-1	tier1	-	no_errors	ENST00000482238	ensembl	human	known	74_37	rna	18.18	18	4	SNP	1.000	T
KLF17	128209	genome.wustl.edu	37	1	44596234	44596234	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:44596234C>T	ENST00000372299.3	+	3	1034	c.976C>T	c.(976-978)Cgt>Tgt	p.R326C	KLF17_ENST00000476802.1_3'UTR	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	326					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					GTCTTTCTTCCGTTCTGATGA	0.458																																																	0													149.0	136.0	140.0					1																	44596234		2203	4300	6503	SO:0001583	missense	0			BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.976C>T	1.37:g.44596234C>T	ENSP00000361373:p.Arg326Cys		Q86VQ7|Q8N805	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R326C	ENST00000372299.3	37	c.976	CCDS508.1	1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927476	0.34002	.	.	ENSG00000171872	ENST00000372299	T	0.71698	-0.59	4.47	3.56	0.40772	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.280447	0.26062	N	0.026574	T	0.78419	0.4280	M	0.62723	1.935	0.52501	D	0.999951	D	0.89917	1.0	D	0.68621	0.959	T	0.79222	-0.1892	10	0.87932	D	0	.	8.3224	0.32136	0.0:0.8957:0.0:0.1043	.	326	Q5JT82	KLF17_HUMAN	C	326	ENSP00000361373:R326C	ENSP00000361373:R326C	R	+	1	0	KLF17	44368821	1.000000	0.71417	0.979000	0.43373	0.311000	0.27955	5.318000	0.65829	1.485000	0.48380	0.561000	0.74099	CGT	KLF17	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171872		0.458	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF17	HGNC	protein_coding	OTTHUMT00000026646.1	-	0.00	57	0	C	NM_173484		44596234	+1	tier1	-	no_errors	ENST00000372299	ensembl	human	known	74_37	missense	22.64	41	12	SNP	1.000	T
KLK11	11012	genome.wustl.edu	37	19	51525866	51525866	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:51525866G>A	ENST00000594768.1	-	6	969	c.784C>T	c.(784-786)Cct>Tct	p.P262S	KLK11_ENST00000319720.7_Missense_Mutation_p.P230S|KLK11_ENST00000600362.1_Missense_Mutation_p.P89S|KLK11_ENST00000594458.1_5'Flank|KLK10_ENST00000358789.3_5'Flank|KLK10_ENST00000309958.3_5'Flank|KLK11_ENST00000391804.3_Missense_Mutation_p.P255S|KLK10_ENST00000391805.1_5'Flank|KLK11_ENST00000453757.3_Missense_Mutation_p.P230S	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	262	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		TAGACACCAGGCTTTCGGGTG	0.567																																																	0													171.0	158.0	163.0					19																	51525866		2203	4300	6503	SO:0001583	missense	0			AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.784C>T	19.37:g.51525866G>A	ENSP00000473047:p.Pro262Ser		O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.P262S	ENST00000594768.1	37	c.784	CCDS12818.1	19	.	.	.	.	.	.	.	.	.	.	g	19.99	3.928300	0.73327	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.95307	-3.67;-3.67;-3.67	4.42	4.42	0.53409	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.36555	U	0.002537	D	0.97804	0.9279	M	0.93854	3.465	0.49798	D	0.999824	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98708	1.0703	10	0.87932	D	0	.	14.5583	0.68118	0.0:0.0:1.0:0.0	.	262;255	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	S	255;230;230;262	ENSP00000375680:P255S;ENSP00000324269:P230S;ENSP00000413958:P230S	ENSP00000324269:P230S	P	-	1	0	KLK11	56217678	1.000000	0.71417	0.984000	0.44739	0.599000	0.36880	9.050000	0.93843	2.306000	0.77630	0.305000	0.20034	CCT	KLK11	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167757		0.567	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2	-	0.00	27	0	G	NM_006853		51525866	-1	tier1	-	no_errors	ENST00000594768	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
LCA5L	150082	genome.wustl.edu	37	21	40783654	40783654	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr21:40783654G>T	ENST00000358268.2	-	7	1578	c.1050C>A	c.(1048-1050)gaC>gaA	p.D350E	LCA5L_ENST00000380671.2_Missense_Mutation_p.D350E|LCA5L_ENST00000495240.1_5'Flank|LCA5L_ENST00000288350.3_Missense_Mutation_p.D350E|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	350										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				CTTTTGGATAGTCCTCTGTGT	0.264																																																	0													69.0	69.0	69.0					21																	40783654		2201	4295	6496	SO:0001583	missense	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1050C>A	21.37:g.40783654G>T	ENSP00000351008:p.Asp350Glu		D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.D350E	ENST00000358268.2	37	c.1050	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734356	0.30774	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.56103	0.48;0.48;0.48	5.52	-5.13	0.02884	.	0.414780	0.24659	N	0.036650	T	0.38268	0.1034	M	0.63843	1.955	0.26266	N	0.97851	B	0.27997	0.197	B	0.28465	0.09	T	0.32052	-0.9921	10	0.22109	T	0.4	-21.9336	6.8374	0.23943	0.345:0.3576:0.2974:0.0	.	350	O95447	LCA5L_HUMAN	E	350	ENSP00000288350:D350E;ENSP00000370046:D350E;ENSP00000351008:D350E	ENSP00000288350:D350E	D	-	3	2	LCA5L	39705524	0.032000	0.19561	0.558000	0.28319	0.728000	0.41692	-1.222000	0.02965	-0.460000	0.07003	-0.312000	0.09012	GAC	LCA5L	-	NULL	ENSG00000157578		0.264	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	-	0.00	81	0	G	NM_152505		40783654	-1	tier1	-	no_errors	ENST00000288350	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.521	T
LGALS9	3965	genome.wustl.edu	37	17	25974143	25974143	+	Splice_Site	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:25974143A>G	ENST00000395473.2	+	9	2225	c.757A>G	c.(757-759)Agg>Ggg	p.R253G	LGALS9_ENST00000313648.6_Splice_Site_p.R221G|LGALS9_ENST00000310394.5_Splice_Site_p.R209G|LGALS9_ENST00000302228.5_Splice_Site_p.R221G|LGALS9_ENST00000413914.2_Splice_Site_p.R196G	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	253	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		CAGTGCTCAGAGGTAAGCCAA	0.577																																					Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)												0													109.0	96.0	100.0					17																	25974143		2203	4300	6503	SO:0001630	splice_region_variant	0			AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.758+1A>G	17.37:g.25974143A>G			A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.R253G	ENST00000395473.2	37	c.757	CCDS11222.1	17	.	.	.	.	.	.	.	.	.	.	A	16.35	3.099132	0.56183	.	.	ENSG00000168961	ENST00000395473;ENST00000302228;ENST00000310394;ENST00000313648;ENST00000413914	T;T;T;T;T	0.26810	3.31;3.31;3.31;3.31;1.71	4.84	-2.63	0.06133	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.050307	0.64402	D	0.000001	T	0.27866	0.0686	M	0.81497	2.545	0.09310	N	0.999999	P;P;B;B;B	0.51653	0.947;0.905;0.002;0.026;0.012	P;P;B;B;B	0.47891	0.56;0.487;0.014;0.014;0.014	T	0.14420	-1.0473	10	0.52906	T	0.07	.	2.7454	0.05265	0.3689:0.4031:0.0899:0.1381	.	196;221;164;221;253	B4DWP7;F8W9W4;B4DJD7;Q3B8N1;O00182	.;.;.;.;LEG9_HUMAN	G	253;221;209;221;196	ENSP00000378856:R253G;ENSP00000306228:R221G;ENSP00000312259:R209G;ENSP00000318214:R221G;ENSP00000393695:R196G	ENSP00000306228:R221G	R	+	1	2	LGALS9	22998270	0.667000	0.27484	0.082000	0.20525	0.008000	0.06430	0.292000	0.19011	-0.078000	0.12730	-0.627000	0.03993	AGG	LGALS9	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	ENSG00000168961		0.577	LGALS9-001	KNOWN	basic|CCDS	protein_coding	LGALS9	HGNC	protein_coding	OTTHUMT00000255583.1	-	0.00	56	0	A	NM_009587	Missense_Mutation	25974143	+1	tier1	-	no_errors	ENST00000395473	ensembl	human	known	74_37	missense	6.78	54	4	SNP	0.014	G
PLEK	5341	genome.wustl.edu	37	2	68592603	68592603	+	Intron	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:68592603G>A	ENST00000234313.7	+	1	221				AC015969.3_ENST00000366218.2_RNA	NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin						actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		CCGGCTACCTGCTCATCTTAG	0.542																																																	0													53.0	55.0	54.0					2																	68592603		692	1591	2283	SO:0001627	intron_variant	0			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.42+78G>A	2.37:g.68592603G>A			B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	RNA	SNP	-	NULL	ENST00000234313.7	37	NULL	CCDS1887.1	2																																																																																			AC015969.3	-	-	ENSG00000203395		0.542	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927723	Clone_based_vega_gene	protein_coding	OTTHUMT00000251755.1	-	0.00	60	0	G	NM_002664		68592603	-1	tier1	-	no_errors	ENST00000366218	ensembl	human	known	74_37	rna	11.90	37	5	SNP	0.000	A
TRY2P	207147	genome.wustl.edu	37	7	141969660	141969660	+	RNA	SNP	T	T	A	rs201999847		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:141969660T>A	ENST00000334288.5	-	0	481					NR_036483.1																						CTGTTGTTTCTTGTTTGTGAT	0.378																																																	0																																												0																															7.37:g.141969660T>A				RNA	SNP	-	NULL	ENST00000334288.5	37	NULL		7																																																																																			U66059.29	-	-	ENSG00000186163		0.378	U66059.29-002	KNOWN	basic	processed_transcript	LOC730441	Clone_based_vega_gene	pseudogene	OTTHUMT00000351332.2	-	0.00	74	0	T			141969660	-1	tier1	-	no_errors	ENST00000334288	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.000	A
LRRC41	10489	genome.wustl.edu	37	1	46746081	46746081	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:46746081C>T	ENST00000343304.6	-	6	2193	c.1908G>A	c.(1906-1908)ttG>ttA	p.L636L	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	636					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TGAGTGTTTGCAAAACAAGCC	0.557																																																	0													93.0	98.0	96.0					1																	46746081		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1908G>A	1.37:g.46746081C>T			A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L636	ENST00000343304.6	37	c.1908	CCDS533.1	1																																																																																			LRRC41	-	NULL	ENSG00000132128		0.557	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	-	0.00	86	0	C	NM_006369		46746081	-1	tier1	-	no_errors	ENST00000343304	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.946	T
LRRN3	54674	genome.wustl.edu	37	7	110763811	110763811	+	Missense_Mutation	SNP	A	A	T	rs139637326	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:110763811A>T	ENST00000422987.3	+	2	1814	c.983A>T	c.(982-984)aAt>aTt	p.N328I	IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.N328I|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.N328I|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	328					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ATTCACCCCAATGCATTTTTC	0.448																																																	0													100.0	100.0	100.0					7																	110763811		2203	4300	6503	SO:0001583	missense	0			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.983A>T	7.37:g.110763811A>T	ENSP00000412417:p.Asn328Ile		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N328I	ENST00000422987.3	37	c.983	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986805	0.53934	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.57436	0.4;0.4;0.4	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000003	T	0.67878	0.2940	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.65747	-0.6093	10	0.36615	T	0.2	.	16.1535	0.81640	1.0:0.0:0.0:0.0	.	328	Q9H3W5	LRRN3_HUMAN	I	328	ENSP00000312001:N328I;ENSP00000397312:N328I;ENSP00000412417:N328I	ENSP00000312001:N328I	N	+	2	0	LRRN3	110551047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.217000	0.71921	0.528000	0.53228	AAT	LRRN3	-	NULL	ENSG00000173114		0.448	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2		0.00	63	0	A	NM_018334		110763811	+1			no_errors	ENST00000308478	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
LSMEM1	286006	genome.wustl.edu	37	7	112126359	112126359	+	Intron	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:112126359C>G	ENST00000312849.4	+	3	488				LSMEM1_ENST00000429049.1_Intron|LSMEM1_ENST00000439068.2_Intron|LSMEM1_ENST00000486022.1_3'UTR	NM_182597.2	NP_872403.1	Q8N8F7	LSME1_HUMAN	leucine-rich single-pass membrane protein 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CCTTTAACTTCTATATTCCCT	0.403																																																	0																																										SO:0001627	intron_variant	0			AK096894	CCDS5756.1	7q31.1	2013-03-08	2013-03-08	2013-03-08	ENSG00000181016	ENSG00000181016			22036	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 53"""	C7orf53			Standard	NM_182597		Approved	FLJ39575	uc011kmq.2	Q8N8F7	OTTHUMG00000155190	ENST00000312849.4:c.128-619C>G	7.37:g.112126359C>G			Q49AR6	RNA	SNP	-	NULL	ENST00000312849.4	37	NULL	CCDS5756.1	7																																																																																			LSMEM1	-	-	ENSG00000181016		0.403	LSMEM1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LSMEM1	HGNC	protein_coding	OTTHUMT00000338716.2	-	0.00	27	0	C	NM_182597		112126359	+1	tier1	-	no_errors	ENST00000486022	ensembl	human	putative	74_37	rna	7.41	50	4	SNP	0.000	G
LSMEM1	286006	genome.wustl.edu	37	7	112126404	112126404	+	Intron	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:112126404C>T	ENST00000312849.4	+	3	488				LSMEM1_ENST00000429049.1_Intron|LSMEM1_ENST00000439068.2_Intron|LSMEM1_ENST00000486022.1_3'UTR	NM_182597.2	NP_872403.1	Q8N8F7	LSME1_HUMAN	leucine-rich single-pass membrane protein 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											TCTGCTATTTCAGTGTTAAGA	0.368																																																	0																																										SO:0001627	intron_variant	0			AK096894	CCDS5756.1	7q31.1	2013-03-08	2013-03-08	2013-03-08	ENSG00000181016	ENSG00000181016			22036	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 53"""	C7orf53			Standard	NM_182597		Approved	FLJ39575	uc011kmq.2	Q8N8F7	OTTHUMG00000155190	ENST00000312849.4:c.128-574C>T	7.37:g.112126404C>T			Q49AR6	RNA	SNP	-	NULL	ENST00000312849.4	37	NULL	CCDS5756.1	7																																																																																			LSMEM1	-	-	ENSG00000181016		0.368	LSMEM1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LSMEM1	HGNC	protein_coding	OTTHUMT00000338716.2	-	0.00	52	0	C	NM_182597		112126404	+1	tier1	-	no_errors	ENST00000486022	ensembl	human	putative	74_37	rna	14.93	57	10	SNP	0.002	T
LSMEM1	286006	genome.wustl.edu	37	7	112126913	112126913	+	Intron	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:112126913C>T	ENST00000312849.4	+	3	488				LSMEM1_ENST00000439068.2_Intron|LSMEM1_ENST00000486022.1_Intron	NM_182597.2	NP_872403.1	Q8N8F7	LSME1_HUMAN	leucine-rich single-pass membrane protein 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											GGGTACTGTTCAGTTCTGCTG	0.418																																																	0																																										SO:0001627	intron_variant	0			AK096894	CCDS5756.1	7q31.1	2013-03-08	2013-03-08	2013-03-08	ENSG00000181016	ENSG00000181016			22036	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 53"""	C7orf53			Standard	NM_182597		Approved	FLJ39575	uc011kmq.2	Q8N8F7	OTTHUMG00000155190	ENST00000312849.4:c.128-65C>T	7.37:g.112126913C>T			Q49AR6	RNA	SNP	-	NULL	ENST00000312849.4	37	NULL	CCDS5756.1	7																																																																																			LSMEM1	-	-	ENSG00000181016		0.418	LSMEM1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LSMEM1	HGNC	protein_coding	OTTHUMT00000338716.2	-	0.00	78	0	C	NM_182597		112126913	+1	tier1	-	no_errors	ENST00000471030	ensembl	human	putative	74_37	rna	13.89	61	10	SNP	0.000	T
MAGEE1	57692	genome.wustl.edu	37	X	75648924	75648924	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrX:75648924C>T	ENST00000361470.2	+	1	879	c.601C>T	c.(601-603)Ctg>Ttg	p.L201L		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	201	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CACCTCCGTGCTGCCTACACC	0.682																																																	0													27.0	22.0	23.0					X																	75648924		2198	4294	6492	SO:0001819	synonymous_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.601C>T	X.37:g.75648924C>T			Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L201	ENST00000361470.2	37	c.601	CCDS14433.1	X																																																																																			MAGEE1	-	NULL	ENSG00000198934		0.682	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	36	0	C	NM_020932		75648924	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.020	T
MBD2	8932	genome.wustl.edu	37	18	51750584	51750585	+	In_Frame_Ins	INS	-	-	GCC			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:51750584_51750585insGCC	ENST00000256429.3	-	1	573_574	c.345_346insGGC	c.(343-348)ggcagc>ggcGGCagc	p.115_116insG	SNORA37_ENST00000384504.1_RNA|MBD2_ENST00000398398.2_In_Frame_Ins_p.115_116insG|MBD2_ENST00000583046.1_In_Frame_Ins_p.115_116insG	NM_003927.4	NP_003918.1	Q9UBB5	MBD2_HUMAN	methyl-CpG binding domain protein 2	115	Gly-rich.|Necessary for interaction with DHX9.				ATP-dependent chromatin remodeling (GO:0043044)|cellular protein complex assembly (GO:0043623)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|protein domain specific binding (GO:0019904)|satellite DNA binding (GO:0003696)|siRNA binding (GO:0035197)			breast(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)		ccgccaccgctgccgccgccgc	0.861																																																	0																																										SO:0001652	inframe_insertion	0			AF072242	CCDS11953.1, CCDS45871.1	18q21	2008-08-01			ENSG00000134046	ENSG00000134046			6917	protein-coding gene	gene with protein product		603547				9774669, 10441743	Standard	NM_003927		Approved		uc002lfg.2	Q9UBB5	OTTHUMG00000132705	ENST00000256429.3:c.343_345dupGGC	18.37:g.51750591_51750593dupGCC	ENSP00000256429:p.Gly119_Gly120dup		O95242|Q9UIS8	In_Frame_Ins	INS	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.115in_frame_insG	ENST00000256429.3	37	c.346_345	CCDS11953.1	18																																																																																			MBD2	-	NULL	ENSG00000134046		0.861	MBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD2	HGNC	protein_coding	OTTHUMT00000256003.2		0.00	11	0	-	NM_003927		51750585	-1	tier1		no_errors	ENST00000256429	ensembl	human	known	74_37	in_frame_ins	50.00	2	2	INS	0.957:0.926	GCC
MIR663A	724033	genome.wustl.edu	37	20	26188852	26188852	+	RNA	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:26188852C>A	ENST00000385250.1	-	0	62					NR_030386.1				microRNA 663a																		AACACGGCCGCGGGATCCCAC	0.746																																																	0													2.0	3.0	3.0					20																	26188852		907	2561	3468			0					20p11.1	2011-11-14	2011-11-14	2011-11-14	ENSG00000207985	ENSG00000273684		"""ncRNAs / Micro RNAs"""	32919	non-coding RNA	RNA, micro			"""microRNA 663"""	MIRN663, MIR663			Standard	NR_030386		Approved	hsa-mir-663	uc021wbn.1				20.37:g.26188852C>A				RNA	SNP	-	NULL	ENST00000385250.1	37	NULL		20																																																																																			MIR663A	-	-	ENSG00000227195		0.746	MIR663A-201	KNOWN	basic	miRNA	MIR663A	HGNC	processed_transcript		-	0.00	11	0	C	NR_030386		26188852	-1	tier1	-	no_errors	ENST00000385250	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.008	A
MKL1	57591	genome.wustl.edu	37	22	40816962	40816962	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr22:40816962G>A	ENST00000355630.3	-	10	1360	c.770C>T	c.(769-771)tCa>tTa	p.S257L	MKL1_ENST00000407029.1_Missense_Mutation_p.S257L|MKL1_ENST00000396617.3_Missense_Mutation_p.S257L|MKL1_ENST00000402042.1_Missense_Mutation_p.S207L	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	257					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GGCGTAGGATGAGTCCATGGG	0.592			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0													90.0	83.0	85.0					22																	40816962		2203	4300	6503	SO:0001583	missense	0			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.770C>T	22.37:g.40816962G>A	ENSP00000347847:p.Ser257Leu		Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.S257L	ENST00000355630.3	37	c.770	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	G	22.5	4.291982	0.80914	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.67523	-0.16;-0.22;-0.27;-0.16	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.82660	0.5085	M	0.79258	2.445	0.80722	D	1	D;D;D	0.63880	0.991;0.993;0.993	P;D;D	0.72338	0.798;0.977;0.977	D	0.84913	0.0849	10	0.87932	D	0	-16.8821	18.8656	0.92290	0.0:0.0:1.0:0.0	.	207;257;257	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	L	257;257;207;257	ENSP00000347847:S257L;ENSP00000379861:S257L;ENSP00000385584:S207L;ENSP00000385835:S257L	ENSP00000347847:S257L	S	-	2	0	MKL1	39146908	1.000000	0.71417	0.993000	0.49108	0.583000	0.36354	8.004000	0.88535	2.464000	0.83262	0.462000	0.41574	TCA	MKL1	-	NULL	ENSG00000196588		0.592	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKL1	HGNC	protein_coding	OTTHUMT00000321522.1	-	0.00	58	0	G	NM_020831		40816962	-1	tier1	-	no_errors	ENST00000355630	ensembl	human	known	74_37	missense	8.54	75	7	SNP	1.000	A
MT-CO1	4512	genome.wustl.edu	37	M	7003	7003	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrM:7003T>C	ENST00000361624.2	+	1	1100	c.1100T>C	c.(1099-1101)cTa>cCa	p.L367P	MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	367					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AGACATCGTACTACACGACAC	0.448																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1100T>C	M.37:g.7003T>C	ENSP00000354499:p.Leu367Pro		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.L367P	ENST00000361624.2	37	c.1100		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.448	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	44	0	T	YP_003024028		7003	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	16.67	10	2	SNP	NULL	C
MT-ND2	4536	genome.wustl.edu	37	M	1987	1987	+	5'Flank	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrM:1987G>T	ENST00000361453.3	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TTTATAGGTAGAGGCGACAAA	0.448																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1987G>T	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.448	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	67	0	G	YP_003024027		1987	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	11.76	15	2	SNP	NULL	T
MT-CO1	4512	genome.wustl.edu	37	M	4357	4357	+	5'Flank	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrM:4357T>C	ENST00000361624.2	+	0	0				MT-TC_ENST00000387405.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						gaacccatccctgagaatcca	0.398																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.4357T>C	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TQ	-	-	ENSG00000210107		0.398	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TQ	HGNC	protein_coding		-	0.00	28	0	T	YP_003024028		4357	-1	tier1	-	no_errors	ENST00000387372	ensembl	human	known	74_37	rna	28.57	5	2	SNP	NULL	C
MT-ND5	4540	genome.wustl.edu	37	M	13062	13062	+	Silent	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrM:13062A>G	ENST00000361567.2	+	1	726	c.726A>G	c.(724-726)ccA>ccG	p.P242P	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	242					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GGCCCCACCCCAGTCTCAGCC	0.542																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.726A>G	M.37:g.13062A>G			Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.P242	ENST00000361567.2	37	c.726		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.542	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	34	0	A	YP_003024036		13062	+1	tier1	rs28670513	no_errors	ENST00000361567	ensembl	human	known	74_37	silent	28.57	5	2	SNP	NULL	G
MUC12	10071	genome.wustl.edu	37	7	100645478	100645478	+	Silent	SNP	T	T	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:100645478T>G	ENST00000379442.3	+	5	12063	c.12063T>G	c.(12061-12063)ggT>ggG	p.G4021G	MUC12_ENST00000536621.1_Silent_p.G3878G			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4021	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CAGACCTCGGTGAGGAATCAA	0.592																																																	0													1.0	2.0	2.0					7																	100645478		136	565	701	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12063T>G	7.37:g.100645478T>G			A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA_dom	p.G3878	ENST00000379442.3	37	c.11634		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.592	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	9	0	T	XM_379904		100645478	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	silent	40.91	12	9	SNP	0.006	G
MUC16	94025	genome.wustl.edu	37	19	9018487	9018487	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:9018487G>A	ENST00000397910.4	-	24	37890	c.37687C>T	c.(37687-37689)Cgc>Tgc	p.R12563C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12565	SEA 4. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCCAGGGCGATGCATGTCC	0.547																																																	0													227.0	195.0	206.0					19																	9018487		2019	4190	6209	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37687C>T	19.37:g.9018487G>A	ENSP00000381008:p.Arg12563Cys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R12563C	ENST00000397910.4	37	c.37687	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	3.562	-0.089368	0.07097	.	.	ENSG00000181143	ENST00000397910	T	0.29917	1.55	2.01	-0.51	0.11973	.	.	.	.	.	T	0.24851	0.0603	M	0.73962	2.25	.	.	.	B	0.32031	0.352	B	0.06405	0.002	T	0.28396	-1.0045	8	0.87932	D	0	.	2.7893	0.05383	0.1726:0.0:0.5576:0.2698	.	12563	B5ME49	.	C	12563	ENSP00000381008:R12563C	ENSP00000381008:R12563C	R	-	1	0	MUC16	8879487	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.521000	0.06245	-0.031000	0.13781	0.195000	0.17529	CGC	MUC16	-	pfam_SEA_dom	ENSG00000181143		0.547	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	130	0	G	NM_024690		9018487	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	7.69	84	7	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9018524	9018524	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:9018524G>T	ENST00000397910.4	-	24	37853	c.37650C>A	c.(37648-37650)ttC>ttA	p.F12550L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12552	SEA 4. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTGATGGTGAAGTTGAGGG	0.493																																																	0													233.0	198.0	210.0					19																	9018524		1977	4177	6154	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37650C>A	19.37:g.9018524G>T	ENSP00000381008:p.Phe12550Leu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.F12550L	ENST00000397910.4	37	c.37650	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	12.03	1.814830	0.32053	.	.	ENSG00000181143	ENST00000397910	T	0.49432	0.78	2.01	2.01	0.26516	.	.	.	.	.	T	0.67059	0.2853	M	0.88031	2.925	.	.	.	D	0.60575	0.988	D	0.65010	0.931	T	0.75130	-0.3426	8	0.87932	D	0	.	7.5334	0.27695	0.0:0.0:1.0:0.0	.	12550	B5ME49	.	L	12550	ENSP00000381008:F12550L	ENSP00000381008:F12550L	F	-	3	2	MUC16	8879524	1.000000	0.71417	0.998000	0.56505	0.307000	0.27823	1.950000	0.40323	1.428000	0.47296	0.195000	0.17529	TTC	MUC16	-	pfam_SEA_dom	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	116	0	G	NM_024690		9018524	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	6.59	85	6	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23900828	23900828	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:23900828G>A	ENST00000355349.3	-	8	860	c.698C>T	c.(697-699)gCc>gTc	p.A233V		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	233	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GACGGTCTTGGCATTGCCAAA	0.597																																																	0													170.0	157.0	161.0					14																	23900828		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.698C>T	14.37:g.23900828G>A	ENSP00000347507:p.Ala233Val		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A233V	ENST00000355349.3	37	c.698	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692438	0.68271	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.98512	-4.97	3.47	3.47	0.39725	Myosin head, motor domain (3);	.	.	.	.	D	0.98883	0.9622	H	0.99211	4.47	0.80722	D	1	B	0.26363	0.147	B	0.33960	0.173	D	0.99967	1.1882	9	0.87932	D	0	.	15.4877	0.75578	0.0:0.0:1.0:0.0	.	233	P12883	MYH7_HUMAN	V	233	ENSP00000347507:A233V	ENSP00000347507:A233V	A	-	2	0	MYH7	22970668	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.380000	0.97202	1.946000	0.56461	0.305000	0.20034	GCC	MYH7	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000092054		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	-	0.00	76	0	G	NM_000257		23900828	-1	tier1	-	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
MYOM2	9172	genome.wustl.edu	37	8	2021562	2021562	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:2021562G>T	ENST00000262113.4	+	10	1243	c.1102G>T	c.(1102-1104)Gcc>Tcc	p.A368S	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	368	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CGACCACAGCGCCTTCCTGTT	0.677																																																	0													40.0	35.0	37.0					8																	2021562		2203	4300	6503	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1102G>T	8.37:g.2021562G>T	ENSP00000262113:p.Ala368Ser		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A368S	ENST00000262113.4	37	c.1102	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.204957	0.95033	.	.	ENSG00000036448	ENST00000262113	T	0.70516	-0.49	4.9	4.9	0.64082	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);	0.000000	0.85682	D	0.000000	D	0.82375	0.5023	M	0.76574	2.34	0.58432	D	0.999996	P	0.50528	0.936	P	0.59825	0.864	D	0.84330	0.0521	10	0.56958	D	0.05	.	18.0821	0.89444	0.0:0.0:1.0:0.0	.	368	P54296	MYOM2_HUMAN	S	368	ENSP00000262113:A368S	ENSP00000262113:A368S	A	+	1	0	MYOM2	2008969	1.000000	0.71417	0.992000	0.48379	0.877000	0.50540	9.433000	0.97501	2.237000	0.73441	0.655000	0.94253	GCC	MYOM2	-	pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub	ENSG00000036448		0.677	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1		0.00	39	0	G	NM_003970		2021562	+1			no_errors	ENST00000262113	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
NBEA	26960	genome.wustl.edu	37	13	36241657	36241657	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr13:36241657A>G	ENST00000400445.3	+	56	9082	c.8548A>G	c.(8548-8550)Agc>Ggc	p.S2850G	NBEA_ENST00000310336.4_Missense_Mutation_p.S2850G|NBEA_ENST00000379922.3_Missense_Mutation_p.S428G|NBEA_ENST00000537702.1_Missense_Mutation_p.S643G|NBEA_ENST00000540320.1_Missense_Mutation_p.S2850G|NBEA_ENST00000379939.2_Missense_Mutation_p.S2847G	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2850					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGTAATTTCAGCATTAATGG	0.423																																																	0													189.0	184.0	185.0					13																	36241657		1879	4112	5991	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.8548A>G	13.37:g.36241657A>G	ENSP00000383295:p.Ser2850Gly		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.S2850G	ENST00000400445.3	37	c.8548	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	29.0	4.966952	0.92855	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50888	0.1642	M	0.63843	1.955	0.80722	D	1	B;D;B	0.62365	0.402;0.991;0.402	B;P;B	0.61477	0.235;0.889;0.298	T	0.52419	-0.8578	10	0.66056	D	0.02	.	16.0173	0.80450	1.0:0.0:0.0:0.0	.	2850;428;2847	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	G	2850;2850;2847;2850;1479;428;643;428	ENSP00000440951:S2850G;ENSP00000383295:S2850G;ENSP00000369271:S2847G;ENSP00000308534:S2850G;ENSP00000440233:S643G;ENSP00000369254:S428G	ENSP00000308534:S2850G	S	+	1	0	NBEA	35139657	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.027000	0.93706	2.181000	0.69327	0.533000	0.62120	AGC	NBEA	-	superfamily_WD40_repeat_dom	ENSG00000172915		0.423	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	73	0	A	NM_015678		36241657	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	G
NOD1	10392	genome.wustl.edu	37	7	30477261	30477261	+	Missense_Mutation	SNP	T	T	A	rs55924701		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:30477261T>A	ENST00000222823.4	-	10	2990	c.2465A>T	c.(2464-2466)aAt>aTt	p.N822I		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	822					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						CCCAACTTGATTGCCCCACAT	0.557																																																	0													94.0	72.0	79.0					7																	30477261		2203	4300	6503	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2465A>T	7.37:g.30477261T>A	ENSP00000222823:p.Asn822Ile		B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.N822I	ENST00000222823.4	37	c.2465	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771374	0.69992	.	.	ENSG00000106100	ENST00000222823	T	0.66995	-0.24	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88882	0.3340	10	0.87932	D	0	.	12.6461	0.56735	0.0:0.0:0.0:1.0	.	822	Q9Y239	NOD1_HUMAN	I	822	ENSP00000222823:N822I	ENSP00000222823:N822I	N	-	2	0	NOD1	30443786	1.000000	0.71417	0.762000	0.31397	0.761000	0.43186	6.195000	0.72088	2.006000	0.58801	0.533000	0.62120	AAT	NOD1	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000106100		0.557	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	-	0.00	62	0	T			30477261	-1	tier1	-	no_errors	ENST00000222823	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.980	A
NPAT	4863	genome.wustl.edu	37	11	108044483	108044483	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:108044483G>A	ENST00000278612.8	-	13	1333	c.1228C>T	c.(1228-1230)Caa>Taa	p.Q410*	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	410					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.Q410E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGGTCTTCTTGTCTAAGCACA	0.403																																																	1	Substitution - Missense(1)	ovary(1)											135.0	122.0	126.0					11																	108044483		1861	4099	5960	SO:0001587	stop_gained	0			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1228C>T	11.37:g.108044483G>A	ENSP00000278612:p.Gln410*		A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Nonsense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.Q410*	ENST00000278612.8	37	c.1228	CCDS41710.1	11	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465525	0.43839	.	.	ENSG00000149308	ENST00000278612	.	.	.	5.54	5.54	0.83059	.	0.640477	0.15914	N	0.238480	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-0.1733	12.4896	0.55893	0.0:0.0:0.8223:0.1777	.	.	.	.	X	410	.	ENSP00000278612:Q410X	Q	-	1	0	NPAT	107549693	0.374000	0.25081	0.083000	0.20561	0.287000	0.27160	3.113000	0.50376	2.765000	0.95021	0.557000	0.71058	CAA	NPAT	-	NULL	ENSG00000149308		0.403	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	HGNC	protein_coding	OTTHUMT00000389506.2		0.00	63	0	G	NM_002519		108044483	-1			no_errors	ENST00000278612	ensembl	human	known	74_37	nonsense	5.66	50	3	SNP	0.015	A
NPR2	4882	genome.wustl.edu	37	9	35792937	35792937	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:35792937C>T	ENST00000342694.2	+	1	787	c.532C>T	c.(532-534)Cgg>Tgg	p.R178W		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	178					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CACAGATGACCGGCCTCACTA	0.612																																																	0													100.0	90.0	93.0					9																	35792937		2203	4300	6503	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.532C>T	9.37:g.35792937C>T	ENSP00000341083:p.Arg178Trp		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.R178W	ENST00000342694.2	37	c.532	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377793	0.82682	.	.	ENSG00000159899	ENST00000342694	T	0.75821	-0.97	4.14	4.14	0.48551	Extracellular ligand-binding receptor (1);	0.000000	0.41194	D	0.000931	D	0.86594	0.5970	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.98	D	0.88639	0.3174	10	0.66056	D	0.02	.	14.0862	0.64957	0.0:1.0:0.0:0.0	.	178;178	P20594-2;P20594	.;ANPRB_HUMAN	W	178	ENSP00000341083:R178W	ENSP00000341083:R178W	R	+	1	2	NPR2	35782937	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.524000	0.53495	2.291000	0.77112	0.462000	0.41574	CGG	NPR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000159899		0.612	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	27	0	C			35792937	+1	tier1	-	no_errors	ENST00000342694	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50148604	50148604	+	3'UTR	SNP	G	G	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:50148604G>C	ENST00000406316.2	-	0	6388				NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AACTCTTAAAGGTTTGCAGGT	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*478C>G	2.37:g.50148604G>C			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	SNP	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			NRXN1	-	-	ENSG00000179915		0.448	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	60	0	G			50148604	-1	tier1	-	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	25.00	41	14	SNP	0.773	C
OBSCN	84033	genome.wustl.edu	37	1	228527712	228527712	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:228527712G>T	ENST00000422127.1	+	70	17369	c.17325G>T	c.(17323-17325)caG>caT	p.Q5775H	OBSCN_ENST00000570156.2_Missense_Mutation_p.Q6732H|OBSCN_ENST00000366707.4_Missense_Mutation_p.Q3409H|OBSCN_ENST00000366709.4_Missense_Mutation_p.Q2894H|OBSCN_ENST00000284548.11_Missense_Mutation_p.Q5775H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5775	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCAAGAACCAGGCGGCCTTTG	0.612																																																	0													102.0	114.0	110.0					1																	228527712		2135	4256	6391	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17325G>T	1.37:g.228527712G>T	ENSP00000409493:p.Gln5775His		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Q5775H	ENST00000422127.1	37	c.17325	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.129564|4.129564	0.77549|0.77549	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	.|T;T;T;T	.|0.63744	.|-0.06;-0.06;-0.06;-0.06	4.98|4.98	3.06|3.06	0.35304|0.35304	.|Dbl homology (DH) domain (4);	.|0.235950	.|0.34580	.|N	.|0.003844	T|T	0.52661|0.52661	0.1748|0.1748	N|N	0.22421|0.22421	0.69|0.69	0.33143|0.33143	D|D	0.54464|0.54464	.|P;P	.|0.49696	.|0.927;0.911	.|P;B	.|0.48488	.|0.579;0.443	T|T	0.66504|0.66504	-0.5907|-0.5907	5|10	.|0.72032	.|D	.|0.01	.|.	10.2834|10.2834	0.43554|0.43554	0.2643:0.0:0.7357:0.0|0.2643:0.0:0.7357:0.0	.|.	.|5775;5775	.|Q5VST9;Q5VST9-3	.|OBSCN_HUMAN;.	C|H	392|5775;5775;3409;2894	.|ENSP00000284548:Q5775H;ENSP00000409493:Q5775H;ENSP00000355668:Q3409H;ENSP00000355670:Q2894H	.|ENSP00000284548:Q5775H	G|Q	+|+	1|3	0|2	OBSCN|OBSCN	226594335|226594335	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.960000|0.960000	0.62799|0.62799	1.220000|1.220000	0.32491|0.32491	1.330000|1.330000	0.45394|0.45394	0.462000|0.462000	0.41574|0.41574	GGC|CAG	OBSCN	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000154358		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	17	0	G	NM_052843		228527712	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	25.93	20	7	SNP	0.944	T
OR2G6	391211	genome.wustl.edu	37	1	248685672	248685672	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:248685672C>A	ENST00000343414.4	+	1	757	c.725C>A	c.(724-726)tCg>tAg	p.S242*		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGACCTGTTCGTCTCACCTG	0.463																																																	0													111.0	112.0	112.0					1																	248685672		2203	4300	6503	SO:0001587	stop_gained	0				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.725C>A	1.37:g.248685672C>A	ENSP00000341291:p.Ser242*		B2RP33	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S242*	ENST00000343414.4	37	c.725	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	N	16.43	3.120625	0.56613	.	.	ENSG00000188558	ENST00000343414	.	.	.	3.83	1.8	0.24995	.	0.000000	0.43579	U	0.000545	.	.	.	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	7.2445	0.26114	0.0:0.5071:0.3871:0.1058	.	.	.	.	X	242	.	ENSP00000341291:S242X	S	+	2	0	OR2G6	246752295	0.000000	0.05858	0.480000	0.27341	0.651000	0.38670	-0.723000	0.04952	0.820000	0.34516	0.400000	0.26472	TCG	OR2G6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000188558		0.463	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	-	0.00	60	0	C	XM_372842		248685672	+1	tier1	-	no_errors	ENST00000343414	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	0.000	A
OR51E2	81285	genome.wustl.edu	37	11	4703783	4703783	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:4703783G>A	ENST00000396950.3	-	2	398	c.159C>T	c.(157-159)agC>agT	p.S53S		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	53					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GAGCGTGCAGGCTGCGTTCCG	0.512																																																	0													118.0	99.0	105.0					11																	4703783		2201	4298	6499	SO:0001819	synonymous_variant	0			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.159C>T	11.37:g.4703783G>A			B2RA63|Q6IF94	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S53	ENST00000396950.3	37	c.159	CCDS7751.1	11																																																																																			OR51E2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000167332		0.512	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51E2	HGNC	protein_coding	OTTHUMT00000257198.1	-	0.00	65	0	G	NM_030774		4703783	-1	tier1	-	no_errors	ENST00000396950	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.974	A
OR5I1	10798	genome.wustl.edu	37	11	55703513	55703513	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:55703513A>G	ENST00000301532.3	-	1	363	c.364T>C	c.(364-366)Tat>Cat	p.Y122H		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	122					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TAGCGATCATAGGCCATGGCG	0.443																																																	0													61.0	63.0	62.0					11																	55703513		2201	4292	6493	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.364T>C	11.37:g.55703513A>G	ENSP00000301532:p.Tyr122His		Q6IEU4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y122H	ENST00000301532.3	37	c.364	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	A	13.30	2.194964	0.38806	.	.	ENSG00000167825	ENST00000301532	T	0.00487	7.05	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.165039	0.28989	N	0.013490	T	0.00998	0.0033	M	0.87328	2.875	0.25742	N	0.985155	D	0.53885	0.963	P	0.48425	0.577	T	0.33343	-0.9872	10	0.87932	D	0	.	12.8531	0.57869	1.0:0.0:0.0:0.0	.	122	Q13606	OR5I1_HUMAN	H	122	ENSP00000301532:Y122H	ENSP00000301532:Y122H	Y	-	1	0	OR5I1	55460089	0.250000	0.23951	0.029000	0.17559	0.066000	0.16364	4.565000	0.60836	1.970000	0.57323	0.519000	0.50382	TAT	OR5I1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000167825		0.443	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1		0.00	29	0	A	NM_006637		55703513	-1			no_errors	ENST00000301532	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.638	G
OR5AP2	338675	genome.wustl.edu	37	11	56409727	56409727	+	Silent	SNP	G	G	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:56409727G>C	ENST00000302981.1	-	1	188	c.189C>G	c.(187-189)acC>acG	p.T63T	OR5AP2_ENST00000544374.1_Silent_p.T64T	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						AATACATGGGGGTGTGGAGAC	0.433																																																	0													82.0	77.0	79.0					11																	56409727		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.189C>G	11.37:g.56409727G>C			B2RNM8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T64	ENST00000302981.1	37	c.192	CCDS31534.1	11																																																																																			OR5AP2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172464		0.433	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	HGNC	protein_coding	OTTHUMT00000391613.1	-	0.00	21	0	G	NM_001002925		56409727	-1	tier1	-	no_errors	ENST00000544374	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.001	C
OSBPL1A	114876	genome.wustl.edu	37	18	21746587	21746587	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:21746587C>T	ENST00000319481.3	-	26	2821	c.2615G>A	c.(2614-2616)tGc>tAc	p.C872Y	OSBPL1A_ENST00000399443.3_Missense_Mutation_p.C359Y|OSBPL1A_ENST00000357041.4_Missense_Mutation_p.C490Y	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	872					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CCGTAACCTGCAGTCTGTCTT	0.433																																																	0													213.0	187.0	196.0					18																	21746587		2203	4300	6503	SO:0001583	missense	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2615G>A	18.37:g.21746587C>T	ENSP00000320291:p.Cys872Tyr		B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.C872Y	ENST00000319481.3	37	c.2615	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644140	0.47258	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.30714	1.52;1.52;1.52	5.68	5.68	0.88126	.	0.041257	0.85682	D	0.000000	T	0.65080	0.2657	M	0.91406	3.205	0.80722	D	1	D	0.67145	0.996	D	0.64877	0.93	T	0.72301	-0.4334	10	0.87932	D	0	-19.8217	20.1412	0.98058	0.0:1.0:0.0:0.0	.	872	Q9BXW6	OSBL1_HUMAN	Y	872;359;490	ENSP00000320291:C872Y;ENSP00000382372:C359Y;ENSP00000349545:C490Y	ENSP00000320291:C872Y	C	-	2	0	OSBPL1A	20000585	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.740000	0.84986	2.838000	0.97847	0.585000	0.79938	TGC	OSBPL1A	-	pfam_Oxysterol-bd	ENSG00000141447		0.433	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1		0.00	75	0	C	NM_080597		21746587	-1			no_errors	ENST00000319481	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
OVCH1	341350	genome.wustl.edu	37	12	29627998	29627998	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:29627998G>T	ENST00000318184.5	-	14	1595	c.1596C>A	c.(1594-1596)ccC>ccA	p.P532P	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	532						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ACTCACCTGAGGGCAAAATGG	0.338																																																	0													58.0	54.0	55.0					12																	29627998		1849	4085	5934	SO:0001819	synonymous_variant	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1596C>A	12.37:g.29627998G>T				Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P532	ENST00000318184.5	37	c.1596		12																																																																																			OVCH1	-	superfamily_CUB_dom	ENSG00000187950		0.338	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	-	0.00	54	0	G	NM_183378		29627998	-1	tier1	-	no_errors	ENST00000318184	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.001	T
PAN3	255967	genome.wustl.edu	37	13	28750681	28750681	+	Missense_Mutation	SNP	C	C	T	rs531555113		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr13:28750681C>T	ENST00000380958.3	+	3	756	c.604C>T	c.(604-606)Cca>Tca	p.P202S	PAN3_ENST00000399613.1_Missense_Mutation_p.P56S	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CAGTGCCAAGCCATATTCAGC	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		18059	0.0		0.001	False		,,,				2504	0.0																0													126.0	122.0	123.0					13																	28750681		2203	4300	6503	SO:0001583	missense	0			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.604C>T	13.37:g.28750681C>T	ENSP00000370345:p.Pro202Ser			Missense_Mutation	SNP	superfamily_Kinase-like_dom,smart_Znf_CCCH,pfscan_Prot_kinase_dom	p.P202S	ENST00000380958.3	37	c.604	CCDS9329.2	13	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261045	0.39995	.	.	ENSG00000152520	ENST00000380958;ENST00000399613	T;T	0.44083	0.93;0.96	5.49	4.64	0.57946	.	0.262372	0.45126	D	0.000389	T	0.28665	0.0710	N	0.19112	0.55	0.80722	D	1	B;B;B	0.25904	0.003;0.001;0.137	B;B;B	0.28709	0.005;0.001;0.093	T	0.06826	-1.0805	10	0.21014	T	0.42	-10.7371	13.697	0.62587	0.0:0.9259:0.0:0.0741	.	202;202;202	Q58A45-4;Q58A45;Q58A45-3	.;PAN3_HUMAN;.	S	202;56	ENSP00000370345:P202S;ENSP00000382522:P56S	ENSP00000370345:P202S	P	+	1	0	PAN3	27648681	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.433000	0.52834	2.584000	0.87258	0.655000	0.94253	CCA	PAN3	-	NULL	ENSG00000152520		0.338	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN3	HGNC	protein_coding	OTTHUMT00000044318.4	-	0.00	65	0	C	NM_175854		28750681	+1	tier1	-	no_errors	ENST00000380958	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
PANK3	79646	genome.wustl.edu	37	5	167988397	167988397	+	Splice_Site	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr5:167988397C>T	ENST00000239231.6	-	5	1253		c.e5+1		PANK3_ENST00000520504.1_Splice_Site|MIR103A1_ENST00000362165.1_RNA	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3						coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TGTTTTTTTACCTCATTAACA	0.383																																																	0													46.0	48.0	47.0					5																	167988397		2203	4300	6503	SO:0001630	splice_region_variant	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.936+1G>A	5.37:g.167988397C>T			D3DQL1|Q53FJ9|Q7RTX4	Splice_Site	SNP	-	e5+1	ENST00000239231.6	37	c.936+1	CCDS4368.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185072	0.78677	.	.	ENSG00000120137	ENST00000239231	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2612	0.87070	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PANK3	167920975	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.306000	0.77630	0.555000	0.69702	.	PANK3	-	-	ENSG00000120137		0.383	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2		0.00	38	0	C	NM_024594	Intron	167988397	-1			no_errors	ENST00000239231	ensembl	human	known	74_37	splice_site	5.00	56	3	SNP	1.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91873845	91873845	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrX:91873845C>T	ENST00000373094.1	+	7	4795	c.3950C>T	c.(3949-3951)tCa>tTa	p.S1317L	PCDH11X_ENST00000298274.8_Missense_Mutation_p.S1280L|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000373097.1_Missense_Mutation_p.S1307L|PCDH11X_ENST00000406881.1_Missense_Mutation_p.S1309L|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S1299L|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S1280L	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1317					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1317L(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGTGATGATTCAATTAAAGTC	0.463																																					NSCLC(38;925 1092 2571 38200 45895)												1	Substitution - Missense(1)	cervix(1)											168.0	155.0	159.0					X																	91873845		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3950C>T	X.37:g.91873845C>T	ENSP00000362186:p.Ser1317Leu		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1317L	ENST00000373094.1	37	c.3950	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553346	0.65425	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.60299	0.27;0.27;0.2;0.23;0.25;0.2	4.58	4.58	0.56647	.	.	.	.	.	T	0.60805	0.2297	N	0.24115	0.695	0.33438	D	0.581951	D;D;D;D;D	0.61697	0.99;0.99;0.99;0.99;0.983	P;P;P;P;P	0.59487	0.814;0.814;0.858;0.858;0.725	T	0.73116	-0.4084	9	0.87932	D	0	.	15.5329	0.75977	0.0:1.0:0.0:0.0	.	1280;1299;1309;1307;1317	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	L	1317;1307;1280;1299;1309;1317;1280	ENSP00000362186:S1317L;ENSP00000362189:S1307L;ENSP00000362180:S1280L;ENSP00000355105:S1299L;ENSP00000384758:S1309L;ENSP00000298274:S1280L	ENSP00000298274:S1280L	S	+	2	0	PCDH11X	91760501	0.784000	0.28713	1.000000	0.80357	0.756000	0.42949	2.641000	0.46587	1.850000	0.53721	0.466000	0.42574	TCA	PCDH11X	-	NULL	ENSG00000102290		0.463	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	87	0	C	NM_032969		91873845	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	32.05	53	25	SNP	0.998	T
PCLO	27445	genome.wustl.edu	37	7	82583352	82583352	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:82583352T>C	ENST00000333891.9	-	5	7254	c.6917A>G	c.(6916-6918)aAg>aGg	p.K2306R	PCLO_ENST00000423517.2_Missense_Mutation_p.K2306R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCCAGTTTCCTTCTTGGCTTT	0.418																																																	0													138.0	137.0	138.0					7																	82583352		1827	4101	5928	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6917A>G	7.37:g.82583352T>C	ENSP00000334319:p.Lys2306Arg			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.K2306R	ENST00000333891.9	37	c.6917	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	8.483	0.860342	0.17178	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16597	2.33;2.33	5.23	2.41	0.29592	.	.	.	.	.	T	0.14227	0.0344	L	0.36672	1.1	0.19945	N	0.999943	B;B	0.30281	0.275;0.275	B;B	0.33042	0.101;0.157	T	0.25222	-1.0138	9	0.87932	D	0	.	6.4196	0.21736	0.144:0.1192:0.0:0.7368	.	2306;2306	Q9Y6V0-5;Q9Y6V0-6	.;.	R	2237;2306;2306	ENSP00000334319:K2306R;ENSP00000388393:K2306R	ENSP00000334319:K2306R	K	-	2	0	PCLO	82421288	0.136000	0.22515	0.980000	0.43619	0.586000	0.36452	0.349000	0.20055	0.782000	0.33613	0.413000	0.27773	AAG	PCLO	-	NULL	ENSG00000186472		0.418	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	66	0	T	NM_014510		82583352	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.229	C
PCSK7	9159	genome.wustl.edu	37	11	117089269	117089269	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:117089269G>T	ENST00000320934.3	-	12	2077	c.1447C>A	c.(1447-1449)Cct>Act	p.P483T	PCSK7_ENST00000540028.1_Missense_Mutation_p.P124T	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	483					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GCTAAGTAAGGGACAGATGTC	0.478			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													99.0	90.0	93.0					11																	117089269		2201	4296	6497	SO:0001583	missense	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1447C>A	11.37:g.117089269G>T	ENSP00000325917:p.Pro483Thr		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.P483T	ENST00000320934.3	37	c.1447	CCDS8382.1	11	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396129	0.83011	.	.	ENSG00000160613	ENST00000320934;ENST00000540028;ENST00000543900	T;T	0.67171	-0.25;-0.25	5.01	5.01	0.66863	Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.81437	0.4822	M	0.75264	2.295	0.58432	D	0.999999	D	0.89917	1.0	D	0.72338	0.977	D	0.83661	0.0161	10	0.87932	D	0	-11.8319	17.0563	0.86534	0.0:0.0:1.0:0.0	.	483	Q16549	PCSK7_HUMAN	T	483;124;483	ENSP00000325917:P483T;ENSP00000441944:P124T	ENSP00000325917:P483T	P	-	1	0	PCSK7	116594479	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.864000	0.75494	2.606000	0.88127	0.655000	0.94253	CCT	PCSK7	-	superfamily_Galactose-bd-like	ENSG00000160613		0.478	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	-	0.00	38	0	G	NM_004716		117089269	-1	tier1	-	no_errors	ENST00000320934	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	T
PDE8A	5151	genome.wustl.edu	37	15	85619146	85619146	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:85619146G>A	ENST00000310298.4	+	5	740	c.488G>A	c.(487-489)cGc>cAc	p.R163H	PDE8A_ENST00000339708.5_Missense_Mutation_p.R163H|PDE8A_ENST00000557957.1_Missense_Mutation_p.R91H|PDE8A_ENST00000557819.2_3'UTR|PDE8A_ENST00000394553.1_Missense_Mutation_p.R163H			O60658	PDE8A_HUMAN	phosphodiesterase 8A	163					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	GGTGTAGTACGCAGGTAAACT	0.313																																																	0													280.0	283.0	282.0					15																	85619146		2202	4299	6501	SO:0001583	missense	0			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.488G>A	15.37:g.85619146G>A	ENSP00000311453:p.Arg163His		B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,superfamily_PAS,superfamily_CheY-like_superfamily,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.R163H	ENST00000310298.4	37	c.488	CCDS10336.1	15	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215661	0.58452	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.43688	0.94;0.94;0.94	5.01	5.01	0.66863	Signal transduction response regulator, receiver domain (1);	0.495183	0.15725	N	0.247707	T	0.55114	0.1900	L	0.48362	1.52	0.49213	D	0.99976	B;D	0.65815	0.286;0.995	B;P	0.60886	0.091;0.88	T	0.50215	-0.8854	10	0.41790	T	0.15	.	16.1955	0.82023	0.0:0.0:1.0:0.0	.	163;163	O60658-2;O60658	.;PDE8A_HUMAN	H	163	ENSP00000311453:R163H;ENSP00000378056:R163H;ENSP00000340679:R163H	ENSP00000311453:R163H	R	+	2	0	PDE8A	83420150	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.039000	0.57325	2.485000	0.83878	0.603000	0.83216	CGC	PDE8A	-	pfam_Sig_transdc_resp-reg_receiver,superfamily_CheY-like_superfamily	ENSG00000073417		0.313	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8A	HGNC	protein_coding	OTTHUMT00000309018.1	-	0.00	66	0	G	NM_002605		85619146	+1	tier1	-	no_errors	ENST00000310298	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	A
PDGFRA	5156	genome.wustl.edu	37	4	55146650	55146650	+	Splice_Site	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr4:55146650G>A	ENST00000257290.5	+	16	2654		c.e16+1		FIP1L1_ENST00000507166.1_Splice_Site	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide						adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TCTATGTTAGGTAAAAGTGTC	0.388			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)			Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	0													48.0	45.0	46.0					4																	55146650		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2323+1G>A	4.37:g.55146650G>A			B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Splice_Site	SNP	-	e15+1	ENST00000257290.5	37	c.2323+1	CCDS3495.1	4	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628761	0.67015	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	.	.	.	5.79	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0757	0.80967	0.0:0.0:0.865:0.135	.	.	.	.	.	-1	.	.	.	+	.	.	FIP1L1;PDGFRA	54841407	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	5.010000	0.64004	1.399000	0.46721	0.561000	0.74099	.	PDGFRA	-	-	ENSG00000134853		0.388	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRA	HGNC	protein_coding	OTTHUMT00000250598.2	-	0.00	63	0	G	NM_006206	Intron	55146650	+1	tier1	-	no_errors	ENST00000257290	ensembl	human	known	74_37	splice_site	11.76	30	4	SNP	1.000	A
PLEKHA3	65977	genome.wustl.edu	37	2	179355543	179355543	+	Splice_Site	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:179355543T>C	ENST00000234453.5	+	3	715		c.e3+2		PLEKHA3_ENST00000461474.1_Splice_Site	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			AAGAAAAAGGTAACTATAAAC	0.378																																																	0													43.0	42.0	42.0					2																	179355543		2203	4300	6503	SO:0001630	splice_region_variant	0			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.313+2T>C	2.37:g.179355543T>C			Q4ZG69|Q86TQ1|Q9NXT3	Splice_Site	SNP	-	e3+2	ENST00000234453.5	37	c.313+2	CCDS33336.1	2	.	.	.	.	.	.	.	.	.	.	T	23.6	4.432052	0.83776	.	.	ENSG00000116095	ENST00000234453	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9568	0.79893	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHA3	179063789	1.000000	0.71417	0.986000	0.45419	0.926000	0.56050	7.948000	0.87774	2.158000	0.67659	0.460000	0.39030	.	PLEKHA3	-	-	ENSG00000116095		0.378	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA3	HGNC	protein_coding	OTTHUMT00000335241.2	-	0.00	32	0	T	NM_019091	Intron	179355543	+1	tier1	-	no_errors	ENST00000234453	ensembl	human	known	74_37	splice_site	27.03	27	10	SNP	1.000	C
PLXNA2	5362	genome.wustl.edu	37	1	208252790	208252790	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:208252790G>T	ENST00000367033.3	-	12	3158	c.2401C>A	c.(2401-2403)Ctc>Atc	p.L801I		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	801					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CACTTGTAGAGATGGACTGCA	0.567																																																	0													18.0	19.0	18.0					1																	208252790		2201	4299	6500	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2401C>A	1.37:g.208252790G>T	ENSP00000356000:p.Leu801Ile		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L801I	ENST00000367033.3	37	c.2401	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070045	0.76301	.	.	ENSG00000076356	ENST00000367033	D	0.84223	-1.82	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90031	0.6887	M	0.81112	2.525	0.80722	D	1	D	0.60160	0.987	P	0.51999	0.687	D	0.88533	0.3104	10	0.30854	T	0.27	.	19.6224	0.95663	0.0:0.0:1.0:0.0	.	801	O75051	PLXA2_HUMAN	I	801	ENSP00000356000:L801I	ENSP00000356000:L801I	L	-	1	0	PLXNA2	206319413	1.000000	0.71417	0.991000	0.47740	0.981000	0.71138	6.837000	0.75354	2.630000	0.89119	0.655000	0.94253	CTC	PLXNA2	-	superfamily_Plexin-like_fold	ENSG00000076356		0.567	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6		0.00	19	0	G	NM_025179		208252790	-1			no_errors	ENST00000367033	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	T
PMEPA1	56937	genome.wustl.edu	37	20	56284579	56284579	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:56284579G>A	ENST00000341744.3	-	1	379	c.60C>T	c.(58-60)gtC>gtT	p.V20V	PMEPA1_ENST00000347215.4_Intron|PMEPA1_ENST00000265626.4_Intron|PMEPA1_ENST00000395816.3_Intron|PMEPA1_ENST00000472841.1_Intron	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	20					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						ACGTGCAGGAGACATTGGGCT	0.716																																																	0													30.0	26.0	28.0					20																	56284579		2178	4273	6451	SO:0001819	synonymous_variant	0			AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.60C>T	20.37:g.56284579G>A			Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	NULL	p.V20	ENST00000341744.3	37	c.60	CCDS13463.1	20																																																																																			PMEPA1	-	NULL	ENSG00000124225		0.716	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEPA1	HGNC	protein_coding	OTTHUMT00000079858.2	-	0.00	71	0	G	NM_020182		56284579	-1	tier1	-	no_errors	ENST00000341744	ensembl	human	known	74_37	silent	26.15	48	17	SNP	1.000	A
PPP1R13B	23368	genome.wustl.edu	37	14	104206296	104206296	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:104206296G>C	ENST00000202556.9	-	12	2739	c.2457C>G	c.(2455-2457)gaC>gaG	p.D819E	PPP1R13B_ENST00000555391.1_5'UTR|PPP1R13B_ENST00000423488.2_Missense_Mutation_p.D238E	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	819	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D819D(1)		endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TGTTGTTATTGTCCTCTGCCG	0.602																																																	1	Substitution - coding silent(1)	lung(1)											40.0	47.0	45.0					14																	104206296		2065	4202	6267	SO:0001583	missense	0			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2457C>G	14.37:g.104206296G>C	ENSP00000202556:p.Asp819Glu		B2RMX5|O94870	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain	p.D819E	ENST00000202556.9	37	c.2457	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	G	10.94	1.494127	0.26774	.	.	ENSG00000088808	ENST00000202556;ENST00000423488	T;T	0.53206	0.84;0.63	5.27	-2.86	0.05717	.	0.197448	0.49916	D	0.000127	T	0.41604	0.1166	L	0.47716	1.5	0.27126	N	0.96201	D	0.67145	0.996	P	0.51615	0.675	T	0.52064	-0.8625	10	0.07175	T	0.84	.	13.2508	0.60050	0.5453:0.0:0.4547:0.0	.	819	Q96KQ4	ASPP1_HUMAN	E	819;238	ENSP00000202556:D819E;ENSP00000395213:D238E	ENSP00000202556:D819E	D	-	3	2	PPP1R13B	103276049	0.001000	0.12720	0.132000	0.22025	0.866000	0.49608	-0.452000	0.06787	-0.516000	0.06470	0.561000	0.74099	GAC	PPP1R13B	-	NULL	ENSG00000088808		0.602	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1		0.00	36	0	G	NM_015316		104206296	-1			no_errors	ENST00000202556	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.127	C
PPP1R2	5504	genome.wustl.edu	37	3	195251628	195251628	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:195251628G>C	ENST00000328432.3	-	3	657	c.297C>G	c.(295-297)atC>atG	p.I99M	RNU6ATAC24P_ENST00000516811.1_RNA	NM_006241.4	NP_006232.1	P41236	IPP2_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2	99					generation of precursor metabolites and energy (GO:0006091)|glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(2)|kidney(1)|large_intestine(1)|urinary_tract(2)	6	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)		Epithelial(36;2.64e-22)|all cancers(36;2.69e-20)|OV - Ovarian serous cystadenocarcinoma(49;3.52e-19)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;9.55e-05)		TCCTGGCTAAGATGTCTGGCG	0.468																																																	0													99.0	85.0	90.0					3																	195251628		2203	4300	6503	SO:0001583	missense	0			U68111	CCDS3309.1	3q29	2012-04-17			ENSG00000184203	ENSG00000184203	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9288	protein-coding gene	gene with protein product		601792				9126490, 8119416	Standard	XM_006713682		Approved	IPP2	uc003fup.3	P41236	OTTHUMG00000155887	ENST00000328432.3:c.297C>G	3.37:g.195251628G>C	ENSP00000328178:p.Ile99Met			Missense_Mutation	SNP	pfam_PPI-2	p.I99M	ENST00000328432.3	37	c.297	CCDS3309.1	3	.	.	.	.	.	.	.	.	.	.	G	6.229	0.410376	0.11812	.	.	ENSG00000184203	ENST00000328432	.	.	.	5.27	-0.36	0.12568	.	0.486738	0.21929	N	0.067053	T	0.38532	0.1044	M	0.69823	2.125	0.19575	N	0.999961	B	0.15719	0.014	B	0.12837	0.008	T	0.31447	-0.9943	9	0.46703	T	0.11	.	2.9847	0.05964	0.1542:0.3595:0.3451:0.1412	.	99	P41236	IPP2_HUMAN	M	99	.	ENSP00000328178:I99M	I	-	3	3	PPP1R2	196732917	0.864000	0.29904	0.222000	0.23844	0.314000	0.28054	0.457000	0.21875	-0.001000	0.14495	0.585000	0.79938	ATC	PPP1R2	-	pfam_PPI-2	ENSG00000184203		0.468	PPP1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R2	HGNC	protein_coding	OTTHUMT00000342133.1	-	0.00	52	0	G	NM_006241		195251628	-1	tier1	-	no_errors	ENST00000328432	ensembl	human	known	74_37	missense	48.48	34	32	SNP	0.132	C
PRDM10	56980	genome.wustl.edu	37	11	129827734	129827734	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:129827734C>A	ENST00000360871.3	-	3	372	c.141G>T	c.(139-141)caG>caT	p.Q47H	PRDM10_ENST00000358825.5_Missense_Mutation_p.Q47H|PRDM10_ENST00000528746.1_Missense_Mutation_p.Q47H	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	47					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		ACACCACCTGCTGTGGGGGGC	0.547																																																	0													249.0	220.0	230.0					11																	129827734		2201	4297	6498	SO:0001583	missense	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.141G>T	11.37:g.129827734C>A	ENSP00000354118:p.Gln47His		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q47H	ENST00000360871.3	37	c.141	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652077	0.88056	.	.	ENSG00000170325	ENST00000358825;ENST00000360871;ENST00000528746;ENST00000527581;ENST00000531431	T;T;T;T;T	0.59224	2.4;2.44;2.34;0.28;0.41	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	L	0.32530	0.975	0.80722	D	1	P;D;D	0.71674	0.83;0.998;0.996	P;D;D	0.80764	0.667;0.994;0.986	T	0.68368	-0.5427	10	0.87932	D	0	-19.7126	14.1642	0.65466	0.0:0.9286:0.0:0.0714	.	47;47;47	Q9NQV6-4;G3XAE5;Q9NQV6	.;.;PRD10_HUMAN	H	47	ENSP00000351686:Q47H;ENSP00000354118:Q47H;ENSP00000431262:Q47H;ENSP00000432093:Q47H;ENSP00000436681:Q47H	ENSP00000351686:Q47H	Q	-	3	2	PRDM10	129332944	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.805000	0.55575	2.728000	0.93425	0.655000	0.94253	CAG	PRDM10	-	NULL	ENSG00000170325		0.547	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1		0.00	35	0	C	NM_199437		129827734	-1			no_errors	ENST00000358825	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
PRPF4	9128	genome.wustl.edu	37	9	116038865	116038865	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:116038865C>T	ENST00000374198.4	+	2	170	c.68C>T	c.(67-69)cCg>cTg	p.P23L	CDC26_ENST00000374206.3_5'Flank|PRPF4_ENST00000374199.4_Missense_Mutation_p.P22L|CDC26_ENST00000490408.1_5'Flank	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	23					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						TTAGTTGCTCCGGTCGTGAAG	0.453																																																	0													107.0	110.0	109.0					9																	116038865		2203	4300	6503	SO:0001583	missense	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.68C>T	9.37:g.116038865C>T	ENSP00000363313:p.Pro23Leu		O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_PRP4-like,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P23L	ENST00000374198.4	37	c.68	CCDS6791.1	9	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301290	0.40694	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.62364	0.03;0.08	5.97	5.07	0.68467	.	0.238181	0.42548	D	0.000682	T	0.48926	0.1527	L	0.52573	1.65	0.80722	D	1	P;P	0.50710	0.938;0.861	B;B	0.32465	0.146;0.101	T	0.51764	-0.8664	10	0.11794	T	0.64	.	16.0517	0.80769	0.0:0.8656:0.1344:0.0	.	38;23	Q59EL4;O43172	.;PRP4_HUMAN	L	22;23	ENSP00000363315:P22L;ENSP00000363313:P23L	ENSP00000363313:P23L	P	+	2	0	PRPF4	115078686	1.000000	0.71417	0.626000	0.29213	0.543000	0.35085	6.931000	0.75863	1.522000	0.49001	0.561000	0.74099	CCG	PRPF4	-	NULL	ENSG00000136875		0.453	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	-	0.00	47	0	C	NM_004697		116038865	+1	tier1	-	no_errors	ENST00000374198	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.995	T
PRR16	51334	genome.wustl.edu	37	5	120022157	120022157	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr5:120022157G>T	ENST00000407149.2	+	2	877	c.668G>T	c.(667-669)cGg>cTg	p.R223L	PRR16_ENST00000446965.1_Missense_Mutation_p.R153L|PRR16_ENST00000505123.1_Missense_Mutation_p.R153L|PRR16_ENST00000379551.2_Missense_Mutation_p.R200L			Q569H4	LARGN_HUMAN	proline rich 16	223	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.R200Q(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		TGTGATACCCGGTATAACATA	0.507																																																	1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					5																	120022157		2203	4300	6503	SO:0001583	missense	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.668G>T	5.37:g.120022157G>T	ENSP00000385118:p.Arg223Leu		D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	NULL	p.R223L	ENST00000407149.2	37	c.668		5	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382993	0.61845	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000505123;ENST00000446965	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.45	5.45	0.79879	.	0.074066	0.56097	D	0.000021	T	0.46619	0.1402	L	0.51422	1.61	0.39408	D	0.966708	P;D	0.53312	0.946;0.959	P;P	0.51385	0.538;0.668	T	0.42258	-0.9462	9	.	.	.	-0.5089	11.5852	0.50914	0.0828:0.0:0.9172:0.0	.	223;200	Q569H4;Q569H4-3	PRR16_HUMAN;.	L	223;200;153;153	ENSP00000385118:R223L;ENSP00000368869:R200L;ENSP00000423446:R153L;ENSP00000405491:R153L	.	R	+	2	0	PRR16	120050056	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	5.967000	0.70403	2.563000	0.86464	0.650000	0.86243	CGG	PRR16	-	NULL	ENSG00000184838		0.507	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1		0.00	29	0	G	NM_016644		120022157	+1			no_errors	ENST00000407149	ensembl	human	known	74_37	missense	6.45	28	2	SNP	1.000	T
PRRT1	80863	genome.wustl.edu	37	6	32118208	32118208	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:32118208C>T	ENST00000211413.5	-	2	619	c.495G>A	c.(493-495)gcG>gcA	p.A165A	PRRT1_ENST00000467780.1_5'Flank|PRRT1_ENST00000375152.2_Silent_p.A84A|PRRT1_ENST00000375150.2_Silent_p.A84A	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1	165					response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.A165A(1)		breast(2)|endometrium(1)|kidney(1)|lung(2)	6						GGTATCCGGGCGCTACGTAGC	0.726																																																	1	Substitution - coding silent(1)	lung(1)											24.0	22.0	23.0					6																	32118208		1505	2705	4210	SO:0001819	synonymous_variant	0			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.495G>A	6.37:g.32118208C>T			A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	Silent	SNP	pfam_CD225/Dispanin_fam	p.A165	ENST00000211413.5	37	c.495	CCDS4739.1	6																																																																																			PRRT1	-	NULL	ENSG00000204314		0.726	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2		0.00	17	0	C	NM_030651		32118208	-1			no_errors	ENST00000211413	ensembl	human	known	74_37	silent	48.00	13	12	SNP	0.806	T
PSMD1	5707	genome.wustl.edu	37	2	231927025	231927025	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:231927025G>T	ENST00000308696.6	+	3	286	c.124G>T	c.(124-126)Gta>Tta	p.V42L	PSMD1_ENST00000409643.1_Missense_Mutation_p.V42L|PSMD1_ENST00000373635.4_Missense_Mutation_p.V42L	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	42					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.V42fs*1(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TTCCGAGTCCGTAGACAAAAT	0.303																																																	1	Deletion - Frameshift(1)	breast(1)											42.0	44.0	43.0					2																	231927025		2202	4296	6498	SO:0001583	missense	0			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.124G>T	2.37:g.231927025G>T	ENSP00000309474:p.Val42Leu		B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	pfam_Proteasome/cyclosome_rpt,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.V42L	ENST00000308696.6	37	c.124	CCDS2482.1	2	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261506	0.59431	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000440838;ENST00000409643	T;T;T	0.27890	1.64;1.64;1.64	5.96	5.96	0.96718	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.27278	0.0669	L	0.35542	1.07	0.80722	D	1	B;B	0.17465	0.002;0.022	B;B	0.15484	0.007;0.013	T	0.07481	-1.0770	10	0.15952	T	0.53	-0.065	20.422	0.99049	0.0:0.0:1.0:0.0	.	42;42	Q99460;Q99460-2	PSMD1_HUMAN;.	L	42	ENSP00000309474:V42L;ENSP00000362738:V42L;ENSP00000386932:V42L	ENSP00000309474:V42L	V	+	1	0	PSMD1	231635269	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.750000	0.98875	2.832000	0.97577	0.655000	0.94253	GTA	PSMD1	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	ENSG00000173692		0.303	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	HGNC	protein_coding	OTTHUMT00000256958.2		0.00	39	0	G			231927025	+1			no_errors	ENST00000308696	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
PTGR2	145482	genome.wustl.edu	37	14	74325551	74325551	+	5'UTR	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr14:74325551T>A	ENST00000555661.1	+	0	131				RP5-1021I20.4_ENST00000556551.2_5'UTR|PTGR2_ENST00000555228.1_5'UTR|PTGR2_ENST00000553326.1_3'UTR|Y_RNA_ENST00000411368.1_RNA|PTGR2_ENST00000267568.4_5'UTR|PTGR2_ENST00000553813.1_5'Flank			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2						prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	GTGAAACCACTGCCCAACCAG	0.284																																					Esophageal Squamous(98;1155 1417 16452 47043 47872)												0													77.0	73.0	75.0					14																	74325551		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.-15T>A	14.37:g.74325551T>A			Q3L8A4|Q6MZH8	RNA	SNP	-	NULL	ENST00000555661.1	37	NULL	CCDS9820.1	14																																																																																			PTGR2	-	-	ENSG00000140043		0.284	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGR2	HGNC	protein_coding	OTTHUMT00000412575.1	-	0.00	89	0	T			74325551	+1	tier1	-	no_errors	ENST00000553326	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.057	A
PTPN6	5777	genome.wustl.edu	37	12	7064025	7064025	+	Silent	SNP	C	C	T	rs377246131		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:7064025C>T	ENST00000318974.9	+	4	628	c.384C>T	c.(382-384)ggC>ggT	p.G128G	PTPN6_ENST00000399448.1_Silent_p.G130G|PTPN6_ENST00000456013.1_Silent_p.G128G|PTPN6_ENST00000447931.2_Silent_p.G89G	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	128	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						AGGCCAAGGGCGAGCCCTGGA	0.642													C|||	6	0.00119808	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0061																0								C	,,	1,4269		0,1,2134	46.0	52.0	50.0		384,390,384	-10.1	0.7	12		50	2,8500		0,2,4249	no	coding-synonymous,coding-synonymous,coding-synonymous	PTPN6	NM_002831.5,NM_080548.4,NM_080549.3	,,	0,3,6383	TT,TC,CC		0.0235,0.0234,0.0235	,,	128/596,130/598,128/625	7064025	3,12769	2135	4251	6386	SO:0001819	synonymous_variant	0				CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.384C>T	12.37:g.7064025C>T			A8K306|G3V0F8|Q969V8|Q9UK67	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.G128	ENST00000318974.9	37	c.384	CCDS44820.1	12																																																																																			PTPN6	-	pfam_SH2,smart_SH2,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2	ENSG00000111679		0.642	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN6	HGNC	protein_coding	OTTHUMT00000400023.1	-	0.00	56	0	C	NM_002831		7064025	+1	tier1	-	no_errors	ENST00000456013	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.027	T
PTPRM	5797	genome.wustl.edu	37	18	7955355	7955355	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:7955355G>T	ENST00000332175.8	+	7	2112	c.1075G>T	c.(1075-1077)Ggg>Tgg	p.G359W	PTPRM_ENST00000580170.1_Missense_Mutation_p.G359W|PTPRM_ENST00000444013.1_Missense_Mutation_p.G146W|PTPRM_ENST00000400053.4_Missense_Mutation_p.G297W|PTPRM_ENST00000400060.4_Missense_Mutation_p.G359W	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	359	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GACCAGGCCAGGGGAGGGTGG	0.502																																																	0													55.0	58.0	57.0					18																	7955355		2203	4300	6503	SO:0001583	missense	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1075G>T	18.37:g.7955355G>T	ENSP00000331418:p.Gly359Trp		A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.G359W	ENST00000332175.8	37	c.1075	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	9.777	1.174151	0.21704	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.115331	0.64402	D	0.000010	D	0.95436	0.8518	M	0.86178	2.8	0.50813	D	0.999891	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.949;0.949	D	0.95168	0.8287	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	146;359;359	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	W	359;359;297;146	ENSP00000331418:G359W;ENSP00000382933:G359W;ENSP00000382927:G297W;ENSP00000387608:G146W	ENSP00000331418:G359W	G	+	1	0	PTPRM	7945355	1.000000	0.71417	0.970000	0.41538	0.523000	0.34469	4.978000	0.63799	2.865000	0.98341	0.655000	0.94253	GGG	PTPRM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000173482		0.502	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	-	0.00	49	0	G			7955355	+1	tier1	-	no_errors	ENST00000400060	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.997	T
PTPRM	5797	genome.wustl.edu	37	18	8314802	8314802	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:8314802C>T	ENST00000332175.8	+	19	3864	c.2827C>T	c.(2827-2829)Cag>Tag	p.Q943*	PTPRM_ENST00000580170.1_Nonsense_Mutation_p.Q956*|PTPRM_ENST00000444013.1_Nonsense_Mutation_p.Q730*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.Q881*|PTPRM_ENST00000400060.4_Nonsense_Mutation_p.Q957*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	943	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGTGAGGCTGCAGACAATAGA	0.358																																																	0													150.0	144.0	146.0					18																	8314802		2203	4300	6503	SO:0001587	stop_gained	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2827C>T	18.37:g.8314802C>T	ENSP00000331418:p.Gln943*		A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Q957*	ENST00000332175.8	37	c.2869	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	C	50	16.295616	0.99859	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	5.86	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	16.9685	0.86293	0.0:0.8722:0.1278:0.0	.	.	.	.	X	943;957;881;730	.	ENSP00000331418:Q943X	Q	+	1	0	PTPRM	8304802	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.460000	0.73518	1.462000	0.47948	0.655000	0.94253	CAG	PTPRM	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000173482		0.358	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	-	0.00	53	0	C			8314802	+1	tier1	-	no_errors	ENST00000400060	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	1.000	T
PTX4	390667	genome.wustl.edu	37	16	1537581	1537581	+	Missense_Mutation	SNP	C	C	T	rs375706387		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:1537581C>T	ENST00000447419.2	-	2	557	c.532G>A	c.(532-534)Gcc>Acc	p.A178T	PTX4_ENST00000440447.2_Intron|PTX4_ENST00000293922.1_Missense_Mutation_p.A173T			Q96A99	PTX4_HUMAN	pentraxin 4, long	178						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CCAGGGTGGGCCACGGGCAGC	0.731																																																	0								C	THR/ALA	0,4334		0,0,2167	10.0	12.0	12.0		517	-4.2	0.0	16		12	1,8447		0,1,4223	no	missense	PTX4	NM_001013658.1	58	0,1,6390	TT,TC,CC		0.0118,0.0,0.0078	benign	173/474	1537581	1,12781	2167	4224	6391	SO:0001583	missense	0				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.532G>A	16.37:g.1537581C>T	ENSP00000445277:p.Ala178Thr			Missense_Mutation	SNP	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.A178T	ENST00000447419.2	37	c.532		16	.	.	.	.	.	.	.	.	.	.	C	11.16	1.558023	0.27827	0.0	1.18E-4	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.06608	3.46;3.28	5.37	-4.15	0.03881	.	1.374570	0.04567	N	0.392521	T	0.04588	0.0125	L	0.29908	0.895	0.09310	N	1	B	0.23806	0.091	B	0.22386	0.039	T	0.41034	-0.9531	10	0.40728	T	0.16	.	3.0165	0.06061	0.1099:0.2568:0.4118:0.2214	.	173	Q96A99-2	.	T	178;173	ENSP00000445277:A178T;ENSP00000293922:A173T	ENSP00000293922:A173T	A	-	1	0	PTX4	1477582	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.017000	0.13399	-0.888000	0.03956	-0.892000	0.02923	GCC	PTX4	-	NULL	ENSG00000251692		0.731	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	HGNC	protein_coding	OTTHUMT00000432526.1		0.00	83	0	C	NM_001013658		1537581	-1			no_errors	ENST00000447419	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.001	T
R3HCC1L	27291	genome.wustl.edu	37	10	100003861	100003861	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:100003861G>T	ENST00000298999.3	+	10	2586	c.2283G>T	c.(2281-2283)ttG>ttT	p.L761F	R3HCC1L_ENST00000370586.2_Missense_Mutation_p.L167F|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.L177F|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.L761F	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	775							nucleotide binding (GO:0000166)										GAAAGCGGTTGGAAGCCAAGC	0.393																																																	0													121.0	111.0	114.0					10																	100003861		2203	4300	6503	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.2283G>T	10.37:g.100003861G>T	ENSP00000298999:p.Leu761Phe		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.L761F	ENST00000298999.3	37	c.2283	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931520	0.73442	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.35048	2.97;2.97;1.34;1.33	5.98	3.87	0.44632	.	0.078755	0.52532	D	0.000076	T	0.39963	0.1098	L	0.27053	0.805	0.58432	D	0.999995	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.22208	-1.0223	9	.	.	.	-2.5503	5.2886	0.15716	0.1905:0.0:0.6531:0.1564	.	167;775;761	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	F	761;761;167;177;168	ENSP00000359616:L761F;ENSP00000298999:L761F;ENSP00000359618:L167F;ENSP00000314018:L177F	.	L	+	3	2	C10orf28	99993851	1.000000	0.71417	0.964000	0.40570	0.993000	0.82548	1.697000	0.37784	0.644000	0.30656	0.563000	0.77884	TTG	R3HCC1L	-	NULL	ENSG00000166024		0.393	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1		0.00	55	0	G	NM_014472		100003861	+1			no_errors	ENST00000370584	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.997	T
RBM46	166863	genome.wustl.edu	37	4	155718963	155718963	+	Splice_Site	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr4:155718963G>T	ENST00000281722.3	+	3	387	c.152G>T	c.(151-153)gGt>gTt	p.G51V	RBM46_ENST00000514866.1_Splice_Site_p.G51V|RBM46_ENST00000510397.1_Splice_Site_p.G51V	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	51							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				TGTCGTTCAGGTTGGGAAGGT	0.358																																																	0													83.0	83.0	83.0					4																	155718963		2203	4300	6503	SO:0001630	splice_region_variant	0			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.152-1G>T	4.37:g.155718963G>T			B3KWU8|B4DZ27	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.G51V	ENST00000281722.3	37	c.152	CCDS3790.1	4	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464463	0.26335	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	T;T;T;T	0.42513	2.22;0.97;2.37;0.97	5.83	4.99	0.66335	Nucleotide-binding, alpha-beta plait (1);	0.093412	0.64402	D	0.000001	T	0.48447	0.1500	L	0.52364	1.645	0.80722	D	1	P;B;B	0.50156	0.932;0.034;0.004	P;B;B	0.51701	0.677;0.097;0.04	T	0.34129	-0.9841	9	.	.	.	.	14.3596	0.66761	0.0704:0.0:0.9296:0.0	.	51;51;51	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	V	51	ENSP00000424500:G51V;ENSP00000281722:G51V;ENSP00000422813:G51V;ENSP00000426672:G51V	.	G	+	2	0	RBM46	155938413	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	4.773000	0.62331	2.763000	0.94921	0.563000	0.77884	GGT	RBM46	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000151962		0.358	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM46	HGNC	protein_coding	OTTHUMT00000365259.1	-	0.00	40	0	G	NM_144979	Missense_Mutation	155718963	+1	tier1	-	no_errors	ENST00000281722	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
RELB	5971	genome.wustl.edu	37	19	45528625	45528625	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:45528625A>G	ENST00000221452.8	+	6	851	c.701A>G	c.(700-702)gAg>gGg	p.E234G	RELB_ENST00000540120.1_Missense_Mutation_p.E234G|RELB_ENST00000505236.1_Missense_Mutation_p.E231G	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	234	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		AGGAAGAAGGAGATTGAGGCT	0.587																																																	0													87.0	98.0	94.0					19																	45528625		2083	4214	6297	SO:0001583	missense	0			M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.701A>G	19.37:g.45528625A>G	ENSP00000221452:p.Glu234Gly		Q6GTX7|Q9UEI7	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.E234G	ENST00000221452.8	37	c.701	CCDS46110.1	19	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555319	0.86231	.	.	ENSG00000104856	ENST00000221452;ENST00000540120;ENST00000505236	T;T;T	0.49432	0.78;0.78;0.78	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	L	0.46157	1.445	0.80722	D	1	D	0.63880	0.993	P	0.58620	0.842	T	0.60167	-0.7316	10	0.87932	D	0	-2.4835	12.7194	0.57134	1.0:0.0:0.0:0.0	.	231	D6R992	.	G	234;234;231	ENSP00000221452:E234G;ENSP00000445542:E234G;ENSP00000423287:E231G	ENSP00000221452:E234G	E	+	2	0	RELB	50220465	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.979000	0.76154	2.108000	0.64289	0.533000	0.62120	GAG	RELB	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD	ENSG00000104856		0.587	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELB	HGNC	protein_coding	OTTHUMT00000367361.2	-	0.00	55	0	A			45528625	+1	tier1	-	no_errors	ENST00000221452	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	G
RIN2	54453	genome.wustl.edu	37	20	19956307	19956307	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:19956307C>T	ENST00000255006.6	+	8	1934	c.1785C>T	c.(1783-1785)tgC>tgT	p.C595C	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	546					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)	p.C546C(1)		autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						ACAAGGAGTGCCACGTGTCCA	0.582																																																	1	Substitution - coding silent(1)	large_intestine(1)											45.0	50.0	48.0					20																	19956307		2151	4246	6397	SO:0001819	synonymous_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1785C>T	20.37:g.19956307C>T			Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.C595	ENST00000255006.6	37	c.1785	CCDS56182.1	20																																																																																			RIN2	-	NULL	ENSG00000132669		0.582	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1		0.00	64	0	C			19956307	+1			no_errors	ENST00000255006	ensembl	human	known	74_37	silent	6.25	45	3	SNP	1.000	T
ROCK1	6093	genome.wustl.edu	37	18	18547850	18547850	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:18547850T>C	ENST00000399799.2	-	26	3995	c.3055A>G	c.(3055-3057)Aga>Gga	p.R1019G		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1019					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GCTTTCTTTCTATCAATTTTA	0.289																																																	0													93.0	92.0	92.0					18																	18547850		2202	4299	6501	SO:0001583	missense	0				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3055A>G	18.37:g.18547850T>C	ENSP00000382697:p.Arg1019Gly		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rho-bd_dom,pfam_HR1_rho-bd,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.R1019G	ENST00000399799.2	37	c.3055	CCDS11870.2	18	.	.	.	.	.	.	.	.	.	.	T	12.13	1.844206	0.32606	.	.	ENSG00000067900	ENST00000399799	T	0.14144	2.53	5.29	4.11	0.48088	.	0.051517	0.85682	D	0.000000	T	0.09862	0.0242	L	0.27053	0.805	0.39922	D	0.974163	B	0.06786	0.001	B	0.04013	0.001	T	0.15122	-1.0448	10	0.18276	T	0.48	.	12.5313	0.56117	0.0:0.0:0.1389:0.8611	.	1019	Q13464	ROCK1_HUMAN	G	1019	ENSP00000382697:R1019G	ENSP00000382697:R1019G	R	-	1	2	ROCK1	16801848	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.089000	0.57685	0.812000	0.34326	0.477000	0.44152	AGA	ROCK1	-	pirsf_Rho-assoc_coiled-coil_kin	ENSG00000067900		0.289	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK1	HGNC	protein_coding	OTTHUMT00000254641.2	-	0.00	50	0	T	NM_005406		18547850	-1	tier1	-	no_errors	ENST00000399799	ensembl	human	known	74_37	missense	30.51	41	18	SNP	1.000	C
RP1	6101	genome.wustl.edu	37	8	55542624	55542624	+	Missense_Mutation	SNP	T	T	C	rs539588544		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:55542624T>C	ENST00000220676.1	+	4	6330	c.6182T>C	c.(6181-6183)aTc>aCc	p.I2061T		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	2061					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ACAAATGAAATCTTTAAAGCA	0.348													T|||	1	0.000199681	0.0	0.0	5008	,	,		17893	0.001		0.0	False		,,,				2504	0.0				Colon(91;1014 1389 7634 14542 40420)												0													60.0	61.0	61.0					8																	55542624		2203	4298	6501	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.6182T>C	8.37:g.55542624T>C	ENSP00000220676:p.Ile2061Thr			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.I2061T	ENST00000220676.1	37	c.6182	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	2.649	-0.282436	0.05642	.	.	ENSG00000104237	ENST00000220676	T	0.23950	1.88	5.39	0.0836	0.14434	.	0.608221	0.14381	N	0.323153	T	0.19565	0.0470	L	0.54323	1.7	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25328	-1.0135	10	0.59425	D	0.04	.	2.7573	0.05296	0.3652:0.1889:0.0:0.4459	.	2061	P56715	RP1_HUMAN	T	2061	ENSP00000220676:I2061T	ENSP00000220676:I2061T	I	+	2	0	RP1	55705177	0.013000	0.17824	0.010000	0.14722	0.048000	0.14542	0.321000	0.19558	0.005000	0.14708	0.533000	0.62120	ATC	RP1	-	NULL	ENSG00000104237		0.348	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	43	0	T	NM_006269		55542624	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.104	C
RPL37A	6168	genome.wustl.edu	37	2	217364062	217364062	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:217364062A>T	ENST00000491306.1	+	2	759	c.73A>T	c.(73-75)Atg>Ttg	p.M25L	AC098820.3_ENST00000438978.1_RNA|RPL37A_ENST00000456586.1_Start_Codon_SNP_p.M1L|RPL37A_ENST00000427280.2_Start_Codon_SNP_p.M1L|RPL37A_ENST00000598925.1_Start_Codon_SNP_p.M1L|RPL37A_ENST00000446558.1_Missense_Mutation_p.M25L|RPL37A_ENST00000600880.1_Missense_Mutation_p.M25L|RPL37A_ENST00000441179.2_Start_Codon_SNP_p.M1L|AC098820.3_ENST00000453157.1_RNA	NM_000998.4	NP_000989.1	P61513	RL37A_HUMAN	ribosomal protein L37a	25					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|ovary(1)	2		Renal(323;0.0458)		Epithelial(149;3.51e-06)|all cancers(144;0.000249)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCCGGAAAATGGTGAAGAA	0.502																																																	0													53.0	57.0	55.0					2																	217364062		2203	4300	6503	SO:0001583	missense	0				CCDS2404.1	2q35	2011-04-06			ENSG00000197756	ENSG00000197756		"""L ribosomal proteins"""	10348	protein-coding gene	gene with protein product		613314				1437567	Standard	NM_000998		Approved	L37A	uc002vgf.3	P61513	OTTHUMG00000133052	ENST00000491306.1:c.73A>T	2.37:g.217364062A>T	ENSP00000418082:p.Met25Leu		P12751|Q6FGF5	Missense_Mutation	SNP	pfam_Ribosomal_L37ae,superfamily_Ribosomal_zn-bd,tigrfam_Ribosomal_L37ae	p.M25L	ENST00000491306.1	37	c.73	CCDS2404.1	2	.	.	.	.	.	.	.	.	.	.	A	19.70	3.876026	0.72180	.	.	ENSG00000197756	ENST00000491306;ENST00000446558;ENST00000456586	.	.	.	5.1	5.1	0.69264	Ribosomal protein L37ae/L37e, N-terminal (1);Ribosomal protein, zinc-binding domain (1);	0.000000	0.64402	U	0.000001	T	0.53997	0.1831	.	.	.	0.80722	D	1	B;B	0.24823	0.0;0.112	B;B	0.23419	0.001;0.046	T	0.52852	-0.8520	8	0.42905	T	0.14	.	14.0687	0.64847	1.0:0.0:0.0:0.0	.	25;25	Q6P4E4;P61513	.;RL37A_HUMAN	L	25;25;1	.	ENSP00000410080:M25L	M	+	1	0	RPL37A	217072307	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.939000	0.92951	1.920000	0.55613	0.533000	0.62120	ATG	RPL37A	-	pfam_Ribosomal_L37ae,superfamily_Ribosomal_zn-bd,tigrfam_Ribosomal_L37ae	ENSG00000197756		0.502	RPL37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL37A	HGNC	protein_coding	OTTHUMT00000256665.2	-	0.00	30	0	A	NM_000998		217364062	+1	tier1	-	no_errors	ENST00000491306	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237608790	237608790	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:237608790G>T	ENST00000366574.2	+	14	1577	c.1260G>T	c.(1258-1260)cgG>cgT	p.R420R	RYR2_ENST00000542537.1_Silent_p.R404R|RYR2_ENST00000360064.6_Silent_p.R418R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	420			R -> W (in CPVT1; dbSNP:rs190140598). {ECO:0000269|PubMed:12106942, ECO:0000269|PubMed:15544015}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGTTATCCGGAGCACAGTCT	0.383																																																	0													142.0	137.0	138.0					1																	237608790		1884	4110	5994	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1260G>T	1.37:g.237608790G>T			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R418	ENST00000366574.2	37	c.1254	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	68	0	G	NM_001035		237608790	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.993	T
SBNO2	22904	genome.wustl.edu	37	19	1127692	1127692	+	Missense_Mutation	SNP	C	C	T	rs371469058		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:1127692C>T	ENST00000361757.3	-	5	589	c.352G>A	c.(352-354)Gtg>Atg	p.V118M	SBNO2_ENST00000587024.1_Missense_Mutation_p.V118M|SBNO2_ENST00000438103.2_Missense_Mutation_p.V61M	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	118					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGTGTCCACGATGTCCGAC	0.607																																																	0								C	MET/VAL,MET/VAL	1,4239		0,1,2119	90.0	101.0	98.0		181,352	1.3	0.0	19		98	0,8468		0,0,4234	no	missense,missense	SBNO2	NM_001100122.1,NM_014963.2	21,21	0,1,6353	TT,TC,CC		0.0,0.0236,0.0079	benign,benign	61/1310,118/1367	1127692	1,12707	2120	4234	6354	SO:0001583	missense	0			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.352G>A	19.37:g.1127692C>T	ENSP00000354733:p.Val118Met		A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.V118M	ENST00000361757.3	37	c.352	CCDS45894.1	19	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860585	0.32884	2.36E-4	0.0	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	3.57	1.26	0.21427	.	1.176410	0.06435	U	0.724873	T	0.18130	0.0435	N	0.14661	0.345	0.09310	N	1	B;D;D;D	0.57257	0.021;0.964;0.964;0.979	B;B;B;B	0.41723	0.005;0.201;0.201;0.365	T	0.16217	-1.0410	9	0.41790	T	0.15	-2.7048	6.2305	0.20732	0.0:0.6912:0.1982:0.1106	.	61;118;118;61	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	M	118;61;75	.	ENSP00000250872:V75M	V	-	1	0	SBNO2	1078692	0.618000	0.27051	0.004000	0.12327	0.587000	0.36485	3.591000	0.53986	0.241000	0.21283	0.491000	0.48974	GTG	SBNO2	-	NULL	ENSG00000064932		0.607	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	HGNC	protein_coding	OTTHUMT00000458065.2	-	0.00	67	0	C	NM_014963		1127692	-1	tier1	-	no_errors	ENST00000361757	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.043	T
SCN10A	6336	genome.wustl.edu	37	3	38738994	38738994	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:38738994G>T	ENST00000449082.2	-	27	5716	c.5717C>A	c.(5716-5718)cCa>cAa	p.P1906Q		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1906					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGATTTGTCTGGGAGTACACA	0.478																																																	0													177.0	162.0	167.0					3																	38738994		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5717C>A	3.37:g.38738994G>T	ENSP00000390600:p.Pro1906Gln		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.P1906Q	ENST00000449082.2	37	c.5717	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430211	0.25726	.	.	ENSG00000185313	ENST00000449082	D	0.95554	-3.74	5.38	5.38	0.77491	.	0.489960	0.17391	U	0.175901	D	0.95010	0.8385	N	0.19112	0.55	0.29333	N	0.866525	D	0.76494	0.999	D	0.68039	0.955	D	0.90941	0.4797	10	0.46703	T	0.11	.	14.5881	0.68342	0.0717:0.0:0.9283:0.0	.	1906	Q9Y5Y9	SCNAA_HUMAN	Q	1906	ENSP00000390600:P1906Q	ENSP00000390600:P1906Q	P	-	2	0	SCN10A	38713998	0.001000	0.12720	1.000000	0.80357	0.120000	0.20174	0.721000	0.25911	2.793000	0.96121	0.655000	0.94253	CCA	SCN10A	-	NULL	ENSG00000185313		0.478	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	-	0.00	53	0	G	NM_006514		38738994	-1	tier1	-	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.898	T
SDHD	6392	genome.wustl.edu	37	11	111965683	111965683	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:111965683T>C	ENST00000375549.3	+	4	604	c.469T>C	c.(469-471)Tgg>Cgg	p.W157R	SDHD_ENST00000528048.1_3'UTR|SDHD_ENST00000525291.1_Missense_Mutation_p.W118R|SDHD_ENST00000528182.1_3'UTR|SDHD_ENST00000528021.1_Intron|SDHD_ENST00000526592.1_3'UTR|SDHD_ENST00000532699.1_Intron	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	157					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	TGCCATGCTGTGGAAGCTCTG	0.433			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																														yes	Rec		Familial paraganglioma	11	11q23	6392	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""		O	0													32.0	30.0	31.0					11																	111965683		2134	4119	6253	SO:0001583	missense	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.469T>C	11.37:g.111965683T>C	ENSP00000364699:p.Trp157Arg		A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	pfam_CybS	p.W157R	ENST00000375549.3	37	c.469	CCDS31678.1	11	.	.	.	.	.	.	.	.	.	.	T	21.7	4.193916	0.78902	.	.	ENSG00000204370	ENST00000375549;ENST00000525291	D;D	0.99454	-5.92;-5.92	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97919	1.0313	10	0.87932	D	0	-12.6744	14.4137	0.67135	0.0:0.0:0.0:1.0	.	157	O14521	DHSD_HUMAN	R	157;118	ENSP00000364699:W157R;ENSP00000436669:W118R	ENSP00000364699:W157R	W	+	1	0	SDHD	111470893	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.548000	0.82154	2.005000	0.58758	0.482000	0.46254	TGG	SDHD	-	pfam_CybS	ENSG00000204370		0.433	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHD	HGNC	protein_coding	OTTHUMT00000392351.1	-	0.00	192	0	T	NM_003002		111965683	+1	tier1	-	no_errors	ENST00000375549	ensembl	human	known	74_37	missense	8.11	136	12	SNP	1.000	C
SEC14L2	23541	genome.wustl.edu	37	22	30811777	30811777	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr22:30811777A>G	ENST00000312932.9	+	9	954	c.694A>G	c.(694-696)Atc>Gtc	p.I232V	SEC14L2_ENST00000403484.1_Missense_Mutation_p.I158V|SEC14L2_ENST00000402592.3_Missense_Mutation_p.I149V|RP4-539M6.19_ENST00000439838.1_Missense_Mutation_p.I66V|SEC14L2_ENST00000405717.3_Missense_Mutation_p.I232V	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	232	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	ACTGAAACATATCAGCCCTGA	0.502																																																	0													58.0	55.0	56.0					22																	30811777		2203	4300	6503	SO:0001583	missense	0			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.694A>G	22.37:g.30811777A>G	ENSP00000316203:p.Ile232Val		B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.I232V	ENST00000312932.9	37	c.694	CCDS13876.1	22	.	.	.	.	.	.	.	.	.	.	A	11.59	1.684560	0.29872	.	.	ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000249590	ENST00000312932;ENST00000428195;ENST00000403484;ENST00000405717;ENST00000402592;ENST00000439838	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53	5.31	-0.399	0.12415	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.210963	0.49916	N	0.000139	T	0.24509	0.0594	L	0.49778	1.585	0.80722	D	1	B;B;B;B;B;B	0.20887	0.049;0.002;0.008;0.0;0.001;0.003	B;B;B;B;B;B	0.20184	0.028;0.018;0.018;0.018;0.024;0.028	T	0.06409	-1.0828	10	0.32370	T	0.25	-16.3847	10.3696	0.44046	0.7356:0.0:0.2644:0.0	.	149;178;232;158;232;232	F5H3U4;B7Z3Z8;B2RAW8;B3KRD8;O76054;O76054-4	.;.;.;.;S14L2_HUMAN;.	V	232;178;158;232;149;66	ENSP00000316203:I232V;ENSP00000387781:I178V;ENSP00000383993:I158V;ENSP00000385186:I232V;ENSP00000383882:I149V;ENSP00000415178:I66V	ENSP00000415178:I66V	I	+	1	0	RP4-539M6.19;SEC14L2	29141777	0.286000	0.24305	0.041000	0.18516	0.989000	0.77384	1.067000	0.30616	-0.327000	0.08551	0.528000	0.53228	ATC	SEC14L2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000100003		0.502	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L2	HGNC	protein_coding	OTTHUMT00000321018.4	-	0.00	29	0	A	NM_012429		30811777	+1	tier1	-	no_errors	ENST00000312932	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.470	G
NTN5	126147	genome.wustl.edu	37	19	49176486	49176486	+	5'Flank	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:49176486G>T	ENST00000270235.4	-	0	0				SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCAGCAGCAGGACAGCCCCGA	0.716																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8			19.37:g.49176486G>T	Exception_encountered		Q8N4X9|Q8WU63	RNA	SNP	-	NULL	ENST00000270235.4	37	NULL	CCDS33068.1	19																																																																																			SEC1P	-	-	ENSG00000232871		0.716	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC1P	HGNC	protein_coding	OTTHUMT00000466176.1	-	0.00	36	0	G	NM_145807		49176486	+1	tier1	-	no_errors	ENST00000430145	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.000	T
SEH1L	81929	genome.wustl.edu	37	18	12955479	12955479	+	Silent	SNP	A	A	G	rs140218685	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:12955479A>G	ENST00000262124.11	+	3	307	c.180A>G	c.(178-180)gtA>gtG	p.V60V	SEH1L_ENST00000399892.2_Silent_p.V60V	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	60					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						GTGGATCTGTATGGCGTGTGA	0.398																																																	0								A	,	4,4402	8.1+/-20.4	0,4,2199	166.0	148.0	154.0		180,180	-1.1	1.0	18	dbSNP_134	154	29,8571	21.0+/-64.5	0,29,4271	no	coding-synonymous,coding-synonymous	SEH1L	NM_001013437.1,NM_031216.3	,	0,33,6470	GG,GA,AA		0.3372,0.0908,0.2537	,	60/422,60/361	12955479	33,12973	2203	4300	6503	SO:0001819	synonymous_variant	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.180A>G	18.37:g.12955479A>G			A8K5B1|Q8NFU6|Q96MH3|Q9C069	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V60	ENST00000262124.11	37	c.180	CCDS45832.1	18																																																																																			SEH1L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085415		0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	-	0.00	74	0	A	NM_031216		12955479	+1	tier1	rs140218685	no_errors	ENST00000399892	ensembl	human	known	74_37	silent	23.08	60	18	SNP	0.998	G
SERINC3	10955	genome.wustl.edu	37	20	43133460	43133460	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:43133460C>T	ENST00000342374.4	-	7	1013	c.856G>A	c.(856-858)Gcc>Acc	p.A286T	SERINC3_ENST00000255175.1_Missense_Mutation_p.A286T|SERINC3_ENST00000541235.1_Missense_Mutation_p.A231T	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	286					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			TTGGACATGGCTGACCAGGTG	0.443																																																	0													132.0	113.0	119.0					20																	43133460		2203	4300	6503	SO:0001583	missense	0			U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.856G>A	20.37:g.43133460C>T	ENSP00000340243:p.Ala286Thr		B4DUE9|O43717|Q9BR33	Missense_Mutation	SNP	pfam_TMS_TDE	p.A286T	ENST00000342374.4	37	c.856	CCDS13333.1	20	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812659	0.90707	.	.	ENSG00000132824	ENST00000411544;ENST00000255175;ENST00000342374;ENST00000538937;ENST00000541235	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.14	5.14	0.70334	.	0.096186	0.64402	D	0.000001	T	0.64068	0.2565	M	0.93978	3.48	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.71414	0.91;0.973	T	0.73297	-0.4027	10	0.87932	D	0	.	13.713	0.62680	0.154:0.846:0.0:0.0	.	286;286	Q53GK8;Q13530	.;SERC3_HUMAN	T	25;286;286;253;231	ENSP00000414197:A25T;ENSP00000255175:A286T;ENSP00000340243:A286T;ENSP00000440966:A231T	ENSP00000255175:A286T	A	-	1	0	SERINC3	42566874	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.702000	0.68332	2.657000	0.90304	0.591000	0.81541	GCC	SERINC3	-	pfam_TMS_TDE	ENSG00000132824		0.443	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC3	HGNC	protein_coding	OTTHUMT00000080544.3		0.00	53	0	C	NM_006811		43133460	-1			no_errors	ENST00000255175	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
SERTAD3	29946	genome.wustl.edu	37	19	40947446	40947446	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:40947446C>G	ENST00000322354.3	-	2	1038	c.542G>C	c.(541-543)tGg>tCg	p.W181S	SERTAD3_ENST00000392028.4_Missense_Mutation_p.W181S|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000601217.1_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	181					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ATTCCACTCCCAAGAACCTGG	0.522																																																	0													96.0	101.0	100.0					19																	40947446		2203	4300	6503	SO:0001583	missense	0			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.542G>C	19.37:g.40947446C>G	ENSP00000325414:p.Trp181Ser		B3KQB3|Q96CQ2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.W181S	ENST00000322354.3	37	c.542	CCDS12558.1	19	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065636	0.55539	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	6.0	6.0	0.97389	.	0.100954	0.43416	D	0.000565	T	0.48786	0.1519	N	0.08118	0	0.58432	D	0.999999	D	0.76494	0.999	D	0.66716	0.946	T	0.39563	-0.9608	9	0.07813	T	0.8	1.9978	15.995	0.80232	0.0:1.0:0.0:0.0	.	181	Q9UJW9	SRTD3_HUMAN	S	181	.	ENSP00000325414:W181S	W	-	2	0	SERTAD3	45639286	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.274000	0.51631	2.848000	0.98002	0.655000	0.94253	TGG	SERTAD3	-	NULL	ENSG00000167565		0.522	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	-	0.00	39	0	C	NM_013368		40947446	-1	tier1	-	no_errors	ENST00000322354	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	G
SHCBP1	79801	genome.wustl.edu	37	16	46650016	46650016	+	Silent	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:46650016T>C	ENST00000303383.3	-	4	704	c.438A>G	c.(436-438)gaA>gaG	p.E146E		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	146					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				AGAGGTATGGTTCAGCAAGCC	0.458																																																	0													85.0	78.0	80.0					16																	46650016		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.438A>G	16.37:g.46650016T>C			Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	p.E146	ENST00000303383.3	37	c.438	CCDS10720.1	16																																																																																			SHCBP1	-	NULL	ENSG00000171241		0.458	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1	HGNC	protein_coding	OTTHUMT00000255740.1	-	0.00	39	0	T	NM_024745		46650016	-1	tier1	-	no_errors	ENST00000303383	ensembl	human	known	74_37	silent	18.75	39	9	SNP	0.036	C
SHMT2	6472	genome.wustl.edu	37	12	57626051	57626051	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:57626051C>T	ENST00000328923.3	+	5	1022	c.570C>T	c.(568-570)ttC>ttT	p.F190F	SHMT2_ENST00000393827.4_Missense_Mutation_p.S85L|SHMT2_ENST00000414700.3_Silent_p.F169F|SHMT2_ENST00000553474.1_Silent_p.F169F|SHMT2_ENST00000449049.3_Silent_p.F169F|SHMT2_ENST00000557487.1_Silent_p.F190F|SHMT2_ENST00000554600.1_3'UTR	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	190					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)	p.F190F(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CCATCTTCTTCGAGTCTATGC	0.587																																					Esophageal Squamous(150;1369 2416 49071 49364)												1	Substitution - coding silent(1)	large_intestine(1)											166.0	136.0	146.0					12																	57626051		2203	4300	6503	SO:0001819	synonymous_variant	0			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.570C>T	12.37:g.57626051C>T			B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase,pirsf_Ser_HO-MeTrfase	p.S85L	ENST00000328923.3	37	c.254	CCDS8934.1	12	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537921	0.65085	.	.	ENSG00000182199	ENST00000393827	T	0.30981	1.51	4.95	-9.0	0.00747	.	.	.	.	.	T	0.25644	0.0624	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10683	-1.0619	8	0.59425	D	0.04	-2.2021	19.8812	0.96900	0.0:0.1145:0.0:0.8855	.	85	B4DLV4	.	L	85	ENSP00000377413:S85L	ENSP00000377413:S85L	S	+	2	0	SHMT2	55912318	0.186000	0.23225	0.449000	0.26957	0.984000	0.73092	-0.473000	0.06615	-2.087000	0.00862	-0.793000	0.03317	TCG	SHMT2	-	pirsf_Ser_HO-MeTrfase	ENSG00000182199		0.587	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT2	HGNC	protein_coding	OTTHUMT00000412525.2		0.00	58	0	C	NM_005412		57626051	+1			no_errors	ENST00000393827	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.973	T
SHROOM4	57477	genome.wustl.edu	37	X	50381301	50381301	+	Missense_Mutation	SNP	C	C	T	rs145605338	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrX:50381301C>T	ENST00000289292.7	-	3	560	c.277G>A	c.(277-279)Gcc>Acc	p.A93T	SHROOM4_ENST00000376020.2_Missense_Mutation_p.A93T|SHROOM4_ENST00000460112.3_5'UTR			Q9ULL8	SHRM4_HUMAN	shroom family member 4	93					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CTGACAGGGGCGTTCCTCCTA	0.577																																																	0								C	THR/ALA	5,3830		0,5,1627,571	64.0	45.0	52.0		277	-2.0	1.0	X	dbSNP_134	52	0,6728		0,0,2428,1872	yes	missense	SHROOM4	NM_020717.3	58	0,5,4055,2443	TT,TC,CC,C		0.0,0.1304,0.0473	benign	93/1494	50381301	5,10558	2203	4300	6503	SO:0001583	missense	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.277G>A	X.37:g.50381301C>T	ENSP00000289292:p.Ala93Thr		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A93T	ENST00000289292.7	37	c.277	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	C	9.088	1.001030	0.19121	0.001304	0.0	ENSG00000158352	ENST00000289292;ENST00000376020	T;T	0.09445	2.98;2.98	5.36	-2.02	0.07388	PDZ/DHR/GLGF (1);	0.868588	0.09929	N	0.737459	T	0.04092	0.0114	N	0.08118	0	0.32252	N	0.571244	B	0.09022	0.002	B	0.04013	0.001	T	0.43669	-0.9377	10	0.22706	T	0.39	.	3.0632	0.06206	0.1104:0.356:0.1079:0.4257	.	93	Q9ULL8	SHRM4_HUMAN	T	93	ENSP00000289292:A93T;ENSP00000365188:A93T	ENSP00000289292:A93T	A	-	1	0	SHROOM4	50398041	1.000000	0.71417	0.956000	0.39512	0.572000	0.35998	0.901000	0.28445	-0.483000	0.06772	-0.380000	0.06706	GCC	SHROOM4	-	superfamily_PDZ	ENSG00000158352		0.577	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	-	0.00	65	0	C	NM_020717		50381301	-1	tier1	rs145605338	no_errors	ENST00000289292	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.884	T
SKI	6497	genome.wustl.edu	37	1	2237626	2237626	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:2237626G>A	ENST00000378536.4	+	6	2007	c.1935G>A	c.(1933-1935)cgG>cgA	p.R645R		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	645					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		AGCAGGCGCGGCAGGCCCGGG	0.687																																					Ovarian(177;144 1678 13697 20086 27838 40755)												0													12.0	11.0	11.0					1																	2237626		2159	4254	6413	SO:0001819	synonymous_variant	0			X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1935G>A	1.37:g.2237626G>A			Q5SYT7	Silent	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.R645	ENST00000378536.4	37	c.1935	CCDS39.1	1																																																																																			SKI	-	NULL	ENSG00000157933		0.687	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKI	HGNC	protein_coding	OTTHUMT00000004070.1		0.00	49	0	G	NM_003036		2237626	+1			no_errors	ENST00000378536	ensembl	human	known	74_37	silent	9.09	40	4	SNP	1.000	A
SLC30A8	169026	genome.wustl.edu	37	8	118175721	118175721	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr8:118175721G>T	ENST00000456015.2	+	6	781	c.781G>T	c.(781-783)Gcc>Tcc	p.A261S	SLC30A8_ENST00000519688.1_Missense_Mutation_p.A212S|SLC30A8_ENST00000521243.1_Missense_Mutation_p.A212S|RN7SL826P_ENST00000479724.2_RNA|SLC30A8_ENST00000427715.2_Missense_Mutation_p.A212S	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	261					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CCTGGTCTTGGCCAGCACCAT	0.398																																					Ovarian(162;1202 1922 6011 16223 52092)												0													152.0	150.0	150.0					8																	118175721		2203	4300	6503	SO:0001583	missense	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.781G>T	8.37:g.118175721G>T	ENSP00000415011:p.Ala261Ser		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A261S	ENST00000456015.2	37	c.781	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996887	0.35226	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	4.95	3.15	0.36227	.	0.547959	0.19987	N	0.101645	T	0.52208	0.1720	L	0.35414	1.06	0.32173	N	0.581382	P	0.35139	0.486	B	0.43082	0.407	T	0.55554	-0.8123	10	0.22109	T	0.4	-1.1141	7.5413	0.27740	0.2725:0.0:0.7275:0.0	.	261	Q8IWU4	ZNT8_HUMAN	S	212;212;212;261	ENSP00000428545:A212S;ENSP00000407505:A212S;ENSP00000431069:A212S;ENSP00000415011:A261S	ENSP00000407505:A212S	A	+	1	0	SLC30A8	118244902	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	2.385000	0.44371	0.759000	0.33084	0.655000	0.94253	GCC	SLC30A8	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000164756		0.398	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1		0.00	57	0	G	NM_173851		118175721	+1			no_errors	ENST00000456015	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.998	T
SLC41A2	84102	genome.wustl.edu	37	12	105199022	105199022	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:105199022C>T	ENST00000258538.3	-	10	1757	c.1630G>A	c.(1630-1632)Gca>Aca	p.A544T	SLC41A2_ENST00000549713.1_5'UTR	NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	544					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						TCACCCAATGCTGTTAGGTAG	0.448																																					Esophageal Squamous(195;176 2919 4272 35572)												0													206.0	211.0	209.0					12																	105199022		2203	4300	6503	SO:0001583	missense	0			BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.1630G>A	12.37:g.105199022C>T	ENSP00000258538:p.Ala544Thr		Q3KP68|Q9H0E5	Missense_Mutation	SNP	pfam_SLC41_membr_dom	p.A544T	ENST00000258538.3	37	c.1630	CCDS9100.2	12	.	.	.	.	.	.	.	.	.	.	C	35	5.442328	0.96187	.	.	ENSG00000136052	ENST00000258538	T	0.23552	1.9	6.07	6.07	0.98685	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.63522	0.2518	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64437	-0.6408	10	0.26408	T	0.33	0.8928	20.6525	0.99598	0.0:1.0:0.0:0.0	.	544	Q96JW4	S41A2_HUMAN	T	544	ENSP00000258538:A544T	ENSP00000258538:A544T	A	-	1	0	SLC41A2	103723152	1.000000	0.71417	0.335000	0.25508	0.809000	0.45718	5.830000	0.69324	2.890000	0.99128	0.585000	0.79938	GCA	SLC41A2	-	pfam_SLC41_membr_dom	ENSG00000136052		0.448	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A2	HGNC	protein_coding	OTTHUMT00000346850.3		0.00	47	0	C	NM_032148		105199022	-1			no_errors	ENST00000258538	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
SLC5A10	125206	genome.wustl.edu	37	17	18862953	18862953	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:18862953G>T	ENST00000395645.3	+	4	343	c.325G>T	c.(325-327)Gtg>Ttg	p.V109L	SLC5A10_ENST00000417251.2_Missense_Mutation_p.V109L|SLC5A10_ENST00000395647.2_Missense_Mutation_p.V109L|SLC5A10_ENST00000317977.6_Missense_Mutation_p.V53L|SLC5A10_ENST00000395642.1_Missense_Mutation_p.V53L|SLC5A10_ENST00000395643.2_Missense_Mutation_p.V109L	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	109					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						ATGGGTGTTCGTGCCCATCTA	0.602																																																	0													129.0	106.0	114.0					17																	18862953		2203	4300	6503	SO:0001583	missense	0				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.325G>T	17.37:g.18862953G>T	ENSP00000379007:p.Val109Leu		A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.V109L	ENST00000395645.3	37	c.325	CCDS42275.1	17	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243872	0.22796	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.90504	-2.68;-2.38;-2.68;-2.38;-2.38;-2.14	5.01	1.72	0.24424	.	0.068505	0.64402	D	0.000016	T	0.78091	0.4229	N	0.10972	0.075	0.54753	D	0.999988	B;B;B;B;B	0.26902	0.051;0.041;0.051;0.098;0.163	B;B;B;B;B	0.31686	0.134;0.082;0.134;0.082;0.128	T	0.64947	-0.6287	10	0.22706	T	0.39	.	6.3277	0.21253	0.1657:0.0:0.6866:0.1478	.	109;109;109;109;53	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	L	53;109;53;109;109;109	ENSP00000324346:V53L;ENSP00000379008:V109L;ENSP00000379004:V53L;ENSP00000401875:V109L;ENSP00000379007:V109L;ENSP00000379005:V109L	ENSP00000324346:V53L	V	+	1	0	SLC5A10	18803678	1.000000	0.71417	0.930000	0.37139	0.364000	0.29643	4.704000	0.61831	0.521000	0.28445	-0.258000	0.10820	GTG	SLC5A10	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000154025		0.602	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A10	HGNC	protein_coding	OTTHUMT00000132129.2	-	0.00	37	0	G	NM_152351		18862953	+1	tier1	-	no_errors	ENST00000395647	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.996	T
SLC8A2	6543	genome.wustl.edu	37	19	47969220	47969220	+	Silent	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:47969220G>T	ENST00000236877.6	-	2	836	c.441C>A	c.(439-441)gtC>gtA	p.V147V	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	147					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		AGACTTCGATGACTGACAGCA	0.622																																																	0													57.0	45.0	49.0					19																	47969220		2203	4300	6503	SO:0001819	synonymous_variant	0			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.441C>A	19.37:g.47969220G>T			B4DYQ9	Silent	SNP	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.V147	ENST00000236877.6	37	c.441	CCDS33065.1	19																																																																																			SLC8A2	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex	ENSG00000118160		0.622	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	HGNC	protein_coding	OTTHUMT00000466997.1	-	0.00	37	0	G			47969220	-1	tier1	-	no_errors	ENST00000236877	ensembl	human	known	74_37	silent	11.76	30	4	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103095550	103095550	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:103095550delC	ENST00000295269.4	+	2	966	c.509delC	c.(508-510)gccfs	p.A170fs		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	170					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CTGATCAACGCCTTGGGCATT	0.612																																																	0													49.0	47.0	48.0					2																	103095550		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.509delC	2.37:g.103095550delC	ENSP00000295269:p.Ala170fs		Q69YK0	Frame_Shift_Del	DEL	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.L171fs	ENST00000295269.4	37	c.509	CCDS33264.1	2																																																																																			SLC9A4	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.612	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1		0.00	50	0	C	NM_001011552.3		103095550	+1	tier1		no_errors	ENST00000295269	ensembl	human	known	74_37	frame_shift_del	15.62	27	5	DEL	1.000	-
SORCS1	114815	genome.wustl.edu	37	10	108412176	108412176	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:108412176T>A	ENST00000263054.6	-	18	2446	c.2439A>T	c.(2437-2439)caA>caT	p.Q813H	SORCS1_ENST00000344440.6_Missense_Mutation_p.Q813H|SORCS1_ENST00000369698.1_Missense_Mutation_p.Q348H	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	813	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CGTTGTGTCCTTGTTCCGCTG	0.527																																																	0													133.0	117.0	123.0					10																	108412176		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2439A>T	10.37:g.108412176T>A	ENSP00000263054:p.Gln813His		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.Q813H	ENST00000263054.6	37	c.2439	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533593	0.45073	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.61980	0.06;0.06;0.06	5.56	0.544	0.17185	PKD/Chitinase domain (1);PKD domain (3);	0.077784	0.53938	D	0.000045	T	0.65322	0.2680	L	0.44542	1.39	0.38769	D	0.954511	D;D;D;D;D	0.61697	0.99;0.978;0.987;0.99;0.987	D;P;P;D;P	0.63033	0.91;0.854;0.854;0.91;0.854	T	0.63042	-0.6725	9	.	.	.	-12.9534	10.5463	0.45062	0.0:0.4226:0.0:0.5774	.	813;813;813;813;813	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	H	348;813;813	ENSP00000358712:Q348H;ENSP00000263054:Q813H;ENSP00000345964:Q813H	.	Q	-	3	2	SORCS1	108402166	0.988000	0.35896	0.965000	0.40720	0.638000	0.38207	0.197000	0.17197	0.062000	0.16340	0.533000	0.62120	CAA	SORCS1	-	pfam_PKD_dom,superfamily_PKD_dom	ENSG00000108018		0.527	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4		0.00	68	0	T	NM_052918		108412176	-1			no_errors	ENST00000344440	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.997	A
SMC3	9126	genome.wustl.edu	37	10	112362581	112362581	+	Splice_Site	SNP	A	A	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:112362581A>T	ENST00000361804.4	+	27	3423		c.e27-1			NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)	p.?(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GTTTATTTTTAGGTGTCATTT	0.363																																																	1	Unknown(1)	NS(1)											69.0	75.0	73.0					10																	112362581		2203	4299	6502	SO:0001630	splice_region_variant	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.3298-1A>T	10.37:g.112362581A>T			A8K156|O60464|Q5T482	Splice_Site	SNP	-	e27-2	ENST00000361804.4	37	c.3298-2	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474881	0.43942	.	.	ENSG00000108055	ENST00000361804	.	.	.	5.87	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9217	0.52795	0.7238:0.2762:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMC3	112352571	1.000000	0.71417	0.971000	0.41717	0.826000	0.46750	7.129000	0.77225	1.014000	0.39417	0.482000	0.46254	.	SMC3	-	-	ENSG00000108055		0.363	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1		0.00	37	0	A	NM_005445	Intron	112362581	+1			no_errors	ENST00000361804	ensembl	human	known	74_37	splice_site	8.33	33	3	SNP	0.998	T
SPATA31D1	389763	genome.wustl.edu	37	9	84608684	84608684	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:84608684T>C	ENST00000344803.2	+	4	3346	c.3299T>C	c.(3298-3300)gTc>gCc	p.V1100A		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1100					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GTAGACGAAGTCAGTCAGAAA	0.502																																																	0													53.0	54.0	53.0					9																	84608684		1948	4149	6097	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3299T>C	9.37:g.84608684T>C	ENSP00000341988:p.Val1100Ala			Missense_Mutation	SNP	NULL	p.V1100A	ENST00000344803.2	37	c.3299	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	T	0.138	-1.105884	0.01828	.	.	ENSG00000214929	ENST00000344803	T	0.05513	3.43	2.86	-4.35	0.03656	.	.	.	.	.	T	0.02267	0.0070	N	0.14661	0.345	0.09310	N	1	B	0.16396	0.017	B	0.15484	0.013	T	0.46005	-0.9222	9	0.06365	T	0.9	0.908	0.8553	0.01181	0.1663:0.2476:0.1644:0.4218	.	1100	Q6ZQQ2	F75D1_HUMAN	A	1100	ENSP00000341988:V1100A	ENSP00000341988:V1100A	V	+	2	0	FAM75D1	83798504	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.690000	0.00831	-1.014000	0.03379	-0.522000	0.04353	GTC	SPATA31D1	-	NULL	ENSG00000214929		0.502	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	74	0	T	NM_001001670		84608684	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	C
SPOCD1	90853	genome.wustl.edu	37	1	32267288	32267288	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:32267288G>T	ENST00000360482.2	-	3	1531	c.1402C>A	c.(1402-1404)Cat>Aat	p.H468N	SPOCD1_ENST00000533231.1_Missense_Mutation_p.H468N|SPOCD1_ENST00000257100.3_5'UTR|SPOCD1_ENST00000373648.2_Missense_Mutation_p.H468N	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	468					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TTCACTCCATGGGGTATTTTC	0.478																																																	0													102.0	107.0	105.0					1																	32267288		2203	4300	6503	SO:0001583	missense	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1402C>A	1.37:g.32267288G>T	ENSP00000353670:p.His468Asn		Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.H468N	ENST00000360482.2	37	c.1402	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283209	0.40394	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.30981	2.05;1.51;2.05	4.37	0.275	0.15659	.	.	.	.	.	T	0.13586	0.0329	N	0.14661	0.345	0.09310	N	1	B;B	0.32160	0.358;0.244	B;B	0.24155	0.051;0.023	T	0.16660	-1.0395	9	0.45353	T	0.12	5.5004	3.7832	0.08689	0.2791:0.0:0.5531:0.1678	.	468;468	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	N	468	ENSP00000353670:H468N;ENSP00000362752:H468N;ENSP00000435851:H468N	ENSP00000353670:H468N	H	-	1	0	SPOCD1	32039875	0.018000	0.18449	0.049000	0.19019	0.637000	0.38172	-0.145000	0.10265	0.059000	0.16252	0.655000	0.94253	CAT	SPOCD1	-	NULL	ENSG00000134668		0.478	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1		0.00	40	0	G	NM_144569		32267288	-1			no_errors	ENST00000360482	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.050	T
SPTA1	6708	genome.wustl.edu	37	1	158651381	158651381	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:158651381C>T	ENST00000368147.4	-	4	647	c.467G>A	c.(466-468)cGg>cAg	p.R156Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	156					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTCAGGGCCCGCAGCAACTG	0.527																																																	0													173.0	178.0	176.0					1																	158651381		2029	4185	6214	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.467G>A	1.37:g.158651381C>T	ENSP00000357129:p.Arg156Gln		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R156Q	ENST00000368147.4	37	c.467	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	0.612	-0.824756	0.02755	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.32023	1.47;1.47	5.15	-4.02	0.04034	.	.	.	.	.	T	0.03011	0.0089	N	0.03224	-0.385	0.34689	D	0.725559	B	0.02656	0.0	B	0.04013	0.001	T	0.45527	-0.9255	9	0.02654	T	1	.	13.238	0.59982	0.0:0.2268:0.0:0.7732	.	156	P02549	SPTA1_HUMAN	Q	156	ENSP00000357130:R156Q;ENSP00000357129:R156Q	ENSP00000357129:R156Q	R	-	2	0	SPTA1	156918005	0.991000	0.36638	0.085000	0.20634	0.102000	0.19082	0.191000	0.17076	-0.907000	0.03862	-0.244000	0.11960	CGG	SPTA1	-	NULL	ENSG00000163554		0.527	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	63	0	C	NM_003126		158651381	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	24.59	46	15	SNP	0.995	T
SREK1	140890	genome.wustl.edu	37	5	65476614	65476614	+	IGR	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr5:65476614A>G	ENST00000380918.3	+	0	2433				SREK1_ENST00000334121.6_3'UTR|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCTTGCATCAACAGCTGTCTT	0.338																																					GBM(10;31 347 27684 38976 41583)												0																																										SO:0001628	intergenic_variant	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809		5.37:g.65476614A>G			A4FTW3|Q2M1J0|Q86X37	RNA	SNP	-	NULL	ENST00000380918.3	37	NULL	CCDS3991.1	5																																																																																			SREK1	-	-	ENSG00000153914		0.338	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	-	0.00	24	0	A	NM_001077199		65476614	+1	tier1	-	no_errors	ENST00000284041	ensembl	human	known	74_37	rna	58.33	10	14	SNP	1.000	G
STIL	6491	genome.wustl.edu	37	1	47748120	47748120	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:47748120T>A	ENST00000360380.3	-	12	1508	c.1145A>T	c.(1144-1146)aAg>aTg	p.K382M	STIL_ENST00000337817.5_Missense_Mutation_p.K382M|STIL_ENST00000371877.3_Missense_Mutation_p.K382M|STIL_ENST00000396221.2_Missense_Mutation_p.K382M|STIL_ENST00000243182.6_Missense_Mutation_p.K382M	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	382					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AGAAGATAACTTTTGGGAAGA	0.388																																																	0													83.0	85.0	84.0					1																	47748120		2203	4300	6503	SO:0001583	missense	0			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1145A>T	1.37:g.47748120T>A	ENSP00000353544:p.Lys382Met		Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.K382M	ENST00000360380.3	37	c.1145	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.646700	0.47258	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.74	3.39	0.38822	.	0.534254	0.21562	N	0.072548	T	0.57562	0.2062	L	0.57536	1.79	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.73708	0.979;0.979;0.979;0.981;0.981	T	0.48906	-0.8993	10	0.62326	D	0.03	-4.4322	4.1208	0.10104	0.0:0.2103:0.176:0.6137	.	382;335;382;382;382	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	M	382;382;382;382;382;335	ENSP00000353544:K382M;ENSP00000337367:K382M;ENSP00000360944:K382M;ENSP00000379523:K382M;ENSP00000243182:K382M;ENSP00000411664:K335M	ENSP00000243182:K382M	K	-	2	0	STIL	47520707	0.916000	0.31088	0.249000	0.24280	0.719000	0.41307	1.488000	0.35551	0.424000	0.26061	0.459000	0.35465	AAG	STIL	-	NULL	ENSG00000123473		0.388	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2		0.00	67	0	T	NM_003035		47748120	-1			no_errors	ENST00000371877	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.144	A
STK38	11329	genome.wustl.edu	37	6	36483136	36483136	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:36483136G>T	ENST00000229812.7	-	7	933	c.648C>A	c.(646-648)gaC>gaA	p.D216E		NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAAGAAGGTTGTCTGGTTTGA	0.458																																					Colon(180;997 3561 16158)												0													232.0	196.0	208.0					6																	36483136		2203	4300	6503	SO:0001583	missense	0				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.648C>A	6.37:g.36483136G>T	ENSP00000229812:p.Asp216Glu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.D216E	ENST00000229812.7	37	c.648	CCDS4822.1	6	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468744	0.84533	.	.	ENSG00000112079	ENST00000229812	T	0.35789	1.29	5.78	3.97	0.46021	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.12528	-1.0544	10	0.87932	D	0	.	9.0937	0.36625	0.2425:0.0:0.7575:0.0	.	216	Q15208	STK38_HUMAN	E	216	ENSP00000229812:D216E	ENSP00000229812:D216E	D	-	3	2	STK38	36591114	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.930000	0.40124	2.730000	0.93505	0.655000	0.94253	GAC	STK38	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000112079		0.458	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	HGNC	protein_coding	OTTHUMT00000040346.1		0.00	53	0	G	NM_007271		36483136	-1			no_errors	ENST00000229812	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
SUMF1	285362	genome.wustl.edu	37	3	4458863	4458863	+	Silent	SNP	G	G	T	rs373665011		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:4458863G>T	ENST00000272902.5	-	6	824	c.789C>A	c.(787-789)ggC>ggA	p.G263G	SUMF1_ENST00000534863.1_Silent_p.G263G|SUMF1_ENST00000405420.2_Silent_p.G263G|SUMF1_ENST00000383843.5_Silent_p.G238G|SUMF1_ENST00000458465.2_Intron	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	263					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		CCGGAAACTCGCCCTGCCAAA	0.552																																																	0													192.0	170.0	178.0					3																	4458863		2203	4300	6503	SO:0001819	synonymous_variant	0			BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.789C>A	3.37:g.4458863G>T			B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Silent	SNP	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.G263	ENST00000272902.5	37	c.789	CCDS2564.1	3																																																																																			SUMF1	-	pfam_FGE_dom,superfamily_C-type_lectin_fold	ENSG00000144455		0.552	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMF1	HGNC	protein_coding	OTTHUMT00000206591.2	-	0.00	49	0	G	NM_182760		4458863	-1	tier1	-	no_errors	ENST00000448413	ensembl	human	known	74_37	silent	17.65	28	6	SNP	0.994	T
SUPT6H	6830	genome.wustl.edu	37	17	27020751	27020751	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:27020751A>T	ENST00000314616.6	+	28	3954	c.3671A>T	c.(3670-3672)cAg>cTg	p.Q1224L	SUPT6H_ENST00000347486.4_Missense_Mutation_p.Q1224L	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1224	Interaction with KDM6A. {ECO:0000250}.|S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGCCCAGGCCAGGCCATCGGT	0.507																																																	0													127.0	109.0	115.0					17																	27020751		2203	4300	6503	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3671A>T	17.37:g.27020751A>T	ENSP00000319104:p.Gln1224Leu		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.Q1224L	ENST00000314616.6	37	c.3671	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	A	32	5.188724	0.94923	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.82	5.82	0.92795	RNA-binding domain, S1 (1);	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	L	0.59436	1.845	0.80722	D	1	P	0.47350	0.894	B	0.42555	0.391	T	0.64279	-0.6445	9	0.66056	D	0.02	-20.9542	16.1848	0.81942	1.0:0.0:0.0:0.0	.	1224	Q7KZ85	SPT6H_HUMAN	L	1224	.	ENSP00000319104:Q1224L	Q	+	2	0	SUPT6H	24044878	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.627000	0.90974	2.232000	0.73038	0.528000	0.53228	CAG	SUPT6H	-	smart_RNA-binding_domain_S1,pirsf_TF_Spt6	ENSG00000109111		0.507	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	57	0	A	NM_003170		27020751	+1	tier1	-	no_errors	ENST00000314616	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	T
TFPI	7035	genome.wustl.edu	37	2	188343494	188343494	+	Intron	SNP	G	G	C	rs148657144		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:188343494G>C	ENST00000233156.3	-	6	923				TFPI_ENST00000409676.1_Missense_Mutation_p.A222G|TFPI_ENST00000392365.1_Intron|TFPI_ENST00000339091.4_Missense_Mutation_p.A222G|AC007319.1_ENST00000412276.1_RNA|AC007319.1_ENST00000453517.1_RNA	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)						blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	AATATGAGCCGCATTCTTCCA	0.353																																																	0													157.0	138.0	145.0					2																	188343494		2203	4300	6503	SO:0001627	intron_variant	0				CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.628+5356C>G	2.37:g.188343494G>C			O95103|Q53TS4	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.A222G	ENST00000233156.3	37	c.665	CCDS2294.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171665	0.78452	.	.	ENSG00000003436	ENST00000409676;ENST00000339091	T;T	0.67698	-0.28;-0.28	4.72	4.72	0.59763	.	.	.	.	.	T	0.79082	0.4386	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	T	0.78028	-0.2364	8	0.33141	T	0.24	.	14.8526	0.70309	0.0:0.0:1.0:0.0	.	222	P10646-2	.	G	222	ENSP00000386344:A222G;ENSP00000342306:A222G	ENSP00000342306:A222G	A	-	2	0	TFPI	188051739	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	3.408000	0.52651	2.138000	0.66242	0.557000	0.71058	GCG	TFPI	-	pirsf_Prot_inhib_I2_TFPI	ENSG00000003436		0.353	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI	HGNC	protein_coding	OTTHUMT00000255881.1		0.00	54	0	G	NM_006287		188343494	-1			no_errors	ENST00000339091	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	C
TGFBR2	7048	genome.wustl.edu	37	3	30691784	30691784	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:30691784A>G	ENST00000295754.5	+	3	668	c.286A>G	c.(286-288)Aca>Gca	p.T96A	TGFBR2_ENST00000359013.4_Missense_Mutation_p.T121A	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	96					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CGAGAACATAACACTAGAGAC	0.428																																																	0													106.0	103.0	104.0					3																	30691784		2203	4300	6503	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.286A>G	3.37:g.30691784A>G	ENSP00000295754:p.Thr96Ala		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.T121A	ENST00000295754.5	37	c.361	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	A	18.10	3.548310	0.65311	.	.	ENSG00000163513	ENST00000295754;ENST00000359013	D;D	0.83250	-1.7;-1.7	5.82	5.82	0.92795	Transforming growth factor beta receptor 2 ectodomain (1);	0.044949	0.85682	D	0.000000	D	0.85885	0.5801	M	0.66939	2.045	0.80722	D	1	B;B	0.23540	0.087;0.087	B;B	0.41723	0.365;0.332	T	0.81111	-0.1081	10	0.18276	T	0.48	.	16.1864	0.81955	1.0:0.0:0.0:0.0	.	96;121	P37173;D2JYI1	TGFR2_HUMAN;.	A	96;121	ENSP00000295754:T96A;ENSP00000351905:T121A	ENSP00000295754:T96A	T	+	1	0	TGFBR2	30666788	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	5.800000	0.69108	2.225000	0.72522	0.533000	0.62120	ACA	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto	ENSG00000163513		0.428	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	-	0.00	41	0	A			30691784	+1	tier1	-	no_errors	ENST00000359013	ensembl	human	known	74_37	missense	41.67	14	10	SNP	1.000	G
TLL2	7093	genome.wustl.edu	37	10	98136519	98136519	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:98136519G>T	ENST00000357947.3	-	18	2603	c.2378C>A	c.(2377-2379)cCt>cAt	p.P793H		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	793	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTATTTGTCAGGCCAGTTGGG	0.537																																																	0													76.0	76.0	76.0					10																	98136519		2203	4300	6503	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2378C>A	10.37:g.98136519G>T	ENSP00000350630:p.Pro793His		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.P793H	ENST00000357947.3	37	c.2378	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032162	0.93575	.	.	ENSG00000095587	ENST00000357947	T	0.66099	-0.19	4.98	4.98	0.66077	CUB (5);	0.000000	0.45361	D	0.000366	D	0.89065	0.6609	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93764	0.7069	10	0.87932	D	0	.	17.7923	0.88558	0.0:0.0:1.0:0.0	.	793	Q9Y6L7	TLL2_HUMAN	H	793	ENSP00000350630:P793H	ENSP00000350630:P793H	P	-	2	0	TLL2	98126509	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	9.601000	0.98297	2.746000	0.94184	0.655000	0.94253	CCT	TLL2	-	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000095587		0.537	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1		0.00	82	0	G			98136519	-1			no_errors	ENST00000357947	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
TMC5	79838	genome.wustl.edu	37	16	19451843	19451843	+	Silent	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:19451843G>A	ENST00000396229.2	+	3	1232	c.483G>A	c.(481-483)ccG>ccA	p.P161P	TMC5_ENST00000542583.2_Silent_p.P161P|TMC5_ENST00000541464.1_Silent_p.P161P|TMC5_ENST00000381414.4_Silent_p.P161P	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	161					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P161P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCTTAGAACCGGACTACCCTG	0.478																																																	1	Substitution - coding silent(1)	lung(1)											167.0	161.0	162.0					16																	19451843		1916	4140	6056	SO:0001819	synonymous_variant	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.483G>A	16.37:g.19451843G>A			Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	pfam_TMC	p.P161	ENST00000396229.2	37	c.483	CCDS45431.1	16																																																																																			TMC5	-	NULL	ENSG00000103534		0.478	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	-	0.00	33	0	G	NM_024780		19451843	+1	tier1	-	no_errors	ENST00000396229	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.992	A
TMEM5	10329	genome.wustl.edu	37	12	64173952	64173952	+	Intron	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:64173952G>A	ENST00000261234.6	+	1	327				TMEM5_ENST00000537373.1_De_novo_Start_OutOfFrame|RP11-415I12.3_ENST00000509615.2_RNA|TMEM5_ENST00000537982.1_3'UTR	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5							integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		TGCGCTCCTGGCTGGGGCTGC	0.751																																																	0													2.0	2.0	2.0					12																	64173952		1231	2697	3928	SO:0001627	intron_variant	0			AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.169+43G>A	12.37:g.64173952G>A			A8K017|Q6PKD6	RNA	SNP	-	NULL	ENST00000261234.6	37	NULL	CCDS8966.1	12																																																																																			TMEM5	-	-	ENSG00000118600		0.751	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM5	HGNC	protein_coding	OTTHUMT00000400821.1	-	0.00	40	0	G	NM_014254		64173952	+1	tier1	-	no_errors	ENST00000537982	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.000	A
TOP3B	8940	genome.wustl.edu	37	22	22326273	22326273	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr22:22326273C>A	ENST00000398793.2	-	5	794	c.360G>T	c.(358-360)aaG>aaT	p.K120N	TOP3B_ENST00000413067.2_Intron|TOP3B_ENST00000357179.5_Missense_Mutation_p.K120N	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	120	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TCTCCCCCTCCTTGTCGCAGT	0.577																																																	0													256.0	140.0	179.0					22																	22326273		2203	4300	6503	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.360G>T	22.37:g.22326273C>A	ENSP00000381773:p.Lys120Asn		A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.K120N	ENST00000398793.2	37	c.360	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065679	0.76187	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000424393;ENST00000437929;ENST00000430142	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.36	-0.52	0.11935	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	M	0.69185	2.1	0.80722	D	1	P	0.41041	0.736	P	0.48952	0.596	T	0.13522	-1.0506	10	0.56958	D	0.05	12.5193	9.1757	0.37109	0.0:0.5276:0.0:0.4724	.	120	O95985	TOP3B_HUMAN	N	120	ENSP00000349705:K120N;ENSP00000381773:K120N;ENSP00000390977:K120N;ENSP00000402622:K120N;ENSP00000414538:K120N	ENSP00000349705:K120N	K	-	3	2	TOP3B	20656273	0.985000	0.35326	0.998000	0.56505	0.997000	0.91878	0.167000	0.16602	0.068000	0.16574	0.655000	0.94253	AAG	TOP3B	-	pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,prints_Topo_IA	ENSG00000100038		0.577	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1		0.00	65	0	C	NM_003935		22326273	-1			no_errors	ENST00000357179	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.998	A
TOPORS	10210	genome.wustl.edu	37	9	32543771	32543771	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr9:32543771T>A	ENST00000360538.2	-	3	868	c.752A>T	c.(751-753)cAa>cTa	p.Q251L	TOPORS_ENST00000379858.1_Missense_Mutation_p.Q186L	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	251	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		ATCTTGTTCTTGAATTTTCCG	0.388																																																	0													96.0	102.0	100.0					9																	32543771		2203	4300	6503	SO:0001583	missense	0			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.752A>T	9.37:g.32543771T>A	ENSP00000353735:p.Gln251Leu		O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q251L	ENST00000360538.2	37	c.752	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038695	0.35989	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.15718	2.4;2.4	5.93	5.93	0.95920	.	0.000000	0.48767	D	0.000173	T	0.35422	0.0931	L	0.50333	1.59	0.37700	D	0.92418	D	0.89917	1.0	D	0.66084	0.941	T	0.19614	-1.0300	10	0.59425	D	0.04	-19.16	15.3592	0.74457	0.0:0.0:0.0:1.0	.	251	Q9NS56	TOPRS_HUMAN	L	251;186	ENSP00000353735:Q251L;ENSP00000369187:Q186L	ENSP00000353735:Q251L	Q	-	2	0	TOPORS	32533771	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.982000	0.49337	2.263000	0.75096	0.533000	0.62120	CAA	TOPORS	-	NULL	ENSG00000197579		0.388	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	HGNC	protein_coding	OTTHUMT00000052007.1	-	0.00	34	0	T	NM_005802		32543771	-1	tier1	-	no_errors	ENST00000360538	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578469	7578469	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:7578469delC	ENST00000269305.4	-	5	650	c.461delG	c.(460-462)ggcfs	p.G154fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.G154fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.G154fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.G154fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.G154fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.G154fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	154	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> I (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G154V(46)|p.0?(8)|p.G154D(6)|p.?(5)|p.P152fs*14(5)|p.G61V(3)|p.G22V(3)|p.G154I(3)|p.T155_R156insDSTPPPGT(3)|p.G154fs*14(2)|p.P153fs*26(2)|p.P153fs*22(2)|p.T23_R24insDSTPPPGT(1)|p.P151_V173del23(1)|p.D148_T155delDSTPPPGT(1)|p.G154A(1)|p.D148fs*23(1)|p.T62_R63insDSTPPPGT(1)|p.Q144_G154del11(1)|p.S149fs*72(1)|p.G154fs*22(1)|p.G154_R156delGTR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACGCGGGTGCCGGGCGGGGG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	98	Substitution - Missense(62)|Deletion - Frameshift(14)|Whole gene deletion(8)|Insertion - In frame(5)|Unknown(5)|Deletion - In frame(4)	lung(34)|stomach(8)|oesophagus(8)|skin(7)|liver(6)|ovary(6)|bone(5)|upper_aerodigestive_tract(4)|large_intestine(4)|breast(4)|central_nervous_system(2)|urinary_tract(2)|prostate(2)|pancreas(2)|thyroid(1)|soft_tissue(1)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CM951223	TP53	M							50.0	51.0	51.0					17																	7578469		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.461delG	17.37:g.7578469delC	ENSP00000269305:p.Gly154fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G154fs	ENST00000269305.4	37	c.461	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	34	0	C	NM_000546		7578469	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	33.33	14	7	DEL	0.872	-
TP53	7157	genome.wustl.edu	37	17	7579406	7579406	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr17:7579406G>T	ENST00000269305.4	-	4	470	c.281C>A	c.(280-282)tCa>tAa	p.S94*	TP53_ENST00000359597.4_Nonsense_Mutation_p.S94*|TP53_ENST00000455263.2_Nonsense_Mutation_p.S94*|TP53_ENST00000413465.2_Nonsense_Mutation_p.S94*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.S94*|TP53_ENST00000445888.2_Nonsense_Mutation_p.S94*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	94	Interaction with WWOX.		S -> L (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S94*(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACAGAAGATGACAGGGGCCA	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	19	Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)	bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|breast(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|liver(1)											46.0	50.0	49.0					17																	7579406		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.281C>A	17.37:g.7579406G>T	ENSP00000269305:p.Ser94*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S94*	ENST00000269305.4	37	c.281	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.295815	0.95574	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.41	4.41	0.53225	.	0.479162	0.22142	N	0.064035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4656	14.8839	0.70553	0.0:0.0:1.0:0.0	.	.	.	.	X	94	.	ENSP00000269305:S94X	S	-	2	0	TP53	7520131	1.000000	0.71417	0.997000	0.53966	0.824000	0.46624	6.829000	0.75314	2.450000	0.82876	0.561000	0.74099	TCA	TP53	-	NULL	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	95	0	G	NM_000546		7579406	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	17.98	73	16	SNP	1.000	T
TPMT	7172	genome.wustl.edu	37	6	18130964	18130964	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr6:18130964C>G	ENST00000309983.4	-	9	758	c.673G>C	c.(673-675)Gaa>Caa	p.E225Q		NM_000367.2	NP_000358.1	P51580	TPMT_HUMAN	thiopurine S-methyltransferase	225					methylation (GO:0032259)|nucleobase-containing compound metabolic process (GO:0006139)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	thiopurine S-methyltransferase activity (GO:0008119)			large_intestine(2)|lung(1)	3	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.146)	all cancers(50;0.06)|Epithelial(50;0.0654)		Azathioprine(DB00993)|Bendroflumethiazide(DB00436)|Cefazolin(DB01327)|Mercaptopurine(DB01033)|Olsalazine(DB01250)|Trichlormethiazide(DB01021)	TTATGTCGTTCTTCAAAAGCA	0.308																																					Colon(190;1381 2791 16728 32493)												0													99.0	99.0	99.0					6																	18130964		2203	4299	6502	SO:0001583	missense	0				CCDS4543.1	6p22.3	2014-09-17			ENSG00000137364	ENSG00000137364	2.1.1.67		12014	protein-coding gene	gene with protein product		187680				8316220	Standard	NM_000367		Approved		uc003ncm.3	P51580	OTTHUMG00000014317	ENST00000309983.4:c.673G>C	6.37:g.18130964C>G	ENSP00000312304:p.Glu225Gln		O14806|O15423|O15424|O15425|O15426|O15515|O15548|O43213|Q5VUK6|Q9UBE6|Q9UBT8|Q9UE62	Missense_Mutation	SNP	pfam_TPMT,pirsf_Thiopurine_S-MeTrfase	p.E225Q	ENST00000309983.4	37	c.673	CCDS4543.1	6	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174451	0.57692	.	.	ENSG00000137364	ENST00000309983	T	0.64991	-0.13	5.92	5.05	0.67936	.	0.151446	0.64402	D	0.000018	T	0.39306	0.1073	L	0.45285	1.41	0.50632	D	0.999886	P	0.51351	0.944	B	0.41236	0.351	T	0.29427	-1.0012	10	0.26408	T	0.33	-27.3164	13.621	0.62136	0.0:0.9255:0.0:0.0745	.	225	P51580	TPMT_HUMAN	Q	225	ENSP00000312304:E225Q	ENSP00000312304:E225Q	E	-	1	0	TPMT	18238943	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	3.144000	0.50616	1.521000	0.48983	0.585000	0.79938	GAA	TPMT	-	pfam_TPMT,pirsf_Thiopurine_S-MeTrfase	ENSG00000137364		0.308	TPMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPMT	HGNC	protein_coding	OTTHUMT00000039960.1	-	0.00	68	0	C			18130964	-1	tier1	-	no_errors	ENST00000309983	ensembl	human	known	74_37	missense	14.89	40	7	SNP	1.000	G
TPPP3	51673	genome.wustl.edu	37	16	67425008	67425008	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:67425008C>T	ENST00000564104.1	-	1	848	c.7G>A	c.(7-9)Gcg>Acg	p.A3T	RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000290942.5_Missense_Mutation_p.A3T|TPPP3_ENST00000393957.2_Missense_Mutation_p.A3T|TPPP3_ENST00000562206.1_Missense_Mutation_p.A3T			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	3					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		TCTGTGCTCGCTGCCATGCCA	0.597																																																	0													63.0	57.0	59.0					16																	67425008		2198	4300	6498	SO:0001583	missense	0			BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.7G>A	16.37:g.67425008C>T	ENSP00000462435:p.Ala3Thr		Q49AH9|Q9Y326|Q9Y6H0	Missense_Mutation	SNP	pfam_P25-alpha	p.A3T	ENST00000564104.1	37	c.7	CCDS10835.1	16	.	.	.	.	.	.	.	.	.	.	C	9.315	1.056563	0.19907	.	.	ENSG00000159713	ENST00000393957;ENST00000290942	T;T	0.44482	0.92;0.92	5.03	2.04	0.26737	.	0.426330	0.23764	N	0.044794	T	0.23330	0.0564	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	10	0.13470	T	0.59	-18.6585	9.4611	0.38785	0.0:0.7694:0.0:0.2306	.	3	Q9BW30	TPPP3_HUMAN	T	3	ENSP00000377529:A3T;ENSP00000290942:A3T	ENSP00000290942:A3T	A	-	1	0	TPPP3	65982509	0.031000	0.19500	0.328000	0.25416	0.896000	0.52359	3.011000	0.49567	0.313000	0.23062	0.491000	0.48974	GCG	TPPP3	-	NULL	ENSG00000159713		0.597	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TPPP3	HGNC	protein_coding	OTTHUMT00000421787.2	-	0.00	67	0	C	NM_015964		67425008	-1	tier1	-	no_errors	ENST00000290942	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.102	T
TRIM42	287015	genome.wustl.edu	37	3	140397293	140397293	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr3:140397293C>T	ENST00000286349.3	+	1	413	c.222C>T	c.(220-222)ccC>ccT	p.P74P		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	74	Cys-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCAATGATCCCAACTGTAAGT	0.552																																																	0													109.0	89.0	96.0					3																	140397293		2203	4300	6503	SO:0001819	synonymous_variant	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.222C>T	3.37:g.140397293C>T			A1L4B4|Q8N832|Q8NDL3	Silent	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.P74	ENST00000286349.3	37	c.222	CCDS3113.1	3																																																																																			TRIM42	-	NULL	ENSG00000155890		0.552	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	32	0	C	NM_152616		140397293	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	silent	16.28	36	7	SNP	1.000	T
TRIM77	390231	genome.wustl.edu	37	11	89444610	89444611	+	Frame_Shift_Ins	INS	-	-	A	rs553410308	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr11:89444610_89444611insA	ENST00000398290.3	+	2	444_445	c.444_445insA	c.(445-447)aaafs	p.K149fs		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	149						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AGTCCATCTGGAAAAAAAAACA	0.322													AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	18	0.00359425	0.0045	0.0043	5008	,	,		17260	0.0		0.003	False		,,,				2504	0.0061																0										42,1848		3,36,906						2.1	0.1			35	89,3879		3,83,1898	no	frameshift	TRIM77P	NM_001146162.1		6,119,2804	A1A1,A1R,RR		2.2429,2.2222,2.2363				131,5727				SO:0001589	frameshift_variant	0				CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.453dupA	11.37:g.89444619_89444619dupA	ENSP00000474003:p.Lys149fs			Frame_Shift_Ins	INS	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q151fs	ENST00000398290.3	37	c.444_445		11																																																																																			TRIM77	-	NULL	ENSG00000214414		0.322	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	TRIM77	HGNC	protein_coding			0.00	55	0	-	NM_001146162		89444611	+1	tier1		no_errors	ENST00000398290	ensembl	human	known	74_37	frame_shift_ins	10.00	63	7	INS	0.059:0.039	A
TRPM2	7226	genome.wustl.edu	37	21	45842268	45842268	+	Intron	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr21:45842268G>A	ENST00000397928.1	+	23	3906				AP001065.2_ENST00000423310.1_RNA|TRPM2_ENST00000498430.1_Intron|TRPM2_ENST00000300482.5_Intron|TRPM2_ENST00000397932.2_Missense_Mutation_p.A1193T|TRPM2_ENST00000300481.9_Intron	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						AACCACCCTCGCATGTTTGCA	0.532																																																	0																																										SO:0001627	intron_variant	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.3462-1260G>A	21.37:g.45842268G>A			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.A1193T	ENST00000397928.1	37	c.3577	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.815518	0.00600	.	.	ENSG00000142185	ENST00000397932	T	0.52526	0.66	1.77	-2.07	0.07276	.	.	.	.	.	T	0.22936	0.0554	.	.	.	0.09310	N	1	B	0.27286	0.174	B	0.12837	0.008	T	0.13872	-1.0493	8	0.22109	T	0.4	.	2.8516	0.05560	0.1713:0.0:0.3924:0.4363	.	1193	E9PGK7	.	T	1193	ENSP00000381026:A1193T	ENSP00000381026:A1193T	A	+	1	0	TRPM2	44666696	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-0.069000	0.11542	-0.573000	0.05998	-0.490000	0.04691	GCA	TRPM2	-	NULL	ENSG00000142185		0.532	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	-	0.00	52	0	G	NM_003307		45842268	+1	tier1	-	no_errors	ENST00000397932	ensembl	human	novel	74_37	missense	7.41	50	4	SNP	0.001	A
TSPYL2	64061	genome.wustl.edu	37	X	53114892	53114892	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chrX:53114892A>G	ENST00000375442.4	+	6	1450	c.1318A>G	c.(1318-1320)Atc>Gtc	p.I440V		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	440					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						TTTCAGCGAGATCTCAGACAT	0.463																																																	0													142.0	118.0	126.0					X																	53114892		2203	4300	6503	SO:0001583	missense	0			AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1318A>G	X.37:g.53114892A>G	ENSP00000364591:p.Ile440Val		O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	pfam_NAP_family	p.I440V	ENST00000375442.4	37	c.1318	CCDS14350.1	X	.	.	.	.	.	.	.	.	.	.	A	10.37	1.331398	0.24167	.	.	ENSG00000184205	ENST00000375442	T	0.22134	1.97	2.91	2.91	0.33838	.	0.229124	0.22148	N	0.063943	T	0.11153	0.0272	N	0.19112	0.55	0.22639	N	0.998906	B;B	0.26002	0.102;0.139	B;B	0.24541	0.054;0.019	T	0.22277	-1.0221	10	0.23302	T	0.38	-31.2776	6.7536	0.23501	1.0:0.0:0.0:0.0	.	80;440	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	V	440	ENSP00000364591:I440V	ENSP00000364591:I440V	I	+	1	0	TSPYL2	53131617	0.998000	0.40836	0.969000	0.41365	0.867000	0.49689	1.368000	0.34216	1.396000	0.46663	0.231000	0.17811	ATC	TSPYL2	-	NULL	ENSG00000184205		0.463	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL2	HGNC	protein_coding	OTTHUMT00000056718.1	-	0.00	34	0	A	NM_022117		53114892	+1	tier1	-	no_errors	ENST00000375442	ensembl	human	known	74_37	missense	34.88	28	15	SNP	0.967	G
USP44	84101	genome.wustl.edu	37	12	95927822	95927822	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:95927822C>G	ENST00000258499.3	-	2	499	c.211G>C	c.(211-213)Gag>Cag	p.E71Q	USP44_ENST00000393091.2_Missense_Mutation_p.E71Q|USP44_ENST00000552440.1_Missense_Mutation_p.E71Q|USP44_ENST00000537435.2_Missense_Mutation_p.E71Q	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	71					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TCATTCACCTCCAATGCAACA	0.418											OREG0022039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													152.0	134.0	140.0					12																	95927822		2203	4300	6503	SO:0001583	missense	0			AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.211G>C	12.37:g.95927822C>G	ENSP00000258499:p.Glu71Gln	1316	B2RDW3	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.E71Q	ENST00000258499.3	37	c.211	CCDS9053.1	12	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277254	0.80580	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435;ENST00000551837;ENST00000549639	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	5.27	5.27	0.74061	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (3);	0.045693	0.85682	D	0.000000	T	0.57695	0.2071	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.60255	-0.7299	10	0.72032	D	0.01	.	19.2436	0.93893	0.0:1.0:0.0:0.0	.	71	Q9H0E7	UBP44_HUMAN	Q	71	ENSP00000258499:E71Q;ENSP00000376806:E71Q;ENSP00000448670:E71Q;ENSP00000442629:E71Q;ENSP00000448601:E71Q;ENSP00000449635:E71Q	ENSP00000258499:E71Q	E	-	1	0	USP44	94451953	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	7.445000	0.80570	2.623000	0.88846	0.561000	0.74099	GAG	USP44	-	pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP	ENSG00000136014		0.418	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP44	HGNC	protein_coding	OTTHUMT00000408312.1		0.00	46	0	C	NM_032147		95927822	-1			no_errors	ENST00000258499	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	G
UBC	7316	genome.wustl.edu	37	12	125396398	125396398	+	Silent	SNP	A	A	G	rs8023		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr12:125396398A>G	ENST00000538617.1	-	4	1096	c.780T>C	c.(778-780)gaT>gaC	p.D260D	UBC_ENST00000536661.1_5'Flank|UBC_ENST00000339647.5_Silent_p.D640D|UBC_ENST00000536769.1_Silent_p.D640D|UBC_ENST00000546120.1_Silent_p.D564D			P0CG48	UBC_HUMAN	ubiquitin C	640	Ubiquitin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TGCCTTCCTTATCTTGGATCT	0.512																																																	0													187.0	174.0	178.0					12																	125396398		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.780T>C	12.37:g.125396398A>G			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.D640	ENST00000538617.1	37	c.1920		12																																																																																			UBC	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000150991		0.512	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400179.1	-	0.00	107	0	A	NM_021009		125396398	-1	tier1	rs8023	no_errors	ENST00000339647	ensembl	human	known	74_37	silent	20.75	84	22	SNP	1.000	G
USP8	9101	genome.wustl.edu	37	15	50792968	50792968	+	3'UTR	SNP	A	A	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:50792968A>G	ENST00000396444.3	+	0	5378				USP8_ENST00000433963.1_3'UTR|USP50_ENST00000530218.1_5'Flank|USP50_ENST00000532404.1_Nonstop_Mutation_p.*335R|RP11-562A8.4_ENST00000560380.1_RNA	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		AAGCTATATCAGGCCTGGGTG	0.428																																																	0													69.0	64.0	66.0					15																	50792968		1896	4110	6006	SO:0001624	3_prime_UTR_variant	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.*1683A>G	15.37:g.50792968A>G			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Nonstop_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.*335R	ENST00000396444.3	37	c.1003	CCDS10137.1	15	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615470	0.87359	.	.	ENSG00000170236	ENST00000532404	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4159	0.67151	1.0:0.0:0.0:0.0	.	.	.	.	R	335	.	.	X	-	1	0	USP50	48580260	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.533000	0.81994	2.223000	0.72356	0.482000	0.46254	TGA	USP50	-	NULL	ENSG00000170236		0.428	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP50	HGNC	protein_coding	OTTHUMT00000254541.1	-	0.00	48	0	A	NM_005154		50792968	-1	tier1	-	no_errors	ENST00000532404	ensembl	human	known	74_37	nonstop	9.09	40	4	SNP	1.000	G
VDAC2	7417	genome.wustl.edu	37	10	76978897	76978897	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:76978897G>T	ENST00000332211.6	+	5	440	c.227G>T	c.(226-228)tGt>tTt	p.C76F	VDAC2_ENST00000535553.1_Missense_Mutation_p.C37F|VDAC2_ENST00000543351.1_Missense_Mutation_p.C76F|VDAC2_ENST00000313132.4_Missense_Mutation_p.C91F|VDAC2_ENST00000472137.1_3'UTR	NM_003375.3	NP_003366.2	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	76					anion transport (GO:0006820)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein polymerization (GO:0032272)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	10	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	TACAAGTGGTGTGAGTATGGT	0.378																																																	0													107.0	103.0	104.0					10																	76978897		2203	4300	6503	SO:0001583	missense	0			BC000165	CCDS7348.1, CCDS53544.1	10q22	2011-11-15			ENSG00000165637	ENSG00000165637		"""Voltage-dependent anion channels"""	12672	protein-coding gene	gene with protein product		193245				7517385, 10049775	Standard	NM_003375		Approved		uc021ptp.1	P45880	OTTHUMG00000018517	ENST00000332211.6:c.227G>T	10.37:g.76978897G>T	ENSP00000361686:p.Cys76Phe		Q5VWK1|Q5VWK3|Q6IB40|Q7L3J5|Q9BWK8|Q9Y5I6	Missense_Mutation	SNP	pfam_Porin_Euk/Tom40,prints_Porin_Euk	p.C91F	ENST00000332211.6	37	c.272	CCDS7348.1	10	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456919	0.43634	.	.	ENSG00000165637	ENST00000298468;ENST00000543351;ENST00000344036;ENST00000332211;ENST00000535553;ENST00000313132;ENST00000447677;ENST00000413289	T;T;T;T;T;T;T	0.43294	1.0;1.0;0.99;1.0;0.99;1.0;0.95	5.43	5.43	0.79202	.	0.364709	0.31301	N	0.007900	T	0.35941	0.0949	L	0.38175	1.15	0.38083	D	0.936735	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.06405	0.002;0.001;0.0	T	0.22103	-1.0226	10	0.52906	T	0.07	.	15.1278	0.72497	0.0:0.1825:0.8175:0.0	.	37;91;76	B4DKM5;P45880-1;P45880	.;.;VDAC2_HUMAN	F	76;76;76;76;37;91;76;91	ENSP00000298468:C76F;ENSP00000443092:C76F;ENSP00000344876:C76F;ENSP00000361686:C76F;ENSP00000361635:C91F;ENSP00000401492:C76F;ENSP00000389551:C91F	ENSP00000298468:C76F	C	+	2	0	VDAC2	76648903	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.639000	0.67868	2.543000	0.85770	0.655000	0.94253	TGT	VDAC2	-	pfam_Porin_Euk/Tom40	ENSG00000165637		0.378	VDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC2	HGNC	protein_coding	OTTHUMT00000048792.1	-	0.00	57	0	G	NM_003375		76978897	+1	tier1	-	no_errors	ENST00000313132	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62305246	62305246	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr15:62305246G>T	ENST00000261517.5	-	11	890	c.817C>A	c.(817-819)Cag>Aag	p.Q273K	VPS13C_ENST00000395896.4_Missense_Mutation_p.Q273K|VPS13C_ENST00000249837.3_Missense_Mutation_p.Q230K|VPS13C_ENST00000395898.3_Missense_Mutation_p.Q230K	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACCAAAATCTGTTCCCTTGAT	0.378																																																	0													81.0	74.0	76.0					15																	62305246		2203	4299	6502	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.817C>A	15.37:g.62305246G>T	ENSP00000261517:p.Gln273Lys			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.Q273K	ENST00000261517.5	37	c.817	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728876	0.30684	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.44482	0.93;0.92;1.1	5.83	5.83	0.93111	.	0.568411	0.17787	N	0.162030	T	0.36248	0.0960	L	0.35341	1.055	0.26461	N	0.975443	B;B;B;B	0.19200	0.034;0.034;0.003;0.021	B;B;B;B	0.18561	0.013;0.022;0.009;0.01	T	0.25328	-1.0135	10	0.52906	T	0.07	.	15.5806	0.76432	0.0:0.1371:0.8629:0.0	.	230;273;230;273	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	K	230;273;273;273	ENSP00000249837:Q230K;ENSP00000261517:Q273K;ENSP00000379233:Q273K	ENSP00000249837:Q230K	Q	-	1	0	VPS13C	60092538	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.352000	0.52239	2.761000	0.94854	0.650000	0.86243	CAG	VPS13C	-	NULL	ENSG00000129003		0.378	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	28	0	G	NM_017684		62305246	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
VPS16	64601	genome.wustl.edu	37	20	2844831	2844831	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr20:2844831G>A	ENST00000380445.3	+	17	1690	c.1618G>A	c.(1618-1620)Gag>Aag	p.E540K	VPS16_ENST00000380469.3_Missense_Mutation_p.E396K|PTPRA_ENST00000380393.3_5'UTR|VPS16_ENST00000380443.3_Missense_Mutation_p.E226K|VPS16_ENST00000481812.2_3'UTR	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	540					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						ACAGCTGCTGGAGTATGAGCC	0.582																																																	0													53.0	55.0	54.0					20																	2844831		2203	4300	6503	SO:0001583	missense	0			AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.1618G>A	20.37:g.2844831G>A	ENSP00000369810:p.Glu540Lys		Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.E540K	ENST00000380445.3	37	c.1618	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003102	0.93287	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000380443	T;T;T	0.46063	0.88;0.88;0.88	5.2	5.2	0.72013	Vps16, C-terminal (1);	0.049844	0.85682	D	0.000000	T	0.57989	0.2091	M	0.66439	2.03	0.80722	D	1	P;P;D;P	0.60575	0.856;0.945;0.988;0.945	P;P;P;P	0.57468	0.652;0.821;0.794;0.821	T	0.58918	-0.7551	10	0.52906	T	0.07	-31.0692	16.2695	0.82607	0.0:0.0:1.0:0.0	.	16;226;396;540	A1A4H0;Q5JUA8;Q9H269-2;Q9H269	.;.;.;VPS16_HUMAN	K	540;396;226	ENSP00000369810:E540K;ENSP00000369836:E396K;ENSP00000369808:E226K	ENSP00000369808:E226K	E	+	1	0	VPS16	2792831	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.722000	0.91452	2.706000	0.92434	0.561000	0.74099	GAG	VPS16	-	pfam_Vps16_C,pirsf_VPS16	ENSG00000215305		0.582	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	HGNC	protein_coding	OTTHUMT00000077658.2	-	0.00	96	0	G	NM_022575		2844831	+1	tier1	-	no_errors	ENST00000380445	ensembl	human	known	74_37	missense	27.91	62	24	SNP	1.000	A
XYLT1	64131	genome.wustl.edu	37	16	17353097	17353097	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:17353097delC	ENST00000261381.6	-	3	745	c.661delG	c.(661-663)gacfs	p.D221fs		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	221					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCGGCTCTGTCCCCGGGAGGC	0.587																																																	0													106.0	117.0	114.0					16																	17353097		2197	4300	6497	SO:0001589	frameshift_variant	0			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.661delG	16.37:g.17353097delC	ENSP00000261381:p.Asp221fs		Q9H1B6	Frame_Shift_Del	DEL	pfam_XylT,pfam_Glyco_trans_14	p.D221fs	ENST00000261381.6	37	c.661	CCDS10569.1	16																																																																																			XYLT1	-	NULL	ENSG00000103489		0.587	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2		0.00	36	0	C	NM_022166		17353097	-1	tier1		no_errors	ENST00000261381	ensembl	human	known	74_37	frame_shift_del	7.14	26	2	DEL	0.000	-
ZCCHC2	54877	genome.wustl.edu	37	18	60242142	60242142	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr18:60242142C>T	ENST00000269499.5	+	13	3246	c.2828C>T	c.(2827-2829)cCc>cTc	p.P943L	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.P622L	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	943						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GCAACTTCTCCCCAGCCAGCG	0.647																																																	0													59.0	65.0	63.0					18																	60242142		2138	4253	6391	SO:0001583	missense	0			AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2828C>T	18.37:g.60242142C>T	ENSP00000269499:p.Pro943Leu		B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Phox,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.P943L	ENST00000269499.5	37	c.2828	CCDS45880.1	18	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332245	0.41297	.	.	ENSG00000141664	ENST00000269499	T	0.26660	1.72	4.89	4.89	0.63831	.	0.990730	0.08216	N	0.979937	T	0.21962	0.0529	N	0.14661	0.345	0.45946	D	0.998777	B	0.17038	0.02	B	0.16722	0.016	T	0.07366	-1.0776	10	0.42905	T	0.14	-0.1946	18.4559	0.90720	0.0:1.0:0.0:0.0	.	943	Q9C0B9	ZCHC2_HUMAN	L	943	ENSP00000269499:P943L	ENSP00000269499:P943L	P	+	2	0	ZCCHC2	58393122	0.970000	0.33590	0.478000	0.27316	0.863000	0.49368	2.934000	0.48956	2.419000	0.82065	0.563000	0.77884	CCC	ZCCHC2	-	NULL	ENSG00000141664		0.647	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	ZCCHC2	HGNC	protein_coding	OTTHUMT00000450083.1	-	0.00	41	0	C	NM_017742		60242142	+1	tier1	-	no_errors	ENST00000269499	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.979	T
ZFYVE27	118813	genome.wustl.edu	37	10	99511159	99511159	+	Silent	SNP	G	G	T	rs561011837		TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:99511159G>T	ENST00000393677.4	+	8	1020	c.816G>T	c.(814-816)ccG>ccT	p.P272P	ZFYVE27_ENST00000356257.4_Silent_p.P277P|ZFYVE27_ENST00000370613.3_Silent_p.P154P|ZFYVE27_ENST00000337540.7_Silent_p.P240P|ZFYVE27_ENST00000453958.2_Silent_p.P272P|ZFYVE27_ENST00000370610.3_Silent_p.P179P|ZFYVE27_ENST00000359980.3_Silent_p.P272P|ZFYVE27_ENST00000357540.4_Silent_p.P186P	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	272					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		ACCTCACACCGGGCAGCGTGG	0.597																																																	0													106.0	88.0	94.0					10																	99511159		2203	4300	6503	SO:0001819	synonymous_variant	0			BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.816G>T	10.37:g.99511159G>T			B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.P277	ENST00000393677.4	37	c.831	CCDS31263.1	10																																																																																			ZFYVE27	-	NULL	ENSG00000155256		0.597	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	ZFYVE27	HGNC	protein_coding	OTTHUMT00000049745.2		0.00	51	0	G	NM_144588		99511159	+1			no_errors	ENST00000356257	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.709	T
ZIC2	7546	genome.wustl.edu	37	13	100634697	100634697	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr13:100634697delG	ENST00000376335.3	+	1	672	c.379delG	c.(379-381)gggfs	p.G127fs		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	127	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.			RGFGD -> ARLPGT (in Ref. 1; AAC96325). {ECO:0000305}.	brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCGCGGCTTCGGGGACTCGGC	0.771																																					Pancreas(97;119 1522 31925 44771 48764)												0													1.0	1.0	1.0					13																	100634697		827	1911	2738	SO:0001589	frameshift_variant	0			AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.379delG	13.37:g.100634697delG	ENSP00000365514:p.Gly127fs		Q5VYA9|Q9H309	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D128fs	ENST00000376335.3	37	c.379	CCDS9495.1	13																																																																																			ZIC2	-	NULL	ENSG00000043355		0.771	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC2	HGNC	protein_coding	OTTHUMT00000045618.2		0.00	16	0	G	NM_007129		100634697	+1	tier1		no_errors	ENST00000376335	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	1.000	-
ZNF107	51427	genome.wustl.edu	37	7	64168548	64168548	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr7:64168548C>A	ENST00000395391.1	+	4	3241	c.1866C>A	c.(1864-1866)aaC>aaA	p.N622K	ZNF107_ENST00000344930.3_Missense_Mutation_p.N622K|ZNF107_ENST00000423627.1_Missense_Mutation_p.N622K			Q9UII5	ZN107_HUMAN	zinc finger protein 107	622					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				GATTCTCAAACCTAACTATAC	0.358																																																	0													42.0	48.0	46.0					7																	64168548		2202	4297	6499	SO:0001583	missense	0			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1866C>A	7.37:g.64168548C>A	ENSP00000378789:p.Asn622Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N622K	ENST00000395391.1	37	c.1866	CCDS5527.1	7	.	.	.	.	.	.	.	.	.	.	.	11.85	1.760693	0.31137	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.21932	1.98;1.98;1.98	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13628	0.0330	N	0.25890	0.77	0.09310	N	1	B	0.31435	0.323	B	0.32928	0.155	T	0.29671	-1.0004	8	.	.	.	.	7.9559	0.30042	0.0:1.0:0.0:0.0	.	622	Q9UII5	ZN107_HUMAN	K	622	ENSP00000343443:N622K;ENSP00000400037:N622K;ENSP00000378789:N622K	.	N	+	3	2	ZNF107	63805983	0.000000	0.05858	0.277000	0.24703	0.825000	0.46686	-1.833000	0.01695	0.635000	0.30488	0.313000	0.20887	AAC	ZNF107	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196247		0.358	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF107	HGNC	protein_coding	OTTHUMT00000251593.1	-	0.00	67	0	C	NM_016220		64168548	+1	tier1	-	no_errors	ENST00000344930	ensembl	human	known	74_37	missense	25.00	42	14	SNP	0.085	A
ZNF142	7701	genome.wustl.edu	37	2	219513948	219513948	+	Missense_Mutation	SNP	G	G	A	rs542070434	byFrequency	TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr2:219513948G>A	ENST00000449707.1	-	6	1104	c.683C>T	c.(682-684)gCg>gTg	p.A228V	ZNF142_ENST00000411696.2_Missense_Mutation_p.A228V	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCTCTCCACCGCACTGTAGTG	0.542											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0	0.0	5008	,	,		19594	0.0		0.0	False		,,,				2504	0.002				Colon(170;867 1942 8995 15834 18053)												0													61.0	64.0	63.0					2																	219513948		2072	4212	6284	SO:0001583	missense	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.683C>T	2.37:g.219513948G>A	ENSP00000408643:p.Ala228Val	2259	Q92510	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A228V	ENST00000449707.1	37	c.683	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496422	0.85069	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.14766	2.48;2.48	5.22	5.22	0.72569	Zinc finger, C2H2-like (1);	0.101973	0.64402	D	0.000002	T	0.22205	0.0535	M	0.71581	2.175	0.47511	D	0.999441	D;P	0.53745	0.962;0.945	B;B	0.43386	0.278;0.418	T	0.01894	-1.1252	10	0.34782	T	0.22	-0.0671	19.3296	0.94280	0.0:0.0:1.0:0.0	.	228;65	P52746;A8MWU9	ZN142_HUMAN;.	V	228	ENSP00000408643:A228V;ENSP00000398798:A228V	ENSP00000398798:A228V	A	-	2	0	ZNF142	219222192	1.000000	0.71417	0.972000	0.41901	0.977000	0.68977	9.418000	0.97395	2.873000	0.98535	0.563000	0.77884	GCG	ZNF142	-	smart_Znf_C2H2-like	ENSG00000115568		0.542	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1		0.00	21	0	G	NM_005081		219513948	-1			no_errors	ENST00000411696	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.998	A
ZNF225	7768	genome.wustl.edu	37	19	44636226	44636226	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:44636226G>T	ENST00000262894.6	+	5	1739	c.1459G>T	c.(1459-1461)Gaa>Taa	p.E487*	ZNF225_ENST00000590612.1_Nonsense_Mutation_p.E487*|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				ATTTAAATGTGAAGAATGTGG	0.398																																																	0													64.0	70.0	68.0					19																	44636226		2193	4297	6490	SO:0001587	stop_gained	0			AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1459G>T	19.37:g.44636226G>T	ENSP00000262894:p.Glu487*		A8K8S2|Q53F12|Q9NS46|Q9UID8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E487*	ENST00000262894.6	37	c.1459	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.681787	0.97759	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	.	.	.	2.89	0.685	0.18009	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	2.394	0.04385	0.2878:0.0:0.3371:0.3751	.	.	.	.	X	487;451	.	ENSP00000262894:E487X	E	+	1	0	ZNF225	49328066	0.000000	0.05858	0.072000	0.20136	0.931000	0.56810	-2.173000	0.01265	0.485000	0.27652	0.561000	0.74099	GAA	ZNF225	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256294		0.398	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	-	0.00	70	0	G			44636226	+1	tier1	-	no_errors	ENST00000262894	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	0.006	T
ZNF365	22891	genome.wustl.edu	37	10	64219517	64219517	+	Silent	SNP	C	C	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr10:64219517C>T	ENST00000410046.3	+	4	1222	c.942C>T	c.(940-942)ggC>ggT	p.G314G	ZNF365_ENST00000395255.3_Silent_p.G314G	NM_199451.2	NP_955523.1	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					AAGGTGCTGGCGAAGCTCGCC	0.522																																																	0													55.0	44.0	48.0					10																	64219517		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000410046.3:c.942C>T	10.37:g.64219517C>T				Silent	SNP	NULL	p.G314	ENST00000410046.3	37	c.942	CCDS7264.1	10																																																																																			ZNF365	-	NULL	ENSG00000138311		0.522	ZNF365-003	KNOWN	basic|CCDS	protein_coding	ZNF365	HGNC	protein_coding	OTTHUMT00000277038.1	-	0.00	48	0	C	NM_014951		64219517	+1	tier1	-	no_errors	ENST00000410046	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.000	T
ZNF536	9745	genome.wustl.edu	37	19	31039530	31039530	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:31039530G>T	ENST00000355537.3	+	4	3151	c.3004G>T	c.(3004-3006)Ggc>Tgc	p.G1002C		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1002					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGCATGGCACGGCTGCTTGTT	0.562																																																	0													75.0	70.0	72.0					19																	31039530		2203	4300	6503	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3004G>T	19.37:g.31039530G>T	ENSP00000347730:p.Gly1002Cys		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G1002C	ENST00000355537.3	37	c.3004	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405430	0.42715	.	.	ENSG00000198597	ENST00000355537	T	0.10192	2.9	5.82	4.79	0.61399	Zinc finger, C2H2-like (1);	0.098719	0.64402	D	0.000001	T	0.18002	0.0432	N	0.19112	0.55	0.58432	D	0.99999	D;D	0.76494	0.999;0.999	D;D	0.65010	0.931;0.931	T	0.03875	-1.0996	10	0.49607	T	0.09	-27.7127	14.7787	0.69749	0.069:0.0:0.931:0.0	.	1002;1002	A7E228;O15090	.;ZN536_HUMAN	C	1002	ENSP00000347730:G1002C	ENSP00000347730:G1002C	G	+	1	0	ZNF536	35731370	1.000000	0.71417	0.982000	0.44146	0.408000	0.30992	7.551000	0.82182	1.463000	0.47967	0.561000	0.74099	GGC	ZNF536	-	smart_Znf_C2H2-like	ENSG00000198597		0.562	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2		0.00	32	0	G	NM_014717		31039530	+1			no_errors	ENST00000355537	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
ZNF611	81856	genome.wustl.edu	37	19	53209056	53209056	+	Silent	SNP	T	T	G			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:53209056T>G	ENST00000319783.1	-	7	1568	c.1252A>C	c.(1252-1254)Aga>Cga	p.R418R	ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000595798.1_Silent_p.R349R|ZNF611_ENST00000540744.1_Silent_p.R418R|ZNF611_ENST00000453741.2_Silent_p.R349R|ZNF611_ENST00000543227.1_Silent_p.R418R|ZNF611_ENST00000602162.1_Silent_p.R349R	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		GTATGAATTCTTCTATGTCGA	0.408																																																	0													101.0	97.0	98.0					19																	53209056		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1252A>C	19.37:g.53209056T>G			B3KRD5|Q69YG9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R418	ENST00000319783.1	37	c.1252	CCDS12855.1	19																																																																																			ZNF611	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213020		0.408	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF611	HGNC	protein_coding	OTTHUMT00000337612.1		0.00	67	0	T	NM_030972		53209056	-1			no_errors	ENST00000319783	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.678	G
ZNF584	201514	genome.wustl.edu	37	19	58927227	58927227	+	Intron	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr19:58927227G>T	ENST00000306910.4	+	3	815				CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000599238.1_Missense_Mutation_p.L75F|ZNF584_ENST00000322834.7_Missense_Mutation_p.A104S|ZNF584_ENST00000593920.1_Intron|ZNF584_ENST00000596921.1_Intron	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		TCTCCTCATTGCCCTTCTCTG	0.498																																																	0													91.0	82.0	85.0					19																	58927227		876	1991	2867	SO:0001627	intron_variant	0			AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.292+214G>T	19.37:g.58927227G>T			A8K203	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.A104S	ENST00000306910.4	37	c.310	CCDS12979.1	19	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624746	0.28889	.	.	ENSG00000171574	ENST00000322834	T	0.01178	5.22	2.28	-1.34	0.09143	.	.	.	.	.	T	0.00608	0.0020	.	.	.	0.09310	N	1	B	0.18013	0.025	B	0.14578	0.011	T	0.46048	-0.9219	8	0.09084	T	0.74	.	3.4874	0.07625	0.0:0.2697:0.3193:0.411	.	104	F6W0P0	.	S	104	ENSP00000320731:A104S	ENSP00000320731:A104S	A	+	1	0	ZNF584	63619039	0.000000	0.05858	0.000000	0.03702	0.364000	0.29643	-0.746000	0.04829	-0.208000	0.10171	0.313000	0.20887	GCC	ZNF584	-	NULL	ENSG00000171574		0.498	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF584	HGNC	protein_coding	OTTHUMT00000467022.1	-	0.00	81	0	G	NM_173548		58927227	+1	tier1	-	no_errors	ENST00000322834	ensembl	human	putative	74_37	missense	8.47	54	5	SNP	0.000	T
ZNF644	84146	genome.wustl.edu	37	1	91406699	91406699	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr1:91406699G>T	ENST00000370440.1	-	3	429	c.212C>A	c.(211-213)aCg>aAg	p.T71K	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.T71K|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CAGAGTCAACGTATTATTTTT	0.388																																																	0													158.0	151.0	153.0					1																	91406699		2203	4300	6503	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.212C>A	1.37:g.91406699G>T	ENSP00000359469:p.Thr71Lys		A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T71K	ENST00000370440.1	37	c.212	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	G	9.393	1.075906	0.20227	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000541557	T;T	0.00609	6.24;6.24	5.91	5.0	0.66597	.	0.277101	0.32287	N	0.006316	T	0.00271	0.0008	N	0.24115	0.695	0.34377	D	0.69271	B	0.28713	0.22	B	0.25987	0.065	T	0.63457	-0.6633	10	0.56958	D	0.05	-0.5362	16.6192	0.84925	0.0:0.0:0.8689:0.1311	.	71	Q9H582	ZN644_HUMAN	K	71	ENSP00000359469:T71K;ENSP00000337008:T71K	ENSP00000337008:T71K	T	-	2	0	ZNF644	91179287	0.592000	0.26832	0.020000	0.16555	0.768000	0.43524	3.183000	0.50918	1.504000	0.48704	-0.152000	0.13540	ACG	ZNF644	-	NULL	ENSG00000122482		0.388	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2		0.00	36	0	G	NM_032186		91406699	-1			no_errors	ENST00000337393	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.964	T
ZNF747	65988	genome.wustl.edu	37	16	30545838	30545838	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA4G-01A-11D-A37C-09	TCGA-VR-AA4G-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	105a18c9-df7e-4573-b1a2-6a987e57d553	d231404d-ece5-43c0-a8a3-e9f294ceb777	g.chr16:30545838G>A	ENST00000252799.3	-	1	830	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W	AC002310.13_ENST00000568114.1_Intron|AC002310.12_ENST00000457283.3_RNA|ZNF747_ENST00000569360.1_Missense_Mutation_p.R55W|ZNF747_ENST00000535210.1_Missense_Mutation_p.R55W|AC002310.12_ENST00000569752.1_RNA|ZNF747_ENST00000395094.3_Missense_Mutation_p.R55W|ZNF747_ENST00000568028.1_Missense_Mutation_p.R55W	NM_023931.2	NP_076420.1	Q9BV97	ZN747_HUMAN	zinc finger protein 747	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			kidney(1)|lung(3)|prostate(1)	5						TGCGCGGGCCGCAGGCAGCCC	0.731																																																	0													14.0	17.0	16.0					16																	30545838		2187	4287	6474	SO:0001583	missense	0			BC001361	CCDS10682.1	16p11.2	2013-01-08			ENSG00000169955	ENSG00000169955		"""Zinc fingers, C2H2-type"", ""-"""	28350	protein-coding gene	gene with protein product						10493829	Standard	NM_023931		Approved	MGC2474	uc002dyn.3	Q9BV97	OTTHUMG00000132401	ENST00000252799.3:c.163C>T	16.37:g.30545838G>A	ENSP00000252799:p.Arg55Trp		A8K827|B7WNU3|Q59FB4|Q96NW0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R55W	ENST00000252799.3	37	c.163	CCDS10682.1	16	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243903	0.58995	.	.	ENSG00000169955	ENST00000535210;ENST00000252799;ENST00000395094	T;T;T	0.01767	4.65;4.65;4.65	2.5	2.5	0.30297	Krueppel-associated box (4);	.	.	.	.	T	0.06554	0.0168	L	0.55481	1.735	0.21325	N	0.999724	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.993	T	0.21895	-1.0232	9	0.72032	D	0.01	.	8.6086	0.33789	0.0:0.0:1.0:0.0	.	55;55	Q9BV97-2;Q9BV97	.;ZN747_HUMAN	W	55	ENSP00000441702:R55W;ENSP00000252799:R55W;ENSP00000378528:R55W	ENSP00000252799:R55W	R	-	1	2	ZNF747	30453339	0.006000	0.16342	0.942000	0.38095	0.525000	0.34531	0.058000	0.14301	1.705000	0.51264	0.484000	0.47621	CGG	ZNF747	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000169955		0.731	ZNF747-001	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	ZNF747	HGNC	protein_coding	OTTHUMT00000255532.2	-	0.00	62	0	G	NM_023931		30545838	-1	tier1	-	no_errors	ENST00000535210	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.579	A
