#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AADAT	51166	genome.wustl.edu	37	4	170983068	170983068	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:170983068G>A	ENST00000337664.4	-	12	1487	c.1211C>T	c.(1210-1212)tCa>tTa	p.S404L	AADAT_ENST00000515480.1_Missense_Mutation_p.S404L|AADAT_ENST00000509167.1_Missense_Mutation_p.S408L|AADAT_ENST00000353187.2_Missense_Mutation_p.S404L	NM_016228.3	NP_057312.1	Q8N5Z0	AADAT_HUMAN	aminoadipate aminotransferase	404					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	mitochondrial matrix (GO:0005759)	2-aminoadipate transaminase activity (GO:0047536)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|pancreas(1)|stomach(1)	11		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)		TGGAGAAGCTGAAGAGAAGGA	0.423																																																	0													131.0	112.0	118.0					4																	170983068		2203	4300	6503	SO:0001583	missense	0			AF097994	CCDS3814.1, CCDS75209.1	4q33	2010-12-09			ENSG00000109576	ENSG00000109576	2.6.1.39		17929	protein-coding gene	gene with protein product	"""kynurenine aminotransferase II"", ""L kynurenine/alpha aminoadipate aminotransferase"""	611754				12126930, 10441733	Standard	NM_182662		Approved	KATII, KAT2	uc003isr.3	Q8N5Z0	OTTHUMG00000160912	ENST00000337664.4:c.1211C>T	4.37:g.170983068G>A	ENSP00000336808:p.Ser404Leu		B3KP84|Q9UL02	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.S408L	ENST00000337664.4	37	c.1223	CCDS3814.1	4	.	.	.	.	.	.	.	.	.	.	G	0.175	-1.067347	0.01934	.	.	ENSG00000109576	ENST00000337664;ENST00000515480;ENST00000509167;ENST00000353187	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	5.63	-4.32	0.03688	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.647515	0.14925	N	0.290404	T	0.67590	0.2909	N	0.01809	-0.71	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.63708	-0.6576	10	0.10111	T	0.7	1.4911	6.7889	0.23689	0.5798:0.0:0.3164:0.1038	.	408;404	Q8N5Z0-2;Q8N5Z0	.;AADAT_HUMAN	L	404;404;408;404	ENSP00000336808:S404L;ENSP00000423341:S404L;ENSP00000423190:S408L;ENSP00000226840:S404L	ENSP00000336808:S404L	S	-	2	0	AADAT	171219643	0.000000	0.05858	0.000000	0.03702	0.356000	0.29392	0.939000	0.28978	-0.832000	0.04251	-0.156000	0.13503	TCA	AADAT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000109576		0.423	AADAT-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	AADAT	HGNC	protein_coding	OTTHUMT00000362952.1	-	0.00	32	0	G	NM_016228		170983068	-1	tier1	-	no_errors	ENST00000509167	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.000	A
ABHD3	171586	genome.wustl.edu	37	18	19284501	19284501	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:19284501G>A	ENST00000289119.2	-	1	265	c.126C>T	c.(124-126)gtC>gtT	p.V42V	ABHD3_ENST00000579875.1_5'UTR|ABHD3_ENST00000578270.1_5'Flank|ABHD3_ENST00000580981.1_Silent_p.V42V	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	42						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						AGGCATAAGCGACGCTGAAGC	0.657																																																	0													40.0	36.0	37.0					18																	19284501		2181	4285	6466	SO:0001819	synonymous_variant	0			AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.126C>T	18.37:g.19284501G>A			B0YIV0|B7Z5C2|O43411	Silent	SNP	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	p.V42	ENST00000289119.2	37	c.126	CCDS32802.1	18																																																																																			ABHD3	-	pirsf_AB-Hydro_YheT	ENSG00000158201		0.657	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD3	HGNC	protein_coding	OTTHUMT00000444757.1	-	0.00	119	0	G			19284501	-1	tier1	-	no_errors	ENST00000289119	ensembl	human	known	74_37	silent	12.71	103	15	SNP	0.973	A
ACCS	84680	genome.wustl.edu	37	11	44089204	44089204	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:44089204C>T	ENST00000263776.8	+	2	461	c.27C>T	c.(25-27)ttC>ttT	p.F9F	ACCS_ENST00000432284.2_Silent_p.F9F|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	9					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						AAAAGGACTTCAGGGCTCCCA	0.537																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													79.0	81.0	80.0					11																	44089204		2203	4300	6503	SO:0001819	synonymous_variant	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.27C>T	11.37:g.44089204C>T			B4E219|Q8WUL4|Q96LX5	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.F9	ENST00000263776.8	37	c.27	CCDS7907.1	11																																																																																			ACCS	-	NULL	ENSG00000110455		0.537	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	-	0.00	74	0	C	NM_032592		44089204	+1	tier1	-	no_errors	ENST00000263776	ensembl	human	known	74_37	silent	25.49	38	13	SNP	0.006	T
ACE2	59272	genome.wustl.edu	37	X	15618926	15618926	+	Missense_Mutation	SNP	C	C	T	rs146676783	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:15618926C>T	ENST00000252519.3	-	1	211	c.109G>A	c.(109-111)Gaa>Aaa	p.E37K	ACE2_ENST00000427411.1_Missense_Mutation_p.E37K|GS1-594A7.3_ENST00000421585.1_RNA			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	37	Interaction with SARS-CoV spike glycoprotein.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	AACAGGTCTTCGGCTTCGTGG	0.438																																																	0								C	LYS/GLU	3,3832		0,3,1629,571	171.0	145.0	154.0		109	5.8	0.9	X	dbSNP_134	154	0,6728		0,0,2428,1872	no	missense	ACE2	NM_021804.2	56	0,3,4057,2443	TT,TC,CC,C		0.0,0.0782,0.0284	benign	37/806	15618926	3,10560	2203	4300	6503	SO:0001583	missense	0			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.109G>A	X.37:g.15618926C>T	ENSP00000252519:p.Glu37Lys		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.E37K	ENST00000252519.3	37	c.109	CCDS14169.1	X	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104764	0.37145	7.82E-4	0.0	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.35605	1.3;1.3	5.81	5.81	0.92471	.	0.245514	0.42682	D	0.000679	T	0.53932	0.1827	M	0.74258	2.255	0.41481	D	0.988165	P	0.40302	0.712	P	0.48738	0.588	T	0.54669	-0.8259	10	0.51188	T	0.08	-25.256	19.0311	0.92957	0.0:1.0:0.0:0.0	.	37	Q9BYF1	ACE2_HUMAN	K	37	ENSP00000252519:E37K;ENSP00000389326:E37K	ENSP00000252519:E37K	E	-	1	0	ACE2	15528847	0.999000	0.42202	0.913000	0.36048	0.023000	0.10783	3.664000	0.54525	2.443000	0.82685	0.594000	0.82650	GAA	ACE2	-	pfam_Peptidase_M2	ENSG00000130234		0.438	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE2	HGNC	protein_coding	OTTHUMT00000055867.1	-	0.00	90	0	C			15618926	-1	tier1	rs146676783	no_errors	ENST00000252519	ensembl	human	known	74_37	missense	18.38	111	25	SNP	1.000	T
ACPT	93650	genome.wustl.edu	37	19	51294951	51294951	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:51294951G>A	ENST00000270593.1	+	4	342	c.342G>A	c.(340-342)gaG>gaA	p.E114E	ACPT_ENST00000270594.3_Intron|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	114						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GCACGCTGGAGAGTGCCCAGG	0.701																																																	0													59.0	65.0	63.0					19																	51294951		2203	4300	6503	SO:0001819	synonymous_variant	0			AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.342G>A	19.37:g.51294951G>A			C0H3P7|Q9BZG3|Q9BZG4	Silent	SNP	pfam_His_Pase_superF_clade-2	p.E114	ENST00000270593.1	37	c.342	CCDS12802.1	19																																																																																			ACPT	-	pfam_His_Pase_superF_clade-2	ENSG00000142513		0.701	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ACPT	HGNC	protein_coding	OTTHUMT00000464434.1	-	0.00	67	0	G	NM_033068		51294951	+1	tier1	-	no_errors	ENST00000270593	ensembl	human	novel	74_37	silent	15.69	43	8	SNP	1.000	A
ACTA2	59	genome.wustl.edu	37	10	90699272	90699272	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:90699272G>T	ENST00000458208.1	-	7	1274	c.800C>A	c.(799-801)tCc>tAc	p.S267Y	ACTA2_ENST00000224784.6_Missense_Mutation_p.S267Y|STAMBPL1_ENST00000371927.3_Intron|ACTA2-AS1_ENST00000437930.4_RNA|ACTA2-AS1_ENST00000596007.1_RNA|ACTA2_ENST00000480297.1_5'Flank	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	267					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		ACCGATGAAGGATGGCTGGAA	0.522																																																	0													120.0	112.0	115.0					10																	90699272		2203	4300	6503	SO:0001583	missense	0			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.800C>A	10.37:g.90699272G>T	ENSP00000402373:p.Ser267Tyr		B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.S267Y	ENST00000458208.1	37	c.800	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	G	19.22	3.786079	0.70337	.	.	ENSG00000107796	ENST00000224784;ENST00000458208;ENST00000544901	D;D	0.97976	-4.64;-4.64	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.99061	0.9678	M	0.93016	3.37	0.80722	D	1	P	0.45126	0.851	D	0.64237	0.923	D	0.99056	1.0829	10	0.87932	D	0	.	19.2285	0.93827	0.0:0.0:1.0:0.0	.	267	P62736	ACTA_HUMAN	Y	267;267;222	ENSP00000224784:S267Y;ENSP00000402373:S267Y	ENSP00000224784:S267Y	S	-	2	0	ACTA2	90689252	1.000000	0.71417	0.981000	0.43875	0.893000	0.52053	9.869000	0.99810	2.890000	0.99128	0.655000	0.94253	TCC	ACTA2	-	pfam_Actin-related,smart_Actin-related	ENSG00000107796		0.522	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1		0.00	33	0	G	NM_001613		90699272	-1			no_errors	ENST00000224784	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
ADNP2	22850	genome.wustl.edu	37	18	77893549	77893549	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:77893549C>T	ENST00000262198.4	+	4	708	c.253C>T	c.(253-255)Ctt>Ttt	p.L85F		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	85					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TACAAAGGTGCTTACTTCATT	0.378																																																	0													90.0	79.0	83.0					18																	77893549		2203	4300	6503	SO:0001583	missense	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.253C>T	18.37:g.77893549C>T	ENSP00000262198:p.Leu85Phe		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.L85F	ENST00000262198.4	37	c.253	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	C	9.549	1.115341	0.20795	.	.	ENSG00000101544	ENST00000262198	T	0.73681	-0.77	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);	0.100994	0.43110	D	0.000612	T	0.78342	0.4268	N	0.17474	0.49	0.38175	D	0.939456	D	0.89917	1.0	D	0.76575	0.988	T	0.76724	-0.2854	9	.	.	.	-16.9551	20.8794	0.99867	0.0:1.0:0.0:0.0	.	85	Q6IQ32	ADNP2_HUMAN	F	85	ENSP00000262198:L85F	.	L	+	1	0	ADNP2	75994540	1.000000	0.71417	0.997000	0.53966	0.840000	0.47671	1.955000	0.40372	2.941000	0.99782	0.655000	0.94253	CTT	ADNP2	-	smart_Znf_C2H2-like	ENSG00000101544		0.378	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1		0.00	91	0	C	NM_014913		77893549	+1			no_errors	ENST00000262198	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.999	T
AFG3L1P	172	genome.wustl.edu	37	16	90057396	90057396	+	RNA	SNP	C	C	T	rs377595175		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:90057396C>T	ENST00000437774.1	+	0	954					NR_003226.1				AFG3-like AAA ATPase 1, pseudogene																		TGTTTATTGGCGTTGGGCCAG	0.572																																																	0										1,1383		0,1,691	157.0	150.0	152.0			-8.9	0.0	16		152	0,3182		0,0,1591	no	intergenic				0,1,2282	TT,TC,CC		0.0,0.0723,0.0219			90057396	1,4565	692	1591	2283			0			AJ001495		16q24.3	2013-10-17	2013-10-17	2010-10-28	ENSG00000223959	ENSG00000223959		"""ATPases / AAA-type"""	314	pseudogene	pseudogene		603020	"""AFG3 ATPase family gene 3-like 1 (S. cerevisiae), pseudogene"", ""AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene"""	AFG3, AFG3L1		9545647, 11549317	Standard	NR_003228		Approved		uc002fpz.1		OTTHUMG00000138987		16.37:g.90057396C>T				RNA	SNP	-	NULL	ENST00000437774.1	37	NULL		16																																																																																			AFG3L1P	-	-	ENSG00000223959		0.572	AFG3L1P-004	KNOWN	basic	processed_transcript	AFG3L1P	HGNC	pseudogene	OTTHUMT00000316791.1	-	0.00	23	0	C	NR_003226		90057396	+1	tier1	-	no_errors	ENST00000388970	ensembl	human	known	74_37	rna	38.89	11	7	SNP	0.146	T
AKAP5	9495	genome.wustl.edu	37	14	64935503	64935503	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:64935503A>G	ENST00000394718.4	+	2	769	c.391A>G	c.(391-393)Aaa>Gaa	p.K131E	ZBTB25_ENST00000555424.1_Intron|AKAP5_ENST00000320636.5_Missense_Mutation_p.K131E|ZBTB25_ENST00000555220.1_Intron	NM_004857.3	NP_004848.3	P24588	AKAP5_HUMAN	A kinase (PRKA) anchor protein 5	131	Essential to the intracellular anchoring function. {ECO:0000250}.				energy reserve metabolic process (GO:0006112)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|stomach(1)	13				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		TCCCTGCATAAAATTCCCAAG	0.388																																																	0													102.0	115.0	110.0					14																	64935503		2203	4300	6503	SO:0001583	missense	0			M90359	CCDS9764.1	14q23.3	2012-05-16			ENSG00000179841	ENSG00000179841		"""A-kinase anchor proteins"""	375	protein-coding gene	gene with protein product		604688				1512224, 1618839	Standard	NM_004857		Approved	AKAP75, AKAP79	uc001xhd.4	P24588	OTTHUMG00000029634	ENST00000394718.4:c.391A>G	14.37:g.64935503A>G	ENSP00000378207:p.Lys131Glu		A2RRB8	Missense_Mutation	SNP	pfam_Pkinase-A_anch_WSK-motif	p.K131E	ENST00000394718.4	37	c.391	CCDS9764.1	14	.	.	.	.	.	.	.	.	.	.	A	16.22	3.060430	0.55432	.	.	ENSG00000179841	ENST00000394718;ENST00000320636	T;T	0.30182	1.54;1.54	5.86	2.14	0.27477	.	0.514323	0.18203	N	0.148446	T	0.17831	0.0428	N	0.24115	0.695	0.09310	N	1	B	0.32918	0.39	B	0.27380	0.079	T	0.11665	-1.0578	10	0.72032	D	0.01	.	7.9671	0.30104	0.5335:0.3959:0.0706:0.0	.	131	P24588	AKAP5_HUMAN	E	131	ENSP00000378207:K131E;ENSP00000315615:K131E	ENSP00000315615:K131E	K	+	1	0	AKAP5	64005256	0.971000	0.33674	0.526000	0.27913	0.800000	0.45204	1.484000	0.35508	0.113000	0.18004	-0.313000	0.08912	AAA	AKAP5	-	NULL	ENSG00000179841		0.388	AKAP5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKAP5	HGNC	protein_coding	OTTHUMT00000268070.3	-	0.00	82	0	A			64935503	+1	tier1	-	no_errors	ENST00000320636	ensembl	human	known	74_37	missense	14.46	71	12	SNP	0.139	G
AMER1	139285	genome.wustl.edu	37	X	63413072	63413072	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:63413072T>C	ENST00000330258.3	-	2	367	c.95A>G	c.(94-96)aAg>aGg	p.K32R	AMER1_ENST00000374869.3_Missense_Mutation_p.K32R|AMER1_ENST00000403336.1_Missense_Mutation_p.K32R	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	32					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTCAGCTGCCTTGTTCTTGGC	0.537																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											240.0	189.0	206.0					X																	63413072		2203	4300	6503	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.95A>G	X.37:g.63413072T>C	ENSP00000329117:p.Lys32Arg		A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.K32R	ENST00000330258.3	37	c.95	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144650	0.37825	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.47177	0.86;0.85;0.86	4.59	4.59	0.56863	.	0.209136	0.34046	N	0.004316	T	0.31857	0.0810	L	0.29908	0.895	0.09310	N	1	P	0.40970	0.734	B	0.40329	0.326	T	0.12293	-1.0553	10	0.14252	T	0.57	-15.9768	7.6662	0.28432	0.0:0.1004:0.0:0.8996	.	32	Q5JTC6	F123B_HUMAN	R	32	ENSP00000364003:K32R;ENSP00000329117:K32R;ENSP00000384722:K32R	ENSP00000329117:K32R	K	-	2	0	FAM123B	63329797	0.882000	0.30256	0.888000	0.34837	0.296000	0.27459	2.838000	0.48199	2.018000	0.59344	0.486000	0.48141	AAG	AMER1	-	NULL	ENSG00000184675		0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	HGNC	protein_coding	OTTHUMT00000316584.1	-	0.00	58	0	T	NM_152424		63413072	-1	tier1	-	no_errors	ENST00000330258	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.137	C
ANGPT4	51378	genome.wustl.edu	37	20	858914	858914	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:858914G>A	ENST00000381922.3	-	7	1212	c.1110C>T	c.(1108-1110)ctC>ctT	p.L370L	ANGPT4_ENST00000546022.1_Silent_p.L370L	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	370	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CCCTTCTGGTGAGCTGGTGCA	0.612																																					Pancreas(181;481 2077 3259 31286 49856)												0													53.0	45.0	47.0					20																	858914		2203	4300	6503	SO:0001819	synonymous_variant	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1110C>T	20.37:g.858914G>A			B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.L370	ENST00000381922.3	37	c.1110	CCDS13009.1	20																																																																																			ANGPT4	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000101280		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	-	0.00	21	0	G	NM_015985		858914	-1	tier1	-	no_errors	ENST00000381922	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.998	A
ANKRD11	29123	genome.wustl.edu	37	16	89349603	89349603	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:89349603G>A	ENST00000301030.4	-	9	3807	c.3347C>T	c.(3346-3348)gCa>gTa	p.A1116V	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A1116V	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1116	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GAAGATGTCTGCGATGTACCA	0.517																																																	0													181.0	163.0	169.0					16																	89349603		2198	4300	6498	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3347C>T	16.37:g.89349603G>A	ENSP00000301030:p.Ala1116Val		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1116V	ENST00000301030.4	37	c.3347	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	16.92	3.256297	0.59321	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.51071	0.72;0.72	5.32	5.32	0.75619	.	0.066900	0.64402	D	0.000015	T	0.48095	0.1481	M	0.72894	2.215	0.80722	D	1	P	0.42456	0.78	B	0.38106	0.265	T	0.56583	-0.7955	10	0.72032	D	0.01	.	13.6513	0.62312	0.0746:0.0:0.9254:0.0	.	1116	Q6UB99	ANR11_HUMAN	V	1116	ENSP00000301030:A1116V;ENSP00000367581:A1116V	ENSP00000301030:A1116V	A	-	2	0	ANKRD11	87877104	1.000000	0.71417	0.117000	0.21633	0.052000	0.14988	5.416000	0.66417	2.641000	0.89580	0.655000	0.94253	GCA	ANKRD11	-	NULL	ENSG00000167522		0.517	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	-	0.00	39	0	G	NM_013275		89349603	-1	tier1	-	no_errors	ENST00000301030	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.892	A
ANXA4	307	genome.wustl.edu	37	2	70035228	70035228	+	Intron	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:70035228G>A	ENST00000394295.4	+	6	645				ANXA4_ENST00000536030.1_Intron|ANXA4_ENST00000409920.1_Intron	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4						epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						TTCACAGAACGCTGAGCATGA	0.522																																																	0																																										SO:0001627	intron_variant	0			M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.397+100G>A	2.37:g.70035228G>A			B4DDF9|Q96F33|Q9BWK1	RNA	SNP	-	NULL	ENST00000394295.4	37	NULL	CCDS1894.1	2																																																																																			ANXA4	-	-	ENSG00000196975		0.522	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA4	HGNC	protein_coding	OTTHUMT00000251848.2	-	0.00	17	0	G	NM_001153		70035228	+1	tier1	-	no_errors	ENST00000468815	ensembl	human	putative	74_37	rna	62.50	6	10	SNP	0.000	A
APLP1	333	genome.wustl.edu	37	19	36370269	36370269	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:36370269G>A	ENST00000221891.4	+	17	2074	c.1882G>A	c.(1882-1884)Gag>Aag	p.E628K	APLP1_ENST00000537454.2_Missense_Mutation_p.E588K|APLP1_ENST00000586861.1_Missense_Mutation_p.E621K|RN7SL402P_ENST00000465059.1_RNA	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	627					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GACCCTGGAGGAGCAGCAGCT	0.672																																																	0													77.0	77.0	77.0					19																	36370269		2203	4300	6503	SO:0001583	missense	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1882G>A	19.37:g.36370269G>A	ENSP00000221891:p.Glu628Lys		O00113|Q96A92	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.E628K	ENST00000221891.4	37	c.1882	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.659819	0.96734	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.96830	-4.14;-4.14	5.89	5.89	0.94794	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.49305	D	0.000156	D	0.97645	0.9228	M	0.69463	2.115	0.80722	D	1	D;D;D;D	0.76494	0.999;0.992;0.998;0.998	D;D;D;D	0.83275	0.996;0.92;0.969;0.953	D	0.97591	1.0117	10	0.54805	T	0.06	-24.0987	15.7619	0.78091	0.0:0.0:1.0:0.0	.	621;588;628;627	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	K	588;628	ENSP00000441501:E588K;ENSP00000221891:E628K	ENSP00000221891:E628K	E	+	1	0	APLP1	41062109	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.917000	0.87498	2.793000	0.96121	0.655000	0.94253	GAG	APLP1	-	pfam_APP_amyloid_C,prints_Amyloid_glyco	ENSG00000105290		0.672	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1	-	0.00	80	0	G	NM_001024807		36370269	+1	tier1	-	no_errors	ENST00000221891	ensembl	human	known	74_37	missense	18.52	66	15	SNP	1.000	A
ARMCX6	54470	genome.wustl.edu	37	X	100871258	100871258	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:100871258C>T	ENST00000361910.4	-	3	697	c.353G>A	c.(352-354)tGt>tAt	p.C118Y	ARMCX6_ENST00000497931.1_Intron|ARMCX6_ENST00000538627.1_Missense_Mutation_p.C118Y|ARMCX6_ENST00000539247.1_Missense_Mutation_p.C118Y	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	118						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						GCCATTTTTACAATTTTGAGC	0.493																																																	0													99.0	100.0	100.0					X																	100871258		2203	4300	6503	SO:0001583	missense	0			BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.353G>A	X.37:g.100871258C>T	ENSP00000354708:p.Cys118Tyr		Q9NWJ3	Missense_Mutation	SNP	pfam_ARM-rpt_dom	p.C118Y	ENST00000361910.4	37	c.353	CCDS14488.1	X	.	.	.	.	.	.	.	.	.	.	.	0.422	-0.907678	0.02434	.	.	ENSG00000198960	ENST00000361910;ENST00000539247;ENST00000538627	T;T;T	0.28255	1.62;1.62;1.62	3.73	-4.09	0.03951	.	1.337810	0.04906	N	0.452211	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.30179	-0.9987	10	0.72032	D	0.01	9.2133	4.6555	0.12615	0.4386:0.2874:0.0:0.2741	.	118	Q7L4S7	ARMX6_HUMAN	Y	118	ENSP00000354708:C118Y;ENSP00000444537:C118Y;ENSP00000440648:C118Y	ENSP00000354708:C118Y	C	-	2	0	ARMCX6	100757914	0.786000	0.28738	0.000000	0.03702	0.031000	0.12232	0.065000	0.14466	-0.955000	0.03636	-1.799000	0.00621	TGT	ARMCX6	-	pfam_ARM-rpt_dom	ENSG00000198960		0.493	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX6	HGNC	protein_coding	OTTHUMT00000057562.1	-	0.00	161	0	C	NM_019007		100871258	-1	tier1	-	no_errors	ENST00000361910	ensembl	human	known	74_37	missense	19.15	76	18	SNP	0.000	T
ARHGAP36	158763	genome.wustl.edu	37	X	130217775	130217775	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:130217775G>A	ENST00000276211.5	+	4	732	c.387G>A	c.(385-387)aaG>aaA	p.K129K	ARHGAP36_ENST00000370922.1_Silent_p.K117K|ARHGAP36_ENST00000370921.1_5'UTR	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	129					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CCCGCCGCAAGCATCTTGAAC	0.567																																																	0													134.0	132.0	133.0					X																	130217775		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.387G>A	X.37:g.130217775G>A			B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K129	ENST00000276211.5	37	c.387	CCDS14628.1	X																																																																																			ARHGAP36	-	NULL	ENSG00000147256		0.567	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	-	0.00	120	0	G	NM_144967		130217775	+1	tier1	-	no_errors	ENST00000276211	ensembl	human	known	74_37	silent	36.59	26	15	SNP	0.846	A
ASB7	140460	genome.wustl.edu	37	15	101170231	101170231	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:101170231C>T	ENST00000332783.7	+	5	1586	c.801C>T	c.(799-801)ttC>ttT	p.F267F	ASB7_ENST00000558747.1_Intron|ASB7_ENST00000343276.4_Silent_p.F267F	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	267	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			GTTTGGATTTCTTACAAGAAG	0.338																																																	0													34.0	36.0	35.0					15																	101170231		2203	4298	6501	SO:0001819	synonymous_variant	0				CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.801C>T	15.37:g.101170231C>T			A8K1E5|Q6GSJ6|Q7Z4S3	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.F267	ENST00000332783.7	37	c.801	CCDS10387.1	15																																																																																			ASB7	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000183475		0.338	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB7	HGNC	protein_coding	OTTHUMT00000313617.1	-	0.00	123	0	C	NM_024708		101170231	+1	tier1	-	no_errors	ENST00000332783	ensembl	human	known	74_37	silent	21.32	107	29	SNP	1.000	T
ATAD2	29028	genome.wustl.edu	37	8	124368675	124368675	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:124368675C>G	ENST00000287394.5	-	13	1707	c.1600G>C	c.(1600-1602)Gat>Cat	p.D534H	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	534					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GCCAGACCATCAATTTCGTCA	0.423																																																	0													95.0	79.0	85.0					8																	124368675		2203	4300	6503	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1600G>C	8.37:g.124368675C>G	ENSP00000287394:p.Asp534His		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D534H	ENST00000287394.5	37	c.1600	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045470	0.93685	.	.	ENSG00000156802	ENST00000287394	D	0.95588	-3.75	5.14	5.14	0.70334	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.210240	0.49916	D	0.000139	D	0.97589	0.9210	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.992	D	0.98249	1.0492	10	0.87932	D	0	-12.021	18.9523	0.92645	0.0:1.0:0.0:0.0	.	364;534	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	H	534	ENSP00000287394:D534H	ENSP00000287394:D534H	D	-	1	0	ATAD2	124437856	1.000000	0.71417	0.973000	0.42090	0.980000	0.70556	7.776000	0.85560	2.549000	0.85964	0.467000	0.42956	GAT	ATAD2	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000156802		0.423	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	0.00	58	0	C	NM_014109		124368675	-1	tier1	-	no_errors	ENST00000287394	ensembl	human	known	74_37	missense	11.32	94	12	SNP	1.000	G
ATG5	9474	genome.wustl.edu	37	6	106756264	106756264	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:106756264C>G	ENST00000369076.3	-	3	534	c.211G>C	c.(211-213)Gaa>Caa	p.E71Q	ATG5_ENST00000343245.3_Missense_Mutation_p.E71Q|ATG5_ENST00000360666.4_Intron|ATG5_ENST00000369070.1_Intron	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	71					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CCTTCATATTCAAACCATATC	0.343																																																	0													164.0	147.0	152.0					6																	106756264		2203	4300	6503	SO:0001583	missense	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.211G>C	6.37:g.106756264C>G	ENSP00000358072:p.Glu71Gln		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Atg5	p.E71Q	ENST00000369076.3	37	c.211	CCDS5055.1	6	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358960	0.82353	.	.	ENSG00000057663	ENST00000369076;ENST00000343245	.	.	.	5.98	5.98	0.97165	.	0.045026	0.85682	D	0.000000	T	0.63768	0.2539	M	0.74467	2.265	0.80722	D	1	P;P	0.38148	0.62;0.62	B;B	0.43155	0.41;0.41	T	0.64740	-0.6336	9	0.46703	T	0.11	0.5513	20.4581	0.99154	0.0:1.0:0.0:0.0	.	71;71	A9UGY9;Q9H1Y0	.;ATG5_HUMAN	Q	71	.	ENSP00000343313:E71Q	E	-	1	0	ATG5	106862957	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.835000	0.97688	0.650000	0.86243	GAA	ATG5	-	NULL	ENSG00000057663		0.343	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	-	0.00	75	0	C	NM_004849		106756264	-1	tier1	-	no_errors	ENST00000343245	ensembl	human	known	74_37	missense	14.08	61	10	SNP	1.000	G
ATP1A1	476	genome.wustl.edu	37	1	116926723	116926723	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:116926723G>T	ENST00000295598.5	+	2	352	c.100G>T	c.(100-102)Gaa>Taa	p.E34*	AL136376.1_ENST00000598661.1_5'Flank|ATP1A1_ENST00000369496.4_Nonsense_Mutation_p.E3*|ATP1A1_ENST00000537345.1_Nonsense_Mutation_p.E34*	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	34					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GGACATGGATGAACTGAAGAA	0.393																																																	0													72.0	71.0	72.0					1																	116926723		2203	4300	6503	SO:0001587	stop_gained	0			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.100G>T	1.37:g.116926723G>T	ENSP00000295598:p.Glu34*		B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.E34*	ENST00000295598.5	37	c.100	CCDS887.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.432222	0.98808	.	.	ENSG00000163399	ENST00000418797;ENST00000295598;ENST00000537345;ENST00000369494;ENST00000339159;ENST00000369496	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.441	0.94821	0.0:0.0:1.0:0.0	.	.	.	.	X	3;34;34;3;33;3	.	ENSP00000295598:E34X	E	+	1	0	ATP1A1	116728246	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.612000	0.98347	2.831000	0.97527	0.655000	0.94253	GAA	ATP1A1	-	tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000163399		0.393	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1A1	HGNC	protein_coding	OTTHUMT00000033481.5		0.00	71	0	G	NM_001160233		116926723	+1			no_errors	ENST00000295598	ensembl	human	known	74_37	nonsense	5.00	76	4	SNP	1.000	T
ATXN2L	11273	genome.wustl.edu	37	16	28845927	28845927	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:28845927G>T	ENST00000336783.4	+	18	2513	c.2346G>T	c.(2344-2346)acG>acT	p.T782T	ATXN2L_ENST00000382686.4_Silent_p.T782T|ATXN2L_ENST00000570200.1_Silent_p.T782T|ATXN2L_ENST00000564304.1_Silent_p.T788T|ATXN2L_ENST00000565845.1_3'UTR|ATXN2L_ENST00000325215.6_Silent_p.T782T|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000395547.2_Silent_p.T782T|ATXN2L_ENST00000340394.8_Silent_p.T782T	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	782					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						TGGCTGCCACGCCCTATTCTT	0.682																																																	0													61.0	72.0	68.0					16																	28845927		2196	4298	6494	SO:0001819	synonymous_variant	0				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.2346G>T	16.37:g.28845927G>T			A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Silent	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.T782	ENST00000336783.4	37	c.2346	CCDS10641.1	16																																																																																			ATXN2L	-	NULL	ENSG00000168488		0.682	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	HGNC	protein_coding	OTTHUMT00000214139.1		0.00	47	0	G	NM_007245		28845927	+1			no_errors	ENST00000395547	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.674	T
BDNF	627	genome.wustl.edu	37	11	27679606	27679606	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:27679606delT	ENST00000525528.1	-	1	1599	c.506delA	c.(505-507)aagfs	p.K169fs	BDNF_ENST00000395986.2_Frame_Shift_Del_p.K184fs|BDNF_ENST00000530861.1_Frame_Shift_Del_p.K169fs|BDNF_ENST00000395978.3_Frame_Shift_Del_p.K169fs|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000438929.1_Frame_Shift_Del_p.K251fs|BDNF_ENST00000418212.1_Frame_Shift_Del_p.K169fs|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000532997.1_Frame_Shift_Del_p.K169fs|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000439476.2_Frame_Shift_Del_p.K169fs|BDNF_ENST00000395983.3_Frame_Shift_Del_p.K169fs|BDNF_ENST00000395981.3_Frame_Shift_Del_p.K169fs|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000533131.1_Frame_Shift_Del_p.K169fs|BDNF_ENST00000533246.1_Frame_Shift_Del_p.K169fs|BDNF_ENST00000395980.2_Frame_Shift_Del_p.K169fs|BDNF_ENST00000314915.6_Frame_Shift_Del_p.K177fs|BDNF_ENST00000356660.4_Frame_Shift_Del_p.K169fs|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000525950.1_Frame_Shift_Del_p.K169fs|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000420794.1_Frame_Shift_Del_p.K169fs	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	169					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TACAGGGACCTTTTCAAGGAC	0.512																																																	0													203.0	199.0	200.0					11																	27679606		2202	4299	6501	SO:0001589	frameshift_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.506delA	11.37:g.27679606delT	ENSP00000437138:p.Lys169fs		A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Frame_Shift_Del	DEL	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Brain-der_neurotrophic_factor,prints_Nerve_growth_factor-rel	p.K251fs	ENST00000525528.1	37	c.752	CCDS7866.1	11																																																																																			BDNF	-	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Brain-der_neurotrophic_factor	ENSG00000176697		0.512	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1		0.00	39	0	T	NM_170735		27679606	-1	tier1		no_errors	ENST00000438929	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
BEND4	389206	genome.wustl.edu	37	4	42145544	42145544	+	Missense_Mutation	SNP	C	C	T	rs552724030		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:42145544C>T	ENST00000502486.1	-	3	1534	c.955G>A	c.(955-957)Gag>Aag	p.E319K	BEND4_ENST00000504360.1_Missense_Mutation_p.E315K	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	319										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						TAGCCTtcctcgtcctcctcc	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		17916	0.0		0.0	False		,,,				2504	0.001																0													52.0	48.0	50.0					4																	42145544		2008	4144	6152	SO:0001583	missense	0			AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.955G>A	4.37:g.42145544C>T	ENSP00000421169:p.Glu319Lys		A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	pfam_BEN_domain	p.E319K	ENST00000502486.1	37	c.955	CCDS47048.1	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072821	0.76415	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.59	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.64238	0.2580	N	0.24115	0.695	0.52501	D	0.999959	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.986;0.994	T	0.69518	-0.5124	9	0.87932	D	0	-14.7625	15.4	0.74830	0.1403:0.8597:0.0:0.0	.	241;319;319	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	K	190;319;315	.	ENSP00000412495:E190K	E	-	1	0	BEND4	41840301	1.000000	0.71417	0.992000	0.48379	0.517000	0.34286	7.487000	0.81328	1.333000	0.45449	0.563000	0.77884	GAG	BEND4	-	NULL	ENSG00000188848		0.517	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND4	HGNC	protein_coding	OTTHUMT00000360975.2	-	0.00	42	0	C	NM_207406		42145544	-1	tier1	-	no_errors	ENST00000502486	ensembl	human	known	74_37	missense	30.77	17	8	SNP	1.000	T
BMS1P17	101101776	genome.wustl.edu	37	14	19904313	19904313	+	lincRNA	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:19904313C>G	ENST00000552602.1	-	0	202				BMS1P18_ENST00000549877.1_lincRNA																							TTCTATAACCCAGTAACATCT	0.443																																																	0																																												0																															14.37:g.19904313C>G				RNA	SNP	-	NULL	ENST00000552602.1	37	NULL		14																																																																																			BMS1P18	-	-	ENSG00000215394		0.443	CTD-2314B22.3-003	KNOWN	basic	lincRNA	BMS1P18	HGNC	lincRNA	OTTHUMT00000409412.1	-	0.00	109	0	C			19904313	+1	tier1	-	no_errors	ENST00000549877	ensembl	human	known	74_37	rna	13.13	86	13	SNP	1.000	G
BPIFB1	92747	genome.wustl.edu	37	20	31886920	31886920	+	Intron	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:31886920G>C	ENST00000253354.1	+	8	822				BPIFB1_ENST00000464032.1_3'UTR	NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1						innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										attttaagacgaggaaacaga	0.532																																																	0																																										SO:0001627	intron_variant	0			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.662-785G>C	20.37:g.31886920G>C			A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	RNA	SNP	-	NULL	ENST00000253354.1	37	NULL	CCDS13218.1	20	.	.	.	.	.	.	.	.	.	.	G	9.909	1.209093	0.22205	.	.	ENSG00000125999	ENST00000375378	.	.	.	2.22	0.234	0.15390	.	.	.	.	.	T	0.37461	0.1004	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.37957	-0.9683	5	0.87932	D	0	.	4.3903	0.11337	0.3468:0.0:0.6532:0.0	.	.	.	.	P	14	.	ENSP00000364527:R14P	R	+	2	0	BPIFB1	31350581	0.000000	0.05858	0.008000	0.14137	0.533000	0.34776	-0.144000	0.10280	0.077000	0.16863	-0.234000	0.12200	CGA	BPIFB1	-	-	ENSG00000125999		0.532	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB1	HGNC	protein_coding	OTTHUMT00000106499.2	-	0.00	60	0	G	NM_033197		31886920	+1	tier1	-	no_errors	ENST00000464032	ensembl	human	known	74_37	rna	33.33	38	19	SNP	0.016	C
BRINP1	1620	genome.wustl.edu	37	9	122011301	122011301	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:122011301G>T	ENST00000265922.3	-	3	807	c.346C>A	c.(346-348)Cag>Aag	p.Q116K	BRINP1_ENST00000373964.2_Missense_Mutation_p.Q116K	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	116	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TCGATGAACTGCTGAGTGGTA	0.567																																																	0													143.0	106.0	118.0					9																	122011301		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.346C>A	9.37:g.122011301G>T	ENSP00000265922:p.Gln116Lys		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.Q116K	ENST00000265922.3	37	c.346	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171689	0.78452	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	D;D	0.83914	-1.78;-1.78	5.66	5.66	0.87406	Membrane attack complex component/perforin (MACPF) domain (2);	0.051014	0.85682	D	0.000000	T	0.79358	0.4432	L	0.38838	1.175	0.80722	D	1	P;B	0.35612	0.512;0.414	B;B	0.35353	0.201;0.162	T	0.79115	-0.1936	10	0.54805	T	0.06	-16.7376	20.1076	0.97898	0.0:0.0:1.0:0.0	.	116;116	O60477-2;O60477	.;DBC1_HUMAN	K	116	ENSP00000265922:Q116K;ENSP00000363075:Q116K	ENSP00000265922:Q116K	Q	-	1	0	DBC1	121051122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.589000	0.67523	2.823000	0.97156	0.650000	0.86243	CAG	BRINP1	-	pfam_MACPF,smart_MACPF	ENSG00000078725		0.567	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2		0.00	67	0	G	NM_014618		122011301	-1			no_errors	ENST00000265922	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
NOL4L	140688	genome.wustl.edu	37	20	31041537	31041537	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:31041537C>T	ENST00000359676.5	-	4	557	c.415G>A	c.(415-417)Gat>Aat	p.D139N	RP5-1184F4.5_ENST00000442179.1_RNA|C20orf112_ENST00000475781.1_5'UTR	NM_001256798.1|NM_080616.4	NP_001243727.1|NP_542183.2	Q96MY1	NOL4L_HUMAN		139						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						TTGATGGAATCGTAGCTCCCA	0.627																																																	0													38.0	32.0	34.0					20																	31041537		2173	4253	6426	SO:0001583	missense	0																														ENST00000359676.5:c.415G>A	20.37:g.31041537C>T	ENSP00000352704:p.Asp139Asn		Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	NULL	p.D139N	ENST00000359676.5	37	c.415	CCDS13202.1	20	.	.	.	.	.	.	.	.	.	.	C	18.78	3.695930	0.68386	.	.	ENSG00000197183	ENST00000359676;ENST00000397984	.	.	.	5.04	5.04	0.67666	.	0.050000	0.85682	N	0.000000	T	0.76285	0.3966	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.78114	-0.2330	9	0.72032	D	0.01	-42.2217	18.5567	0.91088	0.0:1.0:0.0:0.0	.	139	Q96MY1	CT112_HUMAN	N	139	.	ENSP00000352704:D139N	D	-	1	0	C20orf112	30505198	1.000000	0.71417	0.998000	0.56505	0.743000	0.42351	7.315000	0.78998	2.615000	0.88500	0.462000	0.41574	GAT	C20orf112	-	NULL	ENSG00000197183		0.627	C20orf112-001	KNOWN	basic|CCDS	protein_coding	C20orf112	HGNC	protein_coding	OTTHUMT00000078628.2	-	0.00	43	0	C			31041537	-1	tier1	-	no_errors	ENST00000359676	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	T
C6orf163	206412	genome.wustl.edu	37	6	88060192	88060192	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:88060192G>C	ENST00000388923.4	+	3	575	c.324G>C	c.(322-324)ttG>ttC	p.L108F	RP1-102H19.8_ENST00000448282.2_Intron|C6orf163_ENST00000608326.1_Intron	NM_001010868.2	NP_001010868.2	Q5TEZ5	CF163_HUMAN	chromosome 6 open reading frame 163	108										central_nervous_system(1)|kidney(1)	2						TTCAGATTTTGAAAGAGGAAC	0.323																																																	0													122.0	107.0	111.0					6																	88060192		692	1591	2283	SO:0001583	missense	0			AK092941	CCDS55042.1	6q15	2012-02-07			ENSG00000203872	ENSG00000203872			21403	protein-coding gene	gene with protein product							Standard	NM_001010868		Approved		uc021zcl.1	Q5TEZ5	OTTHUMG00000015169	ENST00000388923.4:c.324G>C	6.37:g.88060192G>C	ENSP00000373575:p.Leu108Phe			Missense_Mutation	SNP	NULL	p.L108F	ENST00000388923.4	37	c.324	CCDS55042.1	6	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457052	0.43634	.	.	ENSG00000203872	ENST00000388923	T	0.76839	-1.05	5.37	3.21	0.36854	.	0.152498	0.28057	N	0.016780	T	0.68997	0.3062	M	0.69823	2.125	0.25759	N	0.984969	.	.	.	.	.	.	T	0.64976	-0.6280	8	0.87932	D	0	-3.3613	5.9323	0.19146	0.262:0.0:0.738:0.0	.	.	.	.	F	108	ENSP00000373575:L108F	ENSP00000373575:L108F	L	+	3	2	C6orf163	88116911	0.833000	0.29383	0.961000	0.40146	0.905000	0.53344	0.876000	0.28092	1.405000	0.46838	-0.259000	0.10710	TTG	C6orf163	-	NULL	ENSG00000203872		0.323	C6orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf163	HGNC	protein_coding	OTTHUMT00000041436.2	-	0.00	104	0	G	NM_001010868		88060192	+1	tier1	-	no_errors	ENST00000388923	ensembl	human	known	74_37	missense	21.05	88	24	SNP	0.933	C
CACNA2D3	55799	genome.wustl.edu	37	3	54661816	54661816	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:54661816C>A	ENST00000474759.1	+	10	1014	c.966C>A	c.(964-966)caC>caA	p.H322Q	CACNA2D3_ENST00000415676.2_Missense_Mutation_p.H322Q|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.H228Q|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.H322Q	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	322	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TGTTTCAGCACTTCAGGGAGC	0.413																																																	0													91.0	84.0	86.0					3																	54661816		1943	4128	6071	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.966C>A	3.37:g.54661816C>A	ENSP00000419101:p.His322Gln		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.H322Q	ENST00000474759.1	37	c.966	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083163	0.55861	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.12361	2.69;2.69;2.69;2.69	5.37	1.05	0.20165	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.18509	0.0444	L	0.28504	0.86	0.33361	D	0.572363	D	0.76494	0.999	D	0.83275	0.996	T	0.14448	-1.0472	10	0.12103	T	0.63	.	9.6418	0.39844	0.0:0.5907:0.0:0.4093	.	322	Q8IZS8	CA2D3_HUMAN	Q	322;322;322;228;228;227	ENSP00000389506:H322Q;ENSP00000419101:H322Q;ENSP00000288197:H322Q;ENSP00000417279:H228Q	ENSP00000288197:H322Q	H	+	3	2	CACNA2D3	54636856	0.996000	0.38824	1.000000	0.80357	0.954000	0.61252	0.366000	0.20365	0.273000	0.22049	-0.254000	0.11334	CAC	CACNA2D3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000157445		0.413	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	40	0	C			54661816	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.995	A
CAMKK2	10645	genome.wustl.edu	37	12	121678327	121678329	+	3'UTR	DEL	CTT	CTT	-	rs398056010|rs201965034|rs200501220|rs63023660|rs398021385		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:121678327_121678329delCTT	ENST00000324774.5	-	0	2768_2770				CAMKK2_ENST00000545538.1_In_Frame_Del_p.325_326KG>R|CAMKK2_ENST00000337174.3_3'UTR|CAMKK2_ENST00000392474.2_In_Frame_Del_p.538_539KG>R|CAMKK2_ENST00000347034.2_3'UTR|CAMKK2_ENST00000412367.2_3'UTR|CAMKK2_ENST00000538733.1_3'UTR|CAMKK2_ENST00000404169.3_3'UTR	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta						calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAGTCAAGTCCTTTTTTTTTTTT	0.493																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.*175AAG>-	12.37:g.121678327_121678329delCTT			A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	In_Frame_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.KG538in_frame_delR	ENST00000324774.5	37	c.1615_1613	CCDS9216.1	12																																																																																			CAMKK2	-	NULL	ENSG00000110931		0.493	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	HGNC	protein_coding	OTTHUMT00000402563.1		0.00	77	0	CTT	NM_172226		121678329	-1	tier1		no_errors	ENST00000392474	ensembl	human	known	74_37	in_frame_del	8.45	65	6	DEL	0.005:0.000:0.000	-
CARNS1	57571	genome.wustl.edu	37	11	67186432	67186432	+	Silent	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:67186432A>G	ENST00000307823.3	+	4	653	c.201A>G	c.(199-201)gcA>gcG	p.A67A	CARNS1_ENST00000423745.2_Silent_p.A67A|CARNS1_ENST00000531040.1_Silent_p.A190A|CARNS1_ENST00000445895.2_Silent_p.A190A	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	67					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GAGAGGCAGCAGAACTCGCCC	0.692																																																	0													11.0	14.0	13.0					11																	67186432		2052	4174	6226	SO:0001819	synonymous_variant	0				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.201A>G	11.37:g.67186432A>G			A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Silent	SNP	superfamily_PreATP-grasp_dom,superfamily_TIL_dom,pfscan_ATP-grasp	p.A190	ENST00000307823.3	37	c.570	CCDS44658.1	11																																																																																			CARNS1	-	NULL	ENSG00000172508		0.692	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	HGNC	protein_coding	OTTHUMT00000395501.1	-	0.00	37	0	A	NM_020811		67186432	+1	tier1	-	no_errors	ENST00000445895	ensembl	human	known	74_37	silent	21.62	29	8	SNP	0.989	G
CARNS1	57571	genome.wustl.edu	37	11	67186451	67186451	+	Missense_Mutation	SNP	A	A	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:67186451A>C	ENST00000307823.3	+	4	672	c.220A>C	c.(220-222)Acc>Ccc	p.T74P	CARNS1_ENST00000423745.2_Missense_Mutation_p.T74P|CARNS1_ENST00000531040.1_Missense_Mutation_p.T197P|CARNS1_ENST00000445895.2_Missense_Mutation_p.T197P	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	74					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						CCGTGACCTGACCTGCCCCAC	0.697																																																	0													9.0	12.0	11.0					11																	67186451		2070	4168	6238	SO:0001583	missense	0				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.220A>C	11.37:g.67186451A>C	ENSP00000308268:p.Thr74Pro		A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	superfamily_PreATP-grasp_dom,superfamily_TIL_dom,pfscan_ATP-grasp	p.T197P	ENST00000307823.3	37	c.589	CCDS44658.1	11	.	.	.	.	.	.	.	.	.	.	A	11.14	1.549965	0.27652	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.32515	1.45;1.49;1.49;1.49	4.06	1.52	0.23074	.	.	.	.	.	T	0.16385	0.0394	N	0.14661	0.345	0.28199	N	0.927428	P;B;P	0.35982	0.531;0.396;0.531	B;B;B	0.35353	0.201;0.099;0.201	T	0.14117	-1.0484	9	0.41790	T	0.15	.	6.2838	0.21021	0.3831:0.0:0.6169:0.0	.	197;74;213	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	P	197;74;197;213;74;197	ENSP00000431670:T197P;ENSP00000308268:T74P;ENSP00000401519:T74P;ENSP00000389009:T197P	ENSP00000308268:T74P	T	+	1	0	CARNS1	66943027	0.998000	0.40836	0.998000	0.56505	0.971000	0.66376	0.765000	0.26546	0.177000	0.19895	0.459000	0.35465	ACC	CARNS1	-	NULL	ENSG00000172508		0.697	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	HGNC	protein_coding	OTTHUMT00000395501.1	-	0.00	34	0	A	NM_020811		67186451	+1	tier1	-	no_errors	ENST00000445895	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	C
CBL	867	genome.wustl.edu	37	11	119170428	119170428	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:119170428G>C	ENST00000264033.4	+	16	3034	c.2658G>C	c.(2656-2658)gaG>gaC	p.E886D		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	886	Interaction with CD2AP.|UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		ACAACATCGAGATGGCCAAAA	0.512			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																															"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													303.0	307.0	306.0					11																	119170428		2199	4295	6494	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.2658G>C	11.37:g.119170428G>C	ENSP00000264033:p.Glu886Asp		A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.E886D	ENST00000264033.4	37	c.2658	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533861	0.27387	.	.	ENSG00000110395	ENST00000264033	T	0.38077	1.16	5.8	-1.93	0.07594	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.198963	0.51477	N	0.000084	T	0.15003	0.0362	N	0.11560	0.145	0.58432	D	0.999996	B	0.12630	0.006	B	0.17098	0.017	T	0.08513	-1.0718	10	0.22706	T	0.39	-17.976	7.297	0.26399	0.317:0.3268:0.3563:0.0	.	886	P22681	CBL_HUMAN	D	886	ENSP00000264033:E886D	ENSP00000264033:E886D	E	+	3	2	CBL	118675638	0.951000	0.32395	0.969000	0.41365	0.998000	0.95712	0.167000	0.16602	-0.343000	0.08351	0.655000	0.94253	GAG	CBL	-	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000110395		0.512	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4		0.00	55	0	G	NM_005188		119170428	+1			no_errors	ENST00000264033	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.962	C
CC2D1A	54862	genome.wustl.edu	37	19	14023373	14023373	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:14023373G>C	ENST00000318003.7	+	4	586	c.345G>C	c.(343-345)caG>caC	p.Q115H	CC2D1A_ENST00000589606.1_Missense_Mutation_p.Q115H	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	115					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			GAGAGGAGCAGAAGGCTTCAG	0.602																																																	0													77.0	83.0	81.0					19																	14023373		2013	4188	6201	SO:0001583	missense	0			AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.345G>C	19.37:g.14023373G>C	ENSP00000313601:p.Gln115His		Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_DM14,smart_C2_dom	p.Q115H	ENST00000318003.7	37	c.345	CCDS42512.1	19	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659296	0.29515	.	.	ENSG00000132024	ENST00000318003;ENST00000389233	T	0.21932	1.98	4.35	4.35	0.52113	.	0.351400	0.25738	N	0.028621	T	0.17789	0.0427	N	0.25647	0.755	0.33582	D	0.59999	P;P	0.44946	0.846;0.761	P;B	0.44946	0.465;0.275	T	0.15809	-1.0424	10	0.48119	T	0.1	-10.9473	10.3061	0.43680	0.0:0.2004:0.7996:0.0	.	115;115	Q6P1N0-2;Q6P1N0	.;C2D1A_HUMAN	H	115;90	ENSP00000313601:Q115H	ENSP00000313601:Q115H	Q	+	3	2	CC2D1A	13884373	1.000000	0.71417	0.991000	0.47740	0.386000	0.30323	2.136000	0.42121	2.277000	0.76020	0.650000	0.86243	CAG	CC2D1A	-	NULL	ENSG00000132024		0.602	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CC2D1A	HGNC	protein_coding	OTTHUMT00000457954.1	-	0.00	18	0	G	NM_017721		14023373	+1	tier1	-	no_errors	ENST00000318003	ensembl	human	known	74_37	missense	71.43	2	5	SNP	0.998	C
CCDC60	160777	genome.wustl.edu	37	12	119954500	119954500	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:119954500G>C	ENST00000327554.2	+	8	1421	c.956G>C	c.(955-957)aGa>aCa	p.R319T	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	319										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGGATGCAAAGAAAAGCACCC	0.448																																																	0													91.0	88.0	89.0					12																	119954500		2203	4300	6503	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.956G>C	12.37:g.119954500G>C	ENSP00000333374:p.Arg319Thr			Missense_Mutation	SNP	NULL	p.R319T	ENST00000327554.2	37	c.956	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	8.507	0.865538	0.17250	.	.	ENSG00000183273	ENST00000327554	T	0.22134	1.97	4.76	-3.88	0.04205	.	0.348573	0.23865	N	0.043802	T	0.14874	0.0359	L	0.47716	1.5	0.09310	N	0.999991	B	0.11235	0.004	B	0.10450	0.005	T	0.24333	-1.0163	9	.	.	.	-5.7263	11.2572	0.49060	0.3738:0.0:0.6262:0.0	.	319	Q8IWA6	CCD60_HUMAN	T	319	ENSP00000333374:R319T	.	R	+	2	0	CCDC60	118438883	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.441000	0.06879	-0.837000	0.04223	0.655000	0.94253	AGA	CCDC60	-	NULL	ENSG00000183273		0.448	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	-	0.00	55	0	G	NM_178499		119954500	+1	tier1	-	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	C
CCM2L	140706	genome.wustl.edu	37	20	30619042	30619043	+	In_Frame_Ins	INS	-	-	GAC	rs373573189|rs78827511|rs139704146		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:30619042_30619043insGAC	ENST00000300415.8	+	10	1654_1655	c.1641_1642insGAC	c.(1642-1644)gac>GACgac	p.548_548D>DD	CCM2L_ENST00000262659.8_3'UTR|RP1-310O13.7_ENST00000449519.1_RNA			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	548	Poly-Asp.																TGGCCCCCGATGACGACGACGA	0.713											OREG0025860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001652	inframe_insertion	0			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.1654_1656dupGAC	20.37:g.30619049_30619051dupGAC	ENSP00000300415:p.Asp552dup	818	Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	In_Frame_Ins	INS	NULL	p.551in_frame_insD	ENST00000300415.8	37	c.1641_1642		20																																																																																			CCM2L	-	NULL	ENSG00000101331		0.713	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCM2L	HGNC	protein_coding			0.00	10	0	-	NM_080625		30619043	+1	tier1		no_errors	ENST00000300415	ensembl	human	known	74_37	in_frame_ins	40.00	6	4	INS	0.994:1.000	GAC
CD207	50489	genome.wustl.edu	37	2	71061152	71061152	+	Splice_Site	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:71061152C>T	ENST00000410009.3	-	3	236		c.e3-1			NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						AACCGGGGATCTGGGATTGAG	0.498																																																	0													27.0	23.0	24.0					2																	71061152		1948	4139	6087	SO:0001630	splice_region_variant	0			AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.191-1G>A	2.37:g.71061152C>T				Splice_Site	SNP	-	e3-1	ENST00000410009.3	37	c.191-1		2	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369303	0.24771	.	.	ENSG00000116031	ENST00000410009	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9117	0.52743	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CD207	70914660	1.000000	0.71417	0.994000	0.49952	0.287000	0.27160	3.085000	0.50151	2.508000	0.84585	0.655000	0.94253	.	CD207	-	-	ENSG00000116031		0.498	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	CD207	HGNC	protein_coding	OTTHUMT00000329959.4	-	0.00	28	0	C	NM_015717	Intron	71061152	-1	tier1	-	no_errors	ENST00000410009	ensembl	human	known	74_37	splice_site	66.67	2	4	SNP	0.998	T
CDC26	246184	genome.wustl.edu	37	9	116029647	116029647	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:116029647T>C	ENST00000374206.3	-	4	512	c.154A>G	c.(154-156)Agt>Ggt	p.S52G	CDC26_ENST00000490408.1_Intron	NM_139286.3	NP_644815.1	Q8NHZ8	CDC26_HUMAN	cell division cycle 26	52					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)											TTGGGATCACTGCTAAGCCCA	0.423																																																	0													83.0	90.0	88.0					9																	116029647		2202	4288	6490	SO:0001583	missense	0			AF503918	CCDS6790.1	9q32	2013-01-17	2013-01-17	2003-11-26	ENSG00000176386	ENSG00000176386		"""Anaphase promoting complex subunits"""	17839	protein-coding gene	gene with protein product	"""CDC26 subunit of anaphase promoting complex"", ""anaphase promoting complex subunit 12"""	614533	"""chromosome 9 open reading frame 17"", ""cell division cycle 26"", ""cell division cycle 26 homolog (S. cerevisiae)"""	C9orf17		8895471, 10922056	Standard	NM_139286		Approved	APC12, ANAPC12	uc004bgw.2	Q8NHZ8	OTTHUMG00000020521	ENST00000374206.3:c.154A>G	9.37:g.116029647T>C	ENSP00000363322:p.Ser52Gly			Missense_Mutation	SNP	pfam_APC_suCDC26	p.S52G	ENST00000374206.3	37	c.154	CCDS6790.1	9	.	.	.	.	.	.	.	.	.	.	T	10.35	1.324567	0.24080	.	.	ENSG00000176386	ENST00000374206	.	.	.	5.53	4.4	0.53042	.	0.453405	0.25987	N	0.027031	T	0.33673	0.0871	.	.	.	0.29754	N	0.8361	B	0.16396	0.017	B	0.22880	0.042	T	0.23368	-1.0190	8	0.28530	T	0.3	-2.922	8.5453	0.33417	0.0:0.158:0.0:0.842	.	52	Q8NHZ8	CDC26_HUMAN	G	52	.	ENSP00000363322:S52G	S	-	1	0	CDC26	115069468	0.989000	0.36119	0.998000	0.56505	0.945000	0.59286	1.851000	0.39338	1.055000	0.40461	0.460000	0.39030	AGT	CDC26	-	pfam_APC_suCDC26	ENSG00000176386		0.423	CDC26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC26	HGNC	protein_coding	OTTHUMT00000053723.1	-	0.00	54	0	T	NM_139286		116029647	-1	tier1	-	no_errors	ENST00000374206	ensembl	human	known	74_37	missense	57.89	16	22	SNP	0.997	C
CDKL5	6792	genome.wustl.edu	37	X	18622887	18622887	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:18622887G>T	ENST00000379989.3	+	13	2128	c.1843G>T	c.(1843-1845)Gtg>Ttg	p.V615L	CDKL5_ENST00000379996.3_Missense_Mutation_p.V615L|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	615					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					TTCTATGTATGTGACCCGTGA	0.517																																																	0													192.0	185.0	187.0					X																	18622887		2203	4300	6503	SO:0001583	missense	0			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1843G>T	X.37:g.18622887G>T	ENSP00000369325:p.Val615Leu		G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V615L	ENST00000379989.3	37	c.1843	CCDS14186.1	X	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935050	0.73442	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.78003	-1.14;-1.14	5.83	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.67748	0.2926	L	0.36672	1.1	0.41269	D	0.986835	P	0.37122	0.583	B	0.31016	0.123	T	0.70641	-0.4816	10	0.87932	D	0	-15.1854	14.0049	0.64456	0.0741:0.0:0.9259:0.0	.	615	O76039	CDKL5_HUMAN	L	615	ENSP00000369332:V615L;ENSP00000369325:V615L	ENSP00000369325:V615L	V	+	1	0	CDKL5	18532808	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.230000	0.95299	1.224000	0.43551	0.600000	0.82982	GTG	CDKL5	-	NULL	ENSG00000008086		0.517	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	HGNC	protein_coding	OTTHUMT00000055945.2		0.00	38	0	G	NM_003159		18622887	+1			no_errors	ENST00000379989	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
CDR1	1038	genome.wustl.edu	37	X	139866523	139866523	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:139866523C>A	ENST00000370532.2	-	1	200	c.9G>T	c.(7-9)tgG>tgT	p.W3C		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	3	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CGTCTTCCAACCAAGCCATGT	0.423																																																	0													124.0	126.0	125.0					X																	139866523		2201	4299	6500	SO:0001583	missense	0				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.9G>T	X.37:g.139866523C>A	ENSP00000359563:p.Trp3Cys		Q5JXH6	Missense_Mutation	SNP	NULL	p.W3C	ENST00000370532.2	37	c.9	CCDS14670.1	X	.	.	.	.	.	.	.	.	.	.	C	7.936	0.741698	0.15642	.	.	ENSG00000184258	ENST00000370532	T	0.29655	1.56	4.24	0.433	0.16534	.	.	.	.	.	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	P	0.35124	0.485	B	0.23852	0.049	T	0.23190	-1.0195	8	.	.	.	.	6.4563	0.21932	0.398:0.5081:0.0:0.0939	.	3	P51861	CDR1_HUMAN	C	3	ENSP00000359563:W3C	.	W	-	3	0	CDR1	139694189	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	-0.360000	0.07622	-0.202000	0.10268	-0.269000	0.10298	TGG	CDR1	-	NULL	ENSG00000184258		0.423	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR1	HGNC	protein_coding	OTTHUMT00000058583.1	-	0.00	159	0	C	NM_004065		139866523	-1	tier1	-	no_errors	ENST00000370532	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.001	A
CKM	1158	genome.wustl.edu	37	19	45821144	45821144	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:45821144C>A	ENST00000221476.3	-	3	461	c.287G>T	c.(286-288)cGc>cTc	p.R96L		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	96	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GCCCCCGTGGCGATCCGAGAT	0.582																																																	0													133.0	107.0	116.0					19																	45821144		2203	4300	6503	SO:0001583	missense	0			M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.287G>T	19.37:g.45821144C>A	ENSP00000221476:p.Arg96Leu		Q96QL9	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.R96L	ENST00000221476.3	37	c.287	CCDS12659.1	19	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214283	0.58452	.	.	ENSG00000104879	ENST00000221476	T	0.65364	-0.15	4.62	4.62	0.57501	ATP:guanido phosphotransferase, N-terminal (4);	0.064020	0.64402	D	0.000004	T	0.69415	0.3108	M	0.86343	2.81	0.80722	D	1	P	0.37370	0.592	B	0.39152	0.292	T	0.76846	-0.2808	10	0.72032	D	0.01	-27.7907	15.0581	0.71930	0.0:1.0:0.0:0.0	.	96	P06732	KCRM_HUMAN	L	96	ENSP00000221476:R96L	ENSP00000221476:R96L	R	-	2	0	CKM	50512984	1.000000	0.71417	1.000000	0.80357	0.307000	0.27823	7.236000	0.78154	2.418000	0.82041	0.650000	0.86243	CGC	CKM	-	pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	ENSG00000104879		0.582	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKM	HGNC	protein_coding	OTTHUMT00000457569.1	-	0.00	74	0	C			45821144	-1	tier1	-	no_errors	ENST00000221476	ensembl	human	known	74_37	missense	17.24	48	10	SNP	1.000	A
CLCNKA	1187	genome.wustl.edu	37	1	16349185	16349185	+	Missense_Mutation	SNP	C	C	T	rs77127348		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:16349185C>T	ENST00000331433.4	+	2	90	c.71C>T	c.(70-72)cCc>cTc	p.P24L	CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_Missense_Mutation_p.P24L|CLCNKA_ENST00000420078.1_Missense_Mutation_p.P24L|CLCNKA_ENST00000439316.2_Missense_Mutation_p.P24L			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	24					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTGTGGGGCCCCTGTCCCCAC	0.657																																																	0													39.0	37.0	37.0					1																	16349185		2191	4269	6460	SO:0001583	missense	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.71C>T	1.37:g.16349185C>T	ENSP00000332771:p.Pro24Leu		B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.P24L	ENST00000331433.4	37	c.71	CCDS167.1	1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781232	0.49891	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.85258	-1.92;-1.92;-1.96;-1.92	4.12	3.17	0.36434	.	0.069774	0.64402	U	0.000018	D	0.89753	0.6806	M	0.81239	2.535	0.53005	D	0.999965	D;D;D	0.64830	0.994;0.994;0.989	P;P;P	0.60345	0.873;0.873;0.873	D	0.88841	0.3312	10	0.52906	T	0.07	.	9.4425	0.38677	0.0:0.7826:0.2174:0.0	.	24;24;24	E7EPH6;Q5T5Q4;P51800	.;.;CLCKA_HUMAN	L	24	ENSP00000364844:P24L;ENSP00000410353:P24L;ENSP00000414445:P24L;ENSP00000332771:P24L	ENSP00000332771:P24L	P	+	2	0	CLCNKA	16221772	0.025000	0.19082	0.956000	0.39512	0.319000	0.28217	1.447000	0.35101	0.899000	0.36444	0.313000	0.20887	CCC	CLCNKA	-	prints_Cl_channel-K	ENSG00000186510		0.657	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	-	0.00	64	0	C			16349185	+1	tier1	-	no_errors	ENST00000331433	ensembl	human	known	74_37	missense	54.55	20	24	SNP	0.945	T
CNOT6L	246175	genome.wustl.edu	37	4	78740515	78740516	+	5'UTR	DEL	AC	AC	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:78740515_78740516delAC	ENST00000504123.1	-	0	6_7				CNOT6L_ENST00000264903.4_5'UTR|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						GGCAGGGGAAACACACACACAA	0.624																																																	0										7,3653		1,5,1824						-0.6	1.0			59	8,7876		0,8,3934	no	utr-5	CNOT6L	NM_144571.2		1,13,5758	A1A1,A1R,RR		0.1015,0.1913,0.1299				15,11529				SO:0001623	5_prime_UTR_variant	0			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.-125GT>-	4.37:g.78740523_78740524delAC			Q9UF92	RNA	DEL	-	NULL	ENST00000504123.1	37	NULL		4																																																																																			CNOT6L	-	-	ENSG00000138767		0.624	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	CNOT6L	HGNC	protein_coding	OTTHUMT00000362515.1		0.00	46	0	AC			78740516	-1	tier1		no_errors	ENST00000506166	ensembl	human	known	74_37	rna	8.00	23	2	DEL	0.994:0.997	-
COG6	57511	genome.wustl.edu	37	13	40239254	40239254	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:40239254G>A	ENST00000455146.3	+	4	441	c.391G>A	c.(391-393)Gat>Aat	p.D131N	MIR4305_ENST00000583252.1_RNA|COG6_ENST00000416691.1_Missense_Mutation_p.D131N	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	131					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ACAGACTCAAGATTTAATAGT	0.274																																																	0													53.0	57.0	56.0					13																	40239254		2201	4293	6494	SO:0001583	missense	0			AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.391G>A	13.37:g.40239254G>A	ENSP00000397441:p.Asp131Asn		Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	pfam_COG6	p.D131N	ENST00000455146.3	37	c.391	CCDS9370.1	13	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654631	0.67472	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000422759;ENST00000455146	T;T;T	0.56103	0.48;0.48;0.48	5.72	4.88	0.63580	.	0.088146	0.85682	D	0.000000	T	0.58892	0.2154	L	0.55103	1.725	0.80722	D	1	D;B	0.57257	0.979;0.339	P;B	0.55508	0.777;0.147	T	0.54977	-0.8212	10	0.19147	T	0.46	-10.1424	13.3081	0.60363	0.0764:0.0:0.9236:0.0	.	152;131	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	N	131;162;131;131	ENSP00000403733:D131N;ENSP00000412877:D131N;ENSP00000397441:D131N	ENSP00000255468:D162N	D	+	1	0	COG6	39137254	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.945000	0.92985	1.434000	0.47414	0.591000	0.81541	GAT	COG6	-	pfam_COG6	ENSG00000133103		0.274	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COG6	HGNC	protein_coding	OTTHUMT00000044622.3	-	0.00	224	0	G			40239254	+1	tier1	-	no_errors	ENST00000455146	ensembl	human	known	74_37	missense	35.08	124	67	SNP	1.000	A
COL19A1	1310	genome.wustl.edu	37	6	70850865	70850865	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:70850865G>A	ENST00000322773.4	+	20	1568	c.1466G>A	c.(1465-1467)gGa>gAa	p.G489E	COL19A1_ENST00000393344.1_Missense_Mutation_p.G111E	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	489	Collagen-like 4.|Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TTTACAAAAGGAGAAAAAGGA	0.368																																																	0													166.0	179.0	175.0					6																	70850865		2203	4300	6503	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1466G>A	6.37:g.70850865G>A	ENSP00000316030:p.Gly489Glu		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.G489E	ENST00000322773.4	37	c.1466	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546921	0.45383	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99353	-5.77;-5.77	4.73	4.73	0.59995	.	0.066589	0.56097	D	0.000022	D	0.99638	0.9867	H	0.96015	3.755	0.42455	D	0.992761	D	0.89917	1.0	D	0.97110	1.0	D	0.97746	1.0211	10	0.87932	D	0	.	16.358	0.83243	0.0:0.0:1.0:0.0	.	489	Q14993	COJA1_HUMAN	E	489;111	ENSP00000316030:G489E;ENSP00000377013:G111E	ENSP00000316030:G489E	G	+	2	0	COL19A1	70907586	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	3.709000	0.54853	2.543000	0.85770	0.650000	0.86243	GGA	COL19A1	-	pfam_Collagen	ENSG00000082293		0.368	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	-	0.00	143	0	G			70850865	+1	tier1	-	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	22.64	82	24	SNP	1.000	A
COQ4	51117	genome.wustl.edu	37	9	131088140	131088140	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:131088140C>G	ENST00000300452.3	+	4	705	c.382C>G	c.(382-384)Ctc>Gtc	p.L128V	COQ4_ENST00000372875.3_Missense_Mutation_p.L128V	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						TCGCGAGTATCTCCGTTTCCT	0.572																																																	0													88.0	69.0	75.0					9																	131088140		2203	4300	6503	SO:0001583	missense	0			AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.382C>G	9.37:g.131088140C>G	ENSP00000300452:p.Leu128Val			Missense_Mutation	SNP	pfam_Coq4	p.L128V	ENST00000300452.3	37	c.382	CCDS6898.1	9	.	.	.	.	.	.	.	.	.	.	C	0.552	-0.849027	0.02651	.	.	ENSG00000167113	ENST00000300452;ENST00000372875	T;T	0.39056	1.1;1.1	5.75	4.84	0.62591	.	0.339266	0.31760	N	0.007106	T	0.20577	0.0495	N	0.04018	-0.295	0.38384	D	0.945204	B;B	0.20261	0.043;0.026	B;B	0.30316	0.114;0.038	T	0.17837	-1.0356	10	0.12430	T	0.62	-0.9116	9.2534	0.37568	0.1171:0.4893:0.3936:0.0	.	128;128	Q5T4B9;Q9Y3A0	.;COQ4_HUMAN	V	128	ENSP00000300452:L128V;ENSP00000361966:L128V	ENSP00000300452:L128V	L	+	1	0	COQ4	130127961	0.998000	0.40836	1.000000	0.80357	0.207000	0.24258	1.411000	0.34702	2.714000	0.92807	0.563000	0.77884	CTC	COQ4	-	pfam_Coq4	ENSG00000167113		0.572	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ4	HGNC	protein_coding	OTTHUMT00000054427.1		0.00	42	0	C	NM_016035		131088140	+1			no_errors	ENST00000300452	ensembl	human	known	74_37	missense	15.38	11	2	SNP	1.000	G
CRB1	23418	genome.wustl.edu	37	1	197404164	197404164	+	Silent	SNP	C	C	T	rs62636284		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:197404164C>T	ENST00000367400.3	+	9	3306	c.3171C>T	c.(3169-3171)aaC>aaT	p.N1057N	CRB1_ENST00000367399.2_Silent_p.N945N|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367397.1_Silent_p.N438N|CRB1_ENST00000535699.1_Silent_p.N1033N|CRB1_ENST00000544212.1_Silent_p.N538N	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1057	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						AAGTGGACAACGAAACACCTT	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		18693	0.0		0.0	False		,,,				2504	0.001																0													79.0	82.0	81.0					1																	197404164		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3171C>T	1.37:g.197404164C>T			A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.N1057	ENST00000367400.3	37	c.3171	CCDS1390.1	1																																																																																			CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.448	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	52	0	C	NM_201253		197404164	+1	tier1	rs62636284	no_errors	ENST00000367400	ensembl	human	known	74_37	silent	20.93	34	9	SNP	0.000	T
CRLS1	54675	genome.wustl.edu	37	20	6011944	6011944	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:6011944C>T	ENST00000378863.4	+	4	745	c.588C>T	c.(586-588)taC>taT	p.Y196Y	CRLS1_ENST00000378868.4_Silent_p.Y97Y|CRLS1_ENST00000464921.1_3'UTR|CRLS1_ENST00000452938.1_Intron	NM_019095.4	NP_061968.1	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1	196					cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			lung(3)|ovary(1)	4						CACTTACTTACATGATCATTT	0.318																																																	0													149.0	131.0	137.0					20																	6011944		2203	4299	6502	SO:0001819	synonymous_variant	0			AF241784	CCDS13096.1, CCDS46578.1	20p13-p12.3	2006-04-04	2006-04-04	2006-04-04	ENSG00000088766	ENSG00000088766			16148	protein-coding gene	gene with protein product	"""GCD10 homolog (S. cerevisiae)"""	608188	"""chromosome 20 open reading frame 155"""	C20orf155		16547353	Standard	NM_019095		Approved	dJ967N21.6, CLS1, GCD10	uc002wmn.4	Q9UJA2	OTTHUMG00000031823	ENST00000378863.4:c.588C>T	20.37:g.6011944C>T			D3DW09|E9PAT4|Q27RP0|Q69YQ5	Silent	SNP	pfam_CDP-OH_P_trans	p.Y196	ENST00000378863.4	37	c.588	CCDS13096.1	20																																																																																			CRLS1	-	NULL	ENSG00000088766		0.318	CRLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLS1	HGNC	protein_coding	OTTHUMT00000077902.2	-	0.00	50	0	C	NM_019095		6011944	+1	tier1	-	no_errors	ENST00000378863	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.982	T
CTAGE5	4253	genome.wustl.edu	37	14	39763208	39763208	+	Missense_Mutation	SNP	C	C	T	rs139644527		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:39763208C>T	ENST00000280083.3	+	7	814	c.500C>T	c.(499-501)gCg>gTg	p.A167V	CTAGE5_ENST00000396165.4_Missense_Mutation_p.A138V|CTAGE5_ENST00000396158.2_Missense_Mutation_p.A172V|CTAGE5_ENST00000348007.3_Missense_Mutation_p.A167V|CTAGE5_ENST00000341502.5_Missense_Mutation_p.A167V|CTAGE5_ENST00000556148.1_Missense_Mutation_p.A92V|CTAGE5_ENST00000341749.3_Missense_Mutation_p.A155V|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.A702V|CTAGE5_ENST00000553352.1_Missense_Mutation_p.A138V|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.A138V|CTAGE5_ENST00000557038.1_Missense_Mutation_p.A87V			O15320	CTGE5_HUMAN	CTAGE family, member 5	167					positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TTCTAGATGGCGGATATTTCA	0.343													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15098	0.0		0.0	False		,,,				2504	0.0																0								C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	5,4401	11.4+/-27.6	1,3,2199	114.0	122.0	119.0		500,464,500,413	-3.2	0.0	14	dbSNP_134	119	0,8592		0,0,4296	yes	missense,missense,missense,missense	CTAGE5	NM_005930.3,NM_203354.2,NM_203355.2,NM_203356.2	64,64,64,64	1,3,6495	TT,TC,CC		0.0,0.1135,0.0385	benign,benign,benign,benign	167/805,155/793,167/762,138/776	39763208	5,12993	2203	4296	6499	SO:0001583	missense	0			U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.500C>T	14.37:g.39763208C>T	ENSP00000280083:p.Ala167Val		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	NULL	p.A172V	ENST00000280083.3	37	c.515	CCDS9674.1	14	.	.	.	.	.	.	.	.	.	.	C	7.979	0.750849	0.15778	0.001135	0.0	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000555716;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T;T;T	0.78707	1.53;1.53;-1.2;1.53;-1.2;-1.2;1.53;-1.2;1.53;-1.2;-1.2	5.15	-3.18	0.05186	.	1.225580	0.06364	N	0.712236	T	0.65154	0.2664	L	0.41415	1.275	0.09310	N	1	B;B;B;B;B;B	0.21225	0.053;0.03;0.03;0.03;0.03;0.012	B;B;B;B;B;B	0.20955	0.026;0.026;0.032;0.026;0.02;0.016	T	0.48234	-0.9053	9	.	.	.	.	6.5551	0.22456	0.248:0.6084:0.0:0.1437	.	129;172;167;167;138;155	F8W9E1;O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;.;CTGE5_HUMAN;.;.	V	702;129;155;87;129;138;167;172;167;92;167;138	ENSP00000452252:A702V;ENSP00000452395:A129V;ENSP00000343897:A155V;ENSP00000450869:A87V;ENSP00000379468:A138V;ENSP00000339286:A167V;ENSP00000379462:A172V;ENSP00000280083:A167V;ENSP00000452562:A92V;ENSP00000343912:A167V;ENSP00000450449:A138V	.	A	+	2	0	CTAGE5;RP11-407N17.3	38832959	0.021000	0.18746	0.010000	0.14722	0.309000	0.27889	0.223000	0.17719	-0.326000	0.08564	0.455000	0.32223	GCG	CTAGE5	-	NULL	ENSG00000150527		0.343	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	HGNC	protein_coding	OTTHUMT00000276771.2	-	0.00	108	0	C	NM_005930		39763208	+1	tier1	rs139644527	no_errors	ENST00000396158	ensembl	human	known	74_37	missense	31.86	77	36	SNP	0.002	T
CTTN	2017	genome.wustl.edu	37	11	70277335	70277335	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:70277335G>A	ENST00000301843.8	+	15	1421	c.1215G>A	c.(1213-1215)tcG>tcA	p.S405S	CTTN_ENST00000538675.1_Silent_p.S89S|CTTN_ENST00000346329.3_Silent_p.S368S|CTTN_ENST00000376561.3_Silent_p.S368S	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	405					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		CCCCTGTGTCGCCCGCACCTC	0.562																																																	0													115.0	128.0	123.0					11																	70277335		2200	4294	6494	SO:0001819	synonymous_variant	0			AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.1215G>A	11.37:g.70277335G>A			Q8N707|Q96H99	Silent	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.S405	ENST00000301843.8	37	c.1215	CCDS41680.1	11																																																																																			CTTN	-	superfamily_SH3_domain,prints_p67phox	ENSG00000085733		0.562	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	HGNC	protein_coding	OTTHUMT00000259233.2		0.00	25	0	G	NM_138565		70277335	+1			no_errors	ENST00000301843	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.938	A
CUBN	8029	genome.wustl.edu	37	10	16878337	16878337	+	Silent	SNP	C	C	T	rs147563157		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:16878337C>T	ENST00000377833.4	-	63	10142	c.10077G>A	c.(10075-10077)tcG>tcA	p.S3359S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3359	CUB 25. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A3360S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGGCACAGCCGAAGCATTTC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		17910	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											72.0	72.0	72.0					10																	16878337		2203	4300	6503	SO:0001819	synonymous_variant	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10077G>A	10.37:g.16878337C>T			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.S3359	ENST00000377833.4	37	c.10077	CCDS7113.1	10																																																																																			CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000107611		0.393	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1		0.00	95	0	C	NM_001081		16878337	-1			no_errors	ENST00000377833	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.000	T
CUL1	8454	genome.wustl.edu	37	7	148497645	148497645	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:148497645G>A	ENST00000325222.4	+	22	2581	c.2302G>A	c.(2302-2304)Gaa>Aaa	p.E768K	CUL1_ENST00000409469.1_Missense_Mutation_p.E768K|CUL1_ENST00000602748.1_Missense_Mutation_p.E768K	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	768					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AGTGGATGGTGAAAAGGACAC	0.388																																																	0													116.0	104.0	108.0					7																	148497645		2203	4300	6503	SO:0001583	missense	0			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.2302G>A	7.37:g.148497645G>A	ENSP00000326804:p.Glu768Lys		D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E768K	ENST00000325222.4	37	c.2302	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	.	22.8	4.342759	0.82022	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000433865	T;T	0.75260	-0.92;-0.92	5.59	5.59	0.84812	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.70081	0.3183	L	0.39085	1.19	0.80722	D	1	B;B	0.20052	0.019;0.041	B;B	0.23574	0.015;0.047	T	0.66114	-0.6004	10	0.62326	D	0.03	-0.1732	19.5934	0.95525	0.0:0.0:1.0:0.0	.	695;768	E7EWR0;Q13616	.;CUL1_HUMAN	K	768;768;695	ENSP00000387160:E768K;ENSP00000326804:E768K	ENSP00000326804:E768K	E	+	1	0	CUL1	148128578	1.000000	0.71417	0.971000	0.41717	0.967000	0.64934	9.466000	0.97665	2.635000	0.89317	0.467000	0.42956	GAA	CUL1	-	pfam_Cullin_neddylation_domain,smart_Cullin_neddylation_domain	ENSG00000055130		0.388	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	HGNC	protein_coding	OTTHUMT00000467785.1	-	0.00	81	0	G	NM_003592		148497645	+1	tier1	-	no_errors	ENST00000325222	ensembl	human	known	74_37	missense	54.10	28	33	SNP	1.000	A
CXorf57	55086	genome.wustl.edu	37	X	105855928	105855928	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:105855928G>T	ENST00000372548.4	+	1	727	c.618G>T	c.(616-618)aaG>aaT	p.K206N	CXorf57_ENST00000372544.2_Missense_Mutation_p.K206N	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	206							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TAACAGACAAGCAACCTGAGG	0.453																																																	0													84.0	87.0	86.0					X																	105855928		2203	4299	6502	SO:0001583	missense	0			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.618G>T	X.37:g.105855928G>T	ENSP00000361628:p.Lys206Asn		H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold	p.K206N	ENST00000372548.4	37	c.618	CCDS14519.1	X	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282577	0.23392	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.47177	0.85;0.85;0.86	4.03	2.19	0.27852	.	0.670897	0.14904	N	0.291645	T	0.48484	0.1502	L	0.44542	1.39	0.09310	N	0.999999	P;P;D	0.62365	0.582;0.582;0.991	B;B;P	0.61070	0.148;0.148;0.883	T	0.28681	-1.0036	10	0.37606	T	0.19	-9.6109	2.4619	0.04543	0.2315:0.0:0.509:0.2595	.	206;206;206	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	N	206;206;14	ENSP00000361623:K206N;ENSP00000361628:K206N;ENSP00000405866:K14N	ENSP00000361623:K206N	K	+	3	2	CXorf57	105742584	0.000000	0.05858	0.534000	0.28014	0.227000	0.25037	0.118000	0.15605	0.808000	0.34231	0.594000	0.82650	AAG	CXorf57	-	NULL	ENSG00000147231		0.453	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	HGNC	protein_coding	OTTHUMT00000057800.2	-	0.00	95	0	G	NM_018015		105855928	+1	tier1	-	no_errors	ENST00000372548	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.237	T
CYLC2	1539	genome.wustl.edu	37	9	105767853	105767853	+	Missense_Mutation	SNP	G	G	C	rs367661428		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:105767853G>C	ENST00000374798.3	+	5	1010	c.940G>C	c.(940-942)Gat>Cat	p.D314H	CYLC2_ENST00000487798.1_Missense_Mutation_p.D314H	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	314	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AGAATCTGCTGATTcaaagaa	0.398																																																	0													52.0	52.0	52.0					9																	105767853		2203	4300	6503	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.940G>C	9.37:g.105767853G>C	ENSP00000420256:p.Asp314His		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.D314H	ENST00000374798.3	37	c.940	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	G	8.366	0.834260	0.16820	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.23754	1.89;1.89	3.26	1.37	0.22104	.	6.028330	0.00166	N	0.000004	T	0.23133	0.0559	L	0.27053	0.805	0.09310	N	1	P	0.40794	0.729	B	0.43575	0.424	T	0.17289	-1.0374	10	0.48119	T	0.1	-0.0672	4.6349	0.12520	0.3004:0.0:0.6996:0.0	.	314	Q14093	CYLC2_HUMAN	H	314	ENSP00000420256:D314H;ENSP00000417674:D314H	ENSP00000420256:D314H	D	+	1	0	CYLC2	104807674	0.012000	0.17670	0.023000	0.16930	0.077000	0.17291	0.874000	0.28065	0.708000	0.31955	0.585000	0.79938	GAT	CYLC2	-	NULL	ENSG00000155833		0.398	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	-	0.00	125	0	G	NM_001340		105767853	+1	tier1	-	no_errors	ENST00000374798	ensembl	human	known	74_37	missense	64.18	24	43	SNP	0.005	C
DBF4	10926	genome.wustl.edu	37	7	87537005	87537005	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:87537005C>G	ENST00000265728.1	+	12	2056	c.1552C>G	c.(1552-1554)Ctc>Gtc	p.L518V		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	518					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AGCAAAGGATCTCAAGGAAAA	0.378																																																	0													76.0	75.0	75.0					7																	87537005		2203	4300	6503	SO:0001583	missense	0			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1552C>G	7.37:g.87537005C>G	ENSP00000265728:p.Leu518Val		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.L518V	ENST00000265728.1	37	c.1552	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903799	0.52333	.	.	ENSG00000006634	ENST00000265728	T	0.40225	1.04	5.16	1.17	0.20885	.	0.540328	0.16131	N	0.228204	T	0.41511	0.1162	L	0.34521	1.04	0.25112	N	0.990702	D;D	0.71674	0.996;0.998	P;P	0.62813	0.907;0.899	T	0.16808	-1.0390	10	0.44086	T	0.13	0.9461	2.7514	0.05282	0.3668:0.368:0.0:0.2653	.	294;518	B7Z8C6;Q9UBU7	.;DBF4A_HUMAN	V	518	ENSP00000265728:L518V	ENSP00000265728:L518V	L	+	1	0	DBF4	87374941	0.731000	0.28111	0.713000	0.30519	0.984000	0.73092	-0.168000	0.09925	0.253000	0.21552	0.655000	0.94253	CTC	DBF4	-	NULL	ENSG00000006634		0.378	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	HGNC	protein_coding	OTTHUMT00000253678.1	-	0.00	57	0	C	NM_006716		87537005	+1	tier1	-	no_errors	ENST00000265728	ensembl	human	known	74_37	missense	36.11	46	26	SNP	0.724	G
DCAF12L2	340578	genome.wustl.edu	37	X	125299586	125299586	+	Missense_Mutation	SNP	C	C	T	rs377444816		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:125299586C>T	ENST00000360028.2	-	1	348	c.322G>A	c.(322-324)Gcc>Acc	p.A108T	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.A108T			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	108										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						ACCTGCCTGGCGTTCAGCCAC	0.652																																																	0													70.0	62.0	65.0					X																	125299586		2203	4300	6503	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.322G>A	X.37:g.125299586C>T	ENSP00000353128:p.Ala108Thr		B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A108T	ENST00000360028.2	37	c.322	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	c	9.715	1.158110	0.21454	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.62105	0.05;0.05	3.42	-0.409	0.12378	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.47544	0.1451	L	0.54323	1.7	0.27304	N	0.957504	B	0.14438	0.01	B	0.06405	0.002	T	0.37526	-0.9702	9	0.33141	T	0.24	.	0.5098	0.00593	0.1804:0.2945:0.175:0.3501	.	108	Q5VW00	DC122_HUMAN	T	108	ENSP00000441489:A108T;ENSP00000353128:A108T	ENSP00000353128:A108T	A	-	1	0	DCAF12L2	125127267	1.000000	0.71417	0.888000	0.34837	0.714000	0.41099	1.098000	0.31000	-0.243000	0.09653	-1.480000	0.00990	GCC	DCAF12L2	-	superfamily_WD40_repeat_dom	ENSG00000198354		0.652	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	50	0	C	NM_001013628		125299586	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.993	T
DCAF12L1	139170	genome.wustl.edu	37	X	125685531	125685531	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:125685531C>T	ENST00000371126.1	-	1	1303	c.1061G>A	c.(1060-1062)cGg>cAg	p.R354Q		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	354										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GCTCAGCGACCGCACGCCTGT	0.622																																																	0													33.0	34.0	33.0					X																	125685531		2203	4300	6503	SO:0001583	missense	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1061G>A	X.37:g.125685531C>T	ENSP00000360167:p.Arg354Gln		Q8IYK3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R354Q	ENST00000371126.1	37	c.1061	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611652	0.46631	.	.	ENSG00000198889	ENST00000371126	T	0.63913	-0.07	3.64	-0.288	0.12855	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.36409	N	0.002616	T	0.64681	0.2620	M	0.83774	2.66	0.30920	N	0.728146	D	0.71674	0.998	P	0.50860	0.652	T	0.64398	-0.6417	10	0.48119	T	0.1	.	4.6796	0.12729	0.0:0.5223:0.1606:0.3171	.	354	Q5VU92	DC121_HUMAN	Q	354	ENSP00000360167:R354Q	ENSP00000360167:R354Q	R	-	2	0	DCAF12L1	125513212	0.997000	0.39634	0.001000	0.08648	0.132000	0.20833	3.420000	0.52735	-0.185000	0.10550	0.429000	0.28392	CGG	DCAF12L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198889		0.622	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	-	0.00	58	0	C	NM_178470		125685531	-1	tier1	-	no_errors	ENST00000371126	ensembl	human	known	74_37	missense	47.37	10	9	SNP	0.930	T
DDX19A	55308	genome.wustl.edu	37	16	70404231	70404231	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:70404231G>T	ENST00000302243.7	+	10	1289	c.1126G>T	c.(1126-1128)Gag>Tag	p.E376*	DDX19A_ENST00000443119.2_Nonsense_Mutation_p.E286*|DDX19A_ENST00000417604.2_Nonsense_Mutation_p.E345*	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	376	C-terminal lobe. {ECO:0000250}.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				TGCGGTGATTGAGCGCTTCCG	0.602																																																	0													145.0	122.0	130.0					16																	70404231		2198	4300	6498	SO:0001587	stop_gained	0			AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.1126G>T	16.37:g.70404231G>T	ENSP00000306117:p.Glu376*		B2RPL0|B4DRZ7|Q53FM0	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E376*	ENST00000302243.7	37	c.1126	CCDS10889.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.155187	0.94686	.	.	ENSG00000168872	ENST00000302243;ENST00000302227;ENST00000417604;ENST00000443119	.	.	.	5.19	5.19	0.71726	.	0.094433	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	16.2172	0.82238	0.0:0.0:1.0:0.0	.	.	.	.	X	376;268;345;286	.	ENSP00000306209:E268X	E	+	1	0	DDX19A	68961732	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.041000	0.70988	2.419000	0.82065	0.491000	0.48974	GAG	DDX19A	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000168872		0.602	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX19A	HGNC	protein_coding	OTTHUMT00000268967.2	-	0.00	56	0	G	NM_018332		70404231	+1	tier1	-	no_errors	ENST00000302243	ensembl	human	known	74_37	nonsense	34.78	30	16	SNP	1.000	T
DEPDC5	9681	genome.wustl.edu	37	22	32215189	32215189	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:32215189C>T	ENST00000382112.3	+	21	1918	c.1848C>T	c.(1846-1848)cgC>cgT	p.R616R	DEPDC5_ENST00000382111.2_Silent_p.R616R|DEPDC5_ENST00000535622.1_Silent_p.R616R|DEPDC5_ENST00000382105.2_Silent_p.R616R|DEPDC5_ENST00000536766.1_Silent_p.R588R|DEPDC5_ENST00000266091.3_Silent_p.R616R|DEPDC5_ENST00000400246.1_Silent_p.R616R|DEPDC5_ENST00000400248.2_Silent_p.R616R|DEPDC5_ENST00000400249.2_Silent_p.R616R	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	616					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACAGAAGGCGCTGGATGCACA	0.557																																																	0													110.0	108.0	109.0					22																	32215189		2009	4184	6193	SO:0001819	synonymous_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1848C>T	22.37:g.32215189C>T			A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.R616	ENST00000382112.3	37	c.1848	CCDS46692.1	22																																																																																			DEPDC5	-	NULL	ENSG00000100150		0.557	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	-	0.00	31	0	C	NM_014662		32215189	+1	tier1	-	no_errors	ENST00000266091	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.943	T
DERA	51071	genome.wustl.edu	37	12	16109917	16109917	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:16109917A>T	ENST00000428559.2	+	2	291	c.79A>T	c.(79-81)Agg>Tgg	p.R27W	DERA_ENST00000526530.1_De_novo_Start_InFrame|DERA_ENST00000532964.1_Missense_Mutation_p.R27W	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	27					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				GGCAGTTCTGAGGCGTGCGGA	0.428																																																	0													71.0	71.0	71.0					12																	16109917		1882	4099	5981	SO:0001583	missense	0			AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.79A>T	12.37:g.16109917A>T	ENSP00000416583:p.Arg27Trp		Q53HN9|Q6PHW2	Missense_Mutation	SNP	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	p.R27W	ENST00000428559.2	37	c.79	CCDS44838.1	12	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002877	0.74932	.	.	ENSG00000023697	ENST00000428559;ENST00000531803;ENST00000532964	.	.	.	5.14	3.96	0.45880	.	0.151527	0.64402	D	0.000014	T	0.77039	0.4072	M	0.84511	2.7	0.80722	D	1	D	0.69078	0.997	P	0.61328	0.887	T	0.79671	-0.1706	9	0.87932	D	0	-20.8191	10.863	0.46837	0.8422:0.1578:0.0:0.0	.	27	Q9Y315	DEOC_HUMAN	W	27;48;27	.	ENSP00000416583:R27W	R	+	1	2	DERA	16001184	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	4.212000	0.58514	0.933000	0.37291	0.533000	0.62120	AGG	DERA	-	NULL	ENSG00000023697		0.428	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERA	HGNC	protein_coding	OTTHUMT00000384731.1	-	0.00	60	0	A	NM_015954		16109917	+1	tier1	-	no_errors	ENST00000428559	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.983	T
DHRS7C	201140	genome.wustl.edu	37	17	9674864	9674864	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:9674864A>G	ENST00000330255.5	-	6	892	c.880T>C	c.(880-882)Ttt>Ctt	p.F294L	DHRS7C_ENST00000571134.1_Missense_Mutation_p.F293L	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	294					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						ACGGCGAAAAAGAACTCCGGG	0.592																																																	0													49.0	56.0	53.0					17																	9674864		2029	4169	6198	SO:0001583	missense	0				CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.880T>C	17.37:g.9674864A>G	ENSP00000327975:p.Phe294Leu		B7ZW74|B9EJH3	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.F294L	ENST00000330255.5	37	c.880	CCDS56020.1	17	.	.	.	.	.	.	.	.	.	.	A	14.67	2.603295	0.46423	.	.	ENSG00000184544	ENST00000330255	D	0.85556	-2.0	5.5	5.5	0.81552	.	0.049428	0.85682	D	0.000000	D	0.82444	0.5038	L	0.52126	1.63	0.45762	D	0.998657	B;B	0.26809	0.141;0.16	B;B	0.27380	0.046;0.079	T	0.81102	-0.1085	10	0.62326	D	0.03	.	14.7364	0.69419	1.0:0.0:0.0:0.0	.	294;290	A6NNS2;B9EJH3	DRS7C_HUMAN;.	L	294	ENSP00000327975:F294L	ENSP00000327975:F294L	F	-	1	0	DHRS7C	9615589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.454000	0.60068	2.302000	0.77476	0.533000	0.62120	TTT	DHRS7C	-	NULL	ENSG00000184544		0.592	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	DHRS7C	HGNC	protein_coding	OTTHUMT00000439863.1	-	0.00	81	0	A	XM_113912		9674864	-1	tier1	-	no_errors	ENST00000330255	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	G
ACAA1	30	genome.wustl.edu	37	3	38163174	38163174	+	IGR	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:38163174G>T	ENST00000333167.8	-	0	1785				DLEC1_ENST00000308059.6_Missense_Mutation_p.W1641L|ACAA1_ENST00000480865.1_5'Flank|DLEC1_ENST00000452631.2_Missense_Mutation_p.W1644L|DLEC1_ENST00000346219.3_Missense_Mutation_p.W1641L	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TCCACCAGCTGGGTGGACTTT	0.627																																																	0													62.0	69.0	67.0					3																	38163174		2073	4194	6267	SO:0001628	intergenic_variant	0			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38163174G>T			G5E935|Q96CA6	Missense_Mutation	SNP	superfamily_PapD-like	p.W1641L	ENST00000333167.8	37	c.4922	CCDS2673.1	3	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416878	0.42918	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.38240	1.15;1.15;1.15	4.52	4.52	0.55395	.	0.566803	0.17853	N	0.159774	T	0.27313	0.0670	L	0.60455	1.87	0.27964	N	0.93665	B;B;P;B;B	0.38078	0.174;0.174;0.617;0.174;0.174	B;B;B;B;B	0.37144	0.069;0.069;0.242;0.069;0.069	T	0.13548	-1.0505	10	0.10111	T	0.7	-12.8401	4.1933	0.10431	0.0852:0.272:0.4968:0.1459	.	1644;1641;1641;1641;1641	F8W6T4;B1B5Y4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;.;DLEC1_HUMAN	L	1641;1641;1644	ENSP00000308597:W1641L;ENSP00000315914:W1641L;ENSP00000410427:W1644L	ENSP00000308597:W1641L	W	+	2	0	DLEC1	38138178	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.140000	0.31516	2.237000	0.73441	0.556000	0.70494	TGG	DLEC1	-	NULL	ENSG00000008226		0.627	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000342980.1	-	0.00	37	0	G	NM_001607		38163174	+1	tier1	-	no_errors	ENST00000346219	ensembl	human	known	74_37	missense	83.33	4	20	SNP	1.000	T
DLGAP1	9229	genome.wustl.edu	37	18	3879663	3879663	+	Missense_Mutation	SNP	C	C	T	rs575139844	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:3879663C>T	ENST00000315677.3	-	4	1001	c.406G>A	c.(406-408)Ggc>Agc	p.G136S	DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000581527.1_Missense_Mutation_p.G136S|DLGAP1_ENST00000515196.2_Missense_Mutation_p.G136S|DLGAP1_ENST00000584874.1_Missense_Mutation_p.G136S	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	136					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CGGATGCGGCCGGGGCTGTCG	0.682													C|||	5	0.000998403	0.0	0.0	5008	,	,		14835	0.0		0.0	False		,,,				2504	0.0051																0													61.0	70.0	67.0					18																	3879663		2203	4299	6502	SO:0001583	missense	0			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.406G>A	18.37:g.3879663C>T	ENSP00000316377:p.Gly136Ser		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.G136S	ENST00000315677.3	37	c.406	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593694	0.86953	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.18174	2.23;2.23	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	L	0.54965	1.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.01679	-1.1297	10	0.30854	T	0.27	-33.3494	19.4529	0.94875	0.0:1.0:0.0:0.0	.	136;136;136	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	S	136	ENSP00000316377:G136S;ENSP00000445973:G136S	ENSP00000316377:G136S	G	-	1	0	DLGAP1	3869663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.788000	0.85771	2.595000	0.87683	0.655000	0.94253	GGC	DLGAP1	-	NULL	ENSG00000170579		0.682	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	-	0.00	14	0	C			3879663	-1	tier1	-	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	T
DMXL2	23312	genome.wustl.edu	37	15	51857295	51857295	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:51857295C>G	ENST00000251076.5	-	4	641	c.354G>C	c.(352-354)tgG>tgC	p.W118C	DMXL2_ENST00000449909.3_Missense_Mutation_p.W118C|DMXL2_ENST00000543779.2_Missense_Mutation_p.W118C|DMXL2_ENST00000560421.1_5'UTR	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	118						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CTTGAGGATCCCATGCTAAGT	0.284																																																	0													31.0	31.0	31.0					15																	51857295		2195	4291	6486	SO:0001583	missense	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.354G>C	15.37:g.51857295C>G	ENSP00000251076:p.Trp118Cys		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W118C	ENST00000251076.5	37	c.354	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856071	0.71834	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.13778	2.56;2.56;2.56	4.9	4.9	0.64082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.43299	0.1241	M	0.82823	2.61	0.51482	D	0.999924	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.994;0.991	T	0.49466	-0.8937	10	0.87932	D	0	.	18.4422	0.90670	0.0:1.0:0.0:0.0	.	118;118;118	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	C	118	ENSP00000251076:W118C;ENSP00000441858:W118C;ENSP00000400855:W118C	ENSP00000251076:W118C	W	-	3	0	DMXL2	49644587	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.430000	0.73391	2.419000	0.82065	0.655000	0.94253	TGG	DMXL2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000104093		0.284	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	-	0.00	154	0	C	NM_015263		51857295	-1	tier1	-	no_errors	ENST00000543779	ensembl	human	known	74_37	missense	20.92	121	32	SNP	1.000	G
DNAH12	201625	genome.wustl.edu	37	3	57391391	57391391	+	Missense_Mutation	SNP	G	G	T	rs545635344	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:57391391G>T	ENST00000351747.2	-	41	6688	c.6508C>A	c.(6508-6510)Caa>Aaa	p.Q2170K		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2170					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GGTGCATTTTGTTTCCTCAAA	0.289													G|||	2	0.000399361	0.0	0.0	5008	,	,		19176	0.002		0.0	False		,,,				2504	0.0																0													56.0	45.0	48.0					3																	57391391		692	1591	2283	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6508C>A	3.37:g.57391391G>T	ENSP00000295937:p.Gln2170Lys		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q2170K	ENST00000351747.2	37	c.6508		3	.	.	.	.	.	.	.	.	.	.	G	3.291	-0.144873	0.06627	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.21543	2.15;2.0	5.92	4.14	0.48551	.	.	.	.	.	T	0.09113	0.0225	N	0.05124	-0.11	0.39194	D	0.96302	B	0.02656	0.0	B	0.01281	0.0	T	0.13335	-1.0513	9	0.07030	T	0.85	.	11.5707	0.50832	0.0:0.8018:0.1305:0.0677	.	2170	Q6ZR08	DYH12_HUMAN	K	2170;2189	ENSP00000295937:Q2170K;ENSP00000418137:Q2189K	ENSP00000295937:Q2170K	Q	-	1	0	DNAH12	57366431	0.990000	0.36364	0.257000	0.24404	0.827000	0.46813	2.536000	0.45693	0.838000	0.34948	-0.171000	0.13296	CAA	DNAH12	-	NULL	ENSG00000174844		0.289	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding			0.00	50	0	G	NM_178504		57391391	-1			no_errors	ENST00000351747	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.443	T
DSP	1832	genome.wustl.edu	37	6	7580047	7580048	+	Frame_Shift_Ins	INS	-	-	AAGT			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:7580047_7580048insAAGT	ENST00000379802.3	+	23	3965_3966	c.3624_3625insAAGT	c.(3625-3627)aagfs	p.-1209fs	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATTTAAGGAACAAGTATGAAAC	0.391																																																	0																																										SO:0001589	frameshift_variant	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3625_3628dupAAGT	6.37:g.7580048_7580051dupAAGT	ENSP00000369129:p.Lys1209fs		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Frame_Shift_Ins	INS	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Y1209fs	ENST00000379802.3	37	c.3624_3625	CCDS4501.1	6																																																																																			DSP	-	NULL	ENSG00000096696		0.391	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2		0.00	43	0	-	NM_004415		7580048	+1	tier1		no_errors	ENST00000379802	ensembl	human	known	74_37	frame_shift_ins	45.45	12	10	INS	1.000:1.000	AAGT
DSE	29940	genome.wustl.edu	37	6	116579735	116579735	+	Silent	SNP	T	T	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:116579735T>A	ENST00000540275.1	+	2	250	c.129T>A	c.(127-129)ctT>ctA	p.L43L	RP3-486I3.7_ENST00000448740.2_lincRNA			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	0					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GAGGAGCCCTTGGCAGCATTG	0.552																																																	0																																										SO:0001819	synonymous_variant	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000540275.1:c.129T>A	6.37:g.116579735T>A			Q5R3K6	Silent	SNP	NULL	p.L43	ENST00000540275.1	37	c.129		6																																																																																			DSE	-	NULL	ENSG00000111817		0.552	DSE-203	KNOWN	basic	protein_coding	DSE	HGNC	protein_coding		-	0.00	18	0	T	NM_013352		116579735	+1	tier1	-	no_errors	ENST00000540275	ensembl	human	known	74_37	silent	56.25	7	9	SNP	1.000	A
DYNC1H1	1778	genome.wustl.edu	37	14	102470942	102470942	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:102470942G>T	ENST00000360184.4	+	24	5135	c.4971G>T	c.(4969-4971)atG>atT	p.M1657I		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1657	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCAAGAAGATGTTTGCTGGAG	0.363																																																	0													107.0	101.0	103.0					14																	102470942		2203	4300	6503	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4971G>T	14.37:g.102470942G>T	ENSP00000348965:p.Met1657Ile		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.M1657I	ENST00000360184.4	37	c.4971	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.178027	0.94846	.	.	ENSG00000197102	ENST00000360184	T	0.61158	0.13	5.73	5.73	0.89815	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80728	-0.1253	10	0.51188	T	0.08	.	19.9019	0.96988	0.0:0.0:1.0:0.0	.	1657	Q14204	DYHC1_HUMAN	I	1657	ENSP00000348965:M1657I	ENSP00000348965:M1657I	M	+	3	0	DYNC1H1	101540695	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.802000	0.99131	2.706000	0.92434	0.563000	0.77884	ATG	DYNC1H1	-	pfam_Dynein_heavy_dom-2,superfamily_Thioredoxin-like_fold	ENSG00000197102		0.363	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1		0.00	93	0	G	NM_001376		102470942	+1			no_errors	ENST00000360184	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	T
EFTUD2	9343	genome.wustl.edu	37	17	42931671	42931671	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:42931671C>G	ENST00000426333.2	-	23	2610	c.2313G>C	c.(2311-2313)caG>caC	p.Q771H	EFTUD2_ENST00000591382.1_Missense_Mutation_p.Q771H|EFTUD2_ENST00000592576.1_Missense_Mutation_p.Q761H|EFTUD2_ENST00000402521.3_Missense_Mutation_p.Q736H	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	771					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				TGGTTCCCCACTGGAAACCTT	0.572																																					Ovarian(10;65 485 10258 29980 30707)												0													125.0	120.0	122.0					17																	42931671		2203	4300	6503	SO:0001583	missense	0			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.2313G>C	17.37:g.42931671C>G	ENSP00000392094:p.Gln771His		B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.Q771H	ENST00000426333.2	37	c.2313	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285630	0.80803	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.32988	1.43;1.43	5.16	4.19	0.49359	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.68677	0.3027	H	0.97635	4.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.80957	-0.1150	10	0.87932	D	0	-21.5944	13.8802	0.63678	0.0:0.9269:0.0:0.0731	.	761;771	B4DMC0;Q15029	.;U5S1_HUMAN	H	771;761;736	ENSP00000392094:Q771H;ENSP00000385873:Q736H	ENSP00000262414:Q761H	Q	-	3	2	EFTUD2	40287197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.972000	0.49256	1.417000	0.47077	0.561000	0.74099	CAG	EFTUD2	-	pfam_Transl_elong_EFG/EF2_IV,superfamily_Ribosomal_S5_D2-typ_fold,smart_Transl_elong_EFG/EF2_IV	ENSG00000108883		0.572	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1	-	0.00	43	0	C	NM_004247		42931671	-1	tier1	-	no_errors	ENST00000426333	ensembl	human	known	74_37	missense	9.62	47	5	SNP	1.000	G
EGF	1950	genome.wustl.edu	37	4	110915911	110915911	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:110915911C>T	ENST00000265171.5	+	20	3325	c.2880C>T	c.(2878-2880)ctC>ctT	p.L960L	EGF_ENST00000509793.1_Silent_p.L918L|RNU6-35P_ENST00000384530.1_RNA|EGF_ENST00000503392.1_Silent_p.L919L	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	960					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CCCCTCACCTCAGGGAAGATG	0.433																																																	0													142.0	128.0	133.0					4																	110915911		2203	4300	6503	SO:0001819	synonymous_variant	0			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2880C>T	4.37:g.110915911C>T			B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Silent	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.L960	ENST00000265171.5	37	c.2880	CCDS3689.1	4																																																																																			EGF	-	pirsf_Pro-epidermal_GF	ENSG00000138798		0.433	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	-	0.00	47	0	C			110915911	+1	tier1	-	no_errors	ENST00000265171	ensembl	human	known	74_37	silent	20.00	28	7	SNP	0.000	T
SPG11	80208	genome.wustl.edu	37	15	44853291	44853291	+	IGR	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:44853291G>A	ENST00000261866.7	-	0	7774				EIF3J_ENST00000261868.5_Missense_Mutation_p.A241T|RP11-151N17.1_ENST00000558006.1_RNA|EIF3J_ENST00000424492.3_Missense_Mutation_p.A192T|EIF3J_ENST00000535391.1_Missense_Mutation_p.A187T	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)						cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AGATGATCTGGCAGATTATGG	0.388																																																	0													269.0	231.0	244.0					15																	44853291		2198	4298	6496	SO:0001628	intergenic_variant	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199		15.37:g.44853291G>A			A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	pfam_eIF3j	p.A241T	ENST00000261866.7	37	c.721	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645575	0.47258	.	.	ENSG00000104131	ENST00000261868;ENST00000535391;ENST00000424492	T;T;T	0.45276	0.9;0.9;0.9	5.23	4.3	0.51218	.	0.065165	0.64402	D	0.000015	T	0.47021	0.1423	L	0.52759	1.655	0.40334	D	0.97896	P;P;P	0.51791	0.948;0.879;0.948	P;B;P	0.51918	0.684;0.402;0.684	T	0.39121	-0.9629	10	0.14252	T	0.57	.	16.094	0.81109	0.0:0.1343:0.8657:0.0	.	187;192;241	B4DUI3;F5H425;O75822	.;.;EIF3J_HUMAN	T	241;187;192	ENSP00000261868:A241T;ENSP00000440221:A187T;ENSP00000414548:A192T	ENSP00000261868:A241T	A	+	1	0	EIF3J	42640583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.709000	0.74665	1.307000	0.44944	0.561000	0.74099	GCA	EIF3J	-	pfam_eIF3j	ENSG00000104131		0.388	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF3J	HGNC	protein_coding	OTTHUMT00000253927.1		0.00	75	0	G			44853291	+1			no_errors	ENST00000261868	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
EIF4G3	8672	genome.wustl.edu	37	1	21219891	21219893	+	Intron	DEL	TCT	TCT	-	rs558158883	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:21219891_21219893delTCT	ENST00000264211.8	-	12	2280				EIF4G3_ENST00000374937.3_Intron|EIF4G3_ENST00000400422.1_Intron|EIF4G3_ENST00000374935.3_Intron|EIF4G3_ENST00000602326.1_Intron|EIF4G3_ENST00000537738.1_Intron|EIF4G3_ENST00000536266.1_Intron|EIF4G3_ENST00000374933.3_5'UTR	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3						cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGTCTTTGCCTCTTCTTCTTCTT	0.379														21	0.00419329	0.0106	0.0014	5008	,	,		19673	0.001		0.0	False		,,,				2504	0.0051																0																																										SO:0001627	intron_variant	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2085+116AGA>-	1.37:g.21219900_21219902delTCT			B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	RNA	DEL	-	NULL	ENST00000264211.8	37	NULL	CCDS214.1	1																																																																																			EIF4G3	-	-	ENSG00000075151		0.379	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3		0.00	22	0	TCT	NM_003760		21219893	-1	tier1		no_errors	ENST00000374933	ensembl	human	known	74_37	rna	12.50	21	3	DEL	0.781:0.836:0.918	-
ELFN2	114794	genome.wustl.edu	37	22	37769180	37769180	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:37769180C>T	ENST00000402918.2	-	3	3180	c.2395G>A	c.(2395-2397)Gcc>Acc	p.A799T	RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	799					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TCGTCCTTGGCGAACTGGACC	0.632																																																	0													96.0	87.0	90.0					22																	37769180		2203	4300	6503	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.2395G>A	22.37:g.37769180C>T	ENSP00000385277:p.Ala799Thr		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.A799T	ENST00000402918.2	37	c.2395	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573500	0.86542	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.70399	-0.48;-0.48	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.82614	0.5075	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85059	0.0933	10	0.87932	D	0	-21.9554	17.8461	0.88730	0.0:1.0:0.0:0.0	.	799	Q5R3F8	PPR29_HUMAN	T	799	ENSP00000300147:A799T;ENSP00000385277:A799T	ENSP00000300147:A799T	A	-	1	0	ELFN2	36099126	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.623000	0.83113	2.265000	0.75225	0.561000	0.74099	GCC	ELFN2	-	NULL	ENSG00000166897		0.632	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	-	0.00	51	0	C	NM_052906		37769180	-1	tier1	-	no_errors	ENST00000402918	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	T
KRT16P3	644945	genome.wustl.edu	37	17	20418649	20418649	+	RNA	SNP	C	C	T	rs545809189	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:20418649C>T	ENST00000580113.1	-	0	0				AC025627.9_ENST00000581013.1_RNA					keratin 16 pseudogene 3																		CACCTCACCTCGTGGTTCTTC	0.632													c|||	3	0.000599042	0.0	0.0	5008	,	,		20756	0.003		0.0	False		,,,				2504	0.0																0																																												0			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20418649C>T				RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			AC025627.9	-	-	ENSG00000231645		0.632	KRT16P3-004	KNOWN	basic	processed_transcript	ENSG00000231645	Clone_based_vega_gene	pseudogene	OTTHUMT00000443764.1	-	0.00	87	0	C	NR_029393		20418649	-1	tier1	-	no_errors	ENST00000581013	ensembl	human	known	74_37	rna	25.64	29	10	SNP	1.000	T
CTD-2026G22.1	0	genome.wustl.edu	37	11	49391909	49391909	+	RNA	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:49391909C>A	ENST00000529081.1	+	0	233																											TCTTGGACGTCCTCGGTGGAA	0.299																																																	0																																												0																															11.37:g.49391909C>A				RNA	SNP	-	NULL	ENST00000529081.1	37	NULL		11																																																																																			CTD-2026G22.1	-	-	ENSG00000255532		0.299	CTD-2026G22.1-002	KNOWN	basic	processed_transcript	ENSG00000255532	Clone_based_vega_gene	pseudogene	OTTHUMT00000391375.1	-	0.00	123	0	C			49391909	+1	tier1	-	no_errors	ENST00000529081	ensembl	human	known	74_37	rna	21.50	84	23	SNP	1.000	A
MGAM2	93432	genome.wustl.edu	37	7	141838447	141838447	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:141838447C>A	ENST00000477922.3	+	10	1120	c.1066C>A	c.(1066-1068)Cgt>Agt	p.R356S	RP11-1220K2.2_ENST00000550469.2_Missense_Mutation_p.R356S																endometrium(1)|lung(5)	6						AAGCCGAAATCGTTTAGCTGA	0.393																																																	0																																										SO:0001583	missense	0																														ENST00000477922.3:c.1066C>A	7.37:g.141838447C>A	ENSP00000420449:p.Arg356Ser			Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.R356S	ENST00000477922.3	37	c.1066		7	.	.	.	.	.	.	.	.	.	.	c	18.85	3.711010	0.68730	.	.	ENSG00000257743	ENST00000550469;ENST00000477922	D	0.91740	-2.9	4.64	4.64	0.57946	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.93268	0.7855	.	.	.	.	.	.	D	0.54397	0.966	P	0.55713	0.782	D	0.94807	0.7975	7	0.52906	T	0.07	.	10.4421	0.44472	0.1945:0.8055:0.0:0.0	.	356	Q2M2H8	MGAL2_HUMAN	S	356	ENSP00000447431:R356S	ENSP00000380641:R356S	R	+	1	0	RP11-1220K2.2	141484916	0.996000	0.38824	0.069000	0.20011	0.286000	0.27126	2.591000	0.46163	2.567000	0.86603	0.563000	0.77884	CGT	RP11-1220K2.2	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257743		0.393	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	Clone_based_vega_gene	protein_coding	OTTHUMT00000351325.3	-	0.00	97	0	C			141838447	+1	tier1	-	no_errors	ENST00000477922	ensembl	human	putative	74_37	missense	5.56	68	4	SNP	0.990	A
ACOT6	641372	genome.wustl.edu	37	14	74083610	74083610	+	5'UTR	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:74083610C>T	ENST00000381139.1	+	0	63				RP3-414A15.10_ENST00000555500.1_RNA|RP3-414A15.10_ENST00000555011.1_RNA	NM_001037162.1	NP_001032239.1	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6							cytosol (GO:0005829)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00331)		ATCTCTCTACCCCCAATCTCC	0.378																																																	0																																										SO:0001623	5_prime_UTR_variant	0			DQ082756, BF109853	CCDS32118.1	14q24.3	2011-02-16			ENSG00000205669	ENSG00000205669		"""Acyl CoA thioesterases"""	33159	protein-coding gene	gene with protein product		614267	"""chromosome 14 open reading frame 42"""	C14orf42		16940157	Standard	NM_001037162		Approved		uc001xop.3	Q3I5F7		ENST00000381139.1:c.-269C>T	14.37:g.74083610C>T				RNA	SNP	-	NULL	ENST00000381139.1	37	NULL	CCDS32118.1	14																																																																																			RP3-414A15.10	-	-	ENSG00000258603		0.378	ACOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258603	Clone_based_vega_gene	protein_coding	OTTHUMT00000414437.1	-	0.00	16	0	C	NM_001037162		74083610	-1	tier1	-	no_errors	ENST00000555011	ensembl	human	known	74_37	rna	33.33	14	7	SNP	0.002	T
ARIH1	25820	genome.wustl.edu	37	15	72766629	72766629	+	5'Flank	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:72766629C>T	ENST00000379887.4	+	0	0				RP11-1007O24.3_ENST00000565181.1_lincRNA	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1						cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						AGTGACGCGACGACGCAGCGC	0.716																																																	0																																										SO:0001631	upstream_gene_variant	0			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474		15.37:g.72766629C>T	Exception_encountered		B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	RNA	SNP	-	NULL	ENST00000379887.4	37	NULL	CCDS10244.1	15																																																																																			RP11-1007O24.3	-	-	ENSG00000261423		0.716	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261423	Clone_based_vega_gene	protein_coding	OTTHUMT00000257350.1	-	0.00	18	0	C	NM_005744		72766629	-1	tier1	-	no_errors	ENST00000565181	ensembl	human	known	74_37	rna	33.33	12	6	SNP	0.986	T
TBC1D3P3	653017	genome.wustl.edu	37	17	20451588	20451588	+	lincRNA	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:20451588C>T	ENST00000591705.1	+	0	2905																											CACCAGGCCCCGGATGTTCAT	0.498																																																	0																																												0																															17.37:g.20451588C>T				RNA	SNP	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			RP11-434D2.3	-	-	ENSG00000267075		0.498	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	Clone_based_vega_gene	lincRNA	OTTHUMT00000441761.2	-	0.00	37	0	C			20451588	+1	tier1	-	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	11.76	30	4	SNP	1.000	T
EPM2A	7957	genome.wustl.edu	37	6	145992502	145992502	+	Intron	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:145992502G>A	ENST00000367519.3	-	2	1002				EPM2A_ENST00000496228.1_5'UTR	NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)						autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		CCATCTTGAGGCACAACTGGA	0.398																																																	0																																										SO:0001627	intron_variant	0			AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.476+14755C>T	6.37:g.145992502G>A			B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	RNA	SNP	-	NULL	ENST00000367519.3	37	NULL	CCDS5206.1	6																																																																																			EPM2A	-	-	ENSG00000112425		0.398	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2A	HGNC	protein_coding	OTTHUMT00000042564.1	-	0.00	66	0	G			145992502	-1	tier1	-	no_errors	ENST00000461700	ensembl	human	known	74_37	rna	26.09	51	18	SNP	0.004	A
EPS15	2060	genome.wustl.edu	37	1	51887718	51887719	+	Intron	INS	-	-	A	rs574390223|rs11330309	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:51887718_51887719insA	ENST00000371733.3	-	13	1137				EPS15_ENST00000396122.4_Intron|EPS15_ENST00000371730.2_Intron|EPS15_ENST00000493793.1_5'UTR	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15						cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						GCTCCATTTGTAAAAAAAAAAT	0.267			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)																																								SO:0001627	intron_variant	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1041-188->T	1.37:g.51887728_51887728dupA			B2R8J7|D3DPJ2|Q5SRH4	RNA	INS	-	NULL	ENST00000371733.3	37	NULL	CCDS557.1	1																																																																																			EPS15	-	-	ENSG00000085832		0.267	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1		0.00	21	0	-	NM_001981		51887719	-1	tier1		no_errors	ENST00000493793	ensembl	human	known	74_37	rna	25.00	12	4	INS	0.103:0.380	A
EVA1C	59271	genome.wustl.edu	37	21	33887546	33887546	+	3'UTR	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr21:33887546G>A	ENST00000300255.2	+	0	1845				EVA1C_ENST00000401402.3_3'UTR|EVA1C_ENST00000382699.3_3'UTR|EVA1C_ENST00000485488.1_3'UTR	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)							integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										AAGAAGGAAGGATCCCAAATG	0.478																																																	0													58.0	59.0	59.0					21																	33887546		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.*46G>A	21.37:g.33887546G>A			A6ND58|Q8IXZ0	RNA	SNP	-	NULL	ENST00000300255.2	37	NULL	CCDS13614.1	21																																																																																			EVA1C	-	-	ENSG00000166979		0.478	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVA1C	HGNC	protein_coding	OTTHUMT00000139403.1	-	0.00	48	0	G	NM_058187		33887546	+1	tier1	-	no_errors	ENST00000485488	ensembl	human	known	74_37	rna	13.51	96	15	SNP	0.305	A
FAM114A2	10827	genome.wustl.edu	37	5	153381887	153381887	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:153381887G>A	ENST00000351797.4	-	11	1256	c.1180C>T	c.(1180-1182)Cac>Tac	p.H394Y	FAM114A2_ENST00000522858.1_Missense_Mutation_p.H394Y|FAM114A2_ENST00000520313.1_Missense_Mutation_p.H324Y|FAM114A2_ENST00000520667.1_Missense_Mutation_p.H394Y	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	394							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						GCTGTTTTGTGGAATAGTTCA	0.443																																																	0													141.0	134.0	137.0					5																	153381887		2203	4300	6503	SO:0001583	missense	0			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.1180C>T	5.37:g.153381887G>A	ENSP00000341597:p.His394Tyr		B2R8D8|Q9H7E0	Missense_Mutation	SNP	pfam_DUF719	p.H394Y	ENST00000351797.4	37	c.1180	CCDS4323.1	5	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371226	0.82573	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.28255	1.84;1.84;1.84;1.62	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	M	0.85777	2.775	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.64428	-0.6410	10	0.51188	T	0.08	-7.4866	18.6352	0.91376	0.0:0.0:1.0:0.0	.	324;394	E7ESJ7;Q9NRY5	.;F1142_HUMAN	Y	394;394;394;324	ENSP00000341597:H394Y;ENSP00000430489:H394Y;ENSP00000430384:H394Y;ENSP00000429088:H324Y	ENSP00000341597:H394Y	H	-	1	0	FAM114A2	153362080	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.475000	0.81041	2.685000	0.91497	0.655000	0.94253	CAC	FAM114A2	-	NULL	ENSG00000055147		0.443	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A2	HGNC	protein_coding	OTTHUMT00000252455.1	-	0.00	54	0	G	NM_018691		153381887	-1	tier1	-	no_errors	ENST00000351797	ensembl	human	known	74_37	missense	20.00	32	8	SNP	1.000	A
FAM135B	51059	genome.wustl.edu	37	8	139144977	139144977	+	Silent	SNP	A	A	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:139144977A>C	ENST00000395297.1	-	20	4250	c.4080T>G	c.(4078-4080)acT>acG	p.T1360T		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1360										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTCGGATTAAAGTGCAGTCCT	0.547										HNSCC(54;0.14)																																							0													246.0	253.0	251.0					8																	139144977		1978	4161	6139	SO:0001819	synonymous_variant	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4080T>G	8.37:g.139144977A>C			B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.T1360	ENST00000395297.1	37	c.4080	CCDS6375.2	8																																																																																			FAM135B	-	NULL	ENSG00000147724		0.547	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	44	0	A	NM_015912		139144977	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	silent	24.56	43	14	SNP	0.976	C
FAM135B	51059	genome.wustl.edu	37	8	139255189	139255189	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:139255189G>C	ENST00000395297.1	-	7	835	c.665C>G	c.(664-666)tCa>tGa	p.S222*		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	222								p.S222*(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CCTTACCTCTGAGGAAGTCGG	0.463										HNSCC(54;0.14)																																							2	Substitution - Nonsense(2)	lung(2)											73.0	74.0	74.0					8																	139255189		1896	4110	6006	SO:0001587	stop_gained	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.665C>G	8.37:g.139255189G>C	ENSP00000378710:p.Ser222*		B5MDB3|O95879|Q2WGJ7|Q3KP46	Nonsense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.S222*	ENST00000395297.1	37	c.665	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	G	39	7.525404	0.98339	.	.	ENSG00000147724	ENST00000395297	.	.	.	4.9	4.9	0.64082	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-12.8918	17.0154	0.86418	0.0:0.0:1.0:0.0	.	.	.	.	X	222	.	ENSP00000276737:S222X	S	-	2	0	FAM135B	139324371	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.734000	0.91543	2.441000	0.82636	0.655000	0.94253	TCA	FAM135B	-	NULL	ENSG00000147724		0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	65	0	G	NM_015912		139255189	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	nonsense	12.07	51	7	SNP	1.000	C
FAM208A	23272	genome.wustl.edu	37	3	56662638	56662638	+	Missense_Mutation	SNP	T	T	C	rs377606389		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:56662638T>C	ENST00000493960.2	-	19	3762	c.3752A>G	c.(3751-3753)tAt>tGt	p.Y1251C	FAM208A_ENST00000355628.5_Missense_Mutation_p.Y1190C|FAM208A_ENST00000431842.2_Missense_Mutation_p.Y814C|FAM208A_ENST00000485156.1_5'Flank	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1251							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTTGATAAGATATTCCTGTTA	0.254																																																	0													46.0	46.0	46.0					3																	56662638		2195	4288	6483	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3752A>G	3.37:g.56662638T>C	ENSP00000417509:p.Tyr1251Cys		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.Y1190C	ENST00000493960.2	37	c.3569	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	T	20.8	4.049769	0.75846	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.57907	0.37;0.37;0.37	5.45	5.45	0.79879	.	0.093431	0.47852	D	0.000216	T	0.71134	0.3304	M	0.67953	2.075	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.999;0.997	T	0.74592	-0.3614	10	0.87932	D	0	-15.6871	15.8079	0.78531	0.0:0.0:0.0:1.0	.	1251;1190;814;1251	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	C	814;1251;1190	ENSP00000399410:Y814C;ENSP00000417509:Y1251C;ENSP00000347845:Y1190C	ENSP00000347845:Y1190C	Y	-	2	0	C3orf63	56637678	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.486000	0.66856	2.196000	0.70406	0.454000	0.30748	TAT	FAM208A	-	NULL	ENSG00000163946		0.254	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	-	0.00	92	0	T	NM_015224		56662638	-1	tier1	-	no_errors	ENST00000355628	ensembl	human	known	74_37	missense	24.56	43	14	SNP	1.000	C
FANCB	2187	genome.wustl.edu	37	X	14863281	14863281	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:14863281G>C	ENST00000324138.3	-	7	1777	c.1624C>G	c.(1624-1626)Cca>Gca	p.P542A	FANCB_ENST00000398334.1_Missense_Mutation_p.P542A	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	542					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)		p.P542S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ATTTCACATGGCATCAAGTAT	0.418								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								1	Substitution - Missense(1)	NS(1)											99.0	92.0	94.0					X																	14863281		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1624C>G	X.37:g.14863281G>C	ENSP00000326819:p.Pro542Ala		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.P542A	ENST00000324138.3	37	c.1624	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.202092	0.01581	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.36	0.0166	0.14109	.	0.766655	0.12611	N	0.453827	T	0.33990	0.0882	L	0.54323	1.7	0.09310	N	1	D	0.61697	0.99	P	0.57152	0.814	T	0.32214	-0.9915	9	0.02654	T	1	-0.6089	1.3628	0.02195	0.2578:0.2591:0.3486:0.1345	.	542	Q8NB91	FANCB_HUMAN	A	542	.	ENSP00000326819:P542A	P	-	1	0	FANCB	14773202	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.577000	0.23758	-0.133000	0.11537	0.523000	0.50628	CCA	FANCB	-	NULL	ENSG00000181544		0.418	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	-	0.00	77	0	G	NM_152633		14863281	-1	tier1	-	no_errors	ENST00000324138	ensembl	human	known	74_37	missense	8.24	78	7	SNP	0.000	C
FASTK	10922	genome.wustl.edu	37	7	150776949	150776949	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:150776949C>T	ENST00000297532.6	-	2	220	c.143G>A	c.(142-144)cGg>cAg	p.R48Q	FASTK_ENST00000540185.1_Missense_Mutation_p.R14Q|FASTK_ENST00000353841.2_Intron|FASTK_ENST00000489884.1_Intron|FASTK_ENST00000482571.1_Missense_Mutation_p.R48Q	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	48					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GCCAGACAGCCGAGCAGGGGA	0.622																																																	0													33.0	21.0	25.0					7																	150776949		2196	4298	6494	SO:0001583	missense	0				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.143G>A	7.37:g.150776949C>T	ENSP00000297532:p.Arg48Gln		A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.R48Q	ENST00000297532.6	37	c.143	CCDS5918.1	7	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003204	0.35320	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000297532;ENST00000482571;ENST00000540185	T;T;T	0.52057	0.68;0.68;0.68	4.64	2.77	0.32553	.	0.221198	0.29537	N	0.011861	T	0.34250	0.0891	N	0.24115	0.695	0.29591	N	0.848441	B;B;D	0.54601	0.098;0.032;0.967	B;B;B	0.42282	0.011;0.005;0.382	T	0.32824	-0.9892	10	0.87932	D	0	-35.999	12.6106	0.56547	0.0:0.6799:0.3201:0.0	.	14;48;48	G3V1R6;F8VTW9;Q14296	.;.;FASTK_HUMAN	Q	48;48;48;48;14	ENSP00000297532:R48Q;ENSP00000418516:R48Q;ENSP00000444498:R14Q	ENSP00000297530:R48Q	R	-	2	0	FASTK	150407882	1.000000	0.71417	0.988000	0.46212	0.897000	0.52465	0.905000	0.28504	0.608000	0.30000	0.655000	0.94253	CGG	FASTK	-	NULL	ENSG00000164896		0.622	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	-	0.00	21	0	C	NM_006712		150776949	-1	tier1	-	no_errors	ENST00000297532	ensembl	human	known	74_37	missense	61.11	7	11	SNP	0.995	T
FAT2	2196	genome.wustl.edu	37	5	150901029	150901029	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:150901029C>T	ENST00000261800.5	-	18	11137	c.11125G>A	c.(11125-11127)Gag>Aag	p.E3709K		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3709					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCTCCATCTCCTTGGCTGAG	0.567																																																	0													78.0	77.0	77.0					5																	150901029		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11125G>A	5.37:g.150901029C>T	ENSP00000261800:p.Glu3709Lys		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.E3709K	ENST00000261800.5	37	c.11125	CCDS4317.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.4|22.4	4.285257|4.285257	0.80803|0.80803	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	T|.	0.71698|.	-0.59|.	5.76|5.76	4.88|4.88	0.63580|0.63580	.|.	0.095199|.	0.45606|.	D|.	0.000345|.	T|T	0.67924|0.67924	0.2945|0.2945	L|L	0.50333|0.50333	1.59|1.59	0.49582|0.49582	D|D	0.999802|0.999802	P;D|.	0.57257|.	0.919;0.979|.	B;P|.	0.47528|.	0.395;0.549|.	T|T	0.65857|0.65857	-0.6066|-0.6066	10|5	0.24483|.	T|.	0.36|.	.|.	16.2047|16.2047	0.82120|0.82120	0.1342:0.8658:0.0:0.0|0.1342:0.8658:0.0:0.0	.|.	3709;900|.	Q9NYQ8;E9PDJ8|.	FAT2_HUMAN;.|.	K|E	3709|567	ENSP00000261800:E3709K|.	ENSP00000261800:E3709K|.	E|G	-|-	1|2	0|0	FAT2|FAT2	150881222|150881222	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.588000|4.588000	0.60999|0.60999	1.419000|1.419000	0.47118|0.47118	0.561000|0.561000	0.74099|0.74099	GAG|GGA	FAT2	-	NULL	ENSG00000086570		0.567	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	44	0	C	NM_001447		150901029	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	T
FAT2	2196	genome.wustl.edu	37	5	150929062	150929062	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:150929062C>T	ENST00000261800.5	-	8	4595	c.4583G>A	c.(4582-4584)cGa>cAa	p.R1528Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1528	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCCTGGTCTCGGACCTATGG	0.483																																																	0													48.0	47.0	48.0					5																	150929062		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4583G>A	5.37:g.150929062C>T	ENSP00000261800:p.Arg1528Gln		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R1528Q	ENST00000261800.5	37	c.4583	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.153427	0.94645	.	.	ENSG00000086570	ENST00000261800	T	0.52754	0.65	4.81	4.81	0.61882	Cadherin (4);Cadherin-like (1);	0.000000	0.49305	D	0.000141	T	0.64843	0.2635	L	0.58669	1.825	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.60332	-0.7284	10	0.25106	T	0.35	.	18.2322	0.89937	0.0:1.0:0.0:0.0	.	1528	Q9NYQ8	FAT2_HUMAN	Q	1528	ENSP00000261800:R1528Q	ENSP00000261800:R1528Q	R	-	2	0	FAT2	150909255	1.000000	0.71417	0.999000	0.59377	0.856000	0.48823	7.335000	0.79234	2.360000	0.80028	0.561000	0.74099	CGA	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.483	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	28	0	C	NM_001447		150929062	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	44.12	19	15	SNP	1.000	T
FAT2	2196	genome.wustl.edu	37	5	150948297	150948297	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:150948297G>A	ENST00000261800.5	-	1	208	c.196C>T	c.(196-198)Cag>Tag	p.Q66*		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	66	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTGCCCACTGTGGCTCCGCG	0.483																																																	0													172.0	173.0	173.0					5																	150948297		2203	4300	6503	SO:0001587	stop_gained	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.196C>T	5.37:g.150948297G>A	ENSP00000261800:p.Gln66*		O75091|Q9NSR7	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Q66*	ENST00000261800.5	37	c.196	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776837	0.90195	.	.	ENSG00000086570	ENST00000261800	.	.	.	5.35	4.45	0.53987	.	0.433550	0.22194	N	0.063326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	8.7869	0.34825	0.0819:0.3751:0.543:0.0	.	.	.	.	X	66	.	ENSP00000261800:Q66X	Q	-	1	0	FAT2	150928490	0.649000	0.27322	0.779000	0.31741	0.947000	0.59692	2.378000	0.44309	1.195000	0.43115	0.555000	0.69702	CAG	FAT2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.483	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	47	0	G	NM_001447		150948297	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	nonsense	42.86	24	18	SNP	0.024	A
FAT4	79633	genome.wustl.edu	37	4	126372870	126372870	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:126372870A>G	ENST00000394329.3	+	9	10712	c.10699A>G	c.(10699-10701)Agc>Ggc	p.S3567G	FAT4_ENST00000335110.5_Missense_Mutation_p.S1865G	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3567	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGGAGTTCTGAGCACAACCAG	0.473																																																	0													114.0	115.0	114.0					4																	126372870		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10699A>G	4.37:g.126372870A>G	ENSP00000377862:p.Ser3567Gly		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S3567G	ENST00000394329.3	37	c.10699	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	15.02	2.709408	0.48517	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.56103	0.48;0.48	5.91	5.91	0.95273	Cadherin (4);Cadherin-like (1);	0.201931	0.23902	U	0.043437	T	0.52773	0.1755	M	0.67625	2.065	0.44149	D	0.996946	B;B;B	0.33549	0.417;0.39;0.287	B;B;B	0.33295	0.116;0.161;0.109	T	0.50499	-0.8821	10	0.26408	T	0.33	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	1865;3567;3567	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	G	3567;1865	ENSP00000377862:S3567G;ENSP00000335169:S1865G	ENSP00000335169:S1865G	S	+	1	0	FAT4	126592320	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	9.149000	0.94659	2.254000	0.74563	0.533000	0.62120	AGC	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.473	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	25	0	A	NM_024582		126372870	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	G
FBXO43	286151	genome.wustl.edu	37	8	101154003	101154003	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:101154003A>G	ENST00000428847.2	-	2	795	c.479T>C	c.(478-480)gTa>gCa	p.V160A		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	160					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AGCGAAAGATACATTCAACCT	0.338																																																	0													104.0	96.0	98.0					8																	101154003		1808	4073	5881	SO:0001583	missense	0			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.479T>C	8.37:g.101154003A>G	ENSP00000403293:p.Val160Ala			Missense_Mutation	SNP	pfam_Znf_C6HC,superfamily_F-box_dom,smart_Znf_C6HC	p.V160A	ENST00000428847.2	37	c.479	CCDS47904.1	8	.	.	.	.	.	.	.	.	.	.	A	14.37	2.514095	0.44763	.	.	ENSG00000156509	ENST00000428847	T	0.34072	1.38	5.44	5.44	0.79542	.	0.923878	0.09248	N	0.828292	T	0.24509	0.0594	N	0.08118	0	0.09310	N	1	B;B	0.27791	0.084;0.189	B;B	0.19148	0.014;0.024	T	0.27773	-1.0064	10	0.72032	D	0.01	0.1511	15.801	0.78453	1.0:0.0:0.0:0.0	.	126;160	C9J908;Q4G163	.;FBX43_HUMAN	A	160	ENSP00000403293:V160A	ENSP00000403293:V160A	V	-	2	0	FBXO43	101223179	0.050000	0.20438	0.009000	0.14445	0.016000	0.09150	2.698000	0.47068	2.194000	0.70268	0.460000	0.39030	GTA	FBXO43	-	NULL	ENSG00000156509		0.338	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO43	HGNC	protein_coding	OTTHUMT00000380380.1	-	0.00	59	0	A	XM_209918		101154003	-1	tier1	-	no_errors	ENST00000428847	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.031	G
FCRL5	83416	genome.wustl.edu	37	1	157512737	157512737	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:157512737C>T	ENST00000361835.3	-	6	1192	c.1035G>A	c.(1033-1035)ctG>ctA	p.L345L	FCRL5_ENST00000368190.3_Silent_p.L345L|FCRL5_ENST00000368191.3_Silent_p.L260L|FCRL5_ENST00000356953.4_Silent_p.L345L|FCRL5_ENST00000368189.3_Silent_p.L345L	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	345	Ig-like C2-type 3.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TCTCTGTAGTCAGTGAGAAGC	0.527																																																	0													126.0	123.0	124.0					1																	157512737		2203	4300	6503	SO:0001819	synonymous_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1035G>A	1.37:g.157512737C>T			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L345	ENST00000361835.3	37	c.1035	CCDS1165.1	1																																																																																			FCRL5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143297		0.527	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	-	0.00	42	0	C	NM_031281		157512737	-1	tier1	-	no_errors	ENST00000356953	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.010	T
FGD4	121512	genome.wustl.edu	37	12	32772733	32772733	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:32772733G>A	ENST00000427716.2	+	11	1864	c.1440G>A	c.(1438-1440)gaG>gaA	p.E480E	FGD4_ENST00000381025.3_Silent_p.E232E|FGD4_ENST00000531134.1_Silent_p.E565E|FGD4_ENST00000546442.1_Silent_p.E387E|FGD4_ENST00000525053.1_Silent_p.E592E|FGD4_ENST00000534526.2_Silent_p.E617E|FGD4_ENST00000266482.3_Silent_p.E232E	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	480	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					AAATTGTAGAGACTCAAAATG	0.433																																																	0													126.0	120.0	122.0					12																	32772733		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1440G>A	12.37:g.32772733G>A			Q6ULS2|Q8TCP6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E480	ENST00000427716.2	37	c.1440	CCDS8727.1	12																																																																																			FGD4	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000139132		0.433	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	HGNC	protein_coding	OTTHUMT00000268017.1	-	0.00	63	0	G	NM_139241		32772733	+1	tier1	-	no_errors	ENST00000427716	ensembl	human	known	74_37	silent	19.61	41	10	SNP	1.000	A
FLT3	2322	genome.wustl.edu	37	13	28622425	28622425	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:28622425C>T	ENST00000241453.7	-	9	1273	c.1192G>A	c.(1192-1194)Gat>Aat	p.D398N	FLT3_ENST00000537084.1_Missense_Mutation_p.D398N|FLT3_ENST00000380982.4_Missense_Mutation_p.D398N	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	398					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TATCCGTTATCAAGACCCTTT	0.403			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													176.0	169.0	172.0					13																	28622425		2203	4300	6503	SO:0001583	missense	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1192G>A	13.37:g.28622425C>T	ENSP00000241453:p.Asp398Asn		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D398N	ENST00000241453.7	37	c.1192	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	C	1.519	-0.547465	0.04024	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.76709	-0.97;-1.04;-0.77	5.45	3.71	0.42584	Immunoglobulin-like fold (1);	0.610732	0.16067	N	0.231218	T	0.56202	0.1969	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36187	-0.9758	10	0.15066	T	0.55	.	10.8284	0.46647	0.0:0.8508:0.0:0.1492	.	398;398	P36888-2;P36888	.;FLT3_HUMAN	N	398	ENSP00000241453:D398N;ENSP00000370369:D398N;ENSP00000438139:D398N	ENSP00000241453:D398N	D	-	1	0	FLT3	27520425	0.000000	0.05858	0.022000	0.16811	0.005000	0.04900	0.054000	0.14205	1.316000	0.45131	-0.448000	0.05591	GAT	FLT3	-	NULL	ENSG00000122025		0.403	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	-	0.00	97	0	C			28622425	-1	tier1	-	no_errors	ENST00000380982	ensembl	human	known	74_37	missense	17.20	77	16	SNP	0.045	T
FMN2	56776	genome.wustl.edu	37	1	240370862	240370862	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:240370862G>A	ENST00000319653.9	+	5	2980	c.2750G>A	c.(2749-2751)gGa>gAa	p.G917E		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	917	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G1060E(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCTCTTCCCGGAGCGGGCATA	0.657																																																	1	Substitution - Missense(1)	lung(1)											41.0	46.0	44.0					1																	240370862		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2750G>A	1.37:g.240370862G>A	ENSP00000318884:p.Gly917Glu		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.G917E	ENST00000319653.9	37	c.2750	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	G	7.434	0.639308	0.14386	.	.	ENSG00000155816	ENST00000319653	T	0.67523	-0.27	3.78	1.87	0.25490	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	0.590598	0.14883	N	0.292834	T	0.70456	0.3226	M	0.87827	2.91	0.09310	N	1	P	0.38048	0.616	B	0.42163	0.378	T	0.63269	-0.6675	9	.	.	.	.	7.5848	0.27987	0.2259:0.0:0.7741:0.0	.	917	Q9NZ56	FMN2_HUMAN	E	917	ENSP00000318884:G917E	.	G	+	2	0	FMN2	238437485	0.935000	0.31712	0.004000	0.12327	0.010000	0.07245	1.350000	0.34010	0.924000	0.37069	0.305000	0.20034	GGA	FMN2	-	pfam_Formin_homology_1,smart_FH2_Formin	ENSG00000155816		0.657	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	86	0	G	XM_371352		240370862	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	32.20	39	19	SNP	0.005	A
FMN2	56776	genome.wustl.edu	37	1	240637787	240637787	+	3'UTR	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:240637787G>C	ENST00000319653.9	+	0	5732				FMN2_ENST00000496950.1_3'UTR|AL646016.1_ENST00000596886.1_Intron|FMN2_ENST00000545751.1_3'UTR	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2						cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ACTGTTGTGAGAATATTCCTC	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.*333G>C	1.37:g.240637787G>C			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	RNA	SNP	-	NULL	ENST00000319653.9	37	NULL	CCDS31069.2	1																																																																																			FMN2	-	-	ENSG00000155816		0.363	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	37	0	G	XM_371352		240637787	+1	tier1	-	no_errors	ENST00000496950	ensembl	human	known	74_37	rna	13.16	33	5	SNP	0.000	C
FOXO1	2308	genome.wustl.edu	37	13	41134632	41134632	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:41134632C>T	ENST00000379561.5	-	2	1380	c.996G>A	c.(994-996)atG>atA	p.M332I	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	332	Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.M332I(2)	PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		CCTGTTCGGTCATAATGGGTG	0.473																																																	2	Substitution - Missense(2)	cervix(2)											152.0	135.0	141.0					13																	41134632		2203	4300	6503	SO:0001583	missense	0				CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.996G>A	13.37:g.41134632C>T	ENSP00000368880:p.Met332Ile		O43523|Q5VYC7|Q6NSK6	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.M332I	ENST00000379561.5	37	c.996	CCDS9371.1	13	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589106	0.46110	.	.	ENSG00000150907	ENST00000379561	D	0.93659	-3.26	5.6	5.6	0.85130	.	0.206974	0.56097	D	0.000026	D	0.88793	0.6533	N	0.19112	0.55	0.58432	D	0.999993	B;B	0.33171	0.4;0.003	B;B	0.33960	0.173;0.004	D	0.87051	0.2147	10	0.37606	T	0.19	-11.6204	18.6061	0.91266	0.0:1.0:0.0:0.0	.	306;332	F8TAD1;Q12778	.;FOXO1_HUMAN	I	332	ENSP00000368880:M332I	ENSP00000368880:M332I	M	-	3	0	FOXO1	40032632	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	5.641000	0.67881	2.653000	0.90120	0.563000	0.77884	ATG	FOXO1	-	NULL	ENSG00000150907		0.473	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO1	HGNC	protein_coding	OTTHUMT00000044634.3	-	0.00	37	0	C	NM_002015		41134632	-1	tier1	-	no_errors	ENST00000379561	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	T
GALK1	2584	genome.wustl.edu	37	17	73759429	73759429	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:73759429C>T	ENST00000588479.1	-	3	1021	c.447G>A	c.(445-447)acG>acA	p.T149T	GALK1_ENST00000437911.1_Silent_p.T179T|GALK1_ENST00000225614.2_Silent_p.T149T			P51570	GALK1_HUMAN	galactokinase 1	149					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGAAGGTGTACGTGGCCACTT	0.647																																																	0													60.0	48.0	52.0					17																	73759429		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.447G>A	17.37:g.73759429C>T			B2RC07|B4E1G6	Silent	SNP	pfam_GalKase_gal-bd,pfam_GHMP_kinase_C_dom,pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,prints_Galkinase,tigrfam_Galactokinase	p.T179	ENST00000588479.1	37	c.537	CCDS11728.1	17																																																																																			GALK1	-	pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galkinase,tigrfam_Galactokinase	ENSG00000108479		0.647	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	GALK1	HGNC	protein_coding	OTTHUMT00000448430.1	-	0.00	51	0	C			73759429	-1	tier1	-	no_errors	ENST00000437911	ensembl	human	known	74_37	silent	45.00	33	27	SNP	0.163	T
GALNT6	11226	genome.wustl.edu	37	12	51785413	51785414	+	5'Flank	INS	-	-	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:51785413_51785414insA	ENST00000356317.3	-	0	0				SLC4A8_ENST00000535225.2_Intron|GALNT6_ENST00000603203.1_5'UTR	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCCGCAGCCGCGCCGCGGGGTG	0.772																																																	0																																										SO:0001631	upstream_gene_variant	0			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785413_51785414insA	Exception_encountered		Q8IYH4|Q9H6G2|Q9UIV5	RNA	INS	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																			GALNT6	-	-	ENSG00000139629		0.772	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	HGNC	protein_coding	OTTHUMT00000469736.1		0.00	15	0	-	NM_007210		51785414	-1	tier1		no_errors	ENST00000603203	ensembl	human	known	74_37	rna	33.33	6	3	INS	0.001:0.005	A
GLT1D1	144423	genome.wustl.edu	37	12	129431943	129431943	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:129431943G>A	ENST00000442111.2	+	10	808	c.720G>A	c.(718-720)aaG>aaA	p.K240K	GLT1D1_ENST00000281703.6_Silent_p.K160K|GLT1D1_ENST00000542193.1_Silent_p.K157K|GLT1D1_ENST00000537468.1_Silent_p.K245K			Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	240					biosynthetic process (GO:0009058)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CGGTGGTGAAGAATTGCTTCG	0.478																																																	0													194.0	160.0	172.0					12																	129431943		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9265.1	12q24.32	2013-02-22			ENSG00000151948	ENSG00000151948		"""Glycosyltransferase group 1 domain containing"""	26483	protein-coding gene	gene with protein product							Standard	NM_144669		Approved	FLJ31978	uc001uhx.1	Q96MS3	OTTHUMG00000168437	ENST00000442111.2:c.720G>A	12.37:g.129431943G>A			Q86XG8	Silent	SNP	pfam_Glyco_trans_1	p.K240	ENST00000442111.2	37	c.720		12																																																																																			GLT1D1	-	pfam_Glyco_trans_1	ENSG00000151948		0.478	GLT1D1-002	KNOWN	basic|appris_principal	protein_coding	GLT1D1	HGNC	protein_coding	OTTHUMT00000399740.1	-	0.00	39	0	G	NM_144669		129431943	+1	tier1	-	no_errors	ENST00000442111	ensembl	human	known	74_37	silent	30.43	16	7	SNP	0.982	A
GLYAT	10249	genome.wustl.edu	37	11	58478152	58478152	+	Silent	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:58478152G>C	ENST00000344743.3	-	5	540	c.399C>G	c.(397-399)ctC>ctG	p.L133L	GLYAT_ENST00000278400.3_Silent_p.L133L|GLYAT_ENST00000529732.1_Silent_p.L133L	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	133					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	CTGCCATATAGAGAATGCGTT	0.423																																																	0													166.0	152.0	156.0					11																	58478152		2201	4295	6496	SO:0001819	synonymous_variant	0			AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.399C>G	11.37:g.58478152G>C			O14833|Q96QK7	Silent	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.L133	ENST00000344743.3	37	c.399	CCDS7970.1	11																																																																																			GLYAT	-	pfam_Glycine_N-acyltransferase_N,superfamily_Acyl_CoA_acyltransferase	ENSG00000149124		0.423	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYAT	HGNC	protein_coding	OTTHUMT00000394593.1	-	0.00	69	0	G			58478152	-1	tier1	-	no_errors	ENST00000344743	ensembl	human	known	74_37	silent	50.00	27	27	SNP	0.698	C
GNL3L	54552	genome.wustl.edu	37	X	54584945	54584945	+	Missense_Mutation	SNP	G	G	T	rs549795452		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:54584945G>T	ENST00000336470.4	+	15	1662	c.1523G>T	c.(1522-1524)cGc>cTc	p.R508L	GNL3L_ENST00000360845.2_Missense_Mutation_p.R508L	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	508					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						GTGGACCACCGCCCTAAGAGC	0.552																																																	0													129.0	94.0	106.0					X																	54584945		2203	4300	6503	SO:0001583	missense	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1523G>T	X.37:g.54584945G>T	ENSP00000338573:p.Arg508Leu			Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.R508L	ENST00000336470.4	37	c.1523	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.644578	0.00792	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.17854	2.25;2.25	3.97	-7.94	0.01152	.	2.116720	0.02273	N	0.068604	T	0.08802	0.0218	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.18618	-1.0331	10	0.29301	T	0.29	-17.7126	7.1556	0.25635	0.1504:0.0:0.5855:0.2641	.	508	Q9NVN8	GNL3L_HUMAN	L	508	ENSP00000338573:R508L;ENSP00000354091:R508L	ENSP00000338573:R508L	R	+	2	0	GNL3L	54601670	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.827000	0.00746	-2.003000	0.00962	-0.735000	0.03563	CGC	GNL3L	-	NULL	ENSG00000130119		0.552	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	-	0.00	46	0	G	NM_019067		54584945	+1	tier1	rs145061026	no_errors	ENST00000336470	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685544	23685544	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:23685544C>G	ENST00000567107.1	-	8	2130	c.2078G>C	c.(2077-2079)aGa>aCa	p.R693T	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ACAtcttcttcttcctgctcc	0.562																																																	0																																										SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2078G>C	15.37:g.23685544C>G	ENSP00000454407:p.Arg693Thr		A1L301	Missense_Mutation	SNP	NULL	p.R693T	ENST00000567107.1	37	c.2078		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.562	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	-	0.00	111	0	C	NM_182561		23685544	-1	tier1	-	no_errors	ENST00000567107	ensembl	human	putative	74_37	missense	11.11	80	10	SNP	0.003	G
GPBP1L1	60313	genome.wustl.edu	37	1	46124684	46124684	+	Intron	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:46124684G>T	ENST00000290795.3	-	3	1282				GPBP1L1_ENST00000355105.3_Intron			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					GTTACTACAGGAATGGAGAAC	0.438																																																	0													128.0	118.0	121.0					1																	46124684		2203	4300	6503	SO:0001627	intron_variant	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.60+15C>A	1.37:g.46124684G>T			D3DQ10|Q9H751	RNA	SNP	-	NULL	ENST00000290795.3	37	NULL	CCDS528.1	1																																																																																			GPBP1L1	-	-	ENSG00000159592		0.438	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1	-	0.00	51	0	G	NM_021639		46124684	-1	tier1	-	no_errors	ENST00000495616	ensembl	human	known	74_37	rna	5.88	64	4	SNP	0.000	T
GPR112	139378	genome.wustl.edu	37	X	135430243	135430243	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:135430243C>T	ENST00000394143.1	+	6	4669	c.4378C>T	c.(4378-4380)Cag>Tag	p.Q1460*	GPR112_ENST00000412101.1_Nonsense_Mutation_p.Q1255*|GPR112_ENST00000370652.1_Nonsense_Mutation_p.Q1460*|GPR112_ENST00000287534.4_Nonsense_Mutation_p.Q1397*|GPR112_ENST00000394141.1_Nonsense_Mutation_p.Q1255*	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1460					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGAAAGCACACAGACTTTCCC	0.418																																																	0													115.0	111.0	112.0					X																	135430243		2203	4300	6503	SO:0001587	stop_gained	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4378C>T	X.37:g.135430243C>T	ENSP00000377699:p.Gln1460*		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.Q1460*	ENST00000394143.1	37	c.4378	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	c	44	11.152715	0.99523	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	.	.	.	2.79	0.473	0.16763	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	7.4278	0.27109	0.0:0.4391:0.5609:0.0	.	.	.	.	X	1460;1460;1255;1397;1255	.	ENSP00000287534:Q1397X	Q	+	1	0	GPR112	135257909	0.004000	0.15560	0.625000	0.29200	0.922000	0.55478	0.292000	0.19011	0.319000	0.23209	0.458000	0.33432	CAG	GPR112	-	NULL	ENSG00000156920		0.418	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	44	0	C			135430243	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	nonsense	12.00	22	3	SNP	0.079	T
GPR116	221395	genome.wustl.edu	37	6	46826698	46826698	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:46826698delT	ENST00000283296.7	-	17	3230	c.2942delA	c.(2941-2943)gacfs	p.D981fs	GPR116_ENST00000545669.1_Frame_Shift_Del_p.D410fs|GPR116_ENST00000265417.7_Frame_Shift_Del_p.D981fs|GPR116_ENST00000456426.2_Frame_Shift_Del_p.D839fs|GPR116_ENST00000362015.4_Frame_Shift_Del_p.D981fs	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	981	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GGTGACATTGTCCCCATCACC	0.517																																					NSCLC(59;410 1274 8751 36715 50546)												0													95.0	80.0	85.0					6																	46826698		2203	4298	6501	SO:0001589	frameshift_variant	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2942delA	6.37:g.46826698delT	ENSP00000283296:p.Asp981fs		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Frame_Shift_Del	DEL	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.D981fs	ENST00000283296.7	37	c.2942	CCDS4919.1	6																																																																																			GPR116	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000069122		0.517	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2		0.00	56	0	T	NM_015234		46826698	-1	tier1		no_errors	ENST00000265417	ensembl	human	known	74_37	frame_shift_del	45.45	18	15	DEL	0.193	-
GPR52	9293	genome.wustl.edu	37	1	174417614	174417614	+	Nonsense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:174417614C>G	ENST00000367685.2	+	1	403	c.365C>G	c.(364-366)tCa>tGa	p.S122*	RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000367689.3_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	122					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TATATCATCTCAGTTCTAAAA	0.443																																					Ovarian(92;924 1390 1930 16467 40583)												0													220.0	219.0	219.0					1																	174417614		2203	4300	6503	SO:0001587	stop_gained	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.365C>G	1.37:g.174417614C>G	ENSP00000356658:p.Ser122*		O75654|Q4VBL6|Q6ISM0	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S122*	ENST00000367685.2	37	c.365	CCDS30941.1	1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511740	0.85389	.	.	ENSG00000203737	ENST00000367685	.	.	.	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-7.8595	19.9403	0.97159	0.0:1.0:0.0:0.0	.	.	.	.	X	122	.	ENSP00000356658:S122X	S	+	2	0	GPR52	172684237	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.755000	0.68750	2.712000	0.92718	0.650000	0.86243	TCA	GPR52	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000203737		0.443	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	-	0.00	52	0	C	NM_005684		174417614	+1	tier1	-	no_errors	ENST00000367685	ensembl	human	known	74_37	nonsense	42.86	16	12	SNP	1.000	G
GREB1L	80000	genome.wustl.edu	37	18	19080511	19080511	+	Missense_Mutation	SNP	C	C	T	rs375805199		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:19080511C>T	ENST00000580732.2	+	23	4361	c.3980C>T	c.(3979-3981)aCg>aTg	p.T1327M	GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000424526.1_Missense_Mutation_p.T1327M|GREB1L_ENST00000269218.6_Missense_Mutation_p.T1218M			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1327						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GTGGGAAAGACGGGCTCCTAT	0.507																																																	0								C	MET/THR	0,1384		0,0,692	53.0	48.0	50.0		3980	4.7	0.9	18		50	1,3181		0,1,1590	no	missense	GREB1L	NM_001142966.1	81	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	probably-damaging	1327/1924	19080511	1,4565	692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3980C>T	18.37:g.19080511C>T	ENSP00000464162:p.Thr1327Met		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.T1327M	ENST00000580732.2	37	c.3980	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163368	0.78226	0.0	3.14E-4	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.18810	2.19;2.24	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000003	T	0.50205	0.1602	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.994;0.982	T	0.58707	-0.7589	10	0.87932	D	0	-18.1011	17.6128	0.88059	0.0:1.0:0.0:0.0	.	1218;1327;701	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	M	1327;1218	ENSP00000412060:T1327M;ENSP00000269218:T1218M	ENSP00000269218:T1218M	T	+	2	0	GREB1L	17334509	1.000000	0.71417	0.920000	0.36463	0.884000	0.51177	7.340000	0.79292	2.141000	0.66446	0.555000	0.69702	ACG	GREB1L	-	superfamily_P-loop_NTPase	ENSG00000141449		0.507	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	48	0	C	NM_024935		19080511	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	20.34	47	12	SNP	0.999	T
GRK4	2868	genome.wustl.edu	37	4	2993963	2993963	+	Missense_Mutation	SNP	G	G	A	rs13305979	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:2993963G>A	ENST00000398052.4	+	4	626	c.283G>A	c.(283-285)Gat>Aat	p.D95N	GRK4_ENST00000504933.1_Missense_Mutation_p.D95N|GRK4_ENST00000345167.6_Missense_Mutation_p.D63N|GRK4_ENST00000398051.4_Missense_Mutation_p.D63N	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	95	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.		D -> H (in dbSNP:rs13305979).		G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGTTGCCGATGATGAGGACCG	0.383																																																	0													141.0	139.0	139.0					4																	2993963		2203	4300	6503	SO:0001583	missense	0				CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.283G>A	4.37:g.2993963G>A	ENSP00000381129:p.Asp95Asn		O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.D95N	ENST00000398052.4	37	c.283	CCDS33946.1	4	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953240	0.73902	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	T;T;T;T	0.02579	4.24;4.24;4.24;4.24	5.33	4.48	0.54585	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.060780	0.64402	U	0.000005	T	0.15003	0.0362	M	0.82193	2.58	0.53688	D	0.999974	D;P;D;D	0.59357	0.981;0.915;0.981;0.985	P;P;P;D	0.64877	0.767;0.729;0.706;0.93	T	0.00567	-1.1667	10	0.62326	D	0.03	-16.0908	14.0361	0.64646	0.0:0.1526:0.8474:0.0	.	63;63;95;95	P32298-3;P32298-2;P32298-4;P32298	.;.;.;GRK4_HUMAN	N	63;95;63;95	ENSP00000381128:D63N;ENSP00000381129:D95N;ENSP00000264764:D63N;ENSP00000427445:D95N	ENSP00000264764:D63N	D	+	1	0	GRK4	2963761	1.000000	0.71417	0.021000	0.16686	0.021000	0.10359	7.177000	0.77650	1.365000	0.46057	0.650000	0.86243	GAT	GRK4	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000125388		0.383	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK4	HGNC	protein_coding	OTTHUMT00000358176.2	-	0.00	65	0	G	NM_005307		2993963	+1	tier1	-	no_errors	ENST00000398052	ensembl	human	known	74_37	missense	16.67	45	9	SNP	0.985	A
GRID2	2895	genome.wustl.edu	37	4	94693600	94693600	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:94693600C>T	ENST00000282020.4	+	16	3233	c.2975C>T	c.(2974-2976)aCc>aTc	p.T992I	GRID2_ENST00000510992.1_Missense_Mutation_p.T897I	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	992					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CCAACTCCTACCCTGGGGCTC	0.468																																																	0													62.0	62.0	62.0					4																	94693600		2203	4300	6503	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2975C>T	4.37:g.94693600C>T	ENSP00000282020:p.Thr992Ile		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T992I	ENST00000282020.4	37	c.2975	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	12.53	1.967009	0.34754	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.14266	2.57;2.52	5.39	3.62	0.41486	.	0.415893	0.28555	N	0.014934	T	0.08044	0.0201	N	0.08118	0	0.31168	N	0.703498	B;B	0.19583	0.037;0.037	B;B	0.18263	0.021;0.021	T	0.05699	-1.0869	10	0.72032	D	0.01	.	12.2348	0.54510	0.1356:0.7343:0.1301:0.0	.	897;992	E9PH24;O43424	.;GRID2_HUMAN	I	992;897	ENSP00000282020:T992I;ENSP00000421257:T897I	ENSP00000282020:T992I	T	+	2	0	GRID2	94912623	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.762000	0.62250	0.609000	0.30018	-0.319000	0.08680	ACC	GRID2	-	NULL	ENSG00000152208		0.468	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2		0.00	38	0	C			94693600	+1			no_errors	ENST00000282020	ensembl	human	known	74_37	missense	15.38	11	2	SNP	0.998	T
GSTO1	9446	genome.wustl.edu	37	10	106022789	106022789	+	Missense_Mutation	SNP	C	C	T	rs4925	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:106022789C>T	ENST00000369713.5	+	4	613	c.419C>T	c.(418-420)gCt>gTt	p.A140V	GSTO1_ENST00000493946.1_3'UTR|GSTO1_ENST00000369710.4_Intron|GSTO1_ENST00000539281.1_Missense_Mutation_p.A112V	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	140	GST C-terminal.		A -> D (in allele GSTO1*C; no effect on protein stability; dbSNP:rs4925). {ECO:0000269|PubMed:12618591, ECO:0000269|PubMed:12928150}.		cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.A140D(1)		large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	GAAGACTATGCTGGCCTAAAA	0.353																																																	1	Substitution - Missense(1)	stomach(1)	GRCh37	CM061795	GSTO1	M	rs4925						88.0	85.0	86.0					10																	106022789		2203	4300	6503	SO:0001583	missense	0			AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.419C>T	10.37:g.106022789C>T	ENSP00000358727:p.Ala140Val		D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Missense_Mutation	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_omega	p.A140V	ENST00000369713.5	37	c.419	CCDS7555.1	10	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476652	0.44044	.	.	ENSG00000148834	ENST00000539281;ENST00000369713;ENST00000445155	T;T;T	0.14893	2.47;2.47;2.47	4.83	3.93	0.45458	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.523772	0.23569	N	0.046768	T	0.11793	0.0287	N	0.24115	0.695	0.19300	N	0.999971	B	0.27380	0.177	B	0.23275	0.045	T	0.18209	-1.0344	10	0.46703	T	0.11	-0.2439	11.8844	0.52594	0.0:0.915:0.0:0.085	.	140	P78417	GSTO1_HUMAN	V	112;140;112	ENSP00000441488:A112V;ENSP00000358727:A140V;ENSP00000406708:A112V	ENSP00000358727:A140V	A	+	2	0	GSTO1	106012779	0.016000	0.18221	0.046000	0.18839	0.099000	0.18886	0.831000	0.27476	1.389000	0.46526	0.655000	0.94253	GCT	GSTO1	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000148834		0.353	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTO1	HGNC	protein_coding	OTTHUMT00000050193.1		0.00	61	0	C	NM_004832		106022789	+1			no_errors	ENST00000369713	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.350	T
GUCY1B2	2974	genome.wustl.edu	37	13	51594564	51594564	+	RNA	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:51594564G>T	ENST00000493639.2	-	0	1402					NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										TCCCTCAGCTGGTTGGCCACG	0.547																																																	0													175.0	153.0	160.0					13																	51594564		692	1591	2283			0			AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51594564G>T			Q9NZ64	RNA	SNP	-	NULL	ENST00000493639.2	37	NULL		13																																																																																			GUCY1B2	-	-	ENSG00000123201		0.547	GUCY1B2-001	KNOWN	basic	processed_transcript	GUCY1B2	HGNC	pseudogene	OTTHUMT00000045014.3	-	0.00	55	0	G			51594564	-1	tier1	-	no_errors	ENST00000389600	ensembl	human	known	74_37	rna	9.30	39	4	SNP	1.000	T
HECW2	57520	genome.wustl.edu	37	2	197066110	197066110	+	Missense_Mutation	SNP	G	G	A	rs560792476		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:197066110G>A	ENST00000260983.3	-	29	4792	c.4610C>T	c.(4609-4611)gCg>gTg	p.A1537V	HECW2_ENST00000409111.1_Missense_Mutation_p.A1181V	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1537	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ACATGTATGCGCTCTGAAAAC	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18633	0.0		0.0	False		,,,				2504	0.0																0													121.0	110.0	114.0					2																	197066110		2203	4300	6503	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4610C>T	2.37:g.197066110G>A	ENSP00000260983:p.Ala1537Val		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.A1537V	ENST00000260983.3	37	c.4610	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894498	0.52121	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.60548	0.18;0.18	4.95	4.95	0.65309	HECT (4);	0.058268	0.64402	D	0.000002	T	0.77532	0.4144	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80609	-0.1306	10	0.87932	D	0	.	18.4272	0.90613	0.0:0.0:1.0:0.0	.	1537	Q9P2P5	HECW2_HUMAN	V	1181;1537	ENSP00000386775:A1181V;ENSP00000260983:A1537V	ENSP00000260983:A1537V	A	-	2	0	HECW2	196774355	1.000000	0.71417	0.992000	0.48379	0.030000	0.12068	9.657000	0.98554	2.591000	0.87537	0.650000	0.86243	GCG	HECW2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000138411		0.428	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	-	0.00	55	0	G	NM_020760		197066110	-1	tier1	-	no_errors	ENST00000260983	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	A
HOXA7	3204	genome.wustl.edu	37	7	27192368	27192368	+	IGR	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:27192368G>C	ENST00000242159.3	-	0	2020				HOXA6_ENST00000521478.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						CCATCACTGAGAGGAGGCAGC	0.493																																																	0																																										SO:0001628	intergenic_variant	0				CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192368G>C			A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	RNA	SNP	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																			HOXA-AS3	-	-	ENSG00000254369		0.493	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS3	HGNC	protein_coding	OTTHUMT00000358695.1	-	0.00	95	0	G			27192368	+1	tier1	-	no_errors	ENST00000518947	ensembl	human	known	74_37	rna	15.49	60	11	SNP	1.000	C
HIPK2	28996	genome.wustl.edu	37	7	139416649	139416649	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:139416649G>T	ENST00000406875.3	-	2	279	c.185C>A	c.(184-186)cCa>cAa	p.P62Q	HIPK2_ENST00000428878.2_Missense_Mutation_p.P62Q|HIPK2_ENST00000342645.6_Missense_Mutation_p.P62Q	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	62					adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TGTGGTGGCTGGCTGCGACAG	0.567																																																	0													90.0	95.0	94.0					7																	139416649		1568	3582	5150	SO:0001583	missense	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.185C>A	7.37:g.139416649G>T	ENSP00000385571:p.Pro62Gln		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P62Q	ENST00000406875.3	37	c.185		7	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930067	0.34096	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.51574	0.7;0.72;0.72	5.41	4.47	0.54385	.	.	.	.	.	T	0.40909	0.1136	.	.	.	0.43230	D	0.995124	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.28235	-1.0050	8	0.46703	T	0.11	.	14.9209	0.70838	0.0:0.0:0.8563:0.1437	.	62;62	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	Q	62	ENSP00000385571:P62Q;ENSP00000413724:P62Q;ENSP00000343108:P62Q	ENSP00000343108:P62Q	P	-	2	0	HIPK2	139063135	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	4.640000	0.61368	2.523000	0.85059	0.655000	0.94253	CCA	HIPK2	-	NULL	ENSG00000064393		0.567	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	-	0.00	79	0	G	NM_022740		139416649	-1	tier1	-	no_errors	ENST00000406875	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
HS3ST6	64711	genome.wustl.edu	37	16	1961956	1961956	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:1961956C>T	ENST00000293937.3	-	2	663	c.664G>A	c.(664-666)Gcc>Acc	p.A222T	HS3ST6_ENST00000454677.2_Missense_Mutation_p.A239T|HS3ST6_ENST00000443547.1_Missense_Mutation_p.A191T			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	222					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						ATGCGGACGGCGCTCCAGGCT	0.706																																																	0													20.0	26.0	24.0					16																	1961956		2174	4282	6456	SO:0001583	missense	0					16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.664G>A	16.37:g.1961956C>T	ENSP00000293937:p.Ala222Thr		Q96RX7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.A222T	ENST00000293937.3	37	c.664		16	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115780	0.77323	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	T;T	0.55760	0.5;0.5	4.84	4.84	0.62591	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.77061	0.4075	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.82528	-0.0412	10	0.72032	D	0.01	.	16.9861	0.86340	0.0:1.0:0.0:0.0	.	222	Q96QI5	HS3S6_HUMAN	T	222;191;261	ENSP00000293937:A222T;ENSP00000390354:A191T	ENSP00000293937:A222T	A	-	1	0	HS3ST6	1901957	1.000000	0.71417	0.991000	0.47740	0.413000	0.31143	7.619000	0.83057	2.252000	0.74401	0.505000	0.49811	GCC	HS3ST6	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000162040		0.706	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	HS3ST6	HGNC	protein_coding		-	0.00	87	0	C	NM_001009606		1961956	-1	tier1	-	no_errors	ENST00000293937	ensembl	human	known	74_37	missense	24.56	43	14	SNP	1.000	T
HSD17B7P2	158160	genome.wustl.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																																	0																																												0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2		0.00	57	0	A	NR_003086		38654432	+1			no_errors	ENST00000494540	ensembl	human	known	74_37	rna	7.69	36	3	SNP	1.000	G
HYDIN	54768	genome.wustl.edu	37	16	71019134	71019134	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:71019134G>C	ENST00000393567.2	-	28	4436	c.4286C>G	c.(4285-4287)tCt>tGt	p.S1429C		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1429					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTTGTCTGGAGAAGACTGGTG	0.517																																																	0													15.0	15.0	15.0					16																	71019134		1809	4053	5862	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4286C>G	16.37:g.71019134G>C	ENSP00000377197:p.Ser1429Cys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.S1429C	ENST00000393567.2	37	c.4286	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535413	0.45176	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00958	5.5	4.75	2.76	0.32466	.	0.299341	0.17715	U	0.164441	T	0.01800	0.0057	L	0.38838	1.175	0.80722	D	1	D	0.65815	0.995	P	0.55999	0.789	T	0.70171	-0.4945	10	0.44086	T	0.13	.	7.9642	0.30089	0.1977:0.0:0.8023:0.0	.	1428	F8WD23	.	C	1429;1428	ENSP00000377197:S1429C	ENSP00000313052:S1428C	S	-	2	0	HYDIN	69576635	0.074000	0.21230	0.153000	0.22517	0.021000	0.10359	0.938000	0.28965	0.676000	0.31285	0.609000	0.83330	TCT	HYDIN	-	NULL	ENSG00000157423		0.517	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	63	0	G			71019134	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	36.17	30	17	SNP	0.733	C
IGSF3	3321	genome.wustl.edu	37	1	117146501	117146501	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:117146501G>A	ENST00000369486.3	-	6	2134	c.1369C>T	c.(1369-1371)Cgc>Tgc	p.R457C	IGSF3_ENST00000369483.1_Missense_Mutation_p.R477C|IGSF3_ENST00000318837.6_Missense_Mutation_p.R477C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	457	Ig-like C2-type 4.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ATATTGCTGCGGCGGTTCTGC	0.647																																																	0													68.0	66.0	67.0					1																	117146501		2202	4298	6500	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1369C>T	1.37:g.117146501G>A	ENSP00000358498:p.Arg457Cys		A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R477C	ENST00000369486.3	37	c.1429	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003704	0.74932	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.65549	-0.16;-0.16;-0.16	5.27	5.27	0.74061	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.451806	0.24236	N	0.040317	T	0.62502	0.2433	L	0.29908	0.895	0.50313	D	0.99986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.95;0.991;0.971	T	0.61068	-0.7137	10	0.38643	T	0.18	-29.8822	16.4297	0.83837	0.0:0.0:1.0:0.0	.	477;457;477	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	C	457;477;477	ENSP00000358498:R457C;ENSP00000358495:R477C;ENSP00000321184:R477C	ENSP00000321184:R477C	R	-	1	0	IGSF3	116948024	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.034000	0.57289	2.735000	0.93741	0.557000	0.71058	CGC	IGSF3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000143061		0.647	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1		0.00	51	0	G	NM_001542		117146501	-1			no_errors	ENST00000318837	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	A
IQCJ-SCHIP1	100505385	genome.wustl.edu	37	3	159482272	159482274	+	In_Frame_Del	DEL	GCA	GCA	-	rs149416208		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:159482272_159482274delGCA	ENST00000460298.1	+	2	264_266	c.23_25delGCA	c.(22-27)ggcagc>ggc	p.S14del	IQCJ-SCHIP1_ENST00000476809.1_In_Frame_Del_p.S90del|IQCJ-SCHIP1_ENST00000485419.1_In_Frame_Del_p.S117del|IQCJ-SCHIP1_ENST00000527095.1_Intron|IQCJ-SCHIP1_ENST00000337808.6_In_Frame_Del_p.S41del|IQCJ-SCHIP1_ENST00000467442.1_3'UTR|IQCJ-SCHIP1_ENST00000412423.2_In_Frame_Del_p.S41del|IQCJ-SCHIP1-AS1_ENST00000460574.1_RNA					IQCJ-SCHIP1 readthrough									p.S41delS(1)|p.S117delS(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						AGTGACGCCGgcagcagcagcag	0.635																																																	2	Deletion - In frame(2)	central_nervous_system(2)							,,,,	305,12,3701		12,0,281,2,8,1706					,,,,	2.5	1.0		dbSNP_134	20	596,2,7224		21,0,554,0,2,3334	no	codingComplex,codingComplex,codingComplex,intron,codingComplex	SCHIP1,IQCJ-SCHIP1	NM_014575.3,NM_001197114.1,NM_001197113.1,NM_001197108.1,NM_001197107.1	,,,,	33,0,835,2,10,5040	A1A1,A1A2,A1R,A2A2,A2R,RR		7.6451,7.8895,7.728	,,,,	,,,,		901,14,10925				SO:0001651	inframe_deletion	0				CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000460298.1:c.23_25delGCA	3.37:g.159482281_159482283delGCA	ENSP00000417305:p.Ser14del			In_Frame_Del	DEL	pfam_SCHIP_1	p.S115in_frame_del	ENST00000460298.1	37	c.332_334		3																																																																																			IQCJ-SCHIP1	-	NULL	ENSG00000250588		0.635	IQCJ-SCHIP1-011	PUTATIVE	basic|exp_conf	protein_coding	IQCJ-SCHIP1	HGNC	protein_coding	OTTHUMT00000352558.2		0.00	32	0	GCA	NM_001197113		159482274	+1	tier1		no_errors	ENST00000485419	ensembl	human	known	74_37	in_frame_del	8.89	41	4	DEL	1.000:1.000:1.000	-
IQCG	84223	genome.wustl.edu	37	3	197639584	197639584	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:197639584G>C	ENST00000265239.6	-	9	1349	c.925C>G	c.(925-927)Cat>Gat	p.H309D	IQCG_ENST00000455191.1_Missense_Mutation_p.H309D	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	309						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		ATCTCTGTATGAGTCCGGGCC	0.448																																																	0													177.0	191.0	186.0					3																	197639584		2203	4300	6503	SO:0001583	missense	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.925C>G	3.37:g.197639584G>C	ENSP00000265239:p.His309Asp		Q9BST2|Q9HAG8	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.H309D	ENST00000265239.6	37	c.925	CCDS3331.1	3	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587010	0.46110	.	.	ENSG00000114473	ENST00000265239;ENST00000455191	T;T	0.53206	0.63;0.63	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.70439	0.3224	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	T	0.71922	-0.4446	10	0.51188	T	0.08	-19.5725	18.4723	0.90779	0.0:0.0:1.0:0.0	.	309	Q9H095	IQCG_HUMAN	D	309	ENSP00000265239:H309D;ENSP00000407736:H309D	ENSP00000265239:H309D	H	-	1	0	IQCG	199123981	1.000000	0.71417	0.986000	0.45419	0.025000	0.11179	5.710000	0.68392	2.665000	0.90641	0.638000	0.83543	CAT	IQCG	-	NULL	ENSG00000114473		0.448	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	-	0.00	85	0	G	NM_032263		197639584	-1	tier1	-	no_errors	ENST00000265239	ensembl	human	known	74_37	missense	28.04	76	30	SNP	1.000	C
IQSEC3	440073	genome.wustl.edu	37	12	247635	247635	+	Missense_Mutation	SNP	C	C	T	rs370321433		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:247635C>T	ENST00000538872.1	+	4	1224	c.1106C>T	c.(1105-1107)gCg>gTg	p.A369V	RP11-598F7.4_ENST00000505893.2_RNA|RP11-598F7.4_ENST00000508953.2_RNA|IQSEC3_ENST00000382841.2_Missense_Mutation_p.A66V|IQSEC3_ENST00000326261.4_Missense_Mutation_p.A369V			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	369					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		GCCGAGAAAGCGCTCATGGAG	0.697																																																	0								C	VAL/ALA,VAL/ALA	0,4396		0,0,2198	16.0	17.0	16.0		1106,197	4.5	1.0	12		16	1,8587		0,1,4293	no	missense,missense	IQSEC3	NM_001170738.1,NM_015232.1	64,64	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	369/1183,66/760	247635	1,12983	2198	4294	6492	SO:0001583	missense	0			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.1106C>T	12.37:g.247635C>T	ENSP00000437554:p.Ala369Val		A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.A369V	ENST00000538872.1	37	c.1106	CCDS53728.1	12	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006117	0.74932	0.0	1.16E-4	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.78246	-1.16;-1.16;-1.16	4.52	4.52	0.55395	.	0.317956	0.38217	N	0.001778	D	0.87759	0.6258	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.89418	0.3708	10	0.72032	D	0.01	.	17.4175	0.87505	0.0:1.0:0.0:0.0	.	369;66	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	V	369;369;66	ENSP00000437554:A369V;ENSP00000315662:A369V;ENSP00000372292:A66V	ENSP00000315662:A369V	A	+	2	0	IQSEC3	117896	0.998000	0.40836	0.999000	0.59377	0.273000	0.26683	5.012000	0.64017	2.341000	0.79615	0.462000	0.41574	GCG	IQSEC3	-	NULL	ENSG00000120645		0.697	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC3	HGNC	protein_coding	OTTHUMT00000397382.3	-	0.00	11	0	C	XM_495902		247635	+1	tier1	-	no_errors	ENST00000326261	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	T
ITGA2B	3674	genome.wustl.edu	37	17	42462407	42462407	+	Silent	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:42462407C>G	ENST00000262407.5	-	7	739	c.708G>C	c.(706-708)tcG>tcC	p.S236S	ITGA2B_ENST00000377068.3_Intron|ITGA2B_ENST00000353281.4_Silent_p.S236S	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	236					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GGCGGTAACTCGAGAAAATAT	0.612																																																	0													88.0	91.0	90.0					17																	42462407		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.708G>C	17.37:g.42462407C>G			B2RCY8|O95366|Q14443|Q17R67	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.S236	ENST00000262407.5	37	c.708	CCDS32665.1	17																																																																																			ITGA2B	-	NULL	ENSG00000005961		0.612	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	HGNC	protein_coding	OTTHUMT00000439823.1	-	0.00	76	0	C			42462407	-1	tier1	-	no_errors	ENST00000262407	ensembl	human	known	74_37	silent	22.41	45	13	SNP	0.323	G
ITIH2	3698	genome.wustl.edu	37	10	7786241	7786241	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:7786241G>C	ENST00000358415.4	+	18	2572	c.2406G>C	c.(2404-2406)caG>caC	p.Q802H	ITIH2_ENST00000379587.4_Missense_Mutation_p.Q791H	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	802					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						TCACGAATCAGAGGCAAGTAT	0.443																																																	0													106.0	87.0	93.0					10																	7786241		2203	4300	6503	SO:0001583	missense	0			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.2406G>C	10.37:g.7786241G>C	ENSP00000351190:p.Gln802His		Q14659|Q15484|Q5T986	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.Q802H	ENST00000358415.4	37	c.2406	CCDS31141.1	10	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230586	0.22542	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.11930	2.73;2.73	4.98	-3.04	0.05412	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.693119	0.14283	N	0.329382	T	0.07548	0.0190	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.24512	-1.0158	10	0.42905	T	0.14	0.3149	6.0662	0.19864	0.4289:0.2292:0.3419:0.0	.	802	P19823	ITIH2_HUMAN	H	802;791	ENSP00000351190:Q802H;ENSP00000368906:Q791H	ENSP00000351190:Q802H	Q	+	3	2	ITIH2	7826247	0.195000	0.23338	0.013000	0.15412	0.025000	0.11179	0.200000	0.17257	-0.573000	0.05998	-0.140000	0.14226	CAG	ITIH2	-	pfam_ITI_HC_C	ENSG00000151655		0.443	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH2	HGNC	protein_coding	OTTHUMT00000046678.2	-	0.00	36	0	G	NM_002216		7786241	+1	tier1	-	no_errors	ENST00000358415	ensembl	human	known	74_37	missense	38.46	16	10	SNP	0.021	C
JAK3	3718	genome.wustl.edu	37	19	17937609	17937609	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:17937609C>G	ENST00000527670.1	-	23	3347	c.3318G>C	c.(3316-3318)gaG>gaC	p.E1106D	JAK3_ENST00000458235.1_Missense_Mutation_p.E1106D			P52333	JAK3_HUMAN	Janus kinase 3	1106	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	AGGCATGAGTCTCACACCCCC	0.612		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													157.0	134.0	142.0					19																	17937609		2203	4300	6503	SO:0001583	missense	0			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.3318G>C	19.37:g.17937609C>G	ENSP00000432511:p.Glu1106Asp		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1106D	ENST00000527670.1	37	c.3318	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	C	4.630	0.117083	0.08881	.	.	ENSG00000105639	ENST00000458235;ENST00000527670	T;T	0.75477	-0.94;-0.94	1.52	1.52	0.23074	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.50616	0.1626	N	0.17474	0.49	0.09310	N	1	B	0.27416	0.178	B	0.16722	0.016	T	0.30238	-0.9985	9	0.12430	T	0.62	.	6.5047	0.22188	0.0:1.0:0.0:0.0	.	1106	P52333	JAK3_HUMAN	D	1106	ENSP00000391676:E1106D;ENSP00000432511:E1106D	ENSP00000391676:E1106D	E	-	3	2	JAK3	17798609	0.000000	0.05858	0.045000	0.18777	0.119000	0.20118	0.447000	0.21710	1.155000	0.42497	0.313000	0.20887	GAG	JAK3	-	superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	ENSG00000105639		0.612	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	-	0.00	42	0	C	NM_000215		17937609	-1	tier1	-	no_errors	ENST00000458235	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.249	G
KATNAL2	83473	genome.wustl.edu	37	18	44584698	44584698	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:44584698C>T	ENST00000245121.5	+	4	403	c.209C>T	c.(208-210)tCg>tTg	p.S70L	KATNAL2_ENST00000356157.7_Missense_Mutation_p.S142L|KATNAL2_ENST00000592005.1_Intron	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						GACACCAAATCGCTCAATAAG	0.473																																																	0													93.0	91.0	92.0					18																	44584698		2203	4300	6503	SO:0001583	missense	0			BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.209C>T	18.37:g.44584698C>T	ENSP00000245121:p.Ser70Leu			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S70L	ENST00000245121.5	37	c.209	CCDS32828.1	18	.	.	.	.	.	.	.	.	.	.	C	8.707	0.911063	0.17833	.	.	ENSG00000167216	ENST00000356157;ENST00000245121	D;D	0.93307	-3.19;-3.2	5.35	5.35	0.76521	.	0.709376	0.14131	N	0.339373	D	0.89150	0.6633	L	0.36672	1.1	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.78183	-0.2303	10	0.30854	T	0.27	-14.1573	12.358	0.55186	0.0:0.8302:0.1698:0.0	.	142	Q8IYT4	KATL2_HUMAN	L	142;70	ENSP00000348478:S142L;ENSP00000245121:S70L	ENSP00000245121:S70L	S	+	2	0	KATNAL2	42838696	0.000000	0.05858	0.006000	0.13384	0.504000	0.33889	0.808000	0.27154	2.518000	0.84900	0.561000	0.74099	TCG	KATNAL2	-	NULL	ENSG00000167216		0.473	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	KATNAL2	HGNC	protein_coding	OTTHUMT00000446138.2	-	0.00	72	0	C	NM_031303		44584698	+1	tier1	-	no_errors	ENST00000245121	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.004	T
KCNH3	23416	genome.wustl.edu	37	12	49935472	49935472	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:49935472G>A	ENST00000257981.6	+	3	630	c.370G>A	c.(370-372)Gct>Act	p.A124T	KCNH3_ENST00000550434.1_3'UTR	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	124	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						AGGGGAGGTGGCTCTCTTCCT	0.542																																																	0													185.0	196.0	192.0					12																	49935472		2203	4300	6503	SO:0001583	missense	0			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.370G>A	12.37:g.49935472G>A	ENSP00000257981:p.Ala124Thr		Q9UQ06	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.A124T	ENST00000257981.6	37	c.370	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.844219	0.97016	.	.	ENSG00000135519	ENST00000257981	D	0.99563	-6.17	5.1	5.1	0.69264	PAS-associated, C-terminal (1);PAS (1);PAS fold-4 (1);	0.000000	0.45361	D	0.000371	D	0.97766	0.9267	N	0.01576	-0.805	0.49483	D	0.999798	P	0.46621	0.881	P	0.50270	0.636	D	0.98514	1.0620	10	0.87932	D	0	.	16.4123	0.83722	0.0:0.0:1.0:0.0	.	124	Q9ULD8	KCNH3_HUMAN	T	124	ENSP00000257981:A124T	ENSP00000257981:A124T	A	+	1	0	KCNH3	48221739	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.646000	0.98474	2.825000	0.97269	0.655000	0.94253	GCT	KCNH3	-	pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_PAS,smart_PAC,pfscan_PAS-assoc_C,tigrfam_PAS	ENSG00000135519		0.542	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	HGNC	protein_coding	OTTHUMT00000404571.2		0.00	49	0	G	NM_012284		49935472	+1			no_errors	ENST00000257981	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	A
KHDRBS1	10657	genome.wustl.edu	37	1	32508359	32508359	+	3'UTR	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:32508359C>G	ENST00000327300.7	+	0	1633				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TCCCCTTCTTCTCCCCACCTT	0.338																																					Ovarian(173;401 1982 12359 31110 42403)												0																																										SO:0001624	3_prime_UTR_variant	0			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*134C>G	1.37:g.32508359C>G				RNA	SNP	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																			KHDRBS1	-	-	ENSG00000121774		0.338	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	-	0.00	59	0	C	NM_006559		32508359	+1	tier1	-	no_errors	ENST00000307714	ensembl	human	known	74_37	rna	57.63	24	34	SNP	1.000	G
KHDRBS1	10657	genome.wustl.edu	37	1	32508568	32508568	+	3'UTR	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:32508568C>G	ENST00000327300.7	+	0	1842				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTGTTAGTTTCAAAAATGACA	0.294																																					Ovarian(173;401 1982 12359 31110 42403)												0																																										SO:0001624	3_prime_UTR_variant	0			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*343C>G	1.37:g.32508568C>G				RNA	SNP	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																			KHDRBS1	-	-	ENSG00000121774		0.294	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	-	0.00	65	0	C	NM_006559		32508568	+1	tier1	-	no_errors	ENST00000307714	ensembl	human	known	74_37	rna	50.00	24	24	SNP	1.000	G
KCTD3	51133	genome.wustl.edu	37	1	215793774	215793774	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:215793774G>A	ENST00000259154.4	+	18	2556	c.2262G>A	c.(2260-2262)agG>agA	p.R754R	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	754					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TAGAGTTTAGGAAGAAAGGAG	0.398																																																	0													76.0	80.0	78.0					1																	215793774		2203	4297	6500	SO:0001819	synonymous_variant	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.2262G>A	1.37:g.215793774G>A			A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.R754	ENST00000259154.4	37	c.2262	CCDS1515.1	1																																																																																			KCTD3	-	NULL	ENSG00000136636		0.398	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	-	0.00	101	0	G	NM_016121		215793774	+1	tier1	-	no_errors	ENST00000259154	ensembl	human	known	74_37	silent	23.53	65	20	SNP	0.966	A
KIAA1210	57481	genome.wustl.edu	37	X	118221021	118221021	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:118221021C>T	ENST00000402510.2	-	11	4171	c.4172G>A	c.(4171-4173)aGc>aAc	p.S1391N		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1391										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GTCAGAATTGCTCTCAAAAAC	0.453																																																	0													125.0	122.0	123.0					X																	118221021		1907	4113	6020	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4172G>A	X.37:g.118221021C>T	ENSP00000384670:p.Ser1391Asn		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.S1391N	ENST00000402510.2	37	c.4172	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488829	0.26686	.	.	ENSG00000250423	ENST00000402510	T	0.10005	2.92	4.18	-1.46	0.08800	.	.	.	.	.	T	0.05318	0.0141	N	0.19112	0.55	0.09310	N	1	B	0.19331	0.035	B	0.14023	0.01	T	0.44982	-0.9292	9	0.17832	T	0.49	.	4.4124	0.11439	0.0:0.3251:0.1725:0.5023	.	1391	Q9ULL0	K1210_HUMAN	N	1391	ENSP00000384670:S1391N	ENSP00000384670:S1391N	S	-	2	0	RP13-347D8.6	118105049	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.740000	0.26188	-0.414000	0.07495	-1.292000	0.01352	AGC	KIAA1210	-	NULL	ENSG00000250423		0.453	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	-	0.00	53	0	C	NM_020721		118221021	-1	tier1	-	no_errors	ENST00000402510	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.000	T
KIAA1644	85352	genome.wustl.edu	37	22	44681532	44681532	+	Nonsense_Mutation	SNP	G	G	T	rs201344135		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:44681532G>T	ENST00000381176.4	-	4	507	c.375C>A	c.(373-375)taC>taA	p.Y125*		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	125						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				TGCAGATGTCGTAGTTCATTG	0.572																																																	0													172.0	167.0	169.0					22																	44681532		2040	4205	6245	SO:0001587	stop_gained	0			AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.375C>A	22.37:g.44681532G>T	ENSP00000370568:p.Tyr125*		A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Nonsense_Mutation	SNP	NULL	p.Y125*	ENST00000381176.4	37	c.375	CCDS43025.1	22	.	.	.	.	.	.	.	.	.	.	G	37	5.999824	0.97189	.	.	ENSG00000138944	ENST00000381176	.	.	.	5.06	2.98	0.34508	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.4491	5.5695	0.17188	0.3048:0.0:0.6952:0.0	.	.	.	.	X	125	.	ENSP00000370568:Y125X	Y	-	3	2	KIAA1644	43012865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.156000	0.42310	1.125000	0.41998	0.561000	0.74099	TAC	KIAA1644	-	NULL	ENSG00000138944		0.572	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	KIAA1644	HGNC	protein_coding	OTTHUMT00000075879.2	-	0.00	63	0	G	NM_001099294		44681532	-1	tier1	-	no_errors	ENST00000381176	ensembl	human	putative	74_37	nonsense	6.15	61	4	SNP	1.000	T
KIF21A	55605	genome.wustl.edu	37	12	39703442	39703442	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:39703442G>C	ENST00000361418.5	-	33	4238	c.4223C>G	c.(4222-4224)tCt>tGt	p.S1408C	KIF21A_ENST00000541463.2_Missense_Mutation_p.S1355C|KIF21A_ENST00000361961.3_Missense_Mutation_p.S1395C|KIF21A_ENST00000544797.2_Missense_Mutation_p.S1371C|KIF21A_ENST00000547745.1_5'Flank|KIF21A_ENST00000395670.3_Missense_Mutation_p.S1409C			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1408					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				CTTAATATAAGATGTTGATAC	0.393																																																	0													92.0	87.0	89.0					12																	39703442		2203	4300	6503	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4223C>G	12.37:g.39703442G>C	ENSP00000354878:p.Ser1408Cys		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.S1409C	ENST00000361418.5	37	c.4226	CCDS53776.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	17.90|17.90	3.501349|3.501349	0.64298|0.64298	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000552961|ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463	.|D;D;D;T;D;T	.|0.81499	.|-1.5;-1.5;-1.5;2.19;-1.5;-0.14	5.39|5.39	3.56|3.56	0.40772|0.40772	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.248814	.|0.28677	.|N	.|0.014508	D|D	0.84334|0.84334	0.5449|0.5449	L|L	0.47016|0.47016	1.485|1.485	0.43255|0.43255	D|D	0.995187|0.995187	.|D;D;D;D;D;D	.|0.76494	.|0.988;0.988;0.994;0.994;0.992;0.999	.|P;P;P;P;P;D	.|0.66716	.|0.8;0.8;0.873;0.847;0.896;0.946	D|D	0.85289|0.85289	0.1066|0.1066	5|10	.|0.87932	.|D	.|0	.|.	11.5228|11.5228	0.50562|0.50562	0.1442:0.0:0.8558:0.0|0.1442:0.0:0.8558:0.0	.|.	.|1371;1355;1408;1395;1361;395	.|F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8	.|.;.;KI21A_HUMAN;.;.;.	V|C	709|1395;1409;1361;395;389;1371;1408;1355	.|ENSP00000354851:S1395C;ENSP00000379029:S1409C;ENSP00000448792:S389C;ENSP00000445606:S1371C;ENSP00000354878:S1408C;ENSP00000438075:S1355C	.|ENSP00000344501:S1361C	L|S	-|-	1|2	0|0	KIF21A|KIF21A	37989709|37989709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.901000|0.901000	0.52897|0.52897	6.269000|6.269000	0.72558|0.72558	1.286000|1.286000	0.44565|0.44565	-0.127000|-0.127000	0.14921|0.14921	CTT|TCT	KIF21A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139116		0.393	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	-	0.00	53	0	G	NM_017641		39703442	-1	tier1	-	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	52.50	19	21	SNP	1.000	C
KIF21A	55605	genome.wustl.edu	37	12	39760156	39760156	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:39760156C>A	ENST00000361418.5	-	6	914	c.899G>T	c.(898-900)gGa>gTa	p.G300V	KIF21A_ENST00000541463.2_Missense_Mutation_p.G300V|KIF21A_ENST00000361961.3_Missense_Mutation_p.G300V|KIF21A_ENST00000544797.2_Missense_Mutation_p.G300V|KIF21A_ENST00000395670.3_Missense_Mutation_p.G300V			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	300	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TCTTACAAGTCCACAGTTGAT	0.383																																																	0													113.0	113.0	113.0					12																	39760156		2203	4300	6503	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.899G>T	12.37:g.39760156C>A	ENSP00000354878:p.Gly300Val		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.G300V	ENST00000361418.5	37	c.899	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623681	0.87460	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000552908	T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	4.73	4.73	0.59995	Kinesin, motor domain (3);	0.000000	0.50627	D	0.000103	D	0.87370	0.6160	M	0.83852	2.665	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.997;1.0;0.988	D	0.89713	0.3913	10	0.87932	D	0	.	17.7244	0.88361	0.0:1.0:0.0:0.0	.	300;300;300;300;300	F5H219;B9EGE4;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;.;KI21A_HUMAN;.	V	300;300;300;300;300;300;123	ENSP00000354851:G300V;ENSP00000379029:G300V;ENSP00000445606:G300V;ENSP00000354878:G300V;ENSP00000438075:G300V;ENSP00000449700:G123V	ENSP00000344501:G300V	G	-	2	0	KIF21A	38046423	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.285000	0.78660	2.183000	0.69458	0.655000	0.94253	GGA	KIF21A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom	ENSG00000139116		0.383	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	-	0.00	57	0	C	NM_017641		39760156	-1	tier1	-	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	36.54	33	19	SNP	1.000	A
LAMA4	3910	genome.wustl.edu	37	6	112466087	112466087	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:112466087G>A	ENST00000230538.7	-	19	2799	c.2402C>T	c.(2401-2403)aCg>aTg	p.T801M	LAMA4_ENST00000522006.1_Missense_Mutation_p.T794M|LAMA4_ENST00000389463.4_Missense_Mutation_p.T794M|LAMA4_ENST00000424408.2_Missense_Mutation_p.T794M	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	801	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CTGCTCAACCGTACGAAGCTG	0.433																																																	0													72.0	67.0	69.0					6																	112466087		2203	4300	6503	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2402C>T	6.37:g.112466087G>A	ENSP00000230538:p.Thr801Met		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.T801M	ENST00000230538.7	37	c.2402	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275360	0.23307	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.35	3.59	0.41128	Laminin II (1);	0.378797	0.32918	N	0.005491	T	0.25531	0.0621	L	0.47716	1.5	0.21604	N	0.999627	D;D	0.64830	0.994;0.992	P;P	0.53224	0.721;0.599	T	0.06972	-1.0797	10	0.41790	T	0.15	.	5.0005	0.14262	0.1352:0.1172:0.6265:0.121	.	801;794	Q16363;Q16363-2	LAMA4_HUMAN;.	M	801;794;794;794	ENSP00000230538:T801M;ENSP00000429488:T794M;ENSP00000374114:T794M;ENSP00000416470:T794M	ENSP00000230538:T801M	T	-	2	0	LAMA4	112572780	0.004000	0.15560	0.004000	0.12327	0.120000	0.20174	0.668000	0.25127	0.844000	0.35094	-0.749000	0.03505	ACG	LAMA4	-	pfam_Laminin_II,superfamily_Focal_adhesion_kin_target_dom	ENSG00000112769		0.433	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	46	0	G	NM_001105206		112466087	-1	tier1	-	no_errors	ENST00000230538	ensembl	human	known	74_37	missense	10.20	44	5	SNP	0.024	A
LITAF	9516	genome.wustl.edu	37	16	11643500	11643500	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:11643500C>T	ENST00000571688.1	-	4	709	c.479G>A	c.(478-480)cGt>cAt	p.R160H	LITAF_ENST00000570904.1_Missense_Mutation_p.R160H|LITAF_ENST00000574763.1_Missense_Mutation_p.R160H|LITAF_ENST00000339430.5_Missense_Mutation_p.R160H|LITAF_ENST00000381810.3_Silent_p.A160A|LITAF_ENST00000571459.1_3'UTR|LITAF_ENST00000572255.1_Missense_Mutation_p.R67H|LITAF_ENST00000413364.2_3'UTR|LITAF_ENST00000576036.1_Missense_Mutation_p.R160H	NM_001136472.1	NP_001129944.1	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF factor	160					aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cytokine production (GO:0001817)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			endometrium(1)|large_intestine(1)|liver(1)|lung(3)|skin(1)	7						GTCCTACAAACGCTTGTAGGT	0.612																																																	0													42.0	39.0	40.0					16																	11643500		2197	4300	6497	SO:0001583	missense	0			AB034747	CCDS32386.1, CCDS45411.1	16p13.3-p12	2014-09-17							16841	protein-coding gene	gene with protein product		603795				9305847, 10200294	Standard	NM_004862		Approved	PIG7, SIMPLE, FLJ38636, TP53I7	uc002dbb.3	Q99732		ENST00000571688.1:c.479G>A	16.37:g.11643500C>T	ENSP00000459533:p.Arg160His		D3DUG1|G5E9K0|Q05DW0|Q9C0L6	Missense_Mutation	SNP	pfam_LITAF,smart_LITAF	p.R160H	ENST00000571688.1	37	c.479	CCDS32386.1	16	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305793	0.81247	.	.	ENSG00000189067	ENST00000339430	D	0.88741	-2.42	5.01	4.06	0.47325	LPS-induced tumor necrosis factor alpha factor (2);	.	.	.	.	D	0.93680	0.7981	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	D	0.93403	0.6762	9	0.51188	T	0.08	-10.0725	11.5521	0.50726	0.0:0.9121:0.0:0.0879	.	160	Q99732	LITAF_HUMAN	H	160	ENSP00000340118:R160H	ENSP00000340118:R160H	R	-	2	0	LITAF	11551001	1.000000	0.71417	0.998000	0.56505	0.868000	0.49771	5.757000	0.68766	1.246000	0.43901	-0.152000	0.13540	CGT	LITAF	-	pfam_LITAF,smart_LITAF	ENSG00000189067		0.612	LITAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LITAF	HGNC	protein_coding	OTTHUMT00000436794.2	-	0.00	40	0	C	NM_004862		11643500	-1	tier1	-	no_errors	ENST00000339430	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	T
EIF4B	1975	genome.wustl.edu	37	12	53434012	53434013	+	3'UTR	INS	-	-	TA			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:53434012_53434013insTA	ENST00000262056.9	+	0	2167_2168				RP11-983P16.4_ENST00000552905.1_RNA|RP11-983P16.4_ENST00000546767.1_RNA|RP11-983P16.4_ENST00000550601.1_RNA|RP11-983P16.4_ENST00000607643.1_RNA|RP11-983P16.4_ENST00000546793.1_RNA|EIF4B_ENST00000420463.3_3'UTR|RP11-983P16.4_ENST00000546566.1_RNA|EIF4B_ENST00000416762.3_3'UTR	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						GAATAGACCTCTACATCCTGTG	0.426																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.*6->TA	12.37:g.53434013_53434014dupTA			Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	RNA	INS	-	NULL	ENST00000262056.9	37	NULL	CCDS41788.1	12																																																																																			RP11-983P16.4	-	-	ENSG00000257337		0.426	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC283335	Clone_based_vega_gene	protein_coding	OTTHUMT00000404852.2		0.00	24	0	-	NM_001417		53434013	-1	tier1		no_errors	ENST00000546566	ensembl	human	known	74_37	rna	18.52	22	5	INS	0.774:0.052	TA
LRP5L	91355	genome.wustl.edu	37	22	25750717	25750717	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:25750717G>T	ENST00000402785.2	-	3	597	c.501C>A	c.(499-501)ttC>ttA	p.F167L	LRP5L_ENST00000444995.3_Missense_Mutation_p.F167L|LRP5L_ENST00000402859.2_Missense_Mutation_p.F167L			A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein 5-like	167					canonical Wnt signaling pathway (GO:0060070)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)		Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	6						GGGTGAACCTGAAAATGTGTG	0.567																																																	0													167.0	145.0	152.0					22																	25750717		2200	4300	6500	SO:0001583	missense	0			AL137651	CCDS33626.1	22q11.23	2013-05-30			ENSG00000100068	ENSG00000100068			25323	protein-coding gene	gene with protein product							Standard	NM_182492		Approved	DKFZp434O0213	uc011ajz.2	A4QPB2	OTTHUMG00000150900	ENST00000402785.2:c.501C>A	22.37:g.25750717G>T	ENSP00000384562:p.Phe167Leu		B0QYF3|B0QYF4|B2RPI5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	p.F167L	ENST00000402785.2	37	c.501	CCDS33626.1	22	.	.	.	.	.	.	.	.	.	.	g	12.62	1.991389	0.35131	.	.	ENSG00000100068	ENST00000402859;ENST00000444995;ENST00000402785	D;D;D	0.91124	-2.79;-2.79;-2.79	2.44	-1.96	0.07525	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.94165	0.8128	M	0.87097	2.86	0.49582	D	0.999807	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	D	0.91544	0.5252	9	0.87932	D	0	.	7.3755	0.26825	0.7215:0.0:0.2785:0.0	.	167;167	A4QPB2-2;A4QPB2	.;LRP5L_HUMAN	L	167	ENSP00000384291:F167L;ENSP00000407283:F167L;ENSP00000384562:F167L	ENSP00000384562:F167L	F	-	3	2	LRP5L	24080717	0.994000	0.37717	0.991000	0.47740	0.040000	0.13550	0.356000	0.20181	-0.372000	0.07992	0.194000	0.17425	TTC	LRP5L	-	smart_LDLR_classB_rpt	ENSG00000100068		0.567	LRP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5L	HGNC	protein_coding	OTTHUMT00000320477.2	-	0.00	66	0	G	NM_182492		25750717	-1	tier1	-	no_errors	ENST00000402785	ensembl	human	known	74_37	missense	46.15	35	30	SNP	1.000	T
LRRC37A3	374819	genome.wustl.edu	37	17	62892159	62892159	+	Missense_Mutation	SNP	G	G	T	rs17857225		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:62892159G>T	ENST00000584306.1	-	3	1747	c.1217C>A	c.(1216-1218)gCt>gAt	p.A406D	LRRC37A3_ENST00000319651.5_Missense_Mutation_p.A406D|LRRC37A3_ENST00000577487.1_5'Flank|LRRC37A3_ENST00000339474.5_Intron|LRRC37A3_ENST00000400877.3_Intron|RP11-927P21.1_ENST00000577938.1_RNA|RP11-927P21.1_ENST00000584959.1_RNA|RP11-927P21.1_ENST00000584131.1_RNA	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	406						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						ACTGGGTGAAGCTAAATGATG	0.537																																																	0													1.0	1.0	1.0					17																	62892159		292	887	1179	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.1217C>A	17.37:g.62892159G>T	ENSP00000464535:p.Ala406Asp		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A406D	ENST00000584306.1	37	c.1217	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	0	-2.581395	0.00129	.	.	ENSG00000176809	ENST00000319651	T	0.59772	0.24	2.63	-5.25	0.02781	.	.	.	.	.	T	0.16342	0.0393	N	0.00483	-1.445	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11108	-1.0601	9	0.11794	T	0.64	.	2.8545	0.05568	0.2063:0.2804:0.3945:0.1188	.	406	O60309	L37A3_HUMAN	D	406	ENSP00000325713:A406D	ENSP00000325713:A406D	A	-	2	0	LRRC37A3	60322621	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.921000	0.01569	-5.806000	0.00009	-2.171000	0.00323	GCT	LRRC37A3	-	NULL	ENSG00000176809		0.537	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	-	0.00	30	0	G	NM_199340		62892159	-1	tier1	rs199539333	no_errors	ENST00000319651	ensembl	human	known	74_37	missense	23.33	23	7	SNP	0.000	T
LRRCC1	85444	genome.wustl.edu	37	8	86027421	86027421	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:86027421G>A	ENST00000360375.3	+	5	780	c.631G>A	c.(631-633)Gaa>Aaa	p.E211K	LRRCC1_ENST00000414626.2_Missense_Mutation_p.E191K	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	211	LRRCT.				mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AAATTTGACAGAAATAAATTC	0.363																																																	0													97.0	98.0	97.0					8																	86027421		1825	4088	5913	SO:0001583	missense	0			BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.631G>A	8.37:g.86027421G>A	ENSP00000353538:p.Glu211Lys		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin	p.E211K	ENST00000360375.3	37	c.631	CCDS43750.1	8	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681148	0.47886	.	.	ENSG00000133739	ENST00000426019;ENST00000360375;ENST00000414626	T;T	0.34859	1.34;1.36	5.52	3.72	0.42706	.	0.183530	0.26650	N	0.023209	T	0.42877	0.1222	M	0.76574	2.34	0.20926	N	0.999826	P;B;P	0.43477	0.808;0.047;0.627	B;B;B	0.43990	0.438;0.021;0.219	T	0.34650	-0.9820	10	0.52906	T	0.07	-11.2171	11.5676	0.50815	0.1441:0.0:0.8559:0.0	.	191;118;211	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	K	118;211;191	ENSP00000353538:E211K;ENSP00000394695:E191K	ENSP00000353538:E211K	E	+	1	0	LRRCC1	86214673	0.990000	0.36364	0.019000	0.16419	0.871000	0.50021	1.644000	0.37228	0.691000	0.31592	0.460000	0.39030	GAA	LRRCC1	-	NULL	ENSG00000133739		0.363	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRCC1	HGNC	protein_coding	OTTHUMT00000380267.1	-	0.00	80	0	G	NM_033402		86027421	+1	tier1	-	no_errors	ENST00000360375	ensembl	human	known	74_37	missense	6.30	119	8	SNP	0.157	A
LRRIQ4	344657	genome.wustl.edu	37	3	169539752	169539752	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:169539752C>G	ENST00000340806.6	+	1	43	c.43C>G	c.(43-45)Cat>Gat	p.H15D		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	15										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						ACCTAAAATTCATCAGAGAAA	0.328																																																	0													65.0	62.0	63.0					3																	169539752		1873	4107	5980	SO:0001583	missense	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.43C>G	3.37:g.169539752C>G	ENSP00000342188:p.His15Asp			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.H15D	ENST00000340806.6	37	c.43	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	C	9.052	0.992225	0.18966	.	.	ENSG00000188306	ENST00000340806	T	0.30714	1.52	5.07	4.19	0.49359	.	1.545080	0.03439	N	0.209058	T	0.22282	0.0537	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.18871	0.023	T	0.19811	-1.0294	10	0.24483	T	0.36	.	9.5991	0.39591	0.0:0.8377:0.0:0.1623	.	15	A6NIV6	LRIQ4_HUMAN	D	15	ENSP00000342188:H15D	ENSP00000342188:H15D	H	+	1	0	LRRIQ4	171022446	0.001000	0.12720	0.020000	0.16555	0.102000	0.19082	0.637000	0.24659	1.271000	0.44313	0.561000	0.74099	CAT	LRRIQ4	-	NULL	ENSG00000188306		0.328	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	-	0.00	63	0	C	NM_001080460		169539752	+1	tier1	-	no_errors	ENST00000340806	ensembl	human	known	74_37	missense	11.64	129	17	SNP	0.069	G
LRRK2	120892	genome.wustl.edu	37	12	40689290	40689290	+	Silent	SNP	G	G	A	rs201042000		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:40689290G>A	ENST00000298910.7	+	23	2998	c.2940G>A	c.(2938-2940)gaG>gaA	p.E980E	LRRK2_ENST00000343742.2_Silent_p.E980E	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	980					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGGCTTCTGAGAGAGAATATA	0.363																																																	0													73.0	73.0	73.0					12																	40689290		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2940G>A	12.37:g.40689290G>A			A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.E980	ENST00000298910.7	37	c.2940	CCDS31774.1	12																																																																																			LRRK2	-	NULL	ENSG00000188906		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	61	0	G	XM_058513		40689290	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	silent	50.00	17	17	SNP	1.000	A
LZTS1	11178	genome.wustl.edu	37	8	20112381	20112381	+	Frame_Shift_Del	DEL	G	G	-	rs184099726		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:20112381delG	ENST00000381569.1	-	2	669	c.312delC	c.(310-312)cccfs	p.P104fs	LZTS1_ENST00000522290.1_Frame_Shift_Del_p.P104fs|LZTS1_ENST00000265801.6_Frame_Shift_Del_p.P104fs			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	104					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCATGAGCTTGGGGGGTGTGG	0.602																																																	0													37.0	38.0	38.0					8																	20112381		2203	4300	6503	SO:0001589	frameshift_variant	0			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.312delC	8.37:g.20112381delG	ENSP00000370981:p.Pro104fs		D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Frame_Shift_Del	DEL	NULL	p.K105fs	ENST00000381569.1	37	c.312	CCDS6015.1	8																																																																																			LZTS1	-	NULL	ENSG00000061337		0.602	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	HGNC	protein_coding	OTTHUMT00000214122.1		0.00	29	0	G	NM_021020		20112381	-1	tier1		no_errors	ENST00000265801	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	0.989	-
MACF1	23499	genome.wustl.edu	37	1	39835766	39835766	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:39835766C>T	ENST00000372915.3	+	50	13105	c.13018C>T	c.(13018-13020)Cag>Tag	p.Q4340*	MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000317713.7_Nonsense_Mutation_p.Q2273*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.Q2273*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.Q4372*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.Q2273*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.Q4335*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.Q2273*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.Q2775*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4340					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGGACCTTCCAGAAATGGTT	0.428																																																	0													80.0	82.0	81.0					1																	39835766		2203	4300	6503	SO:0001587	stop_gained	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13018C>T	1.37:g.39835766C>T	ENSP00000362006:p.Gln4340*		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q2273*	ENST00000372915.3	37	c.6817		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.781159|8.781159	0.98952|0.98952	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|.	.|.	.|.	5.52|5.52	4.55|4.55	0.56014|0.56014	.|.	.|0.326252	.|0.22469	.|N	.|0.059647	T|.	0.57621|.	0.2066|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.49041|.	-0.8980|.	4|.	.|0.20519	.|T	.|0.43	.|.	13.5505|13.5505	0.61730|0.61730	0.3448:0.6552:0.0:0.0|0.3448:0.6552:0.0:0.0	.|.	.|.	.|.	.|.	L|X	1406|2273;4340;2273;2273;2273;2775	.|.	.|ENSP00000289893:Q2775X	P|Q	+|+	2|1	0|0	MACF1|MACF1	39608353|39608353	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	2.920000|2.920000	0.48844|0.48844	2.610000|2.610000	0.88304|0.88304	0.591000|0.591000	0.81541|0.81541	CCA|CAG	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.428	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	72	0	C	NM_033044		39835766	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	nonsense	7.78	83	7	SNP	1.000	T
MAGEB6	158809	genome.wustl.edu	37	X	26212543	26212543	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:26212543G>T	ENST00000379034.1	+	2	729	c.580G>T	c.(580-582)Gct>Tct	p.A194S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	194										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AAGCAAAGATGCTGTAAAGAA	0.463																																																	0													74.0	64.0	67.0					X																	26212543		2202	4300	6502	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.580G>T	X.37:g.26212543G>T	ENSP00000368320:p.Ala194Ser		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A194S	ENST00000379034.1	37	c.580	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	C	7.035	0.561482	0.13498	.	.	ENSG00000176746	ENST00000379034	T	0.01902	4.57	2.33	1.47	0.22746	.	0.718217	0.12370	U	0.474899	T	0.01454	0.0047	N	0.14661	0.345	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.49560	-0.8927	10	0.18276	T	0.48	.	6.4234	0.21756	0.0:0.6977:0.3023:0.0	.	194	Q8N7X4	MAGB6_HUMAN	S	194	ENSP00000368320:A194S	ENSP00000368320:A194S	A	+	1	0	MAGEB6	26122464	0.006000	0.16342	0.451000	0.26982	0.005000	0.04900	-0.180000	0.09754	0.430000	0.26230	-0.258000	0.10820	GCT	MAGEB6	-	NULL	ENSG00000176746		0.463	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	107	0	G	NM_173523		26212543	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	12.58	132	19	SNP	0.434	T
MALAT1	378938	genome.wustl.edu	37	11	65266460	65266460	+	lincRNA	SNP	T	T	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:65266460T>A	ENST00000534336.1	+	0	1228				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GTGATCGAATTCCGGTGATGC	0.502																																																	0													141.0	142.0	142.0					11																	65266460		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266460T>A				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.502	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	76	0	T	NR_002819		65266460	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	14.46	71	12	SNP	0.000	A
MANEA	79694	genome.wustl.edu	37	6	96053781	96053781	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:96053781G>T	ENST00000358812.4	+	5	1023	c.889G>T	c.(889-891)Gga>Tga	p.G297*	MANEA_ENST00000474553.1_3'UTR	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	297	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TCCTTATGATGGACTGTTTAT	0.363																																																	0													121.0	116.0	118.0					6																	96053781		2203	4300	6503	SO:0001587	stop_gained	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.889G>T	6.37:g.96053781G>T	ENSP00000351669:p.Gly297*		A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Nonsense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.G297*	ENST00000358812.4	37	c.889	CCDS5032.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.457235	0.97581	.	.	ENSG00000172469	ENST00000358812	.	.	.	6.16	6.16	0.99307	.	0.151346	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-6.5318	19.848	0.96722	0.0:0.0:1.0:0.0	.	.	.	.	X	297	.	ENSP00000351669:G297X	G	+	1	0	MANEA	96160502	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.256000	0.72473	2.937000	0.99478	0.650000	0.86243	GGA	MANEA	-	NULL	ENSG00000172469		0.363	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1	-	0.00	52	0	G	NM_024641		96053781	+1	tier1	-	no_errors	ENST00000358812	ensembl	human	known	74_37	nonsense	18.18	45	10	SNP	1.000	T
MANEA	79694	genome.wustl.edu	37	6	96053793	96053793	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:96053793delG	ENST00000358812.4	+	5	1035	c.901delG	c.(901-903)gccfs	p.A301fs	MANEA_ENST00000474553.1_3'UTR	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	301	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		ACTGTTTATTGCCCTTCTGGT	0.378																																																	0													113.0	109.0	110.0					6																	96053793		2203	4300	6503	SO:0001589	frameshift_variant	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.901delG	6.37:g.96053793delG	ENSP00000351669:p.Ala301fs		A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Frame_Shift_Del	DEL	superfamily_Glycoside_hydrolase_SF	p.A301fs	ENST00000358812.4	37	c.901	CCDS5032.1	6																																																																																			MANEA	-	NULL	ENSG00000172469		0.378	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1		0.00	50	0	G	NM_024641		96053793	+1	tier1		no_errors	ENST00000358812	ensembl	human	known	74_37	frame_shift_del	17.65	42	9	DEL	1.000	-
MANEA	79694	genome.wustl.edu	37	6	96053797	96053797	+	Missense_Mutation	SNP	T	T	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:96053797T>C	ENST00000358812.4	+	5	1039	c.905T>C	c.(904-906)cTt>cCt	p.L302P	MANEA_ENST00000474553.1_3'UTR	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	302	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TTTATTGCCCTTCTGGTAGAA	0.378																																																	0													108.0	104.0	105.0					6																	96053797		2203	4300	6503	SO:0001583	missense	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.905T>C	6.37:g.96053797T>C	ENSP00000351669:p.Leu302Pro		A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.L302P	ENST00000358812.4	37	c.905	CCDS5032.1	6	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271991	0.80469	.	.	ENSG00000172469	ENST00000358812	D	0.92647	-3.08	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.95648	0.8585	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94605	0.7799	10	0.25106	T	0.35	-26.4815	15.7535	0.78005	0.0:0.0:0.0:1.0	.	302	Q5SRI9	MANEA_HUMAN	P	302	ENSP00000351669:L302P	ENSP00000351669:L302P	L	+	2	0	MANEA	96160518	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.603000	0.82811	2.313000	0.78055	0.455000	0.32223	CTT	MANEA	-	NULL	ENSG00000172469		0.378	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1	-	0.00	50	0	T	NM_024641		96053797	+1	tier1	-	no_errors	ENST00000358812	ensembl	human	known	74_37	missense	18.00	41	9	SNP	1.000	C
MC2R	4158	genome.wustl.edu	37	18	13884645	13884645	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:13884645G>T	ENST00000327606.3	-	2	1053	c.873C>A	c.(871-873)atC>atA	p.I291I		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	291					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.I291I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	TGCTGCAGAAGATCATCTTTT	0.478																																					Colon(141;1584 1782 35999 48227 48692)												1	Substitution - coding silent(1)	large_intestine(1)											119.0	115.0	116.0					18																	13884645		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.873C>A	18.37:g.13884645G>T			A8K016|Q3MI45|Q504X6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ACTH_rcpt,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn	p.I291	ENST00000327606.3	37	c.873	CCDS11869.1	18																																																																																			MC2R	-	prints_ACTH_rcpt,prints_Melcrt_ACTH_rcpt	ENSG00000185231		0.478	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC2R	HGNC	protein_coding	OTTHUMT00000254639.2	-	0.00	35	0	G			13884645	-1	tier1	-	no_errors	ENST00000327606	ensembl	human	known	74_37	silent	25.00	18	6	SNP	0.997	T
MCF2L2	23101	genome.wustl.edu	37	3	182933848	182933848	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:182933848G>C	ENST00000328913.3	-	22	2702	c.2405C>G	c.(2404-2406)tCa>tGa	p.S802*	MCF2L2_ENST00000473233.1_Nonsense_Mutation_p.S802*	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	802	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TAGTTCAGTTGAGAATGCTGA	0.433																																																	0													268.0	236.0	246.0					3																	182933848		2203	4300	6503	SO:0001587	stop_gained	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2405C>G	3.37:g.182933848G>C	ENSP00000328118:p.Ser802*		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Nonsense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S802*	ENST00000328913.3	37	c.2405	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597016	0.66332	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	.	.	.	4.29	1.26	0.21427	.	0.447497	0.19966	N	0.102109	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.3153	0.21186	0.3528:0.0:0.6472:0.0	.	.	.	.	X	802	.	ENSP00000328118:S802X	S	-	2	0	MCF2L2	184416542	0.995000	0.38212	0.008000	0.14137	0.088000	0.18126	1.505000	0.35736	0.130000	0.18549	0.655000	0.94253	TCA	MCF2L2	-	superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000053524		0.433	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	-	0.00	69	0	G	NM_015078		182933848	-1	tier1	-	no_errors	ENST00000328913	ensembl	human	known	74_37	nonsense	21.18	67	18	SNP	0.081	C
MEI4	101928601	genome.wustl.edu	37	6	78633056	78633056	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:78633056G>T	ENST00000602452.2	+	4	1165	c.1151G>T	c.(1150-1152)aGa>aTa	p.R384I		NM_001282136.1	NP_001269065.1	A8MW99	MEI4L_HUMAN	meiosis-specific 4 homolog (S. cerevisiae)	384					DNA recombination (GO:0006310)|meiotic DNA double-strand break formation (GO:0042138)|oogenesis (GO:0048477)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	lateral element (GO:0000800)											GAAACTCTTAGAAAATAACTC	0.294																																																	0																																										SO:0001583	missense	0				CCDS64463.1	6q14.1	2014-08-13			ENSG00000269964	ENSG00000269964			43638	protein-coding gene	gene with protein product						20551173	Standard	XM_005248773		Approved			A8MW99	OTTHUMG00000153472	ENST00000602452.2:c.1151G>T	6.37:g.78633056G>T	ENSP00000473370:p.Arg384Ile		R4GMV8	Missense_Mutation	SNP	NULL	p.R384I	ENST00000602452.2	37	c.1151		6																																																																																			MEI4	-	NULL	ENSG00000269964		0.294	MEI4-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	MEI4	HGNC	protein_coding	OTTHUMT00000331298.2	-	0.00	64	0	G			78633056	+1	tier1	-	no_errors	ENST00000602452	ensembl	human	novel	74_37	missense	41.43	41	29	SNP	0.663	T
METAP2	10988	genome.wustl.edu	37	12	95906601	95906601	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:95906601A>G	ENST00000323666.5	+	10	1322	c.1093A>G	c.(1093-1095)Acc>Gcc	p.T365A	METAP2_ENST00000546753.1_Missense_Mutation_p.T342A|METAP2_ENST00000550777.1_Missense_Mutation_p.T329A|METAP2_ENST00000551840.1_Missense_Mutation_p.T364A|METAP2_ENST00000261220.9_Missense_Mutation_p.T342A	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						TGCAATTGAAACCTTTGGTAG	0.353																																																	0													140.0	123.0	129.0					12																	95906601		2203	4300	6503	SO:0001583	missense	0			U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.1093A>G	12.37:g.95906601A>G	ENSP00000325312:p.Thr365Ala			Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP2	p.T365A	ENST00000323666.5	37	c.1093	CCDS9052.1	12	.	.	.	.	.	.	.	.	.	.	A	27.2	4.805591	0.90623	.	.	ENSG00000111142	ENST00000323666;ENST00000546753;ENST00000261220;ENST00000550777;ENST00000551840	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.88	5.88	0.94601	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.92857	0.7728	H	0.98295	4.195	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.996;0.999;0.996;0.997	D;D;D;D;D	0.75020	0.985;0.975;0.984;0.975;0.985	D	0.95507	0.8582	10	0.87932	D	0	-11.0175	16.2961	0.82769	1.0:0.0:0.0:0.0	.	342;329;342;364;365	B4DUX5;F8VRR3;G3XA91;F8VQZ7;P50579	.;.;.;.;AMPM2_HUMAN	A	365;342;342;329;364	ENSP00000325312:T365A;ENSP00000448169:T342A;ENSP00000261220:T342A;ENSP00000448614:T329A;ENSP00000450063:T364A	ENSP00000261220:T342A	T	+	1	0	METAP2	94430732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.250000	0.74265	0.454000	0.30748	ACC	METAP2	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP2	ENSG00000111142		0.353	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METAP2	HGNC	protein_coding	OTTHUMT00000408296.1	-	0.00	75	0	A	NM_006838		95906601	+1	tier1	-	no_errors	ENST00000323666	ensembl	human	known	74_37	missense	59.52	17	25	SNP	1.000	G
METTL21EP	121952	genome.wustl.edu	37	13	103548145	103548145	+	RNA	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:103548145A>G	ENST00000605100.1	+	0	2074					NR_026965.1		A6NDL7	MT21E_HUMAN	methyltransferase like 21E, pseudogene								methyltransferase activity (GO:0008168)										GGAAATacacacacagatgcg	0.423																																																	0																																												0					13q33.1	2012-11-09	2012-11-09	2012-11-09	ENSG00000250878	ENSG00000250878			41948	pseudogene	pseudogene			"""methyltransferase like 21C pseudogene 1"""	METTL21CP1			Standard	NR_026965		Approved		uc001vpx.1	A6NDL7	OTTHUMG00000017312		13.37:g.103548145A>G				RNA	SNP	-	NULL	ENST00000605100.1	37	NULL		13																																																																																			METTL21EP	-	-	ENSG00000250878		0.423	METTL21EP-002	KNOWN	basic	processed_transcript	METTL21EP	HGNC	pseudogene	OTTHUMT00000468255.1		0.00	8	0	A	NR_026965		103548145	+1			no_errors	ENST00000605100	ensembl	human	known	74_37	rna	66.67	1	2	SNP	0.492	G
GLIDR	389741	genome.wustl.edu	37	9	66554111	66554111	+	lincRNA	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:66554111C>T	ENST00000305709.5	+	0	724				RP11-262H14.3_ENST00000445604.2_lincRNA	NR_015363.1																						TAGAGAGGGGCCCTGGGCAGG	0.592																																																	0																																												0																															9.37:g.66554111C>T				RNA	SNP	-	NULL	ENST00000305709.5	37	NULL		9																																																																																			RP11-262H14.4	-	-	ENSG00000170161		0.592	RP11-262H14.4-001	KNOWN	basic	lincRNA	MGC21881	Clone_based_vega_gene	lincRNA	OTTHUMT00000037077.1	-	0.00	15	0	C			66554111	+1	tier1	-	no_errors	ENST00000305709	ensembl	human	known	74_37	rna	40.00	3	2	SNP	0.543	T
MLLT10	8028	genome.wustl.edu	37	10	22015215	22015215	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:22015215C>T	ENST00000307729.7	+	15	2099	c.1921C>T	c.(1921-1923)Cat>Tat	p.H641Y	MLLT10_ENST00000377059.3_Missense_Mutation_p.H641Y|MLLT10_ENST00000446906.2_Missense_Mutation_p.H641Y|MLLT10_ENST00000377072.3_Missense_Mutation_p.H657Y			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	641	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GGCACCATCTCATATGTATGG	0.303			T	"""MLL, PICALM, CDK6"""	AL																																			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													174.0	189.0	184.0					10																	22015215		2203	4300	6503	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1921C>T	10.37:g.22015215C>T	ENSP00000307411:p.His641Tyr		B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.H641Y	ENST00000307729.7	37	c.1921	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459869	0.63401	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41	5.66	5.66	0.87406	.	0.096556	0.64402	D	0.000001	D	0.95784	0.8628	M	0.71036	2.16	0.58432	D	0.999995	D;D;P;D	0.62365	0.991;0.985;0.818;0.985	P;P;B;P	0.59056	0.851;0.714;0.135;0.714	D	0.95993	0.8987	10	0.87932	D	0	.	17.9301	0.88994	0.0:1.0:0.0:0.0	.	336;641;641;657	Q5HYC6;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	Y	657;641;641;476;641;300;299	ENSP00000366272:H657Y;ENSP00000401406:H641Y;ENSP00000307411:H641Y;ENSP00000366258:H641Y	ENSP00000307411:H641Y	H	+	1	0	MLLT10	22055221	1.000000	0.71417	0.716000	0.30569	0.827000	0.46813	6.009000	0.70745	2.655000	0.90218	0.650000	0.86243	CAT	MLLT10	-	NULL	ENSG00000078403		0.303	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	-	0.00	58	0	C			22015215	+1	tier1	-	no_errors	ENST00000307729	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.966	T
MOSPD2	158747	genome.wustl.edu	37	X	14921105	14921105	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:14921105G>C	ENST00000380492.3	+	7	644	c.556G>C	c.(556-558)Gat>Cat	p.D186H	MOSPD2_ENST00000482354.1_Missense_Mutation_p.D186H|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	186	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AGTGATCTTTGATATGCCTTG	0.294																																																	0													98.0	88.0	92.0					X																	14921105		2201	4297	6498	SO:0001583	missense	0			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.556G>C	X.37:g.14921105G>C	ENSP00000369860:p.Asp186His		Q8N3H2|Q8NA83	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_MSP_dom,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_MSP_dom	p.D186H	ENST00000380492.3	37	c.556	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323600	0.81580	.	.	ENSG00000130150	ENST00000380492	T	0.59364	0.27	5.62	5.62	0.85841	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.098402	0.64402	D	0.000001	T	0.73321	0.3572	L	0.58101	1.795	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.74484	-0.3650	10	0.56958	D	0.05	.	18.7012	0.91620	0.0:0.0:1.0:0.0	.	186	Q8NHP6	MSPD2_HUMAN	H	186	ENSP00000369860:D186H	ENSP00000369860:D186H	D	+	1	0	MOSPD2	14831026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.839000	0.92120	2.361000	0.80049	0.600000	0.82982	GAT	MOSPD2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000130150		0.294	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	-	0.00	170	0	G	NM_152581		14921105	+1	tier1	-	no_errors	ENST00000380492	ensembl	human	known	74_37	missense	12.63	173	25	SNP	1.000	C
MT-CO2	4513	genome.wustl.edu	37	M	8009	8009	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrM:8009G>A	ENST00000361739.1	+	1	424	c.424G>A	c.(424-426)Gta>Ata	p.V142I	MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	142			V -> M (in colorectal cancer). {ECO:0000269|PubMed:9806551}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TTGACAATCGAGTAGTACTCC	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.424G>A	M.37:g.8009G>A	ENSP00000354876:p.Val142Ile		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.V142M	ENST00000361739.1	37	c.424		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	542	0	G	YP_003024029		8009	+1	tier1	rs199474826	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	84.10	38	201	SNP	NULL	A
MUC12	10071	genome.wustl.edu	37	7	100637250	100637250	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:100637250C>G	ENST00000379442.3	+	5	3835	c.3835C>G	c.(3835-3837)Cca>Gca	p.P1279A	MUC12_ENST00000536621.1_Missense_Mutation_p.P1136A			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1279	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCGTAGCCAACCAGGTTCTAC	0.582																																																	0													41.0	44.0	43.0					7																	100637250		557	1261	1818	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3835C>G	7.37:g.100637250C>G	ENSP00000368755:p.Pro1279Ala		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.P1136A	ENST00000379442.3	37	c.3406		7	.	.	.	.	.	.	.	.	.	.	-	1.123	-0.654653	0.03480	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14391	2.51;2.51	0.713	-1.05	0.10036	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.44236	-0.9341	6	0.12103	T	0.63	.	.	.	.	.	.	.	.	A	1279;1136	ENSP00000368755:P1279A;ENSP00000441929:P1136A	ENSP00000368755:P1279A	P	+	1	0	MUC12	100423970	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.099000	0.11007	-0.303000	0.08856	0.184000	0.17185	CCA	MUC12	-	NULL	ENSG00000205277		0.582	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	74	0	C	XM_379904		100637250	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	24.00	38	12	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9003588	9003588	+	Missense_Mutation	SNP	G	G	A	rs369380417		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:9003588G>A	ENST00000397910.4	-	49	40255	c.40052C>T	c.(40051-40053)aCg>aTg	p.T13351M	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13353	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACCCTCTCCGTGGTGTTGAA	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		18157	0.0		0.001	False		,,,				2504	0.0																0								G	MET/THR	1,4029		0,1,2014	245.0	203.0	217.0		40052	2.2	0.0	19		217	0,8350		0,0,4175	no	missense	MUC16	NM_024690.2	81	0,1,6189	AA,AG,GG		0.0,0.0248,0.0081	probably-damaging	13351/14508	9003588	1,12379	2015	4175	6190	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40052C>T	19.37:g.9003588G>A	ENSP00000381008:p.Thr13351Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T13351M	ENST00000397910.4	37	c.40052	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.38|12.38	1.919462|1.919462	0.33908|0.33908	2.48E-4|2.48E-4	0.0|0.0	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910	.|T	.|0.51817	.|0.69	3.24|3.24	2.18|2.18	0.27775|0.27775	.|SEA (1);	.|.	.|.	.|.	.|.	T|T	0.64746|0.64746	0.2626|0.2626	M|M	0.80616|0.80616	2.505|2.505	.|.	.|.	.|.	.|D;D	.|0.89917	.|1.0;0.998	.|D;D	.|0.72625	.|0.909;0.978	T|T	0.71307|0.71307	-0.4632|-0.4632	4|8	.|0.87932	.|D	.|0	-1.1554|-1.1554	7.0286|7.0286	0.24954|0.24954	0.1394:0.0:0.8606:0.0|0.1394:0.0:0.8606:0.0	.|.	.|20996;13351	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	W|M	191|13351	.|ENSP00000381008:T13351M	.|ENSP00000381008:T13351M	R|T	-|-	1|2	2|0	MUC16|MUC16	8864588|8864588	0.011000|0.011000	0.17503|0.17503	0.003000|0.003000	0.11579|0.11579	0.205000|0.205000	0.24178|0.24178	1.092000|1.092000	0.30927|0.30927	0.640000|0.640000	0.30582|0.30582	0.455000|0.455000	0.32223|0.32223	CGG|ACG	MUC16	-	pfam_SEA_dom	ENSG00000181143		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	81	0	G	NM_024690		9003588	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	13.33	52	8	SNP	0.013	A
MXRA5	25878	genome.wustl.edu	37	X	3248082	3248082	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:3248082delA	ENST00000217939.6	-	4	840	c.686delT	c.(685-687)ttgfs	p.L229fs		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	229	LRRCT.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				ATCCCATTCCAAAAACCATCT	0.468																																																	0													55.0	53.0	54.0					X																	3248082		2203	4300	6503	SO:0001589	frameshift_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.686delT	X.37:g.3248082delA	ENSP00000217939:p.Leu229fs		Q6P1M7|Q9Y3Y8	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L229fs	ENST00000217939.6	37	c.686	CCDS14124.1	X																																																																																			MXRA5	-	smart_Cys-rich_flank_reg_C	ENSG00000101825		0.468	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2		0.00	75	0	A	NM_015419		3248082	-1	tier1		no_errors	ENST00000217939	ensembl	human	known	74_37	frame_shift_del	11.11	32	4	DEL	0.193	-
MYH15	22989	genome.wustl.edu	37	3	108163547	108163547	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:108163547C>T	ENST00000273353.3	-	23	2711	c.2655G>A	c.(2653-2655)ctG>ctA	p.L885L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	885						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GCTTTGCTTTCAGTTCCTCCC	0.408																																																	0													120.0	112.0	115.0					3																	108163547		1890	4128	6018	SO:0001819	synonymous_variant	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2655G>A	3.37:g.108163547C>T				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.L885	ENST00000273353.3	37	c.2655	CCDS43127.1	3																																																																																			MYH15	-	NULL	ENSG00000144821		0.408	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	-	0.00	59	0	C	XM_036988		108163547	-1	tier1	-	no_errors	ENST00000273353	ensembl	human	known	74_37	silent	14.94	74	13	SNP	0.994	T
MYO15A	51168	genome.wustl.edu	37	17	18023073	18023073	+	Missense_Mutation	SNP	C	C	T	rs200056157		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:18023073C>T	ENST00000205890.5	+	2	1297	c.959C>T	c.(958-960)tCg>tTg	p.S320L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	320					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCGCCCCCGTCGGGGTACTCG	0.602																																																	0													53.0	59.0	58.0					17																	18023073		1922	4119	6041	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.959C>T	17.37:g.18023073C>T	ENSP00000205890:p.Ser320Leu		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.S320L	ENST00000205890.5	37	c.959	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.931022	0.00488	.	.	ENSG00000091536	ENST00000205890	D	0.88277	-2.36	5.6	3.39	0.38822	.	.	.	.	.	T	0.79718	0.4494	N	0.19112	0.55	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.69989	-0.4995	9	0.72032	D	0.01	.	6.4754	0.22033	0.0:0.5214:0.3538:0.1249	.	320	Q9UKN7	MYO15_HUMAN	L	320	ENSP00000205890:S320L	ENSP00000205890:S320L	S	+	2	0	MYO15A	17963798	0.000000	0.05858	0.007000	0.13788	0.093000	0.18481	-0.387000	0.07361	1.339000	0.45563	0.561000	0.74099	TCG	MYO15A	-	NULL	ENSG00000091536		0.602	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	-	0.00	158	0	C	NM_016239		18023073	+1	tier1	-	no_errors	ENST00000205890	ensembl	human	known	74_37	missense	24.21	72	23	SNP	0.000	T
NCOA2	10499	genome.wustl.edu	37	8	71050559	71050559	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:71050559C>G	ENST00000452400.2	-	15	3218	c.3037G>C	c.(3037-3039)Gaa>Caa	p.E1013Q	NCOA2_ENST00000267974.4_Missense_Mutation_p.E101Q	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1013					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)	p.E1013Q(1)	PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ATCTCTAATTCAGATGGCCCT	0.413			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	1	Substitution - Missense(1)	lung(1)											80.0	75.0	77.0					8																	71050559		1824	4083	5907	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3037G>C	8.37:g.71050559C>G	ENSP00000399968:p.Glu1013Gln		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.E1013Q	ENST00000452400.2	37	c.3037	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793296	0.90453	.	.	ENSG00000140396	ENST00000452400;ENST00000267974	T;T	0.08984	4.58;3.03	5.88	5.88	0.94601	.	0.209202	0.49916	D	0.000138	T	0.29556	0.0737	M	0.77103	2.36	0.43347	D	0.9954	D;P	0.62365	0.991;0.86	P;B	0.58820	0.846;0.395	T	0.00569	-1.1666	10	0.72032	D	0.01	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	101;1013	F8WAJ2;Q15596	.;NCOA2_HUMAN	Q	1013;101	ENSP00000399968:E1013Q;ENSP00000267974:E101Q	ENSP00000267974:E101Q	E	-	1	0	NCOA2	71213113	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.432000	0.66514	2.782000	0.95742	0.655000	0.94253	GAA	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.413	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	169	0	C			71050559	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	missense	10.82	173	21	SNP	1.000	G
NCOA6	23054	genome.wustl.edu	37	20	33330968	33330970	+	In_Frame_Del	DEL	TGC	TGC	-	rs140426729	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:33330968_33330970delTGC	ENST00000374796.2	-	12	5660_5662	c.3090_3092delGCA	c.(3088-3093)cagcaa>caa	p.1030_1031QQ>Q	NCOA6_ENST00000359003.2_In_Frame_Del_p.1030_1031QQ>Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1030	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CATCATTtgttgctgctgctgct	0.576																																																	0																																										SO:0001651	inframe_deletion	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3090_3092delGCA	20.37:g.33330977_33330979delTGC	ENSP00000363929:p.Gln1032del		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Del	DEL	NULL	p.Q1032in_frame_del	ENST00000374796.2	37	c.3092_3090	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.576	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2		0.00	38	0	TGC	NM_014071		33330970	-1			no_errors	ENST00000359003	ensembl	human	known	74_37	in_frame_del	16.00	21	4	DEL	1.000:1.000:1.000	0
NEB	4703	genome.wustl.edu	37	2	152512796	152512796	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:152512796G>T	ENST00000172853.10	-	49	6513	c.6366C>A	c.(6364-6366)gtC>gtA	p.V2122V	NEB_ENST00000409198.1_Silent_p.V2122V|NEB_ENST00000427231.2_Silent_p.V2122V|NEB_ENST00000397345.3_Silent_p.V2122V|NEB_ENST00000604864.1_Silent_p.V2122V|NEB_ENST00000603639.1_Silent_p.V2122V			P20929	NEBU_HUMAN	nebulin	2122					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.V2122V(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTGCAGCCGTGACACTGAGCA	0.473																																																	2	Substitution - coding silent(2)	lung(2)											293.0	293.0	293.0					2																	152512796		2125	4248	6373	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6366C>A	2.37:g.152512796G>T			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.V2122	ENST00000172853.10	37	c.6366		2																																																																																			NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.473	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding			0.00	57	0	G	NM_004543		152512796	-1			no_errors	ENST00000397345	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.990	T
NELFB	25920	genome.wustl.edu	37	9	140151336	140151336	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:140151336G>A	ENST00000343053.4	+	4	764	c.427G>A	c.(427-429)Gtg>Atg	p.V143M		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	143					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGCCTGCGCCGTGGAGGTGAA	0.572																																																	0													88.0	78.0	81.0					9																	140151336		2203	4300	6503	SO:0001583	missense	0			AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.427G>A	9.37:g.140151336G>A	ENSP00000339495:p.Val143Met		A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	pfam_COBRA1	p.V143M	ENST00000343053.4	37	c.427	CCDS7040.1	9	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445194	0.83993	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.55	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.75532	0.3862	M	0.67953	2.075	0.58432	D	0.999991	D	0.89917	1.0	D	0.72982	0.979	T	0.76350	-0.2991	9	0.48119	T	0.1	-52.5805	13.1341	0.59399	0.0779:0.0:0.9221:0.0	.	143	Q8WX92	NELFB_HUMAN	M	143	.	ENSP00000339495:V143M	V	+	1	0	COBRA1	139271157	1.000000	0.71417	0.864000	0.33941	0.946000	0.59487	7.659000	0.83766	1.337000	0.45525	0.561000	0.74099	GTG	NELFB	-	pfam_COBRA1	ENSG00000188986		0.572	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELFB	HGNC	protein_coding	OTTHUMT00000254710.1	-	0.00	29	0	G	NM_015456		140151336	+1	tier1	-	no_errors	ENST00000343053	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.995	A
NLRP12	91662	genome.wustl.edu	37	19	54308650	54308650	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:54308650G>A	ENST00000324134.6	-	5	2466	c.2298C>T	c.(2296-2298)ctC>ctT	p.L766L	NLRP12_ENST00000351894.4_Silent_p.L766L|NLRP12_ENST00000354278.3_Silent_p.L766L|NLRP12_ENST00000391772.1_Silent_p.L767L|NLRP12_ENST00000391773.1_Silent_p.L767L|NLRP12_ENST00000345770.5_Silent_p.L767L|NLRP12_ENST00000391775.3_Silent_p.L766L|NLRP12_ENST00000535162.1_Silent_p.L766L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	766					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TATTGGCTATGAGAGCTGCAG	0.557																																																	0													113.0	111.0	112.0					19																	54308650		2203	4300	6503	SO:0001819	synonymous_variant	0			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2298C>T	19.37:g.54308650G>A			A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L766	ENST00000324134.6	37	c.2298	CCDS12864.1	19																																																																																			NLRP12	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000142405		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	-	0.00	33	0	G	NM_144687		54308650	-1	tier1	-	no_errors	ENST00000324134	ensembl	human	known	74_37	silent	40.00	15	10	SNP	0.007	A
NLRP7	199713	genome.wustl.edu	37	19	55450647	55450647	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:55450647C>T	ENST00000590030.1	-	3	1580	c.1540G>A	c.(1540-1542)Gac>Aac	p.D514N	NLRP7_ENST00000588756.1_Missense_Mutation_p.D514N|NLRP7_ENST00000328092.5_Missense_Mutation_p.D514N|NLRP7_ENST00000448121.2_Missense_Mutation_p.D514N|NLRP7_ENST00000446217.1_Missense_Mutation_p.D542N|NLRP7_ENST00000340844.2_Missense_Mutation_p.D514N|NLRP7_ENST00000592784.1_Missense_Mutation_p.D514N			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	514							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TGAATCAGGTCGGGGTTCTTG	0.577																																																	0													83.0	83.0	83.0					19																	55450647		2203	4300	6503	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1540G>A	19.37:g.55450647C>T	ENSP00000465520:p.Asp514Asn		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D542N	ENST00000590030.1	37	c.1624	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	C	8.228	0.804092	0.16467	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.74002	-0.73;-0.73;-0.8;-0.76	2.34	-3.9	0.04181	.	1.976990	0.02773	N	0.119938	T	0.52597	0.1744	L	0.39397	1.21	0.09310	N	1	P;P;P;P	0.45715	0.669;0.669;0.669;0.865	B;B;B;B	0.31390	0.061;0.061;0.061;0.129	T	0.52403	-0.8580	10	0.16896	T	0.51	.	1.5454	0.02564	0.1773:0.4184:0.179:0.2253	.	542;514;514;514	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	N	514;514;514;542;281	ENSP00000329568:D514N;ENSP00000409137:D514N;ENSP00000339491:D514N;ENSP00000414273:D542N	ENSP00000329568:D514N	D	-	1	0	NLRP7	60142459	0.000000	0.05858	0.009000	0.14445	0.070000	0.16714	-3.138000	0.00587	-1.245000	0.02513	-0.379000	0.06801	GAC	NLRP7	-	NULL	ENSG00000167634		0.577	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	-	0.00	39	0	C	NM_139176		55450647	-1	tier1	-	no_errors	ENST00000446217	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.044	T
NLRP9	338321	genome.wustl.edu	37	19	56223887	56223887	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:56223887delT	ENST00000332836.2	-	7	2598	c.2571delA	c.(2569-2571)aaafs	p.K857fs	CTD-2611O12.7_ENST00000597680.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	857						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GGGTCTTCAGTTTCCCATTGC	0.453																																																	0													101.0	93.0	96.0					19																	56223887		2199	4293	6492	SO:0001589	frameshift_variant	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2571delA	19.37:g.56223887delT	ENSP00000331857:p.Lys857fs		B2RN12|Q86W27	Frame_Shift_Del	DEL	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K857fs	ENST00000332836.2	37	c.2571	CCDS12934.1	19																																																																																			NLRP9	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000185792		0.453	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1		0.00	24	0	T	NM_176820		56223887	-1	tier1		no_errors	ENST00000332836	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.000	-
NOS1	4842	genome.wustl.edu	37	12	117655876	117655876	+	Missense_Mutation	SNP	C	C	T	rs201476356		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:117655876C>T	ENST00000338101.4	-	28	4370	c.4366G>A	c.(4366-4368)Gaa>Aaa	p.E1456K	NOS1_ENST00000317775.6_Missense_Mutation_p.E1422K|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.E1422K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TTGCTCTCTTCAATGAAGGCA	0.517																																					Esophageal Squamous(162;1748 2599 51982 52956)												1	Substitution - Missense(1)	endometrium(1)											263.0	260.0	261.0					12																	117655876		1997	4170	6167	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.4366G>A	12.37:g.117655876C>T	ENSP00000337459:p.Glu1456Lys			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.E1422K	ENST00000338101.4	37	c.4264	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478076	0.84747	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	T;T	0.01455	4.87;4.92	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.05777	0.0151	L	0.57536	1.79	0.80722	D	1	D	0.54964	0.969	P	0.52424	0.698	T	0.41502	-0.9505	10	0.45353	T	0.12	-27.9498	17.8415	0.88716	0.0:1.0:0.0:0.0	.	1422	P29475	NOS1_HUMAN	K	1317;1422;1456	ENSP00000320758:E1422K;ENSP00000337459:E1456K	ENSP00000320758:E1422K	E	-	1	0	NOS1	116140259	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.296000	0.78790	2.451000	0.82905	0.561000	0.74099	GAA	NOS1	-	pirsf_NOS_euk	ENSG00000089250		0.517	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	-	0.00	38	0	C			117655876	-1	tier1	-	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	T
NR0B2	8431	genome.wustl.edu	37	1	27240299	27240299	+	Missense_Mutation	SNP	G	G	A	rs374067965		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:27240299G>A	ENST00000254227.3	-	1	158	c.133C>T	c.(133-135)Cgg>Tgg	p.R45W		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	45					cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TGGACGGGCCGGTGCTGCCTA	0.642																																																	0								G	TRP/ARG	1,4401		0,1,2200	30.0	33.0	32.0		133	4.4	1.0	1		32	0,8598		0,0,4299	no	missense	NR0B2	NM_021969.2	101	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	45/258	27240299	1,12999	2201	4299	6500	SO:0001583	missense	0			AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.133C>T	1.37:g.27240299G>A	ENSP00000254227:p.Arg45Trp		F1D8P5|Q5QP36	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.R45W	ENST00000254227.3	37	c.133	CCDS291.1	1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341639	0.41498	2.27E-4	0.0	ENSG00000131910	ENST00000254227	D	0.84800	-1.9	5.38	4.44	0.53790	Nuclear hormone receptor, ligand-binding (2);	0.122937	0.53938	D	0.000045	T	0.79969	0.4538	L	0.60455	1.87	0.49213	D	0.999765	B	0.29955	0.263	B	0.20767	0.031	T	0.77305	-0.2637	10	0.52906	T	0.07	-20.4236	9.188	0.37182	0.0764:0.0:0.7694:0.1542	.	45	Q15466	NR0B2_HUMAN	W	45	ENSP00000254227:R45W	ENSP00000254227:R45W	R	-	1	2	NR0B2	27112886	0.990000	0.36364	0.996000	0.52242	0.933000	0.57130	1.354000	0.34056	1.187000	0.43000	0.561000	0.74099	CGG	NR0B2	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000131910		0.642	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B2	HGNC	protein_coding	OTTHUMT00000012185.1	-	0.00	47	0	G			27240299	-1	tier1	-	no_errors	ENST00000254227	ensembl	human	known	74_37	missense	51.28	19	20	SNP	0.894	A
NRDE2	55051	genome.wustl.edu	37	14	90756756	90756756	+	Missense_Mutation	SNP	A	A	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:90756756A>T	ENST00000354366.3	-	10	2270	c.2038T>A	c.(2038-2040)Ttc>Atc	p.F680I	NRDE2_ENST00000357904.3_Missense_Mutation_p.F449I	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	680																	AAAGGGTTGAAAAAAGTCAAG	0.502																																																	0													47.0	50.0	49.0					14																	90756756		2203	4300	6503	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.2038T>A	14.37:g.90756756A>T	ENSP00000346335:p.Phe680Ile		B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.F680I	ENST00000354366.3	37	c.2038	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	A	6.563	0.472240	0.12461	.	.	ENSG00000119720	ENST00000354366;ENST00000357904	T;T	0.37915	1.17;1.17	5.91	-1.22	0.09494	.	0.555807	0.19792	N	0.105943	T	0.17408	0.0418	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.16748	-1.0392	10	0.19590	T	0.45	-1.7704	5.0492	0.14499	0.286:0.1105:0.4947:0.1088	.	680	Q9H7Z3	CN102_HUMAN	I	680;449	ENSP00000346335:F680I;ENSP00000350579:F449I	ENSP00000346335:F680I	F	-	1	0	C14orf102	89826509	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	0.302000	0.19192	-0.164000	0.10927	0.533000	0.62120	TTC	NRDE2	-	NULL	ENSG00000119720		0.502	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	HGNC	protein_coding	OTTHUMT00000411264.1	-	0.00	53	0	A	NM_017970		90756756	-1	tier1	-	no_errors	ENST00000354366	ensembl	human	known	74_37	missense	20.27	59	15	SNP	0.000	T
OFD1	8481	genome.wustl.edu	37	X	13770835	13770835	+	Intron	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:13770835G>A	ENST00000340096.6	+	11	1382				OFD1_ENST00000398395.3_Silent_p.L356L|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Intron|OFD1_ENST00000380567.1_Intron	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1						axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TCCACAGGCTGCATGGTGTCT	0.413																																																	0																																										SO:0001627	intron_variant	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1056-652G>A	X.37:g.13770835G>A			B9ZVU5|O75666|Q4VAK4	Silent	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.L356	ENST00000340096.6	37	c.1068	CCDS14157.1	X																																																																																			OFD1	-	NULL	ENSG00000046651		0.413	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	-	0.00	60	0	G	NM_003611		13770835	+1	tier1	-	no_errors	ENST00000398395	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.000	A
OR52K1	390036	genome.wustl.edu	37	11	4510699	4510699	+	Missense_Mutation	SNP	C	C	T	rs570619154		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:4510699C>T	ENST00000307632.3	+	1	591	c.569C>T	c.(568-570)gCg>gTg	p.A190V		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A190V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		GTAAGGCTGGCGTGTGGGGAC	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		24785	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	endometrium(1)											372.0	281.0	312.0					11																	4510699		2201	4298	6499	SO:0001583	missense	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.569C>T	11.37:g.4510699C>T	ENSP00000302422:p.Ala190Val		B9EH54|Q6IFK5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A190V	ENST00000307632.3	37	c.569	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	C	8.177	0.792953	0.16327	.	.	ENSG00000196778	ENST00000307632	T	0.00183	8.6	4.63	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.136582	0.33127	N	0.005250	T	0.00178	0.0005	L	0.46741	1.465	0.31795	N	0.629186	B	0.24882	0.113	B	0.25614	0.062	T	0.08868	-1.0701	10	0.49607	T	0.09	.	8.727	0.34476	0.0:0.7464:0.0:0.2536	.	190	Q8NGK4	O52K1_HUMAN	V	190	ENSP00000302422:A190V	ENSP00000302422:A190V	A	+	2	0	OR52K1	4467275	0.922000	0.31269	0.902000	0.35471	0.040000	0.13550	1.995000	0.40767	0.683000	0.31428	-0.299000	0.09455	GCG	OR52K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000196778		0.502	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1		0.00	63	0	C	NM_001005171		4510699	+1			no_errors	ENST00000307632	ensembl	human	known	74_37	missense	8.70	41	4	SNP	0.902	T
OR52N1	79473	genome.wustl.edu	37	11	5809409	5809409	+	Missense_Mutation	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:5809409A>G	ENST00000317078.1	-	1	637	c.638T>C	c.(637-639)aTc>aCc	p.I213T	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AATGCACAGGATATCAAAGCC	0.473																																																	0													141.0	126.0	131.0					11																	5809409		2201	4296	6497	SO:0001583	missense	0			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.638T>C	11.37:g.5809409A>G	ENSP00000322823:p.Ile213Thr		Q6IFF6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.I213T	ENST00000317078.1	37	c.638	CCDS31398.1	11	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619127	0.46736	.	.	ENSG00000181001	ENST00000317078	T	0.37584	1.19	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.122950	0.36034	N	0.002831	T	0.51975	0.1706	M	0.64170	1.965	0.24168	N	0.995636	D	0.56521	0.976	D	0.66979	0.948	T	0.44982	-0.9292	10	0.72032	D	0.01	.	8.7631	0.34687	0.9101:0.0:0.0899:0.0	.	213	Q8NH53	O52N1_HUMAN	T	213	ENSP00000322823:I213T	ENSP00000322823:I213T	I	-	2	0	OR52N1	5765985	0.000000	0.05858	0.989000	0.46669	0.797000	0.45037	1.019000	0.30014	2.092000	0.63282	0.496000	0.49642	ATC	OR52N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181001		0.473	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N1	HGNC	protein_coding	OTTHUMT00000401142.1	-	0.00	33	0	A	NM_001001913		5809409	-1	tier1	-	no_errors	ENST00000317078	ensembl	human	known	74_37	missense	33.33	16	8	SNP	0.785	G
OR52E6	390078	genome.wustl.edu	37	11	5862196	5862196	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:5862196G>T	ENST00000329322.5	-	1	931	c.932C>A	c.(931-933)aCa>aAa	p.T311K	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Missense_Mutation_p.T315K	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTAGTGATCTGTCTTGAAGAA	0.453																																																	0													82.0	79.0	80.0					11																	5862196		1944	4176	6120	SO:0001583	missense	0			AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.932C>A	11.37:g.5862196G>T	ENSP00000328878:p.Thr311Lys		Q6IFF8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T315K	ENST00000329322.5	37	c.944	CCDS53597.1	11	.	.	.	.	.	.	.	.	.	.	G	0.187	-1.056441	0.01965	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00003	9.84;9.84	2.6	0.00239	0.14050	.	1.326690	0.05593	N	0.574989	T	0.00039	0.0001	N	0.00760	-1.21	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07481	-1.0770	10	0.02654	T	1	.	8.0057	0.30323	0.0:0.0:0.3399:0.6601	.	311	Q96RD3	O52E6_HUMAN	K	311;315	ENSP00000328878:T311K;ENSP00000369279:T315K	ENSP00000328878:T311K	T	-	2	0	OR52E6	5818772	0.750000	0.28316	0.000000	0.03702	0.638000	0.38207	-0.144000	0.10280	-0.135000	0.11495	0.551000	0.68910	ACA	OR52E6	-	NULL	ENSG00000205409		0.453	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E6	HGNC	protein_coding	OTTHUMT00000401144.1	-	0.00	54	0	G	NM_001005167		5862196	-1	tier1	-	no_errors	ENST00000379946	ensembl	human	known	74_37	missense	58.62	12	17	SNP	0.000	T
OR10A2	341276	genome.wustl.edu	37	11	6891244	6891244	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:6891244C>T	ENST00000307322.4	+	1	321	c.259C>T	c.(259-261)Cag>Tag	p.Q87*		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTGTGCCACTCAGATGTATTT	0.517																																																	0													103.0	103.0	103.0					11																	6891244		2201	4296	6497	SO:0001587	stop_gained	0			BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.259C>T	11.37:g.6891244C>T	ENSP00000303862:p.Gln87*		B2RNL9|Q6IFG9	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q87*	ENST00000307322.4	37	c.259	CCDS31415.1	11	.	.	.	.	.	.	.	.	.	.	c	19.56	3.850018	0.71603	.	.	ENSG00000170790	ENST00000307322	.	.	.	4.51	4.51	0.55191	.	0.000000	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.206	0.73180	0.0:1.0:0.0:0.0	.	.	.	.	X	87	.	ENSP00000303862:Q87X	Q	+	1	0	OR10A2	6847820	1.000000	0.71417	0.984000	0.44739	0.582000	0.36321	4.706000	0.61845	2.514000	0.84764	0.650000	0.86243	CAG	OR10A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000170790		0.517	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A2	HGNC	protein_coding	OTTHUMT00000385984.1	-	0.00	43	0	C	NM_001004460		6891244	+1	tier1	-	no_errors	ENST00000307322	ensembl	human	known	74_37	nonsense	27.50	29	11	SNP	1.000	T
OR5D16	390144	genome.wustl.edu	37	11	55606363	55606363	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:55606363G>T	ENST00000378396.1	+	1	136	c.136G>T	c.(136-138)Ggg>Tgg	p.G46W		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				AGGGAATCTTGGGATGATAGT	0.428																																																	0													153.0	147.0	149.0					11																	55606363		2201	4296	6497	SO:0001583	missense	0			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.136G>T	11.37:g.55606363G>T	ENSP00000367649:p.Gly46Trp		Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G46W	ENST00000378396.1	37	c.136	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	13.63	2.295516	0.40594	.	.	ENSG00000205029	ENST00000378396	T	0.01963	4.53	4.05	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.14013	0.0339	M	0.91196	3.185	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10823	-1.0613	9	0.87932	D	0	-17.8881	6.3006	0.21111	0.1035:0.1903:0.7061:0.0	.	46	Q8NGK9	OR5DG_HUMAN	W	46	ENSP00000367649:G46W	ENSP00000367649:G46W	G	+	1	0	OR5D16	55362939	0.000000	0.05858	0.090000	0.20809	0.979000	0.70002	-1.137000	0.03219	2.021000	0.59480	0.530000	0.56133	GGG	OR5D16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000205029		0.428	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	-	0.00	92	0	G	NM_001005496		55606363	+1	tier1	-	no_errors	ENST00000378396	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.001	T
OR5B21	219968	genome.wustl.edu	37	11	58275221	58275221	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:58275221G>A	ENST00000360374.2	-	1	357	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCTGCATGGCGATCATAGGCC	0.537																																																	0													126.0	94.0	105.0					11																	58275221		2201	4295	6496	SO:0001583	missense	0				CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.358C>T	11.37:g.58275221G>A	ENSP00000353537:p.Arg120Cys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R120C	ENST00000360374.2	37	c.358	CCDS31552.1	11	.	.	.	.	.	.	.	.	.	.	G	11.00	1.510795	0.27036	.	.	ENSG00000198283	ENST00000360374	T	0.77358	-1.09	5.2	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.204155	0.24359	U	0.039214	T	0.76485	0.3994	M	0.85945	2.785	0.45378	D	0.998363	P	0.46277	0.875	B	0.37304	0.246	T	0.78288	-0.2262	10	0.72032	D	0.01	-5.2516	10.4243	0.44369	0.1591:0.0:0.8409:0.0	.	120	A6NL26	OR5BL_HUMAN	C	120	ENSP00000353537:R120C	ENSP00000353537:R120C	R	-	1	0	OR5B21	58031797	1.000000	0.71417	0.988000	0.46212	0.098000	0.18820	4.619000	0.61218	0.768000	0.33290	-0.150000	0.13652	CGC	OR5B21	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198283		0.537	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B21	HGNC	protein_coding	OTTHUMT00000394891.1	-	0.00	18	0	G	NM_001005218		58275221	-1	tier1	-	no_errors	ENST00000360374	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	A
P2RX4	5025	genome.wustl.edu	37	12	121670443	121670443	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:121670443G>T	ENST00000337233.4	+	10	1316	c.1008G>T	c.(1006-1008)atG>atT	p.M336I	P2RX4_ENST00000543171.1_Missense_Mutation_p.M235I|P2RX4_ENST00000359949.7_Missense_Mutation_p.M352I|P2RX4_ENST00000541532.1_3'UTR	NM_001261397.1|NM_001261398.1|NM_002560.2	NP_001248326.1|NP_001248327.1|NP_002551.2	Q99571	P2RX4_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 4	336					apoptotic signaling pathway (GO:0097190)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular response to ATP (GO:0071318)|endothelial cell activation (GO:0042118)|ion transmembrane transport (GO:0034220)|membrane depolarization (GO:0051899)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|neuronal action potential (GO:0019228)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction (GO:0055117)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sodium ion transport (GO:0002028)|relaxation of cardiac muscle (GO:0055119)|response to ATP (GO:0033198)|response to fluid shear stress (GO:0034405)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|tissue homeostasis (GO:0001894)|transport (GO:0006810)|vasodilation (GO:0042311)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadherin binding (GO:0045296)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCCCCACTATGATCAACATCG	0.572																																																	0													157.0	155.0	155.0					12																	121670443		2203	4300	6503	SO:0001583	missense	0			Y07684	CCDS9214.1, CCDS58282.1	12q24.32	2012-01-17			ENSG00000135124	ENSG00000135124		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8535	protein-coding gene	gene with protein product		600846				9016352	Standard	NM_002560		Approved	P2X4	uc031qjt.1	Q99571	OTTHUMG00000169155	ENST00000337233.4:c.1008G>T	12.37:g.121670443G>T	ENSP00000336607:p.Met336Ile		E7EPF7|F6RU17|O00450|O14722|Q5U089|Q5U090|Q8N4N1|Q9UBG9	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X4_purnocptor,prints_P2X_purnocptor,prints_P2X1_purnocptor,tigrfam_P2X_purnocptor	p.M336I	ENST00000337233.4	37	c.1008	CCDS9214.1	12	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099501	0.20552	.	.	ENSG00000135124	ENST00000337233;ENST00000359949;ENST00000543171;ENST00000542067	T;T;T;T	0.03889	3.77;3.77;3.77;3.77	5.26	5.26	0.73747	.	0.076145	0.85682	D	0.000000	T	0.04497	0.0123	N	0.17474	0.49	0.40282	D	0.978408	B;B;B	0.23185	0.024;0.081;0.029	B;B;B	0.28991	0.058;0.097;0.097	T	0.47898	-0.9081	10	0.10902	T	0.67	-46.0476	17.8411	0.88715	0.0:0.0:1.0:0.0	.	309;352;336	F6RU17;E7EPF7;Q99571	.;.;P2RX4_HUMAN	I	336;352;235;309	ENSP00000336607:M336I;ENSP00000353032:M352I;ENSP00000438131:M235I;ENSP00000438329:M309I	ENSP00000336607:M336I	M	+	3	0	P2RX4	120154826	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.343000	0.44001	2.445000	0.82738	0.462000	0.41574	ATG	P2RX4	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000135124		0.572	P2RX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX4	HGNC	protein_coding	OTTHUMT00000402545.1	-	0.00	22	0	G	NM_175567		121670443	+1	tier1	-	no_errors	ENST00000337233	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
PAK3	5063	genome.wustl.edu	37	X	110406853	110406853	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:110406853C>T	ENST00000372010.1	+	11	1151	c.709C>T	c.(709-711)Cca>Tca	p.P237S	PAK3_ENST00000360648.4_Missense_Mutation_p.P258S|PAK3_ENST00000262836.4_Missense_Mutation_p.P237S|PAK3_ENST00000425146.1_Missense_Mutation_p.P222S|PAK3_ENST00000372007.5_Missense_Mutation_p.P222S|PAK3_ENST00000417227.1_Missense_Mutation_p.P243S|PAK3_ENST00000446737.1_Missense_Mutation_p.P222S|PAK3_ENST00000518291.1_Missense_Mutation_p.P258S|PAK3_ENST00000519681.1_Missense_Mutation_p.P243S			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	237	Linker.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						AGAGGTCACACCACCCTCTGC	0.403										TSP Lung(19;0.15)																																							0													149.0	137.0	141.0					X																	110406853		2203	4300	6503	SO:0001583	missense	0			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.709C>T	X.37:g.110406853C>T	ENSP00000361080:p.Pro237Ser		A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.P258S	ENST00000372010.1	37	c.772	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	C	9.308	1.054742	0.19907	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.72282	-0.63;-0.63;-0.63;-0.64;-0.63;-0.63;-0.63;-0.64;-0.63	5.95	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.66939	2.045	0.41652	D	0.989133	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.59736	-0.7398	10	0.28530	T	0.3	.	7.1603	0.25661	0.3997:0.4621:0.1381:0.0	.	243;258;237;222	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	S	222;222;237;243;222;258;258;243;237	ENSP00000410853:P222S;ENSP00000401982:P222S;ENSP00000361080:P237S;ENSP00000429113:P243S;ENSP00000361077:P222S;ENSP00000428921:P258S;ENSP00000353864:P258S;ENSP00000389172:P243S;ENSP00000262836:P237S	ENSP00000262836:P237S	P	+	1	0	PAK3	110293509	0.985000	0.35326	0.994000	0.49952	0.992000	0.81027	2.589000	0.46145	2.519000	0.84933	0.594000	0.82650	CCA	PAK3	-	NULL	ENSG00000077264		0.403	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1	-	0.00	81	0	C	NM_002578		110406853	+1	tier1	-	no_errors	ENST00000360648	ensembl	human	known	74_37	missense	22.50	31	9	SNP	0.952	T
PAM	5066	genome.wustl.edu	37	5	102363888	102363888	+	Splice_Site	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:102363888G>T	ENST00000438793.3	+	24	3159		c.e24-1		PAM_ENST00000274392.9_Splice_Site|PAM_ENST00000455264.2_Splice_Site|PAM_ENST00000348126.2_Splice_Site|PAM_ENST00000379787.4_Intron|PAM_ENST00000304400.7_Missense_Mutation_p.D898Y|PAM_ENST00000346918.2_Intron	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTTTTTAGCAGATTCTGAACA	0.388																																																	0													153.0	147.0	149.0					5																	102363888		2203	4300	6503	SO:0001630	splice_region_variant	0			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2690-1G>T	5.37:g.102363888G>T			A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Splice_Site	SNP	-	e24-1	ENST00000438793.3	37	c.2690-1	CCDS54885.1	5	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.0|22.0|22.0	4.231323|4.231323|4.231323	0.79688|0.79688|0.79688	.|.|.	.|.|.	ENSG00000145730|ENSG00000145730|ENSG00000145730	ENST00000438793;ENST00000348126;ENST00000274392;ENST00000455264|ENST00000304400|ENST00000379799	.|T|.	.|0.44881|.	.|0.91|.	5.8|5.8|5.8	5.8|5.8|5.8	0.92144|0.92144|0.92144	.|.|.	.|0.891238|.	.|0.10068|.	.|N|.	.|0.720076|.	.|T|T	.|0.76644|0.76644	.|0.4016|0.4016	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B|.	.|0.11235|.	.|0.004|.	.|B|.	.|0.12156|.	.|0.007|.	.|T|T	.|0.74206|0.74206	.|-0.3740|-0.3740	.|9|4	.|0.66056|.	.|D|.	.|0.02|.	.|.|.	20.0415|20.0415|20.0415	0.97592|0.97592|0.97592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|898|.	.|P19021-5|.	.|.|.	.|Y|I	-1|898|602	.|ENSP00000306100:D898Y|.	.|ENSP00000306100:D898Y|.	.|D|R	+|+|+	.|1|2	.|0|0	PAM|PAM|PAM	102391787|102391787|102391787	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.925000|0.925000|0.925000	0.55904|0.55904|0.55904	6.712000|6.712000|6.712000	0.74681|0.74681|0.74681	2.745000|2.745000|2.745000	0.94114|0.94114|0.94114	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	.|GAT|AGA	PAM	-	-	ENSG00000145730		0.388	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PAM	HGNC	protein_coding	OTTHUMT00000250640.2	-	0.00	30	0	G	NM_000919	Intron	102363888	+1	tier1	-	no_errors	ENST00000438793	ensembl	human	known	74_37	splice_site	7.41	50	4	SNP	1.000	T
PCDHGA6	56109	genome.wustl.edu	37	5	140755585	140755585	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:140755585C>T	ENST00000517434.1	+	1	1935	c.1935C>T	c.(1933-1935)gcC>gcT	p.A645A	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	645	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGTGGTGGCCGTCCAGGACC	0.706																																																	0													33.0	43.0	40.0					5																	140755585		2200	4294	6494	SO:0001819	synonymous_variant	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1935C>T	5.37:g.140755585C>T			A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A645	ENST00000517434.1	37	c.1935	CCDS54926.1	5																																																																																			PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253731		0.706	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	-	0.00	96	0	C	NM_018919		140755585	+1	tier1	-	no_errors	ENST00000517434	ensembl	human	known	74_37	silent	42.86	48	36	SNP	0.012	T
PCDHGA6	56109	genome.wustl.edu	37	5	140755848	140755848	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:140755848C>T	ENST00000517434.1	+	1	2198	c.2198C>T	c.(2197-2199)gCg>gTg	p.A733V	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	733					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGCTTAGCGAGCATGCCC	0.622																																																	0													74.0	80.0	78.0					5																	140755848		2203	4300	6503	SO:0001583	missense	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2198C>T	5.37:g.140755848C>T	ENSP00000429601:p.Ala733Val		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A733V	ENST00000517434.1	37	c.2198	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	6.378	0.437859	0.12104	.	.	ENSG00000253731	ENST00000517434	T	0.44482	0.92	5.15	0.115	0.14643	.	0.925107	0.08507	U	0.935524	T	0.25791	0.0628	L	0.37630	1.12	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.09377	0.003;0.004	T	0.29119	-1.0022	10	0.06891	T	0.86	.	5.305	0.15799	0.0:0.4676:0.2001:0.3324	.	733;733	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	V	733	ENSP00000429601:A733V	ENSP00000429601:A733V	A	+	2	0	PCDHGA6	140736032	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.582000	0.05814	0.150000	0.19136	-0.136000	0.14681	GCG	PCDHGA6	-	NULL	ENSG00000253731		0.622	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	-	0.00	102	0	C	NM_018919		140755848	+1	tier1	-	no_errors	ENST00000517434	ensembl	human	known	74_37	missense	38.03	44	27	SNP	0.000	T
PCDH1	5097	genome.wustl.edu	37	5	141243774	141243774	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:141243774C>T	ENST00000394536.3	-	3	2261	c.2122G>A	c.(2122-2124)Gag>Aag	p.E708K	PCDH1_ENST00000456271.1_Missense_Mutation_p.E696K|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000287008.3_Missense_Mutation_p.E708K|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000536585.1_Missense_Mutation_p.E686K	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	708	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TTGTCATTCTCGTCCAGCACA	0.567																																					Ovarian(132;1609 1739 4190 14731 45037)												0													145.0	129.0	134.0					5																	141243774		2203	4300	6503	SO:0001583	missense	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2122G>A	5.37:g.141243774C>T	ENSP00000378043:p.Glu708Lys		Q8IUP2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E708K	ENST00000394536.3	37	c.2122	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	c	14.82	2.650506	0.47362	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.60920	0.15;4.67;4.67;4.67;4.67	5.25	5.25	0.73442	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.50627	D	0.000112	T	0.66934	0.2840	L	0.33093	0.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.97;0.986	T	0.68284	-0.5449	10	0.52906	T	0.07	.	16.3548	0.83232	0.0:1.0:0.0:0.0	.	708;708	Q08174;Q08174-2	PCDH1_HUMAN;.	K	708;708;696;719;686	ENSP00000287008:E708K;ENSP00000378043:E708K;ENSP00000403497:E696K;ENSP00000350122:E719K;ENSP00000438825:E686K	ENSP00000287008:E708K	E	-	1	0	PCDH1	141223958	1.000000	0.71417	0.998000	0.56505	0.491000	0.33493	6.056000	0.71111	2.463000	0.83235	0.450000	0.29827	GAG	PCDH1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000156453		0.567	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	-	0.00	19	0	C	NM_032420		141243774	-1	tier1	-	no_errors	ENST00000287008	ensembl	human	known	74_37	missense	47.62	11	10	SNP	1.000	T
PDE4C	5143	genome.wustl.edu	37	19	18322638	18322638	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:18322638G>A	ENST00000355502.3	-	18	2593	c.1722C>T	c.(1720-1722)cgC>cgT	p.R574R	PDE4C_ENST00000594465.3_Silent_p.R574R|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000539010.1_Silent_p.R343R|PDE4C_ENST00000262805.12_Silent_p.R542R|PDE4C_ENST00000597297.1_Silent_p.R344R|PDE4C_ENST00000447275.3_Silent_p.R468R|PDE4C_ENST00000598111.2_Silent_p.R289R|AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000594617.3_Silent_p.R574R			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	574					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	ACTCACGCTCGCGGTCTCCCT	0.627																																																	0													112.0	94.0	100.0					19																	18322638		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1722C>T	19.37:g.18322638G>A			B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.R574	ENST00000355502.3	37	c.1722	CCDS12373.1	19																																																																																			PDE4C	-	pfam_PDEase_catalytic_dom,prints_PDEase	ENSG00000105650		0.627	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	-	0.00	26	0	G			18322638	-1	tier1	-	no_errors	ENST00000355502	ensembl	human	known	74_37	silent	21.74	18	5	SNP	0.778	A
PIEZO1	9780	genome.wustl.edu	37	16	88790293	88790293	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:88790293G>T	ENST00000301015.9	-	31	4567	c.4321C>A	c.(4321-4323)Cag>Aag	p.Q1441K		NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1441					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						AAGGCACTCTGTGCCGACGGC	0.627																																																	0													77.0	74.0	75.0					16																	88790293		692	1591	2283	SO:0001583	missense	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4321C>A	16.37:g.88790293G>T	ENSP00000301015:p.Gln1441Lys		A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_Piezo	p.Q1441K	ENST00000301015.9	37	c.4321	CCDS54058.1	16	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	13.07|13.07|13.07	2.127890|2.127890|2.127890	0.37533|0.37533|0.37533	.|.|.	.|.|.	ENSG00000103335|ENSG00000103335|ENSG00000103335	ENST00000474606|ENST00000301015|ENST00000451779	.|T|.	.|0.69435|.	.|-0.4|.	5.21|5.21|5.21	5.21|5.21|5.21	0.72293|0.72293|0.72293	.|.|.	.|0.068185|.	.|0.64402|.	.|D|.	.|0.000016|.	T|T|T	0.59101|0.59101|0.59101	0.2169|0.2169|0.2169	L|L|L	0.33792|0.33792|0.33792	1.035|1.035|1.035	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P|.	.|0.37688|.	.|0.605|.	.|B|.	.|0.39027|.	.|0.288|.	T|T|T	0.53906|0.53906|0.53906	-0.8372|-0.8372|-0.8372	5|10|5	.|0.02654|.	.|T|.	.|1|.	-37.7299|-37.7299|-37.7299	17.8776|17.8776|17.8776	0.88829|0.88829|0.88829	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|1441|.	.|Q92508|.	.|PIEZ1_HUMAN|.	Q|K|K	114|1441|1386	.|ENSP00000301015:Q1441K|.	.|ENSP00000301015:Q1441K|.	H|Q|T	-|-|-	3|1|2	2|0|0	FAM38A|FAM38A|FAM38A	87317794|87317794|87317794	0.966000|0.966000|0.966000	0.33281|0.33281|0.33281	0.977000|0.977000|0.977000	0.42913|0.42913|0.42913	0.133000|0.133000|0.133000	0.20885|0.20885|0.20885	4.808000|4.808000|4.808000	0.62583|0.62583|0.62583	2.594000|2.594000|2.594000	0.87642|0.87642|0.87642	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	CAC|CAG|ACA	PIEZO1	-	NULL	ENSG00000103335		0.627	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	-	0.00	57	0	G	NM_014745		88790293	-1	tier1	-	no_errors	ENST00000301015	ensembl	human	novel	74_37	missense	8.33	55	5	SNP	0.998	T
PKHD1L1	93035	genome.wustl.edu	37	8	110408292	110408292	+	Missense_Mutation	SNP	G	G	A	rs199719733		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:110408292G>A	ENST00000378402.5	+	11	952	c.848G>A	c.(847-849)cGa>cAa	p.R283Q		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	283	IPT/TIG 3.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGAAGCATTCGAGGTGGCACC	0.388										HNSCC(38;0.096)																																							0													68.0	62.0	64.0					8																	110408292		2004	4192	6196	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.848G>A	8.37:g.110408292G>A	ENSP00000367655:p.Arg283Gln		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.R283Q	ENST00000378402.5	37	c.848	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	3.898	-0.022531	0.07634	.	.	ENSG00000205038	ENST00000378402	T	0.75938	-0.98	5.81	0.789	0.18607	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.625251	0.15913	N	0.238539	T	0.29190	0.0726	N	0.00128	-2.045	0.09310	N	0.999997	B	0.06786	0.001	B	0.08055	0.003	T	0.42378	-0.9455	10	0.13470	T	0.59	.	6.5379	0.22365	0.7137:0.1286:0.1577:0.0	.	283	Q86WI1	PKHL1_HUMAN	Q	283	ENSP00000367655:R283Q	ENSP00000367655:R283Q	R	+	2	0	PKHD1L1	110477468	0.181000	0.23161	0.160000	0.22671	0.272000	0.26649	0.470000	0.22084	-0.104000	0.12154	-0.137000	0.14449	CGA	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.388	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	80	0	G	NM_177531		110408292	+1	tier1	rs199719733	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	15.79	64	12	SNP	0.280	A
PKHD1L1	93035	genome.wustl.edu	37	8	110471942	110471942	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:110471942G>C	ENST00000378402.5	+	47	7227	c.7123G>C	c.(7123-7125)Gat>Cat	p.D2375H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2375					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CACACTCCCTGATGGAACTCT	0.363										HNSCC(38;0.096)																																							0													77.0	71.0	73.0					8																	110471942		1855	4102	5957	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7123G>C	8.37:g.110471942G>C	ENSP00000367655:p.Asp2375His		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.D2375H	ENST00000378402.5	37	c.7123	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542183	0.85917	.	.	ENSG00000205038	ENST00000378402	D	0.93488	-3.23	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.94804	0.8322	M	0.82323	2.585	0.44677	D	0.997662	B	0.33904	0.431	B	0.41332	0.354	D	0.94910	0.8064	10	0.72032	D	0.01	.	16.7525	0.85489	0.0:0.0:1.0:0.0	.	2375	Q86WI1	PKHL1_HUMAN	H	2375	ENSP00000367655:D2375H	ENSP00000367655:D2375H	D	+	1	0	PKHD1L1	110541118	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.957000	0.87870	2.566000	0.86566	0.455000	0.32223	GAT	PKHD1L1	-	NULL	ENSG00000205038		0.363	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	115	0	G	NM_177531		110471942	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	8.00	138	12	SNP	1.000	C
PLCG1	5335	genome.wustl.edu	37	20	39795158	39795158	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr20:39795158G>T	ENST00000373271.1	+	18	2448	c.2043G>T	c.(2041-2043)atG>atT	p.M681I	PLCG1_ENST00000244007.3_Missense_Mutation_p.M681I|PLCG1_ENST00000373272.2_Missense_Mutation_p.M681I	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	681	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CTGAGCACATGCTAATGCGCG	0.622																																																	0													88.0	75.0	79.0					20																	39795158		2203	4300	6503	SO:0001583	missense	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.2043G>T	20.37:g.39795158G>T	ENSP00000362368:p.Met681Ile		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.M681I	ENST00000373271.1	37	c.2043	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857536	0.32791	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	D;D;D	0.88124	-2.34;-2.34;-2.34	5.7	4.76	0.60689	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);SH2 motif (5);	0.035187	0.85682	N	0.000000	D	0.89649	0.6776	L	0.37750	1.13	0.80722	D	1	P;D;P;P	0.62365	0.504;0.991;0.746;0.559	B;D;B;B	0.74023	0.21;0.982;0.231;0.314	D	0.89149	0.3522	10	0.39692	T	0.17	.	15.0425	0.71803	0.0685:0.0:0.9315:0.0	.	681;257;681;681	P19174-2;B4DMA3;P19174;A2A284	.;.;PLCG1_HUMAN;.	I	681	ENSP00000244007:M681I;ENSP00000362368:M681I;ENSP00000362369:M681I	ENSP00000244007:M681I	M	+	3	0	PLCG1	39228572	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	5.708000	0.68377	1.552000	0.49463	-0.140000	0.14226	ATG	PLCG1	-	pfam_SH2,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_SH2,pirsf_PLC-gamma,pfscan_SH2,prints_SH2	ENSG00000124181		0.622	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	-	0.00	17	0	G	NM_182811		39795158	+1	tier1	-	no_errors	ENST00000244007	ensembl	human	known	74_37	missense	33.33	12	6	SNP	1.000	T
PLIN4	729359	genome.wustl.edu	37	19	4512994	4512994	+	Silent	SNP	A	A	G	rs531498368	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:4512994A>G	ENST00000301286.3	-	3	935	c.936T>C	c.(934-936)agT>agC	p.S312S		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	312	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.S240S(1)|p.S312S(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GGACAGTCTTACTGGTGTCCA	0.557													a|||	23	0.00459265	0.0166	0.0	5008	,	,		19446	0.0		0.001	False		,,,				2504	0.0																2	Substitution - coding silent(2)	endometrium(2)											25.0	13.0	17.0					19																	4512994		1769	3759	5528	SO:0001819	synonymous_variant	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.936T>C	19.37:g.4512994A>G			A6NEI2	Silent	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.S312	ENST00000301286.3	37	c.936	CCDS45927.1	19																																																																																			PLIN4	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000167676		0.557	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1		0.00	20	0	A	XM_170901		4512994	-1			no_errors	ENST00000301286	ensembl	human	novel	74_37	silent	12.00	22	3	SNP	0.000	G
PLXND1	23129	genome.wustl.edu	37	3	129279267	129279267	+	Missense_Mutation	SNP	G	G	A	rs569800532		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:129279267G>A	ENST00000324093.4	-	31	5217	c.5039C>T	c.(5038-5040)aCg>aTg	p.T1680M	PLXND1_ENST00000393239.1_Missense_Mutation_p.T1680M	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1680					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.T1680M(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CAGCTCGTCCGTAGGCAGCAC	0.647																																					Ovarian(97;366 1484 3738 22084 39045)												1	Substitution - Missense(1)	large_intestine(1)											52.0	44.0	47.0					3																	129279267		2203	4300	6503	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5039C>T	3.37:g.129279267G>A	ENSP00000317128:p.Thr1680Met		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.T1680M	ENST00000324093.4	37	c.5039	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130825	0.37630	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.12255	2.7;2.7	4.85	4.85	0.62838	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.268174	0.34067	N	0.004296	T	0.28764	0.0713	L	0.37561	1.115	0.48696	D	0.999692	P;D	0.89917	0.95;1.0	B;D	0.69307	0.398;0.963	T	0.03193	-1.1062	10	0.72032	D	0.01	.	17.9837	0.89150	0.0:0.0:1.0:0.0	.	275;1680	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	M	1680	ENSP00000317128:T1680M;ENSP00000376931:T1680M	ENSP00000317128:T1680M	T	-	2	0	PLXND1	130761957	1.000000	0.71417	0.992000	0.48379	0.073000	0.16967	5.498000	0.66931	2.244000	0.73946	0.462000	0.41574	ACG	PLXND1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000004399		0.647	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	41	0	G	NM_015103		129279267	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	missense	23.08	40	12	SNP	0.971	A
PNISR	25957	genome.wustl.edu	37	6	99848036	99848036	+	3'UTR	DEL	A	A	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:99848036delA	ENST00000369239.5	-	0	3002				PNISR_ENST00000438806.1_3'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TTTACAGATTAAAAAAAAAAA	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.*380T>-	6.37:g.99848036delA			A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	RNA	DEL	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																			PNISR	-	-	ENSG00000132424		0.308	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1		0.00	68	0	A	NM_032870		99848036	-1	tier1		no_errors	ENST00000481229	ensembl	human	known	74_37	rna	13.11	53	8	DEL	0.986	-
POGLUT1	56983	genome.wustl.edu	37	3	119204210	119204210	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:119204210C>G	ENST00000295588.4	+	6	698	c.614C>G	c.(613-615)tCt>tGt	p.S205C		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	205					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						AAGAAAAACTCTACAGCATAT	0.308																																																	0													109.0	118.0	115.0					3																	119204210		2203	4300	6503	SO:0001583	missense	0			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.614C>G	3.37:g.119204210C>G	ENSP00000295588:p.Ser205Cys		B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying,smart_LipoPS_modifying	p.S205C	ENST00000295588.4	37	c.614	CCDS2988.1	3	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376001	0.82682	.	.	ENSG00000163389	ENST00000295588	T	0.24538	1.85	5.32	5.32	0.75619	.	0.181752	0.50627	D	0.000120	T	0.48822	0.1521	M	0.72118	2.19	0.45427	D	0.998405	D	0.69078	0.997	D	0.66351	0.943	T	0.49597	-0.8923	10	0.87932	D	0	-16.0081	14.8705	0.70453	0.0:1.0:0.0:0.0	.	205	Q8NBL1	PGLT1_HUMAN	C	205	ENSP00000295588:S205C	ENSP00000295588:S205C	S	+	2	0	POGLUT1	120686900	0.989000	0.36119	1.000000	0.80357	0.995000	0.86356	6.687000	0.74552	2.634000	0.89283	0.655000	0.94253	TCT	POGLUT1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying	ENSG00000163389		0.308	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	HGNC	protein_coding	OTTHUMT00000355034.2	-	0.00	123	0	C	NM_152305		119204210	+1	tier1	-	no_errors	ENST00000295588	ensembl	human	known	74_37	missense	11.29	165	21	SNP	0.996	G
POLQ	10721	genome.wustl.edu	37	3	121230769	121230769	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:121230769C>T	ENST00000264233.5	-	10	1704	c.1576G>A	c.(1576-1578)Gaa>Aaa	p.E526K		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	526	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CCAGTTACTTCTTCTCCTTCT	0.373								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													114.0	110.0	111.0					3																	121230769		2203	4300	6503	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1576G>A	3.37:g.121230769C>T	ENSP00000264233:p.Glu526Lys		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.E526K	ENST00000264233.5	37	c.1576	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941532	0.73557	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.51817	0.69	4.73	4.73	0.59995	Helicase, C-terminal (1);	0.122041	0.53938	D	0.000054	T	0.45216	0.1331	L	0.45352	1.415	0.48975	D	0.999734	B	0.29341	0.242	B	0.33196	0.159	T	0.40478	-0.9561	10	0.37606	T	0.19	.	17.7022	0.88298	0.0:1.0:0.0:0.0	.	526	O75417	DPOLQ_HUMAN	K	149;526;662	ENSP00000264233:E526K	ENSP00000264233:E526K	E	-	1	0	POLQ	122713459	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.923000	0.63412	2.148000	0.66965	0.462000	0.41574	GAA	POLQ	-	pfscan_Helicase_C	ENSG00000051341		0.373	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	89	0	C	NM_199420		121230769	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	18.35	89	20	SNP	1.000	T
PON3	5446	genome.wustl.edu	37	7	95001650	95001650	+	Splice_Site	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:95001650C>A	ENST00000265627.5	-	4	212	c.202G>T	c.(202-204)Gga>Tga	p.G68*	PON1_ENST00000542556.1_Intron|PON3_ENST00000427422.1_Splice_Site_p.G68*|PON3_ENST00000451904.1_Splice_Site_p.G68*	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	68				G -> E (in Ref. 8; AAC41996). {ECO:0000305}.	aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	TATTTTAATCCCTTTTAAAAA	0.333																																																	0													79.0	75.0	77.0					7																	95001650		2203	4300	6503	SO:0001630	splice_region_variant	0			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.202-1G>T	7.37:g.95001650C>A			A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Nonsense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.G68*	ENST00000265627.5	37	c.202	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309786	0.81247	.	.	ENSG00000105852	ENST00000265627;ENST00000427422	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.2042	18.0823	0.89444	0.0:1.0:0.0:0.0	.	.	.	.	X	68	.	ENSP00000265627:G68X	G	-	1	0	PON3	94839586	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	6.578000	0.74032	2.694000	0.91930	0.555000	0.69702	GGA	PON3	-	NULL	ENSG00000105852		0.333	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	HGNC	protein_coding	OTTHUMT00000333007.1	-	0.00	62	0	C	NM_000940	Nonsense_Mutation	95001650	-1	tier1	-	no_errors	ENST00000265627	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	1.000	A
POT1	25913	genome.wustl.edu	37	7	124481087	124481087	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:124481087G>C	ENST00000357628.3	-	14	1907	c.1309C>G	c.(1309-1311)Cat>Gat	p.H437D	POT1_ENST00000393329.1_Missense_Mutation_p.H306D	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	437					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TTCACAAAATGAACTGCTACT	0.318																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0													135.0	132.0	133.0					7																	124481087		2203	4300	6503	SO:0001583	missense	0			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1309C>G	7.37:g.124481087G>C	ENSP00000350249:p.His437Asp		O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.H437D	ENST00000357628.3	37	c.1309	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	G	22.3	4.272979	0.80580	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000265391	T;T	0.54479	0.57;0.58	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.72961	0.3526	M	0.78049	2.395	0.58432	D	0.999991	D	0.76494	0.999	D	0.65684	0.937	T	0.75952	-0.3136	10	0.72032	D	0.01	-28.7079	18.1169	0.89559	0.0:0.0:1.0:0.0	.	437	Q9NUX5	POTE1_HUMAN	D	437;306;437;437;436	ENSP00000350249:H437D;ENSP00000377002:H306D	ENSP00000265391:H436D	H	-	1	0	POT1	124268323	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	5.023000	0.64084	2.688000	0.91661	0.655000	0.94253	CAT	POT1	-	NULL	ENSG00000128513		0.318	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1	-	0.00	44	0	G			124481087	-1	tier1	-	no_errors	ENST00000357628	ensembl	human	known	74_37	missense	27.27	32	12	SNP	1.000	C
PRB2	653247	genome.wustl.edu	37	12	11546642	11546642	+	Nonsense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:11546642G>A	ENST00000389362.4	-	3	405	c.370C>T	c.(370-372)Caa>Taa	p.Q124*	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	124	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TTGCCTCCTTGTGGGGGTGGT	0.617																																																	0													309.0	300.0	303.0					12																	11546642		2203	4299	6502	SO:0001587	stop_gained	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.370C>T	12.37:g.11546642G>A	ENSP00000374013:p.Gln124*		O00599|P02811|P04281	Nonsense_Mutation	SNP	NULL	p.Q124*	ENST00000389362.4	37	c.370	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	11.80	1.747308	0.30955	.	.	ENSG00000121335	ENST00000389362	.	.	.	1.42	0.324	0.15898	.	1.664440	0.05213	U	0.507193	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	7.4232	0.27083	0.0:0.2739:0.7261:0.0	.	.	.	.	X	124	.	ENSP00000374013:Q124X	Q	-	1	0	PRB2	11437909	0.019000	0.18553	0.004000	0.12327	0.047000	0.14425	1.746000	0.38288	-0.152000	0.11156	0.186000	0.17326	CAA	PRB2	-	NULL	ENSG00000121335		0.617	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	-	0.00	237	0	G	NM_006248		11546642	-1	tier1	-	no_errors	ENST00000389362	ensembl	human	known	74_37	nonsense	8.75	145	14	SNP	0.318	A
PRKDC	5591	genome.wustl.edu	37	8	48866215	48866215	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:48866215G>C	ENST00000314191.2	-	7	742	c.686C>G	c.(685-687)tCa>tGa	p.S229*	PRKDC_ENST00000338368.3_Nonsense_Mutation_p.S229*|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	229					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GCACAGAAGTGAGGACAACCC	0.398								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													77.0	74.0	75.0					8																	48866215		1906	4134	6040	SO:0001587	stop_gained	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.686C>G	8.37:g.48866215G>C	ENSP00000313420:p.Ser229*		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Nonsense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S229*	ENST00000314191.2	37	c.686		8	.	.	.	.	.	.	.	.	.	.	G	27.8	4.859914	0.91433	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.54	5.54	0.83059	.	0.164875	0.39146	N	0.001447	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.4831	0.95018	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000313420:S229X	S	-	2	0	PRKDC	49028768	1.000000	0.71417	0.516000	0.27786	0.724000	0.41520	8.378000	0.90144	2.602000	0.87976	0.655000	0.94253	TCA	PRKDC	-	superfamily_ARM-type_fold	ENSG00000253729		0.398	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		-	0.00	36	0	G	NM_001081640		48866215	-1	tier1	-	no_errors	ENST00000314191	ensembl	human	known	74_37	nonsense	18.75	39	9	SNP	1.000	C
PRPF38A	84950	genome.wustl.edu	37	1	52871486	52871486	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:52871486G>C	ENST00000257181.9	+	2	451	c.265G>C	c.(265-267)Gag>Cag	p.E89Q	PRPF38A_ENST00000474048.1_Intron|ORC1_ENST00000371568.3_5'Flank|ORC1_ENST00000371566.1_5'Flank	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	89					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						TATCATTGTAGAGTTTATCAA	0.388																																																	0													76.0	77.0	77.0					1																	52871486		2203	4300	6503	SO:0001583	missense	0			AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.265G>C	1.37:g.52871486G>C	ENSP00000257181:p.Glu89Gln		Q96JW1|Q9BVZ8	Missense_Mutation	SNP	pfam_PRP38	p.E89Q	ENST00000257181.9	37	c.265	CCDS567.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774797	0.90108	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.72	3.84	0.44239	.	0.047579	0.85682	D	0.000000	T	0.79747	0.4499	M	0.88570	2.965	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.79040	-0.1966	9	0.29301	T	0.29	-14.337	12.2662	0.54679	0.1375:0.0:0.8625:0.0	.	89	Q8NAV1	PR38A_HUMAN	Q	89	.	ENSP00000257181:E89Q	E	+	1	0	PRPF38A	52644074	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.784000	0.99039	0.767000	0.33267	0.585000	0.79938	GAG	PRPF38A	-	pfam_PRP38	ENSG00000134748		0.388	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38A	HGNC	protein_coding	OTTHUMT00000022459.2	-	0.00	62	0	G	NM_032864		52871486	+1	tier1	-	no_errors	ENST00000257181	ensembl	human	known	74_37	missense	18.82	69	16	SNP	1.000	C
PRR14L	253143	genome.wustl.edu	37	22	32112599	32112599	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:32112599C>G	ENST00000327423.6	-	4	1415	c.1226G>C	c.(1225-1227)aGa>aCa	p.R409T	PRR14L_ENST00000434485.1_Missense_Mutation_p.R409T|PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000397493.2_Missense_Mutation_p.R409T	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	409										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AGGTCCACCTCTTTCACTCCT	0.408																																																	0													30.0	27.0	27.0					22																	32112599		692	1591	2283	SO:0001583	missense	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.1226G>C	22.37:g.32112599C>G	ENSP00000331845:p.Arg409Thr		Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.R409T	ENST00000327423.6	37	c.1226	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	C	9.208	1.030155	0.19512	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.09445	2.98;3.0;2.98	4.77	0.12	0.14691	.	0.525146	0.18061	N	0.152947	T	0.09555	0.0235	L	0.51422	1.61	0.09310	N	1	P;P;P	0.36535	0.557;0.557;0.557	B;B;B	0.41860	0.368;0.167;0.368	T	0.17837	-1.0356	9	.	.	.	-4.3792	0.6429	0.00813	0.186:0.3703:0.1819:0.2619	.	409;409;409	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	T	409	ENSP00000380630:R409T;ENSP00000331845:R409T;ENSP00000388314:R409T	.	R	-	2	0	PRR14L	30442599	0.000000	0.05858	0.025000	0.17156	0.023000	0.10783	-0.515000	0.06290	0.148000	0.19059	0.650000	0.86243	AGA	PRR14L	-	NULL	ENSG00000183530		0.408	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	-	0.00	73	0	C	NM_173566		32112599	-1	tier1	-	no_errors	ENST00000397493	ensembl	human	known	74_37	missense	18.48	75	17	SNP	0.004	G
PRSS27	83886	genome.wustl.edu	37	16	2763677	2763677	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:2763677G>T	ENST00000302641.3	-	5	585	c.531C>A	c.(529-531)atC>atA	p.I177I	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	177	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.I177M(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						GTTTCTGCAGGATCCGCGGTT	0.582																																																	1	Substitution - Missense(1)	breast(1)											145.0	109.0	121.0					16																	2763677		2198	4300	6498	SO:0001819	synonymous_variant	0			AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.531C>A	16.37:g.2763677G>T				Silent	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.I177	ENST00000302641.3	37	c.531	CCDS10476.1	16																																																																																			PRSS27	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000172382		0.582	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS27	HGNC	protein_coding	OTTHUMT00000250908.1		0.00	20	0	G	NM_031948		2763677	-1			no_errors	ENST00000302641	ensembl	human	known	74_37	silent	12.50	14	2	SNP	0.057	T
PRSS36	146547	genome.wustl.edu	37	16	31151696	31151696	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:31151696G>C	ENST00000268281.4	-	14	2266	c.2208C>G	c.(2206-2208)atC>atG	p.I736M	PRSS36_ENST00000418068.2_Intron|PRSS36_ENST00000569305.1_Missense_Mutation_p.I731M	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	736	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						GGCAGTCACAGATTCGTTGTG	0.597																																																	0													89.0	87.0	87.0					16																	31151696		2197	4300	6497	SO:0001583	missense	0			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.2208C>G	16.37:g.31151696G>C	ENSP00000268281:p.Ile736Met		A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.I736M	ENST00000268281.4	37	c.2208	CCDS32436.1	16	.	.	.	.	.	.	.	.	.	.	G	7.556	0.663673	0.14710	.	.	ENSG00000178226	ENST00000268281	D	0.88431	-2.38	4.74	3.76	0.43208	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.79997	0.4543	N	0.20807	0.61	0.21740	N	0.999566	B;B	0.32010	0.351;0.351	B;B	0.30855	0.121;0.121	T	0.70494	-0.4856	9	0.42905	T	0.14	.	9.4025	0.38442	0.1059:0.0:0.8941:0.0	.	731;736	B7ZMK8;Q5K4E3	.;POLS2_HUMAN	M	736	ENSP00000268281:I736M	ENSP00000268281:I736M	I	-	3	3	PRSS36	31059197	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	1.266000	0.33039	2.339000	0.79563	0.555000	0.69702	ATC	PRSS36	-	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000178226		0.597	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS36	HGNC	protein_coding	OTTHUMT00000433542.1	-	0.00	77	0	G	NM_173502		31151696	-1	tier1	-	no_errors	ENST00000268281	ensembl	human	known	74_37	missense	30.77	36	16	SNP	0.999	C
PTCH2	8643	genome.wustl.edu	37	1	45292420	45292420	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:45292420C>G	ENST00000372192.3	-	18	2846	c.2716G>C	c.(2716-2718)Gag>Cag	p.E906Q	PTCH2_ENST00000447098.2_Missense_Mutation_p.E906Q	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	906					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TGGGCAAACTCCAAGGGCTGA	0.682									Basal Cell Nevus syndrome																																								0													22.0	26.0	25.0					1																	45292420		2196	4287	6483	SO:0001583	missense	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2716G>C	1.37:g.45292420C>G	ENSP00000361266:p.Glu906Gln		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.E906Q	ENST00000372192.3	37	c.2716	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901989	0.72754	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.93247	-3.18;-3.19	3.89	3.89	0.44902	.	0.000000	0.49916	D	0.000136	D	0.94984	0.8377	L	0.54323	1.7	0.58432	D	0.999998	D;D	0.89917	0.997;1.0	D;D	0.97110	0.921;1.0	D	0.92469	0.5984	10	0.14656	T	0.56	-18.3167	17.1751	0.86839	0.0:1.0:0.0:0.0	.	906;906	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	Q	906	ENSP00000389703:E906Q;ENSP00000361266:E906Q	ENSP00000361266:E906Q	E	-	1	0	PTCH2	45065007	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.530000	0.67141	2.462000	0.83206	0.563000	0.77884	GAG	PTCH2	-	tigrfam_TM_rcpt_patched	ENSG00000117425		0.682	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	-	0.00	25	0	C	NM_003738		45292420	-1	tier1	-	no_errors	ENST00000372192	ensembl	human	known	74_37	missense	69.23	8	18	SNP	1.000	G
PTPLAD1	51495	genome.wustl.edu	37	15	65855215	65855215	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:65855215G>C	ENST00000261875.5	+	6	691	c.525G>C	c.(523-525)ttG>ttC	p.L175F	PTPLAD1_ENST00000568793.1_Missense_Mutation_p.L150F|PTPLAD1_ENST00000566511.1_Missense_Mutation_p.L58F|PTPLAD1_ENST00000569894.1_Missense_Mutation_p.L58F|PTPLAD1_ENST00000565299.1_Missense_Mutation_p.L213F|PTPLAD1_ENST00000562901.1_Missense_Mutation_p.L58F|PTPLAD1_ENST00000566074.1_Missense_Mutation_p.L58F|PTPLAD1_ENST00000442729.2_Missense_Mutation_p.L120F	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	175					activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						TCTGTATCTTGGGAAAAGGCA	0.383																																																	0													123.0	113.0	116.0					15																	65855215		1884	4103	5987	SO:0001583	missense	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.525G>C	15.37:g.65855215G>C	ENSP00000261875:p.Leu175Phe		A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA,pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.L175F	ENST00000261875.5	37	c.525	CCDS45282.1	15	.	.	.	.	.	.	.	.	.	.	G	2.254	-0.370972	0.05034	.	.	ENSG00000074696	ENST00000442729;ENST00000261875	T;T	0.10763	2.84;2.87	5.58	-2.03	0.07365	.	0.312424	0.30347	N	0.009824	T	0.05227	0.0139	L	0.38175	1.15	0.58432	D	0.999993	P;B	0.34934	0.476;0.075	B;B	0.31686	0.134;0.046	T	0.44937	-0.9295	10	0.09843	T	0.71	-14.4109	5.1291	0.14899	0.2503:0.0:0.3391:0.4105	.	120;175	B4DRF4;Q9P035	.;HACD3_HUMAN	F	120;175	ENSP00000392491:L120F;ENSP00000261875:L175F	ENSP00000261875:L175F	L	+	3	2	PTPLAD1	63642268	0.629000	0.27146	0.991000	0.47740	0.928000	0.56348	-0.158000	0.10070	-0.225000	0.09913	-0.218000	0.12543	TTG	PTPLAD1	-	NULL	ENSG00000074696		0.383	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	-	0.00	122	0	G	NM_016395		65855215	+1	tier1	-	no_errors	ENST00000261875	ensembl	human	known	74_37	missense	24.51	77	25	SNP	0.931	C
PTPLAD1	51495	genome.wustl.edu	37	15	65856552	65856552	+	Splice_Site	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:65856552G>C	ENST00000261875.5	+	7	698		c.e7-1		PTPLAD1_ENST00000568793.1_Splice_Site|PTPLAD1_ENST00000566511.1_Splice_Site|PTPLAD1_ENST00000569894.1_Splice_Site|PTPLAD1_ENST00000565299.1_Splice_Site|PTPLAD1_ENST00000562901.1_Splice_Site|PTPLAD1_ENST00000566074.1_Splice_Site|PTPLAD1_ENST00000442729.2_Splice_Site	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1						activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						TTTGCCTATAGAGTCCTTTTA	0.368																																																	0													190.0	178.0	182.0					15																	65856552		1867	4105	5972	SO:0001630	splice_region_variant	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.533-1G>C	15.37:g.65856552G>C			A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	Splice_Site	SNP	-	e7-1	ENST00000261875.5	37	c.533-1	CCDS45282.1	15	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420728	0.62622	.	.	ENSG00000074696	ENST00000442729;ENST00000261875	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPLAD1	63643605	1.000000	0.71417	0.998000	0.56505	0.706000	0.40770	9.473000	0.97714	2.793000	0.96121	0.655000	0.94253	.	PTPLAD1	-	-	ENSG00000074696		0.368	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	-	0.00	47	0	G	NM_016395	Intron	65856552	+1	tier1	-	no_errors	ENST00000261875	ensembl	human	known	74_37	splice_site	16.13	26	5	SNP	1.000	C
PTPN18	26469	genome.wustl.edu	37	2	131117002	131117002	+	Silent	SNP	G	G	A	rs138461234	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:131117002G>A	ENST00000175756.5	+	4	413	c.312G>A	c.(310-312)acG>acA	p.T104T	PTPN18_ENST00000347849.3_Intron|PTPN18_ENST00000420717.1_3'UTR	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	104	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					ACATTGCCACGCAAGGACCCT	0.607																																																	0													98.0	89.0	92.0					2																	131117002		2203	4300	6503	SO:0001819	synonymous_variant	0			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.312G>A	2.37:g.131117002G>A			B4E1E6|Q53P42	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T104	ENST00000175756.5	37	c.312	CCDS2161.1	2																																																																																			PTPN18	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000072135		0.607	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN18	HGNC	protein_coding	OTTHUMT00000254523.2	-	0.00	49	0	G			131117002	+1	tier1	-	no_errors	ENST00000175756	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.003	A
RAPGEF2	9693	genome.wustl.edu	37	4	160268112	160268112	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:160268112C>T	ENST00000264431.4	+	19	3610	c.3191C>T	c.(3190-3192)tCa>tTa	p.S1064L		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1064					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CTTTATCCTTCACGGAAGAAA	0.483																																																	0													77.0	86.0	83.0					4																	160268112		1948	4152	6100	SO:0001583	missense	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.3191C>T	4.37:g.160268112C>T	ENSP00000264431:p.Ser1064Leu		D3DP27	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S1064L	ENST00000264431.4	37	c.3191	CCDS43277.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.26|12.26	1.883596|1.883596	0.33255|0.33255	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000510253|ENST00000264431	.|T	.|0.37752	.|1.18	6.17|6.17	5.34|5.34	0.76211|0.76211	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.31827|0.31827	0.0809|0.0809	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.04013	.|0.001	T|T	0.10730|0.10730	-1.0617|-1.0617	5|10	.|0.13470	.|T	.|0.59	.|.	15.5517|15.5517	0.76158|0.76158	0.0:0.9345:0.0:0.0655|0.0:0.9345:0.0:0.0655	.|.	.|1064	.|Q9Y4G8	.|RPGF2_HUMAN	Y|L	96|1064	.|ENSP00000264431:S1064L	.|ENSP00000264431:S1064L	H|S	+|+	1|2	0|0	RAPGEF2|RAPGEF2	160487562|160487562	1.000000|1.000000	0.71417|0.71417	0.069000|0.069000	0.20011|0.20011	0.783000|0.783000	0.44284|0.44284	7.818000|7.818000	0.86416|0.86416	1.635000|1.635000	0.50512|0.50512	0.655000|0.655000	0.94253|0.94253	CAC|TCA	RAPGEF2	-	NULL	ENSG00000109756		0.483	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	-	0.00	74	0	C	NM_014247		160268112	+1	tier1	-	no_errors	ENST00000264431	ensembl	human	known	74_37	missense	20.83	38	10	SNP	0.995	T
RBBP6	5930	genome.wustl.edu	37	16	24581206	24581206	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:24581206G>A	ENST00000319715.4	+	17	3627	c.3195G>A	c.(3193-3195)gaG>gaA	p.E1065E	RBBP6_ENST00000348022.2_Silent_p.E1031E|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1065	Interaction with RB1. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CCAAAGAGGAGACTCCGAAGA	0.398																																																	0													52.0	52.0	52.0					16																	24581206		2194	4300	6494	SO:0001819	synonymous_variant	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3195G>A	16.37:g.24581206G>A			Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.E1065	ENST00000319715.4	37	c.3195	CCDS10621.1	16																																																																																			RBBP6	-	NULL	ENSG00000122257		0.398	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	-	0.00	65	0	G	NM_006910		24581206	+1	tier1	-	no_errors	ENST00000319715	ensembl	human	known	74_37	silent	43.33	34	26	SNP	1.000	A
RBL2	5934	genome.wustl.edu	37	16	53499461	53499461	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:53499461C>T	ENST00000262133.6	+	13	1947	c.1810C>T	c.(1810-1812)Cca>Tca	p.P604S	RBL2_ENST00000544545.1_Missense_Mutation_p.P388S|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	604	Domain A.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ACCAGAGTCTCCACTCTGGGA	0.348																																																	0													66.0	71.0	70.0					16																	53499461		2198	4299	6497	SO:0001583	missense	0			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1810C>T	16.37:g.53499461C>T	ENSP00000262133:p.Pro604Ser		B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.P604S	ENST00000262133.6	37	c.1810	CCDS10748.1	16	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423637	0.43020	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.86956	-2.19;-2.19;-2.19	4.99	4.99	0.66335	Retinoblastoma-associated protein, A-box (1);Cyclin-like (1);	0.109663	0.64402	D	0.000007	D	0.88306	0.6401	L	0.41356	1.27	0.42261	D	0.992019	P;P;P;D	0.62365	0.626;0.932;0.537;0.991	B;P;B;P	0.59825	0.328;0.752;0.369;0.864	D	0.89065	0.3465	10	0.72032	D	0.01	-9.0982	11.6632	0.51358	0.1372:0.7304:0.1325:0.0	.	388;604;314;604	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	S	604;530;314;388	ENSP00000262133:P604S;ENSP00000443744:P530S;ENSP00000444685:P388S	ENSP00000262133:P604S	P	+	1	0	RBL2	52056962	0.970000	0.33590	1.000000	0.80357	0.977000	0.68977	2.517000	0.45529	2.463000	0.83235	0.655000	0.94253	CCA	RBL2	-	pfam_RB_A,superfamily_Cyclin-like	ENSG00000103479		0.348	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	HGNC	protein_coding	OTTHUMT00000256908.3	-	0.00	181	0	C	NM_005611		53499461	+1	tier1	-	no_errors	ENST00000262133	ensembl	human	known	74_37	missense	36.99	109	64	SNP	0.993	T
RFPL2	10739	genome.wustl.edu	37	22	32587270	32587270	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:32587270C>T	ENST00000400237.1	-	5	1561	c.626G>A	c.(625-627)cGa>cAa	p.R209Q	RFPL2_ENST00000248983.4_Missense_Mutation_p.R119Q|RFPL2_ENST00000400236.3_Missense_Mutation_p.R119Q|RFPL2_ENST00000248980.4_Missense_Mutation_p.R148Q|RFPL2_ENST00000489846.1_5'UTR			O75678	RFPL2_HUMAN	ret finger protein-like 2	209	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						GCGCCCACTTCGGACGCTCCT	0.532																																																	0													129.0	118.0	122.0					22																	32587270		2203	4300	6503	SO:0001583	missense	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.626G>A	22.37:g.32587270C>T	ENSP00000383096:p.Arg209Gln			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.R209Q	ENST00000400237.1	37	c.626	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	C	6.203	0.405544	0.11754	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	0.351	-0.702	0.11265	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.11281	0.0275	L	0.48260	1.515	0.09310	N	1	P;P	0.50710	0.938;0.728	B;B	0.42522	0.39;0.105	T	0.16424	-1.0403	9	0.46703	T	0.11	.	4.5359	0.12028	0.0:0.6821:0.0:0.3179	.	209;148	O75678;O75678-3	RFPL2_HUMAN;.	Q	148;119;119;209	ENSP00000248980:R148Q;ENSP00000248983:R119Q;ENSP00000383095:R119Q;ENSP00000383096:R209Q	ENSP00000248980:R148Q	R	-	2	0	RFPL2	30917270	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.374000	0.20501	-0.502000	0.06596	-0.490000	0.04691	CGA	RFPL2	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000128253		0.532	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	-	0.00	73	0	C	NM_006605		32587270	-1	tier1	-	no_errors	ENST00000400237	ensembl	human	known	74_37	missense	57.78	38	52	SNP	0.015	T
SCAMP1	9522	genome.wustl.edu	37	5	77772628	77772628	+	3'UTR	DEL	A	A	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:77772628delA	ENST00000339292.4	+	0	2242				SCAMP1_ENST00000538629.1_3'UTR			O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						endocytosis (GO:0006897)|exocytosis (GO:0006887)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	clathrin-coated vesicle (GO:0030136)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|synaptic vesicle membrane (GO:0030672)|trans-Golgi network (GO:0005802)|zymogen granule membrane (GO:0042589)							all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		TTCCAGCAATAAAAAAAAAAG	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF038966	CCDS75264.1	5q14.1	2013-02-21			ENSG00000085365	ENSG00000085365		"""Secretory carrier membrane proteins"""	10563	protein-coding gene	gene with protein product		606911				9378760	Standard	NM_004866		Approved	SCAMP37	uc003kfl.3	O15126	OTTHUMG00000162479	ENST00000339292.4:c.*2239A>-	5.37:g.77772628delA			O43587|Q6FG23|Q96BX1|Q96QK5	RNA	DEL	-	NULL	ENST00000339292.4	37	NULL		5																																																																																			SCAMP1	-	-	ENSG00000085365		0.308	SCAMP1-001	KNOWN	sequence_error|basic|exp_conf	processed_transcript	SCAMP1	HGNC	protein_coding	OTTHUMT00000369096.2		0.00	36	0	A	NM_004866		77772628	+1	tier1		no_errors	ENST00000320280	ensembl	human	known	74_37	rna	11.11	24	3	DEL	0.109	-
KIAA1731	85459	genome.wustl.edu	37	11	93454868	93454869	+	Intron	DNP	AC	AC	GT	rs376304920		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:93454868_93454869AC>GT	ENST00000325212.6	+	20	6012				SCARNA9_ENST00000362805.1_RNA|SCARNA9_ENST00000364329.1_RNA|KIAA1731_ENST00000344196.4_Intron|KIAA1731_ENST00000411936.1_Intron|SCARNA9_ENST00000530422.1_RNA|KIAA1731_ENST00000531700.1_Intron|Y_RNA_ENST00000363005.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731							centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				gtgtgtgtgtACGCACATGTGT	0.406																																																	0																																										SO:0001627	intron_variant	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	Exception_encountered	11.37:g.93454868_93454869delinsGT			C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	RNA	SNP	-	NULL	ENST00000325212.6	37	NULL	CCDS44708.1	11																																																																																			SCARNA9	-	-	ENSG00000254911		0.406	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCARNA9	HGNC	protein_coding	OTTHUMT00000394640.1		0.00	36|35	0	A|C	NM_033395		93454868|93454869	+1			no_errors	ENST00000530422	ensembl	human	known	74_37	rna	9.09|5.97	60|63	6|4	SNP	0.001|0.000	G|T
SCFD2	152579	genome.wustl.edu	37	4	54231952	54231952	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:54231952C>G	ENST00000401642.3	-	1	290	c.157G>C	c.(157-159)Gac>Cac	p.D53H	SCFD2_ENST00000388940.4_Missense_Mutation_p.D53H	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	53					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGGTGACAGTCAGGACCCCCC	0.647																																																	0													50.0	49.0	50.0					4																	54231952		2203	4300	6503	SO:0001583	missense	0			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.157G>C	4.37:g.54231952C>G	ENSP00000384182:p.Asp53His		Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.D53H	ENST00000401642.3	37	c.157	CCDS33984.1	4	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348617	0.24426	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.42131	0.98;0.98	5.21	4.37	0.52481	.	0.663319	0.15200	N	0.275052	T	0.26122	0.0637	N	0.08118	0	0.09310	N	0.999999	B;B	0.33512	0.415;0.291	B;B	0.34301	0.179;0.087	T	0.22521	-1.0214	10	0.72032	D	0.01	.	12.0651	0.53583	0.0:0.9164:0.0:0.0836	.	53;53	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	H	53	ENSP00000384182:D53H;ENSP00000373592:D53H	ENSP00000373592:D53H	D	-	1	0	SCFD2	53926709	0.950000	0.32346	0.070000	0.20053	0.086000	0.17979	1.529000	0.35996	1.568000	0.49683	0.561000	0.74099	GAC	SCFD2	-	NULL	ENSG00000184178		0.647	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD2	HGNC	protein_coding	OTTHUMT00000361311.3	-	0.00	39	0	C	NM_152540		54231952	-1	tier1	-	no_errors	ENST00000401642	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.394	G
SEPT12	124404	genome.wustl.edu	37	16	4838399	4838399	+	5'UTR	SNP	C	C	A	rs550303536		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:4838399C>A	ENST00000268231.8	-	0	123				SMIM22_ENST00000589327.1_5'Flank|SMIM22_ENST00000589721.1_5'UTR|SEPT12_ENST00000591861.1_5'UTR|SEPT12_ENST00000396693.5_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12						cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						GCTCCATCTGCACTTGCTGTG	0.562																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.-141G>T	16.37:g.4838399C>A			Q0P6B0|Q1PBH0|Q96LL0	RNA	SNP	-	NULL	ENST00000268231.8	37	NULL	CCDS10522.1	16																																																																																			SEPT12	-	-	ENSG00000140623		0.562	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	-	0.00	21	0	C	NM_144605		4838399	-1	tier1	-	no_errors	ENST00000591861	ensembl	human	known	74_37	rna	31.58	13	6	SNP	0.000	A
SETD3	84193	genome.wustl.edu	37	14	99870582	99870582	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:99870582C>T	ENST00000331768.5	-	11	1316	c.1157G>A	c.(1156-1158)cGa>cAa	p.R386Q		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	386					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				ACAGAATACTCGGAGAAAAGC	0.388																																																	0													79.0	78.0	78.0					14																	99870582		2203	4300	6503	SO:0001583	missense	0			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1157G>A	14.37:g.99870582C>T	ENSP00000327436:p.Arg386Gln		A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	pfam_Rubisco_LSMT_subst-bd,pfam_SET_dom,superfamily_Rubisco_LSMT_subst-bd	p.R386Q	ENST00000331768.5	37	c.1157	CCDS9951.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.734828	0.96865	.	.	ENSG00000183576	ENST00000331768	T	0.38722	1.12	5.39	5.39	0.77823	Rubisco LS methyltransferase, substrate-binding domain (3);	0.221848	0.39544	N	0.001336	T	0.67767	0.2928	M	0.88570	2.965	0.80722	D	1	D	0.76494	0.999	P	0.57776	0.827	T	0.75428	-0.3321	10	0.87932	D	0	-41.182	19.1841	0.93635	0.0:1.0:0.0:0.0	.	386	Q86TU7	SETD3_HUMAN	Q	386	ENSP00000327436:R386Q	ENSP00000327436:R386Q	R	-	2	0	SETD3	98940335	1.000000	0.71417	0.981000	0.43875	0.935000	0.57460	7.678000	0.84035	2.537000	0.85549	0.655000	0.94253	CGA	SETD3	-	pfam_Rubisco_LSMT_subst-bd,superfamily_Rubisco_LSMT_subst-bd	ENSG00000183576		0.388	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD3	HGNC	protein_coding	OTTHUMT00000072339.3	-	0.00	62	0	C	NM_032233		99870582	-1	tier1	-	no_errors	ENST00000331768	ensembl	human	known	74_37	missense	23.64	42	13	SNP	1.000	T
SETX	23064	genome.wustl.edu	37	9	135158548	135158549	+	Intron	DEL	AA	AA	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:135158548_135158549delAA	ENST00000224140.5	-	19	6729				SETX_ENST00000372169.2_Intron|SETX_ENST00000393220.1_Intron	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin						cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AATCAGATGCAAAAAAAAAAAA	0.376																																																	0																																										SO:0001627	intron_variant	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6546+101TT>-	9.37:g.135158558_135158559delAA			A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	RNA	DEL	-	NULL	ENST00000224140.5	37	NULL	CCDS6947.1	9																																																																																			SETX	-	-	ENSG00000107290		0.376	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3		0.00	31	0	AA	NM_015046		135158549	-1	tier1		no_errors	ENST00000474172	ensembl	human	known	74_37	rna	6.45	29	2	DEL	0.010:0.003	-
SGSM1	129049	genome.wustl.edu	37	22	25280128	25280128	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:25280128C>A	ENST00000400359.4	+	16	1776	c.1769C>A	c.(1768-1770)aCa>aAa	p.T590K	SGSM1_ENST00000400358.4_Missense_Mutation_p.T535K	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	590						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CAGGGACTGACAGCCAGGATC	0.557																																																	0													69.0	69.0	69.0					22																	25280128		2044	4188	6232	SO:0001583	missense	0			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1769C>A	22.37:g.25280128C>A	ENSP00000383212:p.Thr590Lys		A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.T590K	ENST00000400359.4	37	c.1769	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	C	26.3	4.719684	0.89205	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.09163	3.05;3.01	5.39	5.39	0.77823	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.25344	0.0616	L	0.49640	1.575	0.80722	D	1	D;D;D;D	0.63046	0.966;0.992;0.974;0.992	P;P;P;P	0.58620	0.772;0.711;0.842;0.84	T	0.00086	-1.2096	10	0.52906	T	0.07	-2.7798	18.5878	0.91197	0.0:1.0:0.0:0.0	.	535;651;668;590	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	K	651;535;590	ENSP00000383211:T535K;ENSP00000383212:T590K	ENSP00000383211:T535K	T	+	2	0	SGSM1	23610128	1.000000	0.71417	0.968000	0.41197	0.739000	0.42172	5.630000	0.67805	2.708000	0.92522	0.638000	0.83543	ACA	SGSM1	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000167037		0.557	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	-	0.00	36	0	C	XM_059318		25280128	+1	tier1	-	no_errors	ENST00000400359	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	A
SH3D21	79729	genome.wustl.edu	37	1	36785719	36785719	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:36785719C>T	ENST00000426732.2	+	13	1392	c.1107C>T	c.(1105-1107)gtC>gtT	p.V369V	SH3D21_ENST00000453908.2_Silent_p.V485V|SH3D21_ENST00000474766.1_3'UTR|SH3D21_ENST00000505871.1_Silent_p.V374V|EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000312808.4_Silent_p.V131V			A4FU49	SH321_HUMAN	SH3 domain containing 21	369						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						TAGAAAAGGTCTTGACCCCAG	0.522																																																	0													53.0	59.0	57.0					1																	36785719		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.1107C>T	1.37:g.36785719C>T			B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox,prints_Spectrin_alpha_SH3	p.V485	ENST00000426732.2	37	c.1455		1																																																																																			SH3D21	-	NULL	ENSG00000214193		0.522	SH3D21-202	KNOWN	basic	protein_coding	SH3D21	HGNC	protein_coding		-	0.00	72	0	C	NM_024676		36785719	+1	tier1	-	no_errors	ENST00000453908	ensembl	human	known	74_37	silent	25.49	38	13	SNP	0.011	T
SIGIRR	59307	genome.wustl.edu	37	11	406070	406070	+	Intron	SNP	G	G	C	rs201999242		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:406070G>C	ENST00000431843.2	-	10	1376				SIGIRR_ENST00000397632.3_Intron|SIGIRR_ENST00000382520.2_Missense_Mutation_p.P450A|SIGIRR_ENST00000531205.1_Missense_Mutation_p.P450A|SIGIRR_ENST00000529486.1_5'Flank|SIGIRR_ENST00000332725.3_Intron	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain						acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGGGGTGGGGAGACCGAGAC	0.692																																																	0													12.0	12.0	12.0					11																	406070		2161	4251	6412	SO:0001627	intron_variant	0				CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.1070-11C>G	11.37:g.406070G>C			Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.P450A	ENST00000431843.2	37	c.1348	CCDS31325.1	11	.	.	.	.	.	.	.	.	.	.	g	8.319	0.823954	0.16678	.	.	ENSG00000185187	ENST00000531205;ENST00000382520	T;T	0.04194	3.68;3.68	2.94	-0.115	0.13560	.	.	.	.	.	T	0.04137	0.0115	.	.	.	0.09310	N	1	B	0.23591	0.088	B	0.18561	0.022	T	0.38672	-0.9650	8	0.59425	D	0.04	.	6.7561	0.23514	0.3174:0.0:0.6826:0.0	.	450	C9JFX4	.	A	450	ENSP00000433022:P450A;ENSP00000371960:P450A	ENSP00000371960:P450A	P	-	1	0	SIGIRR	396070	0.000000	0.05858	0.002000	0.10522	0.027000	0.11550	0.663000	0.25053	-0.138000	0.11434	-0.424000	0.05967	CCC	SIGIRR	-	NULL	ENSG00000185187		0.692	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIGIRR	HGNC	protein_coding	OTTHUMT00000383884.3	-	0.00	34	0	G	NM_021805		406070	-1	tier1	-	no_errors	ENST00000382520	ensembl	human	known	74_37	missense	40.00	18	12	SNP	0.006	C
SIGLEC5	8778	genome.wustl.edu	37	19	52133213	52133213	+	Missense_Mutation	SNP	C	C	G	rs374509897	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:52133213C>G	ENST00000534261.2	-	3	693	c.294G>C	c.(292-294)aaG>aaC	p.K98N	SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.K98N|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.K98N			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	98	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		AGCAGTTCTTCTTCTGGACAT	0.532													C|||	27	0.00539137	0.0	0.0	5008	,	,		16835	0.0268		0.0	False		,,,				2504	0.0																0								C	ASN/LYS	4,4060		0,4,2028	25.0	22.0	23.0		294	-1.3	0.0	19		23	0,7970		0,0,3985	no	missense	SIGLEC5	NM_003830.2	94	0,4,6013	GG,GC,CC		0.0,0.0984,0.0332	benign	98/552	52133213	4,12030	2032	3985	6017	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.294G>C	19.37:g.52133213C>G	ENSP00000473238:p.Lys98Asn			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K98N	ENST00000534261.2	37	c.294	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	C	2.785	-0.252557	0.05829	9.84E-4	0.0	ENSG00000105501	ENST00000429354	T	0.66460	-0.21	3.93	-1.28	0.09318	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.596940	0.01585	N	0.021286	T	0.51941	0.1704	N	0.26042	0.785	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.27938	-1.0059	10	0.17369	T	0.5	.	8.5221	0.33282	0.0:0.3167:0.5355:0.1477	.	98	O15389	SIGL5_HUMAN	N	98	ENSP00000415200:K98N	ENSP00000415200:K98N	K	-	3	2	SIGLEC5	56825025	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.608000	0.05641	0.105000	0.17753	-1.373000	0.01185	AAG	SIGLEC5	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105501		0.532	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	-	0.00	18	0	C	NM_003830		52133213	-1	tier1	-	no_errors	ENST00000570106	ensembl	human	known	74_37	missense	25.00	9	3	SNP	0.000	G
SIPA1L2	57568	genome.wustl.edu	37	1	232650439	232650439	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:232650439C>T	ENST00000366630.1	-	2	1005	c.647G>A	c.(646-648)cGa>cAa	p.R216Q	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.R216Q			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	216					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ATTTTCTACTCGGTACCCTCT	0.498																																																	0													113.0	112.0	112.0					1																	232650439		1884	4110	5994	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.647G>A	1.37:g.232650439C>T	ENSP00000355589:p.Arg216Gln		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.R216Q	ENST00000366630.1	37	c.647	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485491	0.44147	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.41758	0.99;0.99	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.30103	0.0754	N	0.25485	0.75	0.48632	D	0.999686	P	0.39624	0.681	B	0.32090	0.14	T	0.06232	-1.0838	10	0.27082	T	0.32	-20.5052	18.9136	0.92496	0.0:1.0:0.0:0.0	.	216	Q9P2F8	SI1L2_HUMAN	Q	216	ENSP00000355589:R216Q;ENSP00000262861:R216Q	ENSP00000262861:R216Q	R	-	2	0	SIPA1L2	230717062	1.000000	0.71417	0.960000	0.40013	0.975000	0.68041	4.761000	0.62243	2.708000	0.92522	0.650000	0.86243	CGA	SIPA1L2	-	NULL	ENSG00000116991		0.498	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	-	0.00	40	0	C	XM_045839		232650439	-1	tier1	-	no_errors	ENST00000262861	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	T
SLC7A2	6542	genome.wustl.edu	37	8	17412489	17412489	+	Intron	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:17412489C>T	ENST00000494857.1	+	8	1413				SLC7A2_ENST00000470360.1_Silent_p.L404L|SLC7A2_ENST00000004531.10_Intron|SLC7A2_ENST00000522656.1_Intron|SLC7A2_ENST00000398090.3_Silent_p.L404L	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2						amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	ACCCCGAATTCTGTTTGCCAT	0.438																																																	0													163.0	146.0	152.0					8																	17412489		2203	4300	6503	SO:0001627	intron_variant	0			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1195+281C>T	8.37:g.17412489C>T			B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Silent	SNP	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	p.L404	ENST00000494857.1	37	c.1210	CCDS34852.1	8																																																																																			SLC7A2	-	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	ENSG00000003989		0.438	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	HGNC	protein_coding	OTTHUMT00000253367.3	-	0.00	70	0	C	NM_003046		17412489	+1	tier1	-	no_errors	ENST00000398090	ensembl	human	known	74_37	silent	37.04	17	10	SNP	1.000	T
SLFNL1	200172	genome.wustl.edu	37	1	41483370	41483370	+	Silent	SNP	G	G	T	rs74071110	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:41483370G>T	ENST00000359345.1	-	2	3470	c.894C>A	c.(892-894)ccC>ccA	p.P298P	SLFNL1_ENST00000372613.2_Silent_p.P298P|SLFNL1_ENST00000439569.2_Silent_p.P298P|SLFNL1_ENST00000372611.1_Silent_p.P239P|SLFNL1_ENST00000302946.8_Silent_p.P298P|SLFNL1_ENST00000397197.2_Silent_p.P298P	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	298							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				TGTAGGCATCGGGAAAGATCT	0.642																																																	0													84.0	79.0	81.0					1																	41483370		2203	4300	6503	SO:0001819	synonymous_variant	0			BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.894C>A	1.37:g.41483370G>T			A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Silent	SNP	pfam_ATPase_AAA-4	p.P298	ENST00000359345.1	37	c.894	CCDS460.1	1																																																																																			SLFNL1	-	pfam_ATPase_AAA-4	ENSG00000171790		0.642	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFNL1	HGNC	protein_coding	OTTHUMT00000015650.1		0.00	31	0	G	NM_144990		41483370	-1			no_errors	ENST00000302946	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.066	T
SLITRK3	22865	genome.wustl.edu	37	3	164907208	164907208	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:164907208G>A	ENST00000475390.1	-	2	1854	c.1411C>T	c.(1411-1413)Ctg>Ttg	p.L471L	SLITRK3_ENST00000241274.3_Silent_p.L471L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	471					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CCTGGTGTCAGCTTCTCTATA	0.483										HNSCC(40;0.11)																																							0													60.0	62.0	61.0					3																	164907208		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1411C>T	3.37:g.164907208G>A			Q1RMY6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L471	ENST00000475390.1	37	c.1411	CCDS3197.1	3																																																																																			SLITRK3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000121871		0.483	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	-	0.00	50	0	G	NM_014926		164907208	-1	tier1	-	no_errors	ENST00000241274	ensembl	human	known	74_37	silent	8.18	101	9	SNP	1.000	A
SMARCA5	8467	genome.wustl.edu	37	4	144459835	144459835	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:144459835G>T	ENST00000283131.3	+	12	2050	c.1588G>T	c.(1588-1590)Gat>Tat	p.D530Y		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	530	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					CTGCAGGTTGGATGGTCAGAC	0.378																																																	0													88.0	88.0	88.0					4																	144459835		2203	4300	6503	SO:0001583	missense	0			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1588G>T	4.37:g.144459835G>T	ENSP00000283131:p.Asp530Tyr			Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D530Y	ENST00000283131.3	37	c.1588	CCDS3761.1	4	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840220	0.91117	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	T	0.77358	-1.09	5.86	5.86	0.93980	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93736	0.7998	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95653	0.8708	10	0.87932	D	0	-35.0618	20.1894	0.98226	0.0:0.0:1.0:0.0	.	530	O60264	SMCA5_HUMAN	Y	530;473;473	ENSP00000283131:D530Y	ENSP00000283131:D530Y	D	+	1	0	SMARCA5	144679285	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.800000	0.99124	2.781000	0.95711	0.591000	0.81541	GAT	SMARCA5	-	pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000153147		0.378	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	HGNC	protein_coding	OTTHUMT00000365077.3		0.00	104	0	G			144459835	+1			no_errors	ENST00000283131	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25490689	25490689	+	RNA	SNP	A	A	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:25490689A>C	ENST00000453082.2	+	0	2719				SNORD115-41_ENST00000363608.1_RNA|SNORD115-42_ENST00000364273.1_RNA|SNORD115-40_ENST00000606510.1_RNA	NR_003343.1				small nucleolar RNA host gene 14 (non-protein coding)																		CATGCTCAATAGGATTACGCT	0.498																																																	0													480.0	464.0	469.0					15																	25490689		876	1991	2867			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25490689A>C				RNA	SNP	-	NULL	ENST00000453082.2	37	NULL		15																																																																																			SNORD115-41	-	-	ENSG00000200478		0.498	SNHG14-003	KNOWN	non_canonical_TEC|basic	antisense	SNORD115-41	HGNC	processed_transcript	OTTHUMT00000126730.2	-	0.00	68	0	A			25490689	+1	tier1	-	no_errors	ENST00000363608	ensembl	human	known	74_37	rna	36.11	23	13	SNP	0.965	C
SPANXC	64663	genome.wustl.edu	37	X	140336535	140336535	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:140336535T>A	ENST00000358993.2	-	1	94	c.56A>T	c.(55-57)aAc>aTc	p.N19I		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	19						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					ATTCACCTCGTTGGATTCACA	0.493																																																	0													83.0	117.0	105.0					X																	140336535		2195	4274	6469	SO:0001583	missense	0			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.56A>T	X.37:g.140336535T>A	ENSP00000351884:p.Asn19Ile		Q32WL9|Q5JX88	Missense_Mutation	SNP	pfam_SPANX_prot	p.N19I	ENST00000358993.2	37	c.56	CCDS14673.1	X	.	.	.	.	.	.	.	.	.	.	t	9.417	1.081929	0.20309	.	.	ENSG00000198573	ENST00000358993	T	0.15139	2.45	.	.	.	.	.	.	.	.	T	0.36908	0.0984	M	0.76328	2.33	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.08554	-1.0716	7	0.87932	D	0	.	.	.	.	.	19	Q9NY87	SPNXC_HUMAN	I	19	ENSP00000351884:N19I	ENSP00000351884:N19I	N	-	2	0	SPANXC	140164201	0.148000	0.22702	0.001000	0.08648	0.001000	0.01503	0.662000	0.25038	0.322000	0.23283	0.317000	0.21355	AAC	SPANXC	-	pfam_SPANX_prot	ENSG00000198573		0.493	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	HGNC	protein_coding	OTTHUMT00000058590.1	-	0.00	387	0	T	NM_022661		140336535	-1	tier1	-	no_errors	ENST00000358993	ensembl	human	known	74_37	missense	20.69	183	48	SNP	0.001	A
SPOCK3	50859	genome.wustl.edu	37	4	167655806	167655806	+	3'UTR	SNP	A	A	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr4:167655806A>C	ENST00000357154.3	-	0	1714				SPOCK3_ENST00000511531.1_3'UTR|SPOCK3_ENST00000512681.1_3'UTR|SPOCK3_ENST00000504953.1_3'UTR|SPOCK3_ENST00000421836.2_3'UTR|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000502330.1_3'UTR|SPOCK3_ENST00000535728.1_3'UTR|SPOCK3_ENST00000511269.1_3'UTR|SPOCK3_ENST00000541354.1_3'UTR|SPOCK3_ENST00000357545.4_3'UTR|SPOCK3_ENST00000510741.1_3'UTR|SPOCK3_ENST00000506886.1_3'UTR	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3						negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TGAAAAACTTATTATAGTAGC	0.289																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.*266T>G	4.37:g.167655806A>C			B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	RNA	SNP	-	NULL	ENST00000357154.3	37	NULL	CCDS54817.1	4																																																																																			SPOCK3	-	-	ENSG00000196104		0.289	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCK3	HGNC	protein_coding	OTTHUMT00000364091.1	-	0.00	39	0	A			167655806	-1	tier1	-	no_errors	ENST00000507137	ensembl	human	known	74_37	rna	34.78	15	8	SNP	0.000	C
SPPL3	121665	genome.wustl.edu	37	12	121220483	121220483	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:121220483G>T	ENST00000353487.2	-	6	980	c.477C>A	c.(475-477)ctC>ctA	p.L159L		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	160						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AATGGCCAGTGAGAACCCAGA	0.418																																																	0													118.0	88.0	98.0					12																	121220483		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.477C>A	12.37:g.121220483G>T			Q3MJ04|Q8TAU4|Q96DD9	Silent	SNP	pfam_Peptidase_A22B_SPP,smart_Preselin/SPP	p.L159	ENST00000353487.2	37	c.477	CCDS9208.1	12																																																																																			SPPL3	-	pfam_Peptidase_A22B_SPP,smart_Preselin/SPP	ENSG00000157837		0.418	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	HGNC	protein_coding	OTTHUMT00000402980.2	-	0.00	60	0	G	NM_139015		121220483	-1	tier1	-	no_errors	ENST00000353487	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2816501	2816501	+	Missense_Mutation	SNP	G	G	T	rs549557408		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:2816501G>T	ENST00000301740.8	+	11	6521	c.5972G>T	c.(5971-5973)cGa>cTa	p.R1991L		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1991	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCGGTCACCCGAAGGAGATCT	0.567																																																	0													68.0	71.0	70.0					16																	2816501		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5972G>T	16.37:g.2816501G>T	ENSP00000301740:p.Arg1991Leu		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R1991L	ENST00000301740.8	37	c.5972	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	9.788	1.177259	0.21787	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26373	1.74	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000029	T	0.22166	0.0534	N	0.08118	0	0.23669	N	0.997158	D	0.63880	0.993	P	0.54706	0.759	T	0.20306	-1.0279	10	0.11182	T	0.66	-6.9001	16.354	0.83228	0.0:0.0:1.0:0.0	.	1991	Q9UQ35	SRRM2_HUMAN	L	1991;1991;1243	ENSP00000301740:R1991L	ENSP00000301740:R1991L	R	+	2	0	SRRM2	2756502	0.174000	0.23070	0.647000	0.29507	0.778000	0.44026	3.451000	0.52964	2.466000	0.83321	0.650000	0.86243	CGA	SRRM2	-	NULL	ENSG00000167978		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1		0.00	33	0	G			2816501	+1			no_errors	ENST00000301740	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.404	T
SRCAP	10847	genome.wustl.edu	37	16	30749318	30749318	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:30749318G>T	ENST00000262518.4	+	34	8342	c.7957G>T	c.(7957-7959)Gag>Tag	p.E2653*	SRCAP_ENST00000395059.2_Nonsense_Mutation_p.E2591*|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000344771.4_Nonsense_Mutation_p.E2495*	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2653	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CAATGGCCTGGAGCTCCCACC	0.597																																																	0													70.0	61.0	64.0					16																	30749318		2197	4300	6497	SO:0001587	stop_gained	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7957G>T	16.37:g.30749318G>T	ENSP00000262518:p.Glu2653*		B0JZA6|O15026|Q7Z744|Q9Y5L9	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.E2653*	ENST00000262518.4	37	c.7957	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	46	12.622410	0.99683	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	.	.	.	4.88	4.88	0.63580	.	0.532223	0.17144	N	0.185327	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-3.5506	13.3988	0.60870	0.0:0.0:1.0:0.0	.	.	.	.	X	2653;2591;2495	.	ENSP00000262518:E2653X	E	+	1	0	SRCAP	30656819	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.351000	0.52232	2.543000	0.85770	0.467000	0.42956	GAG	SRCAP	-	NULL	ENSG00000080603		0.597	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1		0.00	12	0	G	NM_006662		30749318	+1			no_errors	ENST00000262518	ensembl	human	known	74_37	nonsense	50.00	7	7	SNP	0.999	T
ST6GALNAC3	256435	genome.wustl.edu	37	1	77094397	77094397	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:77094397G>A	ENST00000328299.3	+	5	972	c.824G>A	c.(823-825)gGg>gAg	p.G275E		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	275					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						GCCCCATATGGGGGTCATAGG	0.378																																																	0													125.0	128.0	127.0					1																	77094397		2203	4298	6501	SO:0001583	missense	0				CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.824G>A	1.37:g.77094397G>A	ENSP00000329214:p.Gly275Glu		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.G275E	ENST00000328299.3	37	c.824	CCDS672.1	1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.986797	0.74589	.	.	ENSG00000184005	ENST00000328299;ENST00000394993;ENST00000415813	T	0.32272	1.46	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.57799	0.2078	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.98;0.998	T	0.64972	-0.6281	10	0.72032	D	0.01	-26.7341	19.3735	0.94500	0.0:0.0:1.0:0.0	.	174;275	B4DM98;Q8NDV1	.;SIA7C_HUMAN	E	275;274;173	ENSP00000329214:G275E	ENSP00000329214:G275E	G	+	2	0	ST6GALNAC3	76866985	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	9.398000	0.97281	2.644000	0.89710	0.645000	0.84053	GGG	ST6GALNAC3	-	pfam_Glyco_trans_29	ENSG00000184005		0.378	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC3	HGNC	protein_coding	OTTHUMT00000026501.1	-	0.00	60	0	G	NM_152996		77094397	+1	tier1	-	no_errors	ENST00000328299	ensembl	human	known	74_37	missense	52.63	27	30	SNP	1.000	A
STAMBPL1	57559	genome.wustl.edu	37	10	90672913	90672913	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:90672913C>A	ENST00000371926.3	+	6	1434	c.476C>A	c.(475-477)gCa>gAa	p.A159E	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.A159E|STAMBPL1_ENST00000371922.1_5'UTR|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.A159E	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	159						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		TTGATAGAGGCAGAAAGGAAG	0.433																																																	0													67.0	74.0	71.0					10																	90672913		2203	4300	6503	SO:0001583	missense	0			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.476C>A	10.37:g.90672913C>A	ENSP00000360994:p.Ala159Glu		B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.A159E	ENST00000371926.3	37	c.476	CCDS7391.1	10	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463250	0.26248	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.20598	2.06;2.06;2.06	5.98	5.98	0.97165	.	0.068555	0.64402	D	0.000018	T	0.14184	0.0343	L	0.29908	0.895	0.80722	D	1	B;B	0.32829	0.036;0.386	B;B	0.24269	0.016;0.052	T	0.04579	-1.0941	10	0.02654	T	1	-2.6416	19.0085	0.92863	0.0:1.0:0.0:0.0	.	159;159	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	E	159	ENSP00000360994:A159E;ENSP00000360995:A159E;ENSP00000360992:A159E	ENSP00000360992:A159E	A	+	2	0	STAMBPL1	90662893	0.868000	0.29978	0.972000	0.41901	0.992000	0.81027	1.657000	0.37366	2.834000	0.97654	0.655000	0.94253	GCA	STAMBPL1	-	NULL	ENSG00000138134		0.433	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1	-	0.00	49	0	C	NM_020799		90672913	+1	tier1	-	no_errors	ENST00000371927	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.959	A
STARD9	57519	genome.wustl.edu	37	15	42985567	42985567	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:42985567C>T	ENST00000290607.7	+	23	11848	c.11791C>T	c.(11791-11793)Cac>Tac	p.H3931Y		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3931					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGTTGAAGGCCACCAGAAGCT	0.562																																																	0													36.0	39.0	38.0					15																	42985567		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.11791C>T	15.37:g.42985567C>T	ENSP00000290607:p.His3931Tyr		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H3931Y	ENST00000290607.7	37	c.11791	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435838	0.43224	.	.	ENSG00000159433	ENST00000290607	T	0.65732	-0.17	5.8	3.9	0.45041	.	.	.	.	.	T	0.52757	0.1754	L	0.54323	1.7	0.09310	N	1	P	0.41947	0.766	B	0.34038	0.174	T	0.47573	-0.9107	9	0.72032	D	0.01	.	9.4642	0.38802	0.0:0.8318:0.0:0.1682	.	3845	Q9P2P6	STAR9_HUMAN	Y	3931	ENSP00000290607:H3931Y	ENSP00000290607:H3931Y	H	+	1	0	STARD9	40772859	0.000000	0.05858	0.001000	0.08648	0.117000	0.20001	0.704000	0.25661	0.775000	0.33450	0.462000	0.41574	CAC	STARD9	-	NULL	ENSG00000159433		0.562	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	-	0.00	43	0	C			42985567	+1	tier1	-	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.002	T
SUPT6H	6830	genome.wustl.edu	37	17	27023872	27023872	+	Silent	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:27023872G>A	ENST00000314616.6	+	30	4264	c.3981G>A	c.(3979-3981)aaG>aaA	p.K1327K	SUPT6H_ENST00000347486.4_Silent_p.K1327K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1327	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CATACATCAAGAGAGTGATCG	0.458																																																	0													114.0	97.0	103.0					17																	27023872		2203	4300	6503	SO:0001819	synonymous_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3981G>A	17.37:g.27023872G>A			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.K1327	ENST00000314616.6	37	c.3981	CCDS32596.1	17																																																																																			SUPT6H	-	pirsf_TF_Spt6,pfscan_SH2	ENSG00000109111		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2		0.00	36	0	G	NM_003170		27023872	+1			no_errors	ENST00000314616	ensembl	human	known	74_37	silent	22.22	7	2	SNP	1.000	A
SUV420H1	51111	genome.wustl.edu	37	11	67957421	67957421	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:67957421C>G	ENST00000304363.4	-	2	476	c.123G>C	c.(121-123)aaG>aaC	p.K41N	SUV420H1_ENST00000402185.2_Missense_Mutation_p.K41N|SUV420H1_ENST00000405515.1_Missense_Mutation_p.K41N|SUV420H1_ENST00000401547.2_Missense_Mutation_p.K41N|SUV420H1_ENST00000402789.1_Missense_Mutation_p.K41N	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	41					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTTTGCCAGCCTTCAGGGTGT	0.438																																																	0													361.0	316.0	331.0					11																	67957421		2200	4294	6494	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.123G>C	11.37:g.67957421C>G	ENSP00000305899:p.Lys41Asn		B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.K41N	ENST00000304363.4	37	c.123	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423580	0.62733	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185;ENST00000434573	T;T;T;T;T;T	0.51817	1.01;1.01;1.01;1.01;0.69;1.01	5.87	5.87	0.94306	.	0.090894	0.64402	D	0.000001	T	0.32645	0.0836	N	0.08118	0	0.36963	D	0.893425	B;P;B;P	0.50066	0.009;0.503;0.241;0.931	B;B;B;B	0.44224	0.022;0.166;0.148;0.444	T	0.46275	-0.9203	10	0.87932	D	0	-31.295	13.4155	0.60966	0.0:0.9285:0.0:0.0715	.	41;41;41;41	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	N	41	ENSP00000305899:K41N;ENSP00000385965:K41N;ENSP00000385640:K41N;ENSP00000385005:K41N;ENSP00000384724:K41N;ENSP00000402921:K41N	ENSP00000305899:K41N	K	-	3	2	SUV420H1	67713997	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.455000	0.44988	2.784000	0.95788	0.585000	0.79938	AAG	SUV420H1	-	NULL	ENSG00000110066		0.438	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	-	0.00	67	0	C	NM_017635		67957421	-1	tier1	-	no_errors	ENST00000304363	ensembl	human	known	74_37	missense	52.66	80	89	SNP	1.000	G
SYNDIG1L	646658	genome.wustl.edu	37	14	74876117	74876117	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr14:74876117C>A	ENST00000554823.1	-	1	392	c.331G>T	c.(331-333)Gct>Tct	p.A111S	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.A111S			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	111					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						TTCTCTGCAGCTTGGCCAGGT	0.612																																																	0													74.0	77.0	76.0					14																	74876117		2024	4191	6215	SO:0001583	missense	0				CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.331G>T	14.37:g.74876117C>A	ENSP00000450439:p.Ala111Ser			Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.A111S	ENST00000554823.1	37	c.331	CCDS41970.1	14	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.568417	0.00133	.	.	ENSG00000183379	ENST00000331628;ENST00000554823	D;D	0.95205	-3.64;-3.64	4.63	2.79	0.32731	.	0.629071	0.15524	N	0.257870	D	0.83321	0.5229	N	0.11427	0.14	0.09310	N	1	B	0.24258	0.1	B	0.15870	0.014	T	0.69468	-0.5137	10	0.02654	T	1	-0.0705	7.9996	0.30288	0.0:0.744:0.0:0.256	.	111	A6NDD5	SYN1L_HUMAN	S	111	ENSP00000331474:A111S;ENSP00000450439:A111S	ENSP00000331474:A111S	A	-	1	0	SYNDIG1L	73945870	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.181000	0.16880	0.558000	0.29135	-0.373000	0.07131	GCT	SYNDIG1L	-	NULL	ENSG00000183379		0.612	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYNDIG1L	HGNC	protein_coding	OTTHUMT00000412341.1	-	0.00	44	0	C	XM_938515		74876117	-1	tier1	-	no_errors	ENST00000331628	ensembl	human	known	74_37	missense	19.15	38	9	SNP	0.001	A
SYT4	6860	genome.wustl.edu	37	18	40850370	40850370	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:40850370C>T	ENST00000255224.3	-	4	1582	c.1214G>A	c.(1213-1215)tGg>tAg	p.W405*	SYT4_ENST00000590752.1_Nonsense_Mutation_p.W387*|SYT4_ENST00000586678.1_5'UTR	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	405					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						GATCTCTTTCCAGTGCTCTCC	0.483																																					NSCLC(85;81 1419 2855 22820 35912)												0													168.0	169.0	168.0					18																	40850370		2203	4300	6503	SO:0001587	stop_gained	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.1214G>A	18.37:g.40850370C>T	ENSP00000255224:p.Trp405*		B4DEU3|Q9P2K4	Nonsense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.W405*	ENST00000255224.3	37	c.1214	CCDS11922.1	18	.	.	.	.	.	.	.	.	.	.	C	40	8.219605	0.98712	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5717	0.95423	0.0:1.0:0.0:0.0	.	.	.	.	X	405;210	.	ENSP00000255224:W405X	W	-	2	0	SYT4	39104368	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.644000	0.89710	0.655000	0.94253	TGG	SYT4	-	superfamily_C2_dom,smart_C2_dom	ENSG00000132872		0.483	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	-	0.00	32	0	C	NM_020783		40850370	-1	tier1	-	no_errors	ENST00000255224	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	1.000	T
TAF1	6872	genome.wustl.edu	37	X	70612510	70612510	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:70612510C>T	ENST00000373790.4	+	19	2921	c.2870C>T	c.(2869-2871)aCg>aTg	p.T957M	TAF1_ENST00000449580.1_Missense_Mutation_p.T957M|TAF1_ENST00000423759.1_Missense_Mutation_p.T978M|TAF1_ENST00000276072.3_Missense_Mutation_p.T978M	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	957	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GCAGATCCCACGGGGTGTGGT	0.488																																																	0													83.0	73.0	77.0					X																	70612510		2203	4300	6503	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2870C>T	X.37:g.70612510C>T	ENSP00000362895:p.Thr957Met		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.T957M	ENST00000373790.4	37	c.2870	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	23.1	4.377712	0.82682	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	4.81	4.81	0.61882	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.051023	0.85682	D	0.000000	T	0.62829	0.2460	M	0.93678	3.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.75453	-0.3312	10	0.87932	D	0	.	17.3645	0.87359	0.0:1.0:0.0:0.0	.	957;957;978	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	M	957;957;978;978	ENSP00000362895:T957M;ENSP00000389000:T957M;ENSP00000406549:T978M;ENSP00000276072:T978M	ENSP00000276072:T978M	T	+	2	0	TAF1	70529235	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.439000	0.80444	2.112000	0.64535	0.544000	0.68410	ACG	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.488	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	-	0.00	72	0	C	NM_004606		70612510	+1	tier1	-	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	T
TAF1D	79101	genome.wustl.edu	37	11	93469859	93469859	+	Splice_Site	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:93469859C>G	ENST00000448108.2	-	5	1344		c.e5+1		SNORA40_ENST00000388090.1_RNA|MIR1304_ENST00000408243.1_RNA|TAF1D_ENST00000546088.1_5'Flank	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						AAGTCACTTACTGCCAATTTG	0.328																																																	0													111.0	114.0	113.0					11																	93469859		2200	4298	6498	SO:0001630	splice_region_variant	0				CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451	ENST00000448108.2:c.693+1G>C	11.37:g.93469859C>G			Q6I9Y6	Splice_Site	SNP	-	e4+1	ENST00000448108.2	37	c.693+1	CCDS8293.1	11	.	.	.	.	.	.	.	.	.	.	C	9.822	1.186148	0.21870	.	.	ENSG00000166012	ENST00000448108	.	.	.	3.87	3.87	0.44632	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6494	0.51279	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TAF1D	93109507	1.000000	0.71417	1.000000	0.80357	0.340000	0.28889	1.855000	0.39378	2.446000	0.82766	0.591000	0.81541	.	TAF1D	-	-	ENSG00000166012		0.328	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1D	HGNC	protein_coding	OTTHUMT00000394662.2	-	0.00	41	0	C	NM_024116	Intron	93469859	-1	tier1	-	no_errors	ENST00000323981	ensembl	human	known	74_37	splice_site	8.11	68	6	SNP	1.000	G
TAS2R30	259293	genome.wustl.edu	37	12	11286602	11286602	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:11286602C>T	ENST00000539585.1	-	1	641	c.242G>A	c.(241-243)aGa>aAa	p.R81K	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	81					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AGCAGTAATTCTTACTTCTAC	0.433																																																	0													86.0	88.0	87.0					12																	11286602		2080	4255	6335	SO:0001583	missense	0			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.242G>A	12.37:g.11286602C>T	ENSP00000444736:p.Arg81Lys		Q645X7	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.R81K	ENST00000539585.1	37	c.242	CCDS53750.1	12	.	.	.	.	.	.	.	.	.	.	-	8.957	0.969541	0.18659	.	.	ENSG00000256188	ENST00000539585	T	0.37058	1.22	2.33	-0.642	0.11486	.	.	.	.	.	T	0.23727	0.0574	L	0.27053	0.805	0.09310	N	1	B	0.31893	0.345	B	0.37346	0.247	T	0.29305	-1.0016	9	0.31617	T	0.26	.	4.7075	0.12856	0.0:0.442:0.0:0.558	.	81	P59541	T2R30_HUMAN	K	81	ENSP00000444736:R81K	ENSP00000444736:R81K	R	-	2	0	TAS2R30	11177869	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.511000	0.02260	-0.055000	0.13244	0.313000	0.20887	AGA	TAS2R30	-	pfam_TAS2_rcpt	ENSG00000256188		0.433	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R30	HGNC	protein_coding	OTTHUMT00000400238.1	-	0.00	97	0	C	NM_001097643		11286602	-1	tier1	-	no_errors	ENST00000539585	ensembl	human	known	74_37	missense	25.00	63	21	SNP	0.000	T
TCF4	6925	genome.wustl.edu	37	18	52896218	52896218	+	Missense_Mutation	SNP	C	C	T	rs121909121		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:52896218C>T	ENST00000356073.4	-	18	2338	c.1727G>A	c.(1726-1728)cGg>cAg	p.R576Q	TCF4_ENST00000568740.1_Missense_Mutation_p.R551Q|TCF4_ENST00000566279.1_Missense_Mutation_p.R520Q|TCF4_ENST00000565018.2_Missense_Mutation_p.R580Q|TCF4_ENST00000537578.1_Missense_Mutation_p.R556Q|TCF4_ENST00000544241.2_Missense_Mutation_p.R509Q|TCF4_ENST00000561992.1_Missense_Mutation_p.R446Q|TCF4_ENST00000564403.2_Missense_Mutation_p.R586Q|TCF4_ENST00000561831.3_Missense_Mutation_p.R416Q|TCF4_ENST00000540999.1_Missense_Mutation_p.R552Q|TCF4_ENST00000567880.1_Missense_Mutation_p.R516Q|TCF4_ENST00000354452.3_Missense_Mutation_p.R580Q|TCF4_ENST00000543082.1_Missense_Mutation_p.R534Q|TCF4_ENST00000537856.3_Missense_Mutation_p.R446Q|TCF4_ENST00000566286.1_Missense_Mutation_p.R573Q|TCF4_ENST00000568673.1_Missense_Mutation_p.R556Q|TCF4_ENST00000570287.2_Missense_Mutation_p.R416Q|TCF4_ENST00000457482.3_Missense_Mutation_p.R420Q|TCF4_ENST00000564228.1_Missense_Mutation_p.R505Q|TCF4_ENST00000570177.2_Missense_Mutation_p.R446Q|TCF4_ENST00000564999.1_Missense_Mutation_p.R576Q|TCF4_ENST00000398339.1_Missense_Mutation_p.R682Q	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	576	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.		R -> Q (in PTHS; loss of function). {ECO:0000269|PubMed:17436254, ECO:0000269|PubMed:19235238, ECO:0000269|PubMed:22045651}.|R -> W (in PTHS; mislocalized to small spherical punctae that are dispersed throughout the nucleus; can attenuate homo- and heterodimer formation; affects transcriptional activity in a context- dependent manner). {ECO:0000269|PubMed:17436254, ECO:0000269|PubMed:17436255, ECO:0000269|PubMed:22045651}.		DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GTCACGGACCCGCAGACGCTC	0.582																																																	0			GRCh37	CM072075	TCF4	M	rs121909121						182.0	157.0	166.0					18																	52896218		2203	4300	6503	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1727G>A	18.37:g.52896218C>T	ENSP00000348374:p.Arg576Gln		B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R682Q	ENST00000356073.4	37	c.2045	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	36	5.972554	0.97162	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	D;D;D;D;D;D;D;D;D	0.99722	-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53	5.89	5.89	0.94794	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99809	0.9917	M	0.93150	3.385	0.80722	A	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;1.0;1.0;0.997;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.979;1.0;1.0;0.964;1.0	D	0.97341	0.9957	9	0.87932	D	0	-8.6194	19.0276	0.92939	0.0:1.0:0.0:0.0	.	556;580;416;682;576;534;509;420;573	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	Q	580;420;576;534;552;556;509;446;682	ENSP00000346440:R580Q;ENSP00000409447:R420Q;ENSP00000348374:R576Q;ENSP00000439656:R534Q;ENSP00000445202:R552Q;ENSP00000440731:R556Q;ENSP00000441562:R509Q;ENSP00000439827:R446Q;ENSP00000381382:R682Q	ENSP00000346440:R580Q	R	-	2	0	TCF4	51047216	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.797000	0.96272	0.563000	0.77884	CGG	TCF4	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000196628		0.582	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	-	0.00	36	0	C	NM_003199		52896218	-1	tier1	rs121909121	no_errors	ENST00000398339	ensembl	human	known	74_37	missense	32.56	29	14	SNP	1.000	T
TCN2	6948	genome.wustl.edu	37	22	31019043	31019043	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:31019043C>T	ENST00000215838.3	+	8	1689	c.1195C>T	c.(1195-1197)Cga>Tga	p.R399*	TCN2_ENST00000407817.3_Nonsense_Mutation_p.R372*|TCN2_ENST00000405742.3_Nonsense_Mutation_p.R395*			P20062	TCO2_HUMAN	transcobalamin II	399			R -> Q (in dbSNP:rs4820889).		cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCAGCTTCTCCGAGACCCCAA	0.552																																																	0													80.0	77.0	78.0					22																	31019043		2203	4300	6503	SO:0001587	stop_gained	0				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.1195C>T	22.37:g.31019043C>T	ENSP00000215838:p.Arg399*		Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Nonsense_Mutation	SNP	pfam_Cbl-bd_transpt_euk,superfamily_Terpenoid_cyclase/PrenylTrfase	p.R399*	ENST00000215838.3	37	c.1195	CCDS13881.1	22	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309620	0.60414	.	.	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	.	.	.	5.51	3.29	0.37713	.	0.388191	0.27961	N	0.017159	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6284	11.782	0.52020	0.3185:0.6815:0.0:0.0	.	.	.	.	X	399;395;372	.	ENSP00000215838:R399X	R	+	1	2	TCN2	29349043	0.495000	0.26051	0.963000	0.40424	0.019000	0.09904	1.018000	0.30002	1.317000	0.45149	0.585000	0.79938	CGA	TCN2	-	NULL	ENSG00000185339		0.552	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCN2	HGNC	protein_coding	OTTHUMT00000321282.2	-	0.00	67	0	C	NM_000355		31019043	+1	tier1	-	no_errors	ENST00000215838	ensembl	human	known	74_37	nonsense	11.54	46	6	SNP	1.000	T
TERF2IP	54386	genome.wustl.edu	37	16	75690378	75690378	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr16:75690378G>C	ENST00000300086.4	+	3	1166	c.1069G>C	c.(1069-1071)Gat>Cat	p.D357H		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	357					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						TCAGAGAGCTGATGGATATCC	0.433																																																	0													158.0	163.0	161.0					16																	75690378		2198	4300	6498	SO:0001583	missense	0			AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.1069G>C	16.37:g.75690378G>C	ENSP00000300086:p.Asp357His		B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	pfam_Rap1_Myb_dom,superfamily_Homeodomain-like,superfamily_BRCT_dom	p.D357H	ENST00000300086.4	37	c.1069	CCDS32491.1	16	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387835	0.82902	.	.	ENSG00000166848	ENST00000300086	T	0.46063	0.88	5.84	5.84	0.93424	.	0.282373	0.38778	N	0.001573	T	0.56746	0.2006	L	0.32530	0.975	0.53688	D	0.999979	D	0.89917	1.0	D	0.85130	0.997	T	0.57774	-0.7753	10	0.87932	D	0	-24.3602	18.7214	0.91697	0.0:0.0:1.0:0.0	.	357	Q9NYB0	TE2IP_HUMAN	H	357	ENSP00000300086:D357H	ENSP00000300086:D357H	D	+	1	0	TERF2IP	74247879	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.621000	0.74228	2.760000	0.94817	0.591000	0.81541	GAT	TERF2IP	-	NULL	ENSG00000166848		0.433	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TERF2IP	HGNC	protein_coding	OTTHUMT00000435519.1	-	0.00	44	0	G	NM_018975		75690378	+1	tier1	-	no_errors	ENST00000300086	ensembl	human	known	74_37	missense	37.50	30	18	SNP	1.000	C
TFCP2L1	29842	genome.wustl.edu	37	2	121995273	121995273	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:121995273G>T	ENST00000263707.5	-	10	1026	c.929C>A	c.(928-930)tCg>tAg	p.S310*		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	310					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					ATCCTGGATCGAAGCTGATGG	0.592																																																	0													88.0	89.0	89.0					2																	121995273		2203	4300	6503	SO:0001587	stop_gained	0			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.929C>A	2.37:g.121995273G>T	ENSP00000263707:p.Ser310*		Q4ZG43	Nonsense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.S310*	ENST00000263707.5	37	c.929	CCDS2134.1	2	.	.	.	.	.	.	.	.	.	.	G	38	7.254314	0.98168	.	.	ENSG00000115112	ENST00000263707	.	.	.	5.69	5.69	0.88448	.	0.250225	0.42420	D	0.000710	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.6674	19.819	0.96583	0.0:0.0:1.0:0.0	.	.	.	.	X	310	.	ENSP00000263707:S310X	S	-	2	0	TFCP2L1	121711743	1.000000	0.71417	0.984000	0.44739	0.770000	0.43624	9.684000	0.98659	2.691000	0.91804	0.655000	0.94253	TCG	TFCP2L1	-	superfamily_SAM/pointed	ENSG00000115112		0.592	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	HGNC	protein_coding	OTTHUMT00000338539.1		0.00	30	0	G	NM_014553		121995273	-1			no_errors	ENST00000263707	ensembl	human	known	74_37	nonsense	22.22	7	2	SNP	1.000	T
THPO	7066	genome.wustl.edu	37	3	184091254	184091254	+	Silent	SNP	A	A	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr3:184091254A>G	ENST00000204615.7	-	5	559	c.345T>C	c.(343-345)tcT>tcC	p.S115S	THPO_ENST00000477594.1_5'Flank|THPO_ENST00000421442.2_Silent_p.S115S|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000445696.2_Silent_p.S115S	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	115					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGACCTGTCCAGAAAGCTGCC	0.582																																																	0													83.0	73.0	76.0					3																	184091254		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.345T>C	3.37:g.184091254A>G			A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Silent	SNP	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,prints_Thrombopoeitin	p.S115	ENST00000204615.7	37	c.345	CCDS3265.1	3																																																																																			THPO	-	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,prints_Thrombopoeitin	ENSG00000090534		0.582	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THPO	HGNC	protein_coding	OTTHUMT00000345554.1	-	0.00	55	0	A	NM_000460		184091254	-1	tier1	-	no_errors	ENST00000204615	ensembl	human	known	74_37	silent	15.52	49	9	SNP	0.989	G
TMED3	23423	genome.wustl.edu	37	15	79614407	79614407	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:79614407C>T	ENST00000299705.5	+	3	693	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	TMED3_ENST00000536821.1_Intron|TMED3_ENST00000424155.2_Intron|TMED3_ENST00000558562.1_3'UTR	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	169					protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						GGCCCAGGACCGGGCCCGAGC	0.577																																																	0													71.0	68.0	69.0					15																	79614407		2196	4293	6489	SO:0001583	missense	0			BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.505C>T	15.37:g.79614407C>T	ENSP00000299705:p.Arg169Trp		A8K069|B4DN05|Q2T9F8	Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.R169W	ENST00000299705.5	37	c.505	CCDS10310.1	15	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575735	0.86645	.	.	ENSG00000166557	ENST00000299705	T	0.25749	1.78	5.05	3.15	0.36227	GOLD (1);	0.067835	0.64402	D	0.000010	T	0.62853	0.2462	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73685	-0.3905	10	0.87932	D	0	-32.2228	12.1788	0.54199	0.3098:0.6902:0.0:0.0	.	169	Q9Y3Q3	TMED3_HUMAN	W	169	ENSP00000299705:R169W	ENSP00000299705:R169W	R	+	1	2	TMED3	77401462	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.421000	0.59848	0.696000	0.31696	0.591000	0.81541	CGG	TMED3	-	pfam_GOLD	ENSG00000166557		0.577	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED3	HGNC	protein_coding	OTTHUMT00000291369.1	-	0.00	58	0	C	NM_007364		79614407	+1	tier1	-	no_errors	ENST00000299705	ensembl	human	known	74_37	missense	27.50	29	11	SNP	1.000	T
TMEM163	81615	genome.wustl.edu	37	2	135215728	135215728	+	Silent	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:135215728C>G	ENST00000281924.6	-	7	748	c.684G>C	c.(682-684)gtG>gtC	p.V228V		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	228						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		TCACGCCACCCACGAGGGAGT	0.557																																																	0													91.0	85.0	87.0					2																	135215728		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.684G>C	2.37:g.135215728C>G			Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	NULL	p.V228	ENST00000281924.6	37	c.684	CCDS2172.1	2																																																																																			TMEM163	-	NULL	ENSG00000152128		0.557	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM163	HGNC	protein_coding	OTTHUMT00000254631.2	-	0.00	25	0	C	NM_030923		135215728	-1	tier1	-	no_errors	ENST00000281924	ensembl	human	known	74_37	silent	53.33	7	8	SNP	1.000	G
TMEM191A	84222	genome.wustl.edu	37	22	21055369	21055369	+	RNA	DEL	A	A	-	rs113134575|rs74469280		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:21055369delA	ENST00000450925.2	+	0	0					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											tctgtctcagaaaaaaaaaaa	0.473																																																	0																																												0			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21055369delA			B2R8E2	RNA	DEL	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-	ENSG00000226287		0.473	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1		0.00	11	0	A			21055369	+1	tier1		no_errors	ENST00000359859	ensembl	human	known	74_37	rna	25.00	6	2	DEL	0.005	-
TMEM70	54968	genome.wustl.edu	37	8	74893683	74893683	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:74893683G>C	ENST00000312184.5	+	3	683	c.610G>C	c.(610-612)Gat>Cat	p.D204H	Y_RNA_ENST00000365350.1_RNA	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	204					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			GAAGATTCCAGATGCTAAACA	0.383																																																	0													136.0	125.0	129.0					8																	74893683		2203	4300	6503	SO:0001583	missense	0			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.610G>C	8.37:g.74893683G>C	ENSP00000312599:p.Asp204His		E9PDY9|Q9NWY5	Missense_Mutation	SNP	pfam_DUF1301_TMEM70	p.D204H	ENST00000312184.5	37	c.610	CCDS6215.1	8	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432270	0.25813	.	.	ENSG00000175606	ENST00000312184	T	0.66460	-0.21	5.38	-2.66	0.06077	.	0.892934	0.09959	N	0.733609	T	0.75759	0.3893	M	0.68593	2.085	0.21256	N	0.999745	D	0.60575	0.988	P	0.62813	0.907	T	0.69993	-0.4994	10	0.66056	D	0.02	-2.3968	12.2356	0.54514	0.4979:0.0:0.5021:0.0	.	204	Q9BUB7	TMM70_HUMAN	H	204	ENSP00000312599:D204H	ENSP00000312599:D204H	D	+	1	0	TMEM70	75056237	0.004000	0.15560	0.003000	0.11579	0.012000	0.07955	0.664000	0.25068	-0.765000	0.04645	0.655000	0.94253	GAT	TMEM70	-	pfam_DUF1301_TMEM70	ENSG00000175606		0.383	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM70	HGNC	protein_coding	OTTHUMT00000379028.1	-	0.00	45	0	G	NM_017866		74893683	+1	tier1	-	no_errors	ENST00000312184	ensembl	human	known	74_37	missense	21.21	52	14	SNP	0.117	C
TNIP1	10318	genome.wustl.edu	37	5	150410288	150410288	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr5:150410288C>G	ENST00000389378.2	-	18	2485	c.1897G>C	c.(1897-1899)Gag>Cag	p.E633Q	TNIP1_ENST00000523200.1_Missense_Mutation_p.E569Q|TNIP1_ENST00000524280.1_Silent_p.V536V|TNIP1_ENST00000521591.1_Missense_Mutation_p.E633Q|TNIP1_ENST00000315050.7_Missense_Mutation_p.E633Q|TNIP1_ENST00000521423.1_5'Flank|TNIP1_ENST00000520931.1_Missense_Mutation_p.E580Q|TNIP1_ENST00000522226.1_Missense_Mutation_p.E633Q|TNIP1_ENST00000518977.1_Intron|TNIP1_ENST00000523338.1_Intron	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	633	Pro-rich.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGGCCCCTCACGGTCATTT	0.448																																																	0													81.0	81.0	81.0					5																	150410288		2203	4300	6503	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1897G>C	5.37:g.150410288C>G	ENSP00000374029:p.Glu633Gln		A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E633Q	ENST00000389378.2	37	c.1897	CCDS34280.1	5	.	.	.	.	.	.	.	.	.	.	C	11.18	1.563507	0.27915	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000523200	T;T;T;T;T;T	0.12361	2.72;2.72;2.72;2.72;2.72;2.69	5.44	2.7	0.31948	.	0.637227	0.14743	N	0.301049	T	0.11580	0.0282	L	0.44542	1.39	0.09310	N	1	B;B	0.18166	0.026;0.015	B;B	0.19391	0.025;0.025	T	0.24693	-1.0153	10	0.35671	T	0.21	-2.4862	6.874	0.24137	0.0:0.7207:0.0:0.2793	.	569;633	E7ET96;Q15025	.;TNIP1_HUMAN	Q	580;633;633;526;595;633;633;569	ENSP00000429891:E580Q;ENSP00000374029:E633Q;ENSP00000317891:E633Q;ENSP00000428187:E633Q;ENSP00000430760:E633Q;ENSP00000431105:E569Q	ENSP00000317891:E633Q	E	-	1	0	TNIP1	150390481	0.002000	0.14202	0.233000	0.24025	0.848000	0.48234	0.470000	0.22084	0.669000	0.31146	0.448000	0.29417	GAG	TNIP1	-	NULL	ENSG00000145901		0.448	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1		0.00	43	0	C	NM_006058		150410288	-1			no_errors	ENST00000315050	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.047	G
TP53	7157	genome.wustl.edu	37	17	7576652	7576652	+	Intron	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:7576652C>T	ENST00000269305.4	-	9	1183				TP53_ENST00000455263.2_Intron|TP53_ENST00000420246.2_Silent_p.Q333Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Intron|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I332fs*49(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAAGCTGGTCTGGTCCTTTA	0.393		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	10	Whole gene deletion(8)|Unknown(1)|Insertion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|stomach(1)|breast(1)											57.0	50.0	52.0					17																	7576652		1567	3582	5149	SO:0001627	intron_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+200G>A	17.37:g.7576652C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	p.Q333	ENST00000269305.4	37	c.999	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.393	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	57	0	C	NM_000546		7576652	-1	tier1	-	no_errors	ENST00000420246	ensembl	human	known	74_37	silent	29.55	31	13	SNP	0.131	T
TP53	7157	genome.wustl.edu	37	17	7578442	7578442	+	Missense_Mutation	SNP	T	T	C	rs148924904		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:7578442T>C	ENST00000269305.4	-	5	677	c.488A>G	c.(487-489)tAc>tGc	p.Y163C	TP53_ENST00000455263.2_Missense_Mutation_p.Y163C|TP53_ENST00000420246.2_Missense_Mutation_p.Y163C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.Y163C|TP53_ENST00000445888.2_Missense_Mutation_p.Y163C|TP53_ENST00000413465.2_Missense_Mutation_p.Y163C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	163	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y163C(134)|p.Y70C(12)|p.Y31C(12)|p.0?(8)|p.Y163S(7)|p.V157_C176del20(1)|p.Y31S(1)|p.Y163fs*1(1)|p.Y70S(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.I162_Y163delIY(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACTGCTTGTAGATGGCCAT	0.622		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	183	Substitution - Missense(167)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)	lung(49)|breast(34)|haematopoietic_and_lymphoid_tissue(14)|ovary(14)|urinary_tract(13)|large_intestine(10)|upper_aerodigestive_tract(9)|central_nervous_system(7)|oesophagus(7)|stomach(6)|biliary_tract(6)|bone(4)|pancreas(3)|soft_tissue(2)|liver(2)|endometrium(1)|salivary_gland(1)|prostate(1)	GRCh37	CM942135	TP53	M	rs148924904						53.0	54.0	53.0					17																	7578442		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.488A>G	17.37:g.7578442T>C	ENSP00000269305:p.Tyr163Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y163C	ENST00000269305.4	37	c.488	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.54	2.567047	0.45694	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.59	3.32	0.38043	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.062225	0.64402	D	0.000003	D	0.99746	0.9899	M	0.70595	2.14	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.996;0.999;0.983;0.999;1.0;0.999;0.994	D	0.98089	1.0408	10	0.87932	D	0	-16.6607	9.5833	0.39501	0.2797:0.0:0.0:0.7203	.	124;163;163;70;163;163;163	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	163;163;163;163;163;163;152;70;31;70;31;163	ENSP00000410739:Y163C;ENSP00000352610:Y163C;ENSP00000269305:Y163C;ENSP00000398846:Y163C;ENSP00000391127:Y163C;ENSP00000391478:Y163C;ENSP00000425104:Y31C;ENSP00000423862:Y70C;ENSP00000424104:Y163C	ENSP00000269305:Y163C	Y	-	2	0	TP53	7519167	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	5.141000	0.64814	0.446000	0.26666	0.533000	0.62120	TAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.622	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	18	0	T	NM_000546		7578442	-1	tier1	rs148924904	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	50.00	13	13	SNP	1.000	C
TRIM49B	283116	genome.wustl.edu	37	11	49059204	49059204	+	Missense_Mutation	SNP	T	T	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:49059204T>A	ENST00000332682.7	+	7	1062	c.1034T>A	c.(1033-1035)gTc>gAc	p.V345D		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	345	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						TACTGGGAGGTCCATGTAGGG	0.443																																																	0																																										SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.1034T>A	11.37:g.49059204T>A	ENSP00000330216:p.Val345Asp			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.V345D	ENST00000332682.7	37	c.1034	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848195	0.32699	.	.	ENSG00000182053	ENST00000332682	T	0.77229	-1.08	0.689	0.689	0.18033	.	.	.	.	.	D	0.88760	0.6524	H	0.96996	3.92	0.25673	N	0.985871	.	.	.	.	.	.	T	0.79662	-0.1710	6	0.87932	D	0	.	.	.	.	.	.	.	.	D	345	ENSP00000330216:V345D	ENSP00000330216:V345D	V	+	2	0	AC084851.1	49015780	0.850000	0.29656	0.013000	0.15412	0.029000	0.11900	1.211000	0.32382	0.539000	0.28788	0.155000	0.16302	GTC	TRIM49B	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000182053		0.443	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		-	0.00	201	0	T			49059204	+1	tier1	-	no_errors	ENST00000332682	ensembl	human	known	74_37	missense	15.76	139	26	SNP	0.524	A
TTN	7273	genome.wustl.edu	37	2	179486304	179486304	+	Silent	SNP	G	G	T	rs199834143		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:179486304G>T	ENST00000591111.1	-	195	40548	c.40324C>A	c.(40324-40326)Cgg>Agg	p.R13442R	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000342992.6_Silent_p.R12515R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.R6018R|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.R6143R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Silent_p.R6210R|TTN_ENST00000589042.1_Silent_p.R15083R|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13442	Ig-like 90.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTCTCTTCCGTCCTTCAGTC	0.463																																																	0													138.0	136.0	137.0					2																	179486304		2000	4177	6177	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40324C>A	2.37:g.179486304G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R12515	ENST00000591111.1	37	c.37543		2																																																																																			TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	36	0	G	NM_133378		179486304	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.489	T
TXNL4A	10907	genome.wustl.edu	37	18	77733717	77733717	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr18:77733717G>A	ENST00000269601.5	-	3	597	c.397C>T	c.(397-399)Ccc>Tcc	p.P133S	TXNL4A_ENST00000592957.1_Missense_Mutation_p.P62S|TXNL4A_ENST00000588162.1_3'UTR|TXNL4A_ENST00000592837.1_Missense_Mutation_p.P62S|TXNL4A_ENST00000585474.1_Missense_Mutation_p.P62S	NM_006701.2	NP_006692.1	P83876	TXN4A_HUMAN	thioredoxin-like 4A	133					gene expression (GO:0010467)|mitotic nuclear division (GO:0007067)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)				breast(1)|large_intestine(1)|lung(3)	5		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TAGTCCTTGGGGGACACCACC	0.557																																					Ovarian(160;2333 2597 11821 36245)												0													95.0	95.0	95.0					18																	77733717		2203	4300	6503	SO:0001583	missense	0			AF023612	CCDS32852.1	18q23	2013-07-16	2004-08-11	2004-08-12		ENSG00000141759			30551	protein-coding gene	gene with protein product	"""similar to S. pombe dim1+"""	611595	"""thioredoxin-like 4"""	TXNL4		11015569	Standard	NM_006701		Approved	U5-15kD, DIM1, HsT161, DIB1, SNRNP15	uc002lnp.3	P83876		ENST00000269601.5:c.397C>T	18.37:g.77733717G>A	ENSP00000269601:p.Pro133Ser		B2RC18|O14834	Missense_Mutation	SNP	pfam_mRNA_splic_U5,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5	p.P133S	ENST00000269601.5	37	c.397	CCDS32852.1	18	.	.	.	.	.	.	.	.	.	.	G	34	5.303751	0.95601	.	.	ENSG00000141759	ENST00000269601	.	.	.	5.76	5.76	0.90799	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.84543	0.5495	H	0.97829	4.085	0.80722	D	1	P	0.45902	0.868	P	0.47206	0.541	D	0.89680	0.3890	9	0.87932	D	0	-32.4977	19.9113	0.97025	0.0:0.0:1.0:0.0	.	133	P83876	TXN4A_HUMAN	S	133	.	ENSP00000269601:P133S	P	-	1	0	TXNL4A	75834705	1.000000	0.71417	0.856000	0.33681	0.984000	0.73092	8.118000	0.89577	2.876000	0.98609	0.655000	0.94253	CCC	TXNL4A	-	pfam_mRNA_splic_U5,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5	ENSG00000141759		0.557	TXNL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNL4A	HGNC	protein_coding	OTTHUMT00000451036.1	-	0.00	48	0	G	NM_006701		77733717	-1	tier1	-	no_errors	ENST00000269601	ensembl	human	known	74_37	missense	31.82	30	14	SNP	1.000	A
UBAP2L	9898	genome.wustl.edu	37	1	154215741	154215741	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:154215741C>G	ENST00000361546.2	+	9	847	c.805C>G	c.(805-807)Ctg>Gtg	p.L269V	UBAP2L_ENST00000428931.1_Missense_Mutation_p.L269V|UBAP2L_ENST00000271877.7_Missense_Mutation_p.L280V|UBAP2L_ENST00000343815.6_Missense_Mutation_p.L269V			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	269					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTCAGTGCCTCTGCCTGCGGA	0.448																																																	0													215.0	195.0	202.0					1																	154215741		2203	4300	6503	SO:0001583	missense	0			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.805C>G	1.37:g.154215741C>G	ENSP00000355343:p.Leu269Val		B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.L269V	ENST00000361546.2	37	c.805	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	C	7.464	0.645194	0.14451	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000412596;ENST00000368504;ENST00000437652;ENST00000361546	T;T;T;T;T;T;T	0.45276	2.69;2.69;2.69;0.93;0.9;0.94;2.69	4.8	4.8	0.61643	.	0.278187	0.30869	N	0.008706	T	0.08358	0.0208	N	0.02011	-0.69	0.33909	D	0.639441	B;B;B;B;B	0.29136	0.004;0.234;0.007;0.007;0.004	B;B;B;B;B	0.25506	0.002;0.061;0.005;0.005;0.002	T	0.09143	-1.0688	10	0.15499	T	0.54	-4.477	17.0462	0.86504	0.0:1.0:0.0:0.0	.	183;280;262;269;269	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	V	269;269;280;269;280;262;269	ENSP00000345308:L269V;ENSP00000389445:L269V;ENSP00000271877:L280V;ENSP00000389052:L269V;ENSP00000357490:L280V;ENSP00000389717:L262V;ENSP00000355343:L269V	ENSP00000271877:L280V	L	+	1	2	UBAP2L	152482365	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.031000	0.41117	2.504000	0.84457	0.650000	0.86243	CTG	UBAP2L	-	NULL	ENSG00000143569		0.448	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	-	0.00	83	0	C	NM_014847		154215741	+1	tier1	-	no_errors	ENST00000361546	ensembl	human	known	74_37	missense	49.23	33	32	SNP	1.000	G
UBQLN4	56893	genome.wustl.edu	37	1	156018300	156018300	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:156018300G>T	ENST00000368309.3	-	5	984	c.892C>A	c.(892-894)Cgg>Agg	p.R298R	UBQLN4_ENST00000472638.1_5'UTR	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	298				R -> Q (in Ref. 1; AAF80171). {ECO:0000305}.	regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					ACCTGTTCCCGGGCAGCACTG	0.622																																																	0													43.0	41.0	42.0					1																	156018300		2203	4300	6503	SO:0001819	synonymous_variant	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.892C>A	1.37:g.156018300G>T			A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Silent	SNP	pfam_Ubiquitin_dom,pfam_UBA/Ts_N,pfam_Rad60/SUMO_like,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.R298	ENST00000368309.3	37	c.892	CCDS1127.1	1																																																																																			UBQLN4	-	NULL	ENSG00000160803		0.622	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	-	0.00	51	0	G	NM_020131		156018300	-1	tier1	-	no_errors	ENST00000368309	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.976	T
UNC13C	440279	genome.wustl.edu	37	15	54307496	54307496	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:54307496C>G	ENST00000260323.11	+	1	2396	c.2396C>G	c.(2395-2397)tCt>tGt	p.S799C	UNC13C_ENST00000537900.1_Missense_Mutation_p.S799C|UNC13C_ENST00000545554.1_Missense_Mutation_p.S799C	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	799					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAATTTGGATCTACACTGCAG	0.443																																																	0													83.0	78.0	79.0					15																	54307496		1918	4114	6032	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2396C>G	15.37:g.54307496C>G	ENSP00000260323:p.Ser799Cys		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.S799C	ENST00000260323.11	37	c.2396	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553547	0.65425	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83250	-1.7;-1.69;-1.7	5.69	5.69	0.88448	.	.	.	.	.	D	0.87212	0.6121	L	0.29908	0.895	0.58432	D	0.999991	D	0.89917	1.0	D	0.83275	0.996	D	0.88426	0.3032	9	0.87932	D	0	.	18.7937	0.91985	0.0:1.0:0.0:0.0	.	799	Q8NB66	UN13C_HUMAN	C	799	ENSP00000260323:S799C;ENSP00000438156:S799C;ENSP00000442569:S799C	ENSP00000260323:S799C	S	+	2	0	UNC13C	52094788	1.000000	0.71417	0.997000	0.53966	0.857000	0.48899	5.673000	0.68109	2.681000	0.91329	0.650000	0.86243	TCT	UNC13C	-	NULL	ENSG00000137766		0.443	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	40	0	C	NM_173166		54307496	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	G
UNC13C	440279	genome.wustl.edu	37	15	54542505	54542505	+	Missense_Mutation	SNP	C	C	T	rs563857639		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:54542505C>T	ENST00000260323.11	+	7	3311	c.3311C>T	c.(3310-3312)aCg>aTg	p.T1104M	UNC13C_ENST00000537900.1_Missense_Mutation_p.T1102M|UNC13C_ENST00000545554.1_Missense_Mutation_p.T1104M	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1104					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAGGTCTGGACGGCTACCACA	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		18437	0.0		0.0	False		,,,				2504	0.001																0													113.0	107.0	109.0					15																	54542505		2106	4263	6369	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3311C>T	15.37:g.54542505C>T	ENSP00000260323:p.Thr1104Met		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1104M	ENST00000260323.11	37	c.3311	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709299	0.89018	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.93488	-3.23;-3.23;-3.23	5.56	5.56	0.83823	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.052260	0.85682	D	0.000000	D	0.96552	0.8875	M	0.89030	3	0.58432	D	0.999999	D	0.71674	0.998	P	0.55871	0.786	D	0.97095	0.9793	10	0.87932	D	0	.	18.5213	0.90954	0.0:1.0:0.0:0.0	.	1104	Q8NB66	UN13C_HUMAN	M	1104;1104;1102	ENSP00000260323:T1104M;ENSP00000438156:T1104M;ENSP00000442569:T1102M	ENSP00000260323:T1104M	T	+	2	0	UNC13C	52329797	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	7.800000	0.85949	2.626000	0.88956	0.650000	0.86243	ACG	UNC13C	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000137766		0.498	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	35	0	C	NM_173166		54542505	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	T
UNC13C	440279	genome.wustl.edu	37	15	54614270	54614270	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr15:54614270C>G	ENST00000260323.11	+	13	4402	c.4402C>G	c.(4402-4404)Cga>Gga	p.R1468G	UNC13C_ENST00000537900.1_Missense_Mutation_p.R1466G|UNC13C_ENST00000545554.1_Missense_Mutation_p.R1468G	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1468					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGCCTCAGATCGATTTGCTGC	0.388																																																	0													78.0	72.0	74.0					15																	54614270		1861	4079	5940	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4402C>G	15.37:g.54614270C>G	ENSP00000260323:p.Arg1468Gly		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R1468G	ENST00000260323.11	37	c.4402	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957697	0.53400	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.81078	-1.45;-1.45;-1.45	5.7	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.89719	0.6796	M	0.83483	2.645	0.58432	D	0.999997	P;D	0.89917	0.869;1.0	P;D	0.81914	0.756;0.995	D	0.90666	0.4594	10	0.56958	D	0.05	.	14.4317	0.67254	0.2658:0.7342:0.0:0.0	.	1468;1468	F5H090;Q8NB66	.;UN13C_HUMAN	G	1468;1468;1466	ENSP00000260323:R1468G;ENSP00000438156:R1468G;ENSP00000442569:R1466G	ENSP00000260323:R1468G	R	+	1	2	UNC13C	52401562	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	3.181000	0.50903	1.378000	0.46305	0.650000	0.86243	CGA	UNC13C	-	NULL	ENSG00000137766		0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	76	0	C	NM_173166		54614270	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	13.73	44	7	SNP	1.000	G
UPB1	51733	genome.wustl.edu	37	22	24896222	24896222	+	Silent	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:24896222C>A	ENST00000326010.5	+	2	596	c.252C>A	c.(250-252)ccC>ccA	p.P84P	UPB1_ENST00000382760.2_Silent_p.P84P|UPB1_ENST00000413389.2_Intron	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	84	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					TCCCCCTCCCCGCAAATGCCC	0.562																																																	0													63.0	67.0	66.0					22																	24896222		2203	4300	6503	SO:0001819	synonymous_variant	0			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.252C>A	22.37:g.24896222C>A			A3KMF8|Q9UIR3	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.P84	ENST00000326010.5	37	c.252	CCDS13827.1	22																																																																																			UPB1	-	superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000100024		0.562	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	HGNC	protein_coding	OTTHUMT00000319869.1	-	0.00	20	0	C			24896222	+1	tier1	-	no_errors	ENST00000326010	ensembl	human	known	74_37	silent	47.62	11	10	SNP	0.001	A
USP24	23358	genome.wustl.edu	37	1	55643796	55643796	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:55643796C>T	ENST00000294383.6	-	2	333	c.334G>A	c.(334-336)Gag>Aag	p.E112K	USP24_ENST00000407756.1_Intron	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	112					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TTTCCATTCTCATCATTCTTC	0.348																																																	0													112.0	103.0	106.0					1																	55643796		692	1591	2283	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.334G>A	1.37:g.55643796C>T	ENSP00000294383:p.Glu112Lys		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.E112K	ENST00000294383.6	37	c.334	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	32	5.158309	0.94686	.	.	ENSG00000162402	ENST00000294383	T	0.02472	4.28	5.72	5.72	0.89469	.	0.060741	0.64402	D	0.000007	T	0.11410	0.0278	L	0.60455	1.87	0.80722	D	1	.	.	.	.	.	.	T	0.00492	-1.1707	8	0.45353	T	0.12	.	19.869	0.96843	0.0:1.0:0.0:0.0	.	.	.	.	K	112	ENSP00000294383:E112K	ENSP00000294383:E112K	E	-	1	0	USP24	55416384	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.463000	0.80869	2.709000	0.92574	0.591000	0.81541	GAG	USP24	-	NULL	ENSG00000162402		0.348	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	-	0.00	189	0	C			55643796	-1	tier1	-	no_errors	ENST00000294383	ensembl	human	novel	74_37	missense	17.10	160	33	SNP	1.000	T
USP36	57602	genome.wustl.edu	37	17	76795028	76795028	+	Missense_Mutation	SNP	C	C	T	rs201438220	byFrequency	TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr17:76795028C>T	ENST00000542802.3	-	19	3645	c.3202G>A	c.(3202-3204)Gtg>Atg	p.V1068M	USP36_ENST00000449938.2_Missense_Mutation_p.V673M|USP36_ENST00000312010.6_Missense_Mutation_p.V1068M			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1066					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TCATCAACCACGGTCTCAGTC	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		19870	0.002		0.0	False		,,,				2504	0.0																0													323.0	252.0	276.0					17																	76795028		2203	4300	6503	SO:0001583	missense	0			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.3202G>A	17.37:g.76795028C>T	ENSP00000441214:p.Val1068Met		Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.V1068M	ENST00000542802.3	37	c.3202	CCDS32755.1	17	.	.	.	.	.	.	.	.	.	.	c	16.34	3.094478	0.56075	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802	T;T;T	0.45276	0.9;0.9;0.9	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000003	T	0.65780	0.2724	M	0.74258	2.255	0.47659	D	0.999487	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.69120	-0.5229	10	0.72032	D	0.01	-18.8464	16.8481	0.85986	0.0:1.0:0.0:0.0	.	1068;673	Q9P275-2;E9PEW0	.;.	M	1068;673;1068	ENSP00000310590:V1068M;ENSP00000401119:V673M;ENSP00000441214:V1068M	ENSP00000310590:V1068M	V	-	1	0	USP36	74306623	0.989000	0.36119	0.054000	0.19295	0.024000	0.10985	2.854000	0.48325	2.509000	0.84616	0.552000	0.68991	GTG	USP36	-	NULL	ENSG00000055483		0.587	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP36	HGNC	protein_coding	OTTHUMT00000437472.3		0.00	34	0	C	NM_025090		76795028	-1			no_errors	ENST00000312010	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.997	T
USP6NL	9712	genome.wustl.edu	37	10	11505038	11505038	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:11505038G>A	ENST00000609104.1	-	15	2283	c.1889C>T	c.(1888-1890)cCc>cTc	p.P630L	USP6NL_ENST00000379237.2_Missense_Mutation_p.P653L|USP6NL_ENST00000277575.5_Missense_Mutation_p.P647L	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	630					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						GCTGTAGGAGGGGGGATGAGC	0.512																																																	0													47.0	47.0	47.0					10																	11505038		1927	4139	6066	SO:0001583	missense	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1889C>T	10.37:g.11505038G>A	ENSP00000476462:p.Pro630Leu		A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P653L	ENST00000609104.1	37	c.1958	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882783	0.91740	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.19250	2.16;2.2	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000005	T	0.48223	0.1488	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.33369	-0.9871	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	630;647	Q92738;Q92738-2	US6NL_HUMAN;.	L	630;647;630	ENSP00000277575:P647L;ENSP00000368539:P630L	ENSP00000277575:P647L	P	-	2	0	USP6NL	11545044	1.000000	0.71417	0.087000	0.20705	0.023000	0.10783	7.708000	0.84633	2.873000	0.98535	0.563000	0.77884	CCC	USP6NL	-	NULL	ENSG00000148429		0.512	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3	-	0.00	106	0	G	NM_014688		11505038	-1	tier1	-	no_errors	ENST00000379237	ensembl	human	known	74_37	missense	25.00	57	19	SNP	0.987	A
VPS13D	55187	genome.wustl.edu	37	1	12378163	12378163	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr1:12378163C>A	ENST00000358136.3	+	31	7313	c.7183C>A	c.(7183-7185)Ctc>Atc	p.L2395I	VPS13D_ENST00000356315.4_Missense_Mutation_p.L2395I	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TACAGTAGTTCTCAACAATCT	0.353																																																	0													185.0	187.0	186.0					1																	12378163		2203	4300	6503	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7183C>A	1.37:g.12378163C>A	ENSP00000350854:p.Leu2395Ile			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.L2395I	ENST00000358136.3	37	c.7183	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.164392|4.164392	0.78339|0.78339	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.52526	.|0.66;0.66	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	.|0.138572	.|0.47455	.|D	.|0.000240	T|T	0.65396|0.65396	0.2687|0.2687	M|M	0.77486|0.77486	2.375|2.375	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.997;0.997;0.994	.|D;D;D	.|0.78314	.|0.991;0.981;0.957	T|T	0.61816|0.61816	-0.6985|-0.6985	5|10	.|0.18710	.|T	.|0.47	.|.	12.4834|12.4834	0.55856|0.55856	0.0:0.9231:0.0:0.0769|0.0:0.9231:0.0:0.0769	.|.	.|302;2395;2395	.|B1AJZ2;Q5THJ4-2;Q5THJ4	.|.;.;VP13D_HUMAN	L|I	1217|2395	.|ENSP00000348666:L2395I;ENSP00000350854:L2395I	.|ENSP00000348666:L2395I	F|L	+|+	3|1	2|0	VPS13D|VPS13D	12300750|12300750	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.071000|3.071000	0.50041|0.50041	2.574000|2.574000	0.86865|0.86865	0.563000|0.563000	0.77884|0.77884	TTC|CTC	VPS13D	-	NULL	ENSG00000048707		0.353	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	52	0	C	NM_015378		12378163	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	26.09	34	12	SNP	1.000	A
WAC	51322	genome.wustl.edu	37	10	28821727	28821727	+	5'Flank	SNP	C	C	G	rs541145912		TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr10:28821727C>G	ENST00000354911.4	+	0	0				WAC_ENST00000375646.1_5'UTR|WAC-AS1_ENST00000528337.1_RNA|WAC_ENST00000428935.1_5'Flank|WAC_ENST00000532233.1_3'UTR|WAC-AS1_ENST00000527986.1_RNA|WAC_ENST00000375664.4_5'UTR|WAC_ENST00000347934.4_5'Flank	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil						cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						TGGCTTCCCTCGCGCCCCACC	0.711													C|||	1	0.000199681	0.0	0.0	5008	,	,		11192	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001631	upstream_gene_variant	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872		10.37:g.28821727C>G	Exception_encountered		A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	RNA	SNP	-	NULL	ENST00000354911.4	37	NULL	CCDS7159.1	10																																																																																			WAC	-	-	ENSG00000095787		0.711	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	-	0.00	83	0	C	NM_100264		28821727	+1	tier1	-	no_errors	ENST00000528491	ensembl	human	known	74_37	rna	28.95	27	11	SNP	0.137	G
WSCD2	9671	genome.wustl.edu	37	12	108618549	108618549	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr12:108618549G>A	ENST00000332082.4	+	6	1534	c.716G>A	c.(715-717)aGg>aAg	p.R239K	WSCD2_ENST00000261400.3_Missense_Mutation_p.R239K|WSCD2_ENST00000547525.1_Missense_Mutation_p.R239K|WSCD2_ENST00000549903.1_Missense_Mutation_p.R239K			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	239	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TGCTTCCGCAGGCCCGACAAC	0.537																																																	0													68.0	72.0	71.0					12																	108618549		1921	4135	6056	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.716G>A	12.37:g.108618549G>A	ENSP00000331933:p.Arg239Lys		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.R239K	ENST00000332082.4	37	c.716	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	G	1.657	-0.512389	0.04200	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.39	3.59	0.41128	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.094648	0.64402	N	0.000002	T	0.35566	0.0936	L	0.43152	1.355	0.37043	D	0.897227	B	0.30179	0.271	B	0.34652	0.187	T	0.18840	-1.0324	10	0.06099	T	0.92	-32.0901	9.3512	0.38140	0.2313:0.0:0.7687:0.0	.	239	Q2TBF2	WSCD2_HUMAN	K	239;239;86;239;239	ENSP00000448047:R239K;ENSP00000261400:R239K;ENSP00000446744:R86K;ENSP00000331933:R239K;ENSP00000447272:R239K	ENSP00000261400:R239K	R	+	2	0	WSCD2	107142679	0.604000	0.26932	0.917000	0.36280	0.298000	0.27526	1.039000	0.30266	0.855000	0.35359	-0.126000	0.14955	AGG	WSCD2	-	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.537	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	-	0.00	16	0	G	NM_014653		108618549	+1	tier1	-	no_errors	ENST00000261400	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.992	A
XIST	7503	genome.wustl.edu	37	X	73070744	73070744	+	lincRNA	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chrX:73070744G>A	ENST00000429829.1	-	0	1844					NR_001564.2				X inactive specific transcript (non-protein coding)																		AGGTGGAAAGGCTAAATGTCC	0.527																																																	0													23.0	21.0	22.0					X																	73070744		875	1991	2866			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73070744G>A				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.527	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	-	0.00	52	0	G	NR_001564		73070744	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	43.33	17	13	SNP	0.000	A
ZAK	51776	genome.wustl.edu	37	2	174074471	174074471	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:174074471C>G	ENST00000375213.3	+	10	837	c.759C>G	c.(757-759)ttC>ttG	p.F253L	MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000338983.3_Missense_Mutation_p.F253L|MLTK_ENST00000409176.2_Missense_Mutation_p.F253L|MLK7-AS1_ENST00000423106.2_RNA|MLTK_ENST00000539448.1_Missense_Mutation_p.F253L|MLK7-AS1_ENST00000419609.1_RNA|MLTK_ENST00000431503.2_Missense_Mutation_p.F152L	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										GGCCATCATTCAAGCAAATCA	0.408																																																	0													109.0	98.0	102.0					2																	174074471		2203	4300	6503	SO:0001583	missense	0																														ENST00000375213.3:c.759C>G	2.37:g.174074471C>G	ENSP00000364361:p.Phe253Leu		B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F253L	ENST00000375213.3	37	c.759	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858691	0.91433	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000431503;ENST00000375213	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	5.97	5.09	0.68999	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.041761	0.85682	D	0.000000	D	0.90669	0.7073	L	0.53249	1.67	0.80722	D	1	P;P;D;P;P	0.69078	0.911;0.891;0.997;0.911;0.604	P;P;P;P;B	0.61070	0.672;0.543;0.883;0.672;0.218	D	0.91652	0.5335	10	0.87932	D	0	.	15.3335	0.74231	0.0:0.933:0.0:0.067	.	253;253;253;253;253	A8K710;Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;.;MLTK_HUMAN;.;.	L	253;253;253;152;253	ENSP00000439414:F253L;ENSP00000387259:F253L;ENSP00000340257:F253L;ENSP00000399787:F152L;ENSP00000364361:F253L	ENSP00000340257:F253L	F	+	3	2	AC013461.1	173782717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.784000	0.47774	1.535000	0.49220	0.591000	0.81541	TTC	MLTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000091436		0.408	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Uniprot_gn	protein_coding	OTTHUMT00000255401.1	-	0.00	31	0	C			174074471	+1	tier1	-	no_errors	ENST00000375213	ensembl	human	known	74_37	missense	52.94	8	9	SNP	1.000	G
XRCC5	7520	genome.wustl.edu	37	2	217024864	217024864	+	Missense_Mutation	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:217024864G>T	ENST00000392133.3	+	17	2205	c.1744G>T	c.(1744-1746)Gct>Tct	p.A582S	XRCC5_ENST00000392132.2_Missense_Mutation_p.A582S			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	582					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		CTCCAGTCTGGCTGAAGGCAG	0.453								Non-homologous end-joining																																									0													79.0	81.0	80.0					2																	217024864		2203	4300	6503	SO:0001583	missense	0			AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1744G>T	2.37:g.217024864G>T	ENSP00000375978:p.Ala582Ser		A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	pfam_Ku_N,pfam_Ku_PK_bind,pfam_Ku70/Ku80_beta-barrel_dom,pfam_Ku_C,superfamily_SPOC_like_C_dom,superfamily_Ku_PK_bind,smart_VWF_A,smart_Ku70/Ku80_beta-barrel_dom	p.A582S	ENST00000392133.3	37	c.1744	CCDS2402.1	2	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729102	0.30684	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.30182	1.54;1.54	5.2	5.2	0.72013	Ku, C-terminal (2);	0.194134	0.45867	D	0.000331	T	0.30293	0.0760	M	0.64997	1.995	0.41269	D	0.986839	B	0.18741	0.03	B	0.17098	0.017	T	0.11767	-1.0574	10	0.08599	T	0.76	.	15.6013	0.76628	0.0:0.0:1.0:0.0	.	582	P13010	XRCC5_HUMAN	S	582	ENSP00000375978:A582S;ENSP00000375977:A582S	ENSP00000375977:A582S	A	+	1	0	XRCC5	216733109	1.000000	0.71417	0.997000	0.53966	0.308000	0.27856	4.205000	0.58466	2.708000	0.92522	0.563000	0.77884	GCT	XRCC5	-	superfamily_Ku_PK_bind	ENSG00000079246		0.453	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC5	HGNC	protein_coding	OTTHUMT00000256675.3	-	0.00	85	0	G	NM_021141		217024864	+1	tier1	-	no_errors	ENST00000392132	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	T
ZC3H13	23091	genome.wustl.edu	37	13	46538007	46538010	+	Frame_Shift_Del	DEL	TTTC	TTTC	-			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	TTTC	TTTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr13:46538007_46538010delTTTC	ENST00000242848.4	-	17	4987_4990	c.4639_4642delGAAA	c.(4639-4644)gaaacafs	p.ET1547fs	ZC3H13_ENST00000378921.2_Frame_Shift_Del_p.ET503fs|ZC3H13_ENST00000282007.3_Frame_Shift_Del_p.ET1548fs			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1547							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CTCTGACATGTTTCTTTGACTTTG	0.382																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0																																										SO:0001589	frameshift_variant	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.4639_4642delGAAA	13.37:g.46538007_46538010delTTTC	ENSP00000242848:p.Glu1547fs		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Frame_Shift_Del	DEL	pfam_Znf_CCCH,smart_Znf_CCCH	p.E1547fs	ENST00000242848.4	37	c.4642_4639		13																																																																																			ZC3H13	-	NULL	ENSG00000123200		0.382	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1		0.00	102	0	TTTC	NM_015070		46538010	-1	tier1		no_errors	ENST00000242848	ensembl	human	known	74_37	frame_shift_del	18.75	65	15	DEL	1.000:1.000:1.000:1.000	-
ZDBF2	57683	genome.wustl.edu	37	2	207172018	207172018	+	Silent	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:207172018C>A	ENST00000374423.3	+	5	3152	c.2766C>A	c.(2764-2766)atC>atA	p.I922I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	922							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						ATTATAATATCATTTTTCATT	0.313																																																	0													37.0	36.0	36.0					2																	207172018		1848	4084	5932	SO:0001819	synonymous_variant	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2766C>A	2.37:g.207172018C>A			Q6ZNP7|Q6ZSN8	Silent	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.I922	ENST00000374423.3	37	c.2766	CCDS46501.1	2																																																																																			ZDBF2	-	NULL	ENSG00000204186		0.313	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	-	0.00	66	0	C	NM_020923		207172018	+1	tier1	-	no_errors	ENST00000374423	ensembl	human	known	74_37	silent	22.45	38	11	SNP	0.000	A
ZDBF2	57683	genome.wustl.edu	37	2	207174923	207174923	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr2:207174923C>G	ENST00000374423.3	+	5	6057	c.5671C>G	c.(5671-5673)Caa>Gaa	p.Q1891E		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1891							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TGCACCAACTCAAGCTGTGTC	0.433																																																	0													57.0	56.0	57.0					2																	207174923		2004	4171	6175	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5671C>G	2.37:g.207174923C>G	ENSP00000363545:p.Gln1891Glu		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.Q1891E	ENST00000374423.3	37	c.5671	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333594	0.24167	.	.	ENSG00000204186	ENST00000374423	T	0.48836	0.8	5.49	2.39	0.29439	.	.	.	.	.	T	0.35393	0.0930	L	0.50333	1.59	0.09310	N	1	B	0.34290	0.447	B	0.32393	0.145	T	0.29366	-1.0014	9	0.44086	T	0.13	.	2.8216	0.05473	0.2414:0.4316:0.2364:0.0906	.	1891	Q9HCK1	ZDBF2_HUMAN	E	1891	ENSP00000363545:Q1891E	ENSP00000363545:Q1891E	Q	+	1	0	ZDBF2	206883168	0.406000	0.25344	0.192000	0.23308	0.028000	0.11728	0.100000	0.15231	1.302000	0.44855	0.558000	0.71614	CAA	ZDBF2	-	NULL	ENSG00000204186		0.433	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	-	0.00	40	0	C	NM_020923		207174923	+1	tier1	-	no_errors	ENST00000374423	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.301	G
ZDHHC8P1	150244	genome.wustl.edu	37	22	23744334	23744334	+	RNA	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:23744334G>A	ENST00000255890.4	-	0	215									zinc finger, DHHC-type containing 8 pseudogene 1																		GGTCCAGGCTGCCCTTGGACT	0.657																																																	0																																												0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23744334G>A				RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.657	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	-	0.00	84	0	G	NR_003950		23744334	-1	tier1	-	no_errors	ENST00000255890	ensembl	human	known	74_37	rna	5.41	70	4	SNP	1.000	A
ZFP91	80829	genome.wustl.edu	37	11	58384873	58384873	+	Silent	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:58384873C>T	ENST00000316059.6	+	11	1578	c.1407C>T	c.(1405-1407)ctC>ctT	p.L469L	ZFP91-CNTF_ENST00000389919.4_Silent_p.L469L	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	469					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CAGGCGCCCTCATCACCAGCA	0.532																																																	0													57.0	52.0	54.0					11																	58384873		2201	4295	6496	SO:0001819	synonymous_variant	0			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1407C>T	11.37:g.58384873C>T			A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L469	ENST00000316059.6	37	c.1407	CCDS31553.1	11																																																																																			ZFP91	-	NULL	ENSG00000186660		0.532	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP91	HGNC	protein_coding	OTTHUMT00000268674.1	-	0.00	15	0	C	NM_053023		58384873	+1	tier1	-	no_errors	ENST00000316059	ensembl	human	known	74_37	silent	38.71	19	12	SNP	1.000	T
ZHX1	11244	genome.wustl.edu	37	8	124265591	124265591	+	Missense_Mutation	SNP	G	G	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:124265591G>A	ENST00000522655.1	-	3	3136	c.2596C>T	c.(2596-2598)Cgg>Tgg	p.R866W	ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Missense_Mutation_p.R866W|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Missense_Mutation_p.R866W			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	866	Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GACAGCTTCCGTTTCACATGT	0.378																																																	0													192.0	184.0	187.0					8																	124265591		2203	4300	6503	SO:0001583	missense	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2596C>T	8.37:g.124265591G>A	ENSP00000428821:p.Arg866Trp		Q8IWD8	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.R866W	ENST00000522655.1	37	c.2596	CCDS6342.1	8	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660631	0.67586	.	.	ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655	T;T;T	0.28666	1.6;1.6;1.6	5.95	5.06	0.68205	.	0.082877	0.48286	D	0.000190	T	0.40145	0.1105	.	.	.	0.49130	D	0.999759	D	0.67145	0.996	P	0.46885	0.53	T	0.44436	-0.9328	9	0.87932	D	0	-6.3926	16.4882	0.84190	0.0:0.0:0.8678:0.1322	.	866	Q9UKY1	ZHX1_HUMAN	W	866	ENSP00000297857:R866W;ENSP00000378938:R866W;ENSP00000428821:R866W	ENSP00000297857:R866W	R	-	1	2	ZHX1	124334772	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.203000	0.58453	1.502000	0.48669	0.491000	0.48974	CGG	ZHX1	-	NULL	ENSG00000165156		0.378	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	-	0.00	70	0	G			124265591	-1	tier1	-	no_errors	ENST00000297857	ensembl	human	known	74_37	missense	7.21	103	8	SNP	1.000	A
ZNF250	58500	genome.wustl.edu	37	8	146115388	146115388	+	Silent	SNP	G	G	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr8:146115388G>T	ENST00000292579.7	-	3	230	c.114C>A	c.(112-114)cgC>cgA	p.R38R	ZNF250_ENST00000543949.1_Silent_p.R38R|ZNF250_ENST00000342660.6_Silent_p.R33R|ZNF250_ENST00000417550.2_Silent_p.R33R	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		CAGGGCACAGGCGGTCCCATT	0.537																																					NSCLC(16;520 556 24096 40084 43446)												0													63.0	52.0	56.0					8																	146115388		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.114C>A	8.37:g.146115388G>T			D3DWP1|Q59HE9|Q8N942|Q96AH9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R38	ENST00000292579.7	37	c.114	CCDS34972.1	8																																																																																			ZNF250	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000196150		0.537	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF250	HGNC	protein_coding	OTTHUMT00000382968.1	-	0.00	47	0	G	NM_021061		146115388	-1	tier1	-	no_errors	ENST00000292579	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.045	T
ZPR1	8882	genome.wustl.edu	37	11	116652907	116652907	+	Missense_Mutation	SNP	C	C	G			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr11:116652907C>G	ENST00000227322.3	-	12	1205	c.1146G>C	c.(1144-1146)gaG>gaC	p.E382D		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		382					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CCTGTAGTCTCTCCGTCTGTC	0.468																																																	0													118.0	97.0	104.0					11																	116652907		2201	4296	6497	SO:0001583	missense	0																														ENST00000227322.3:c.1146G>C	11.37:g.116652907C>G	ENSP00000227322:p.Glu382Asp		Q2TAA0	Missense_Mutation	SNP	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	p.E382D	ENST00000227322.3	37	c.1146	CCDS8375.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.093|9.093	1.002302|1.002302	0.19121|0.19121	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000429220	T|T	0.44482|0.44083	0.92|0.93	6.02|6.02	1.4|1.4	0.22301|0.22301	Zinc finger, ZPR1-type (3);|.	0.236003|0.236003	0.49305|0.49305	N|N	0.000152|0.000152	T|T	0.34629|0.34629	0.0904|0.0904	L|L	0.55743|0.55743	1.74|1.74	0.47511|0.47511	D|D	0.999443|0.999443	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.08472|0.08472	-1.0720|-1.0720	10|8	0.23891|0.13853	T|T	0.37|0.58	-7.993|-7.993	3.0479|3.0479	0.06160|0.06160	0.1147:0.4477:0.226:0.2116|0.1147:0.4477:0.226:0.2116	.|.	382|.	O75312|.	ZPR1_HUMAN|.	D|Q	382|309	ENSP00000227322:E382D|ENSP00000394495:E309Q	ENSP00000227322:E382D|ENSP00000394495:E309Q	E|E	-|-	3|1	2|0	ZNF259|ZNF259	116158117|116158117	0.999000|0.999000	0.42202|0.42202	0.935000|0.935000	0.37517|0.37517	0.228000|0.228000	0.25075|0.25075	0.786000|0.786000	0.26844|0.26844	0.395000|0.395000	0.25257|0.25257	0.655000|0.655000	0.94253|0.94253	GAG|GAG	ZNF259	-	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	ENSG00000109917		0.468	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	HGNC	protein_coding	OTTHUMT00000106283.2	-	0.00	63	0	C			116652907	-1	tier1	-	no_errors	ENST00000227322	ensembl	human	known	74_37	missense	32.61	31	15	SNP	0.986	G
ZNF292	23036	genome.wustl.edu	37	6	87965877	87965877	+	Missense_Mutation	SNP	C	C	A			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr6:87965877C>A	ENST00000369577.3	+	8	2573	c.2530C>A	c.(2530-2532)Caa>Aaa	p.Q844K	ZNF292_ENST00000339907.4_Missense_Mutation_p.Q839K	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	844						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TCCTGAAGCCCAACTTAATTC	0.418																																																	0													49.0	47.0	48.0					6																	87965877		1956	4154	6110	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2530C>A	6.37:g.87965877C>A	ENSP00000358590:p.Gln844Lys		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q844K	ENST00000369577.3	37	c.2530	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	4.846	0.157230	0.09236	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.06768	3.26;3.27	5.83	5.83	0.93111	.	0.428449	0.28001	N	0.016989	T	0.01489	0.0048	N	0.08118	0	0.32429	N	0.548239	B	0.17038	0.02	B	0.16722	0.016	T	0.35201	-0.9798	10	0.06365	T	0.9	.	14.9023	0.70689	0.0:0.7388:0.2612:0.0	.	844	O60281	ZN292_HUMAN	K	844;839	ENSP00000358590:Q844K;ENSP00000342847:Q839K	ENSP00000342847:Q839K	Q	+	1	0	ZNF292	88022596	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	2.288000	0.43514	2.756000	0.94617	0.655000	0.94253	CAA	ZNF292	-	NULL	ENSG00000188994		0.418	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	42	0	C	NM_015021		87965877	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	33.33	14	7	SNP	1.000	A
ZNF79	7633	genome.wustl.edu	37	9	130206956	130206956	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr9:130206956C>T	ENST00000342483.5	+	5	1383	c.977C>T	c.(976-978)aCt>aTt	p.T326I	ZNF79_ENST00000543471.1_Missense_Mutation_p.T302I	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	326					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						CATCAGAGGACTCACACCGGG	0.557																																																	0													114.0	104.0	107.0					9																	130206956		2203	4300	6503	SO:0001583	missense	0			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.977C>T	9.37:g.130206956C>T	ENSP00000362446:p.Thr326Ile		Q5VVW1|Q96NV1	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T326I	ENST00000342483.5	37	c.977	CCDS6871.1	9	.	.	.	.	.	.	.	.	.	.	C	0.070	-1.204084	0.01581	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	T;T	0.12672	2.66;2.66	3.83	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06416	0.0165	N	0.25094	0.71	0.24000	N	0.996219	B	0.31548	0.328	B	0.28011	0.085	T	0.33007	-0.9885	9	0.02654	T	1	.	5.0421	0.14463	0.0:0.6654:0.2169:0.1177	.	326	Q15937	ZNF79_HUMAN	I	326;302	ENSP00000362446:T326I;ENSP00000438418:T302I	ENSP00000362446:T326I	T	+	2	0	ZNF79	129246777	0.000000	0.05858	0.998000	0.56505	0.816000	0.46133	0.058000	0.14301	0.823000	0.34589	0.655000	0.94253	ACT	ZNF79	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196152		0.557	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF79	HGNC	protein_coding	OTTHUMT00000054188.1	-	0.00	64	0	C	NM_007135		130206956	+1	tier1	-	no_errors	ENST00000342483	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.970	T
ZNF804B	219578	genome.wustl.edu	37	7	88847592	88847592	+	Missense_Mutation	SNP	G	G	C			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr7:88847592G>C	ENST00000333190.4	+	2	841	c.232G>C	c.(232-234)Gac>Cac	p.D78H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	78							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAATTCTTATGACCATGCTCA	0.368										HNSCC(36;0.09)																																							0													89.0	86.0	87.0					7																	88847592		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.232G>C	7.37:g.88847592G>C	ENSP00000329638:p.Asp78His		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.D78H	ENST00000333190.4	37	c.232	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455737	0.84209	.	.	ENSG00000182348	ENST00000333190	T	0.16457	2.34	5.31	5.31	0.75309	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000003	T	0.48352	0.1495	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51772	-0.8663	10	0.87932	D	0	-14.1974	19.1711	0.93578	0.0:0.0:1.0:0.0	.	78	A4D1E1	Z804B_HUMAN	H	78	ENSP00000329638:D78H	ENSP00000329638:D78H	D	+	1	0	ZNF804B	88685528	1.000000	0.71417	0.999000	0.59377	0.911000	0.54048	9.657000	0.98554	2.774000	0.95407	0.484000	0.47621	GAC	ZNF804B	-	pfam_Znf_C2H2_jaz	ENSG00000182348		0.368	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	55	0	G	NM_181646		88847592	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	C
ZNF91	7644	genome.wustl.edu	37	19	23544910	23544910	+	Missense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr19:23544910C>T	ENST00000300619.7	-	4	1076	c.871G>A	c.(871-873)Gag>Aag	p.E291K	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.E259K	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	291					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TAGGGTTTCTCTCCAGTGTGT	0.383																																																	0													89.0	95.0	93.0					19																	23544910		2196	4291	6487	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.871G>A	19.37:g.23544910C>T	ENSP00000300619:p.Glu291Lys		A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E291K	ENST00000300619.7	37	c.871	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248344	0.39697	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.24350	1.86;1.86	1.56	1.56	0.23342	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24774	0.0601	L	0.31664	0.95	0.32459	N	0.544348	D;D	0.61697	0.987;0.99	P;P	0.50405	0.507;0.64	T	0.34403	-0.9830	9	0.51188	T	0.08	.	10.0684	0.42317	0.0:1.0:0.0:0.0	.	259;291	Q05481-2;Q05481	.;ZNF91_HUMAN	K	291;259	ENSP00000300619:E291K;ENSP00000380272:E259K	ENSP00000300619:E291K	E	-	1	0	ZNF91	23336750	0.733000	0.28132	0.012000	0.15200	0.002000	0.02628	1.848000	0.39309	0.854000	0.35336	0.162000	0.16502	GAG	ZNF91	-	pfscan_Znf_C2H2	ENSG00000167232		0.383	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	-	0.00	99	0	C	NM_003430		23544910	-1	tier1	-	no_errors	ENST00000300619	ensembl	human	known	74_37	missense	13.79	75	12	SNP	1.000	T
ZNRF3	84133	genome.wustl.edu	37	22	29446744	29446744	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VR-AA7B-01A-31D-A403-09	TCGA-VR-AA7B-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bbffd8c8-f1a8-43d1-8064-a79678d11b20	f279b1d8-e75b-468c-b25d-587804a7ea13	g.chr22:29446744C>T	ENST00000544604.2	+	8	2750	c.2575C>T	c.(2575-2577)Cga>Tga	p.R859*	ZNRF3_ENST00000402174.1_Nonsense_Mutation_p.R759*|ZNRF3_ENST00000332811.4_Nonsense_Mutation_p.R759*|ZNRF3_ENST00000406323.3_Nonsense_Mutation_p.R759*	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	859					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GGGTGGGACGCGAGGCCCGGA	0.697																																																	0													11.0	13.0	12.0					22																	29446744		1901	4105	6006	SO:0001587	stop_gained	0			AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.2575C>T	22.37:g.29446744C>T	ENSP00000443824:p.Arg859*		B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R859*	ENST00000544604.2	37	c.2575	CCDS56225.1	22	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046598	0.75846	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	.	.	.	5.61	3.44	0.39384	.	1.507060	0.04173	N	0.325138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	0.1821	8.5855	0.33655	0.0:0.74:0.0:0.26	.	.	.	.	X	859;759;566;759;759	.	ENSP00000328614:R759X	R	+	1	2	ZNRF3	27776744	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.456000	0.21859	0.662000	0.31006	-0.345000	0.07892	CGA	ZNRF3	-	NULL	ENSG00000183579		0.697	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNRF3	HGNC	protein_coding	OTTHUMT00000320943.2	-	0.00	76	0	C	XM_290972		29446744	+1	tier1	-	no_errors	ENST00000544604	ensembl	human	known	74_37	nonsense	44.29	39	31	SNP	0.001	T
