#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA2	20	genome.wustl.edu	37	9	139904091	139904091	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:139904091C>A	ENST00000371605.3	-	43	6780	c.6633G>T	c.(6631-6633)gaG>gaT	p.E2211D	ABCA2_ENST00000265662.5_Missense_Mutation_p.E2212D|ABCA2_ENST00000341511.6_Missense_Mutation_p.E2212D			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2211	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CTGTGGTGGGCTCGTCCTGGG	0.642																																																	0													56.0	69.0	65.0					9																	139904091		2188	4293	6481	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.6633G>T	9.37:g.139904091C>A	ENSP00000360666:p.Glu2211Asp		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E2212D	ENST00000371605.3	37	c.6636		9	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543376	0.65198	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000398210;ENST00000355090;ENST00000341511	D;D;D	0.98602	-5.02;-5.02;-5.02	3.42	2.51	0.30379	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.332844	0.29760	N	0.011275	D	0.98317	0.9442	H	0.97516	4.02	0.49389	D	0.999784	P;P	0.45634	0.773;0.863	B;B	0.42495	0.389;0.389	D	0.97553	1.0093	10	0.87932	D	0	.	9.5109	0.39076	0.0:0.8146:0.0:0.1854	.	2211;2242	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	D	2212;2211;113;2242;2212	ENSP00000265662:E2212D;ENSP00000360666:E2211D;ENSP00000344155:E2212D	ENSP00000265662:E2212D	E	-	3	2	ABCA2	139023912	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	1.806000	0.38892	0.772000	0.33382	0.491000	0.48974	GAG	ABCA2	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000107331		0.642	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	129	0	C	NM_001606		139904091	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	missense	53.70	25	29	SNP	1.000	A
ACAP2	23527	genome.wustl.edu	37	3	195006581	195006581	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:195006581C>T	ENST00000326793.6	-	22	2410	c.2180G>A	c.(2179-2181)cGt>cAt	p.R727H		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	727					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TCTTGCTAAACGTAACCTAAA	0.279																																																	0													108.0	97.0	101.0					3																	195006581		2202	4299	6501	SO:0001583	missense	0				CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.2180G>A	3.37:g.195006581C>T	ENSP00000324287:p.Arg727His		A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R727H	ENST00000326793.6	37	c.2180	CCDS33924.1	3	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710788	0.89112	.	.	ENSG00000114331	ENST00000326793	T	0.34072	1.38	5.93	5.93	0.95920	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.70923	-0.4740	10	0.87932	D	0	.	19.3347	0.94312	0.0:1.0:0.0:0.0	.	727	Q15057	ACAP2_HUMAN	H	727	ENSP00000324287:R727H	ENSP00000324287:R727H	R	-	2	0	ACAP2	196487870	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.433000	0.80362	2.798000	0.96311	0.655000	0.94253	CGT	ACAP2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000114331		0.279	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP2	HGNC	protein_coding	OTTHUMT00000342126.2	-	0.00	40	0	C	NM_012287		195006581	-1	tier1	-	no_errors	ENST00000326793	ensembl	human	known	74_37	missense	50.00	20	20	SNP	1.000	T
ACOT11	26027	genome.wustl.edu	37	1	55070098	55070098	+	Missense_Mutation	SNP	G	G	T	rs146094962		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:55070098G>T	ENST00000371316.3	+	12	1314	c.1232G>T	c.(1231-1233)aGt>aTt	p.S411I	ACOT11_ENST00000343744.2_Missense_Mutation_p.S411I|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	411	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						TCGGAGATCAGTCAGGTAGCT	0.502																																					Ovarian(148;1440 1861 22015 32453 51933)												0													107.0	87.0	94.0					1																	55070098		2203	4300	6503	SO:0001583	missense	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.1232G>T	1.37:g.55070098G>T	ENSP00000360366:p.Ser411Ile		B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.S411I	ENST00000371316.3	37	c.1232	CCDS592.1	1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501604	0.26949	.	.	ENSG00000162390	ENST00000343744;ENST00000371316	D;D	0.84589	-1.87;-1.87	5.01	-3.2	0.05156	Lipid-binding START (3);START-like domain (1);	0.337825	0.35320	N	0.003281	T	0.76111	0.3942	N	0.22421	0.69	0.09310	N	1	B;B	0.34103	0.437;0.063	B;B	0.40477	0.33;0.093	T	0.67221	-0.5725	10	0.48119	T	0.1	-16.6474	13.1087	0.59261	0.814:0.0:0.186:0.0	.	411;411	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	I	411	ENSP00000340260:S411I;ENSP00000360366:S411I	ENSP00000340260:S411I	S	+	2	0	ACOT11	54842686	0.515000	0.26210	0.042000	0.18584	0.637000	0.38172	1.199000	0.32235	-1.216000	0.02607	-1.945000	0.00491	AGT	ACOT11	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	ENSG00000162390		0.502	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1		0.00	39	0	G	NM_015547		55070098	+1			no_errors	ENST00000371316	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.101	T
ACP5	54	genome.wustl.edu	37	19	11687567	11687567	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:11687567G>T	ENST00000592828.1	-	5	755	c.353C>A	c.(352-354)tCt>tAt	p.S118Y	ACP5_ENST00000412435.2_Missense_Mutation_p.S118Y|ACP5_ENST00000590420.1_Intron|ACP5_ENST00000433365.2_Missense_Mutation_p.S118Y|ACP5_ENST00000218758.5_Missense_Mutation_p.S118Y	NM_001111034.1	NP_001104504.1	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	118					bone morphogenesis (GO:0060349)|bone resorption (GO:0045453)|defense response to Gram-positive bacterium (GO:0050830)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of superoxide anion generation (GO:0032929)|negative regulation of tumor necrosis factor production (GO:0032720)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	acid phosphatase activity (GO:0003993)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)	p.S118I(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	9						AATCTGGGCAGAGACATTGCC	0.572																																																	1	Substitution - Missense(1)	lung(1)											177.0	168.0	171.0					19																	11687567		2203	4300	6503	SO:0001583	missense	0			X14618	CCDS12265.1	19p13.2	2012-10-02			ENSG00000102575	ENSG00000102575	3.1.3.2		124	protein-coding gene	gene with protein product	"""tartrate-resistant acid phosphatase"""	171640				8449511, 2338077	Standard	NM_001611		Approved	TRAP	uc002msj.4	P13686	OTTHUMG00000182036	ENST00000592828.1:c.353C>A	19.37:g.11687567G>T	ENSP00000468767:p.Ser118Tyr		A8K3V2|Q2TAB1|Q6IAS6|Q9UCJ5|Q9UCJ6|Q9UCJ7	Missense_Mutation	SNP	pfam_PEstase_dom	p.S118Y	ENST00000592828.1	37	c.353	CCDS12265.1	19	.	.	.	.	.	.	.	.	.	.	g	13.26	2.185253	0.38609	.	.	ENSG00000102575	ENST00000218758;ENST00000412435;ENST00000433365	T;T;T	0.71698	-0.59;-0.59;-0.59	5.04	4.0	0.46444	Metallophosphoesterase domain (1);	0.190687	0.45606	D	0.000345	T	0.80660	0.4665	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.81754	-0.0788	10	0.66056	D	0.02	-7.6342	12.3404	0.55091	0.0846:0.0:0.9154:0.0	.	118	P13686	PPA5_HUMAN	Y	118	ENSP00000218758:S118Y;ENSP00000392374:S118Y;ENSP00000413456:S118Y	ENSP00000218758:S118Y	S	-	2	0	ACP5	11548567	0.983000	0.35010	0.624000	0.29186	0.002000	0.02628	2.262000	0.43285	1.116000	0.41820	-0.136000	0.14681	TCT	ACP5	-	pfam_PEstase_dom	ENSG00000102575		0.572	ACP5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACP5	HGNC	protein_coding	OTTHUMT00000458881.1		0.00	36	0	G			11687567	-1			no_errors	ENST00000218758	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.834	T
ADNP	23394	genome.wustl.edu	37	20	49509522	49509522	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:49509522C>T	ENST00000396029.3	-	5	2296	c.1729G>A	c.(1729-1731)Gaa>Aaa	p.E577K	ADNP_ENST00000349014.3_Missense_Mutation_p.E577K|ADNP_ENST00000396032.3_Missense_Mutation_p.E577K|ADNP_ENST00000371602.4_Missense_Mutation_p.E577K	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	577					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GCAACAGATTCAGCTGGGGCA	0.438																																																	0													152.0	150.0	150.0					20																	49509522		2203	4300	6503	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1729G>A	20.37:g.49509522C>T	ENSP00000379346:p.Glu577Lys		E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E577K	ENST00000396029.3	37	c.1729	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423205	0.83559	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.75	5.75	0.90469	.	0.046453	0.85682	D	0.000000	T	0.54727	0.1876	L	0.29908	0.895	0.80722	D	1	B	0.22080	0.064	B	0.20767	0.031	T	0.47235	-0.9133	9	0.40728	T	0.16	-8.3139	19.9474	0.97186	0.0:1.0:0.0:0.0	.	577	Q9H2P0	ADNP_HUMAN	K	577	.	ENSP00000342905:E577K	E	-	1	0	ADNP	48942929	1.000000	0.71417	0.985000	0.45067	0.992000	0.81027	7.423000	0.80229	2.710000	0.92621	0.650000	0.86243	GAA	ADNP	-	NULL	ENSG00000101126		0.438	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	-	0.00	69	0	C	NM_181442		49509522	-1	tier1	-	no_errors	ENST00000349014	ensembl	human	known	74_37	missense	28.57	80	32	SNP	1.000	T
AFF4	27125	genome.wustl.edu	37	5	132270120	132270120	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:132270120G>T	ENST00000265343.5	-	3	1016	c.637C>A	c.(637-639)Cct>Act	p.P213T	AFF4_ENST00000491831.1_5'UTR|AFF4_ENST00000378595.3_Missense_Mutation_p.P213T	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	213	Ser-rich.				spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGGTCCCGAGGTGATTTGGAG	0.483																																					Ovarian(126;889 1733 2942 10745 11605)												0													113.0	107.0	109.0					5																	132270120		2203	4300	6503	SO:0001583	missense	0			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.637C>A	5.37:g.132270120G>T	ENSP00000265343:p.Pro213Thr		B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P213T	ENST00000265343.5	37	c.637	CCDS4164.1	5	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310844	0.81358	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.67171	-0.25;-0.25	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.82609	0.5074	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	T	0.82242	-0.0554	10	0.51188	T	0.08	-11.5401	19.876	0.96870	0.0:0.0:1.0:0.0	.	213;213;213	Q9UHB7-3;Q9UHB7-2;Q9UHB7	.;.;AFF4_HUMAN	T	213	ENSP00000265343:P213T;ENSP00000367858:P213T	ENSP00000265343:P213T	P	-	1	0	AFF4	132298019	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.743000	0.98849	2.704000	0.92352	0.557000	0.71058	CCT	AFF4	-	pfam_TF_AF4/FMR2	ENSG00000072364		0.483	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	HGNC	protein_coding	OTTHUMT00000133049.1		0.00	60	0	G	NM_014423		132270120	-1			no_errors	ENST00000265343	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
AGO2	27161	genome.wustl.edu	37	8	141567319	141567319	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:141567319C>T	ENST00000220592.5	-	8	1007	c.895G>A	c.(895-897)Gag>Aag	p.E299K	AGO2_ENST00000519980.1_Missense_Mutation_p.E299K	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	299	PAZ. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										TGCCCGCTCTCCTGCTGCAGC	0.587																																																	0													86.0	89.0	88.0					8																	141567319		2203	4300	6503	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.895G>A	8.37:g.141567319C>T	ENSP00000220592:p.Glu299Lys		Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.E299K	ENST00000220592.5	37	c.895	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219604	0.79464	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.09817	2.94;2.94	5.01	4.13	0.48395	Argonaute/Dicer protein, PAZ (4);	0.099165	0.64402	D	0.000002	T	0.17959	0.0431	L	0.52905	1.665	0.80722	D	1	B;B	0.27656	0.184;0.056	B;B	0.40982	0.331;0.345	T	0.03463	-1.1034	10	0.40728	T	0.16	-9.4511	13.5454	0.61699	0.0:0.9239:0.0:0.0761	.	299;299	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	K	299	ENSP00000220592:E299K;ENSP00000430176:E299K	ENSP00000220592:E299K	E	-	1	0	EIF2C2	141636501	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.671000	0.83941	1.220000	0.43490	0.655000	0.94253	GAG	AGO2	-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom	ENSG00000123908		0.587	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO2	HGNC	protein_coding	OTTHUMT00000377866.4	-	0.00	62	0	C			141567319	-1	tier1	-	no_errors	ENST00000220592	ensembl	human	known	74_37	missense	30.91	38	17	SNP	1.000	T
AKAP6	9472	genome.wustl.edu	37	14	33291681	33291681	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:33291681G>C	ENST00000280979.4	+	13	4832	c.4662G>C	c.(4660-4662)caG>caC	p.Q1554H	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1554					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CTGGCATGCAGAATGCCAAAC	0.403																																					Melanoma(49;821 1200 7288 13647 42351)												0													115.0	121.0	119.0					14																	33291681		2203	4300	6503	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4662G>C	14.37:g.33291681G>C	ENSP00000280979:p.Gln1554His		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.Q1554H	ENST00000280979.4	37	c.4662	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	G	7.831	0.719774	0.15372	.	.	ENSG00000151320	ENST00000280979	T	0.05717	3.4	5.79	2.9	0.33743	.	0.471953	0.22481	N	0.059500	T	0.08133	0.0203	M	0.65975	2.015	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08186	-1.0734	10	0.54805	T	0.06	-2.411	6.656	0.22988	0.2503:0.1286:0.6211:0.0	.	1554	Q13023	AKAP6_HUMAN	H	1554	ENSP00000280979:Q1554H	ENSP00000280979:Q1554H	Q	+	3	2	AKAP6	32361432	0.971000	0.33674	1.000000	0.80357	0.987000	0.75469	-0.001000	0.12947	0.771000	0.33359	0.650000	0.86243	CAG	AKAP6	-	NULL	ENSG00000151320		0.403	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	-	0.00	29	0	G	NM_004274		33291681	+1	tier1	-	no_errors	ENST00000280979	ensembl	human	known	74_37	missense	16.90	59	12	SNP	1.000	C
ALS2CR11	151254	genome.wustl.edu	37	2	202357836	202357836	+	Intron	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:202357836G>C	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439140.1_Missense_Mutation_p.F1076L|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						AAAAAACATTGAAGATGTTTT	0.274																																																	0													15.0	13.0	13.0					2																	202357836		691	1549	2240	SO:0001627	intron_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+2781C>G	2.37:g.202357836G>C			C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_dom	p.F1076L	ENST00000286195.3	37	c.3228	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448716	0.26074	.	.	ENSG00000155754	ENST00000439140	T	0.59638	0.25	5.69	-1.12	0.09808	.	.	.	.	.	T	0.28466	0.0704	N	0.17474	0.49	0.09310	N	0.999998	B	0.20052	0.041	B	0.20184	0.028	T	0.24799	-1.0150	9	0.02654	T	1	.	1.7218	0.02913	0.3713:0.146:0.3413:0.1414	.	1076	E9PGG4	.	L	1076	ENSP00000409937:F1076L	ENSP00000409937:F1076L	F	-	3	2	ALS2CR11	202066081	0.000000	0.05858	0.004000	0.12327	0.472000	0.32918	0.007000	0.13174	-0.427000	0.07350	-0.484000	0.04775	TTC	ALS2CR11	-	NULL	ENSG00000155754		0.274	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	-	0.00	48	0	G	NM_152525		202357836	-1	tier1	-	no_errors	ENST00000439140	ensembl	human	novel	74_37	missense	59.52	17	25	SNP	0.002	C
AMPD1	270	genome.wustl.edu	37	1	115219977	115219977	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:115219977C>T	ENST00000520113.2	-	10	1497	c.1482G>A	c.(1480-1482)agG>agA	p.R494R	AMPD1_ENST00000353928.6_Silent_p.R461R|AMPD1_ENST00000369538.3_Silent_p.R490R			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	494					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CATACTAGATCCTGGGAACCT	0.512																																																	0													126.0	111.0	116.0					1																	115219977		2203	4300	6503	SO:0001819	synonymous_variant	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1482G>A	1.37:g.115219977C>T			A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.R494	ENST00000520113.2	37	c.1482	CCDS876.2	1																																																																																			AMPD1	-	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.512	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	-	0.00	58	0	C			115219977	-1	tier1	-	no_errors	ENST00000520113	ensembl	human	known	74_37	silent	20.83	57	15	SNP	1.000	T
ANK1	286	genome.wustl.edu	37	8	41566347	41566347	+	Silent	SNP	C	C	T	rs375243297		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:41566347C>T	ENST00000347528.4	-	17	2030	c.1947G>A	c.(1945-1947)gaG>gaA	p.E649E	ANK1_ENST00000396942.1_Silent_p.E649E|ANK1_ENST00000265709.8_Silent_p.E682E|ANK1_ENST00000396945.1_Silent_p.E649E|ANK1_ENST00000289734.7_Silent_p.E649E|ANK1_ENST00000379758.2_Silent_p.E649E|ANK1_ENST00000352337.4_Silent_p.E649E	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	649	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GAGCCACCATCTCTGCGTGGC	0.612																																																	0								C	,,,,	0,4406		0,0,2203	127.0	113.0	118.0		1947,2046,1947,1947,1947	-4.9	0.8	8		118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ANK1	NM_000037.3,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	649/1881,682/1898,649/1857,649/1882,649/1720	41566347	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1947G>A	8.37:g.41566347C>T			A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.E649	ENST00000347528.4	37	c.1947	CCDS6119.1	8																																																																																			ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.612	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	-	0.00	39	0	C	NM_020475		41566347	-1	tier1	-	no_errors	ENST00000396942	ensembl	human	known	74_37	silent	27.66	34	13	SNP	0.937	T
ANKRD26	22852	genome.wustl.edu	37	10	27349452	27349452	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:27349452G>A	ENST00000376087.4	-	14	1645	c.1480C>T	c.(1480-1482)Ctt>Ttt	p.L494F	ANKRD26_ENST00000436985.2_Missense_Mutation_p.L510F	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	494					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TTCAAGTGAAGATATCTCTCA	0.254																																																	0													20.0	19.0	19.0					10																	27349452		1800	4031	5831	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1480C>T	10.37:g.27349452G>A	ENSP00000365255:p.Leu494Phe		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L510F	ENST00000376087.4	37	c.1528	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	G	7.904	0.735101	0.15574	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.31510	1.49;1.53	4.88	1.91	0.25777	.	4.276560	0.01613	U	0.022648	T	0.22166	0.0534	N	0.19112	0.55	0.09310	N	1	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.18618	-1.0331	10	0.48119	T	0.1	.	4.8809	0.13679	0.2664:0.1552:0.5784:0.0	.	494;494;510	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	F	494;510	ENSP00000365255:L494F;ENSP00000405112:L510F	ENSP00000365255:L494F	L	-	1	0	ANKRD26	27389458	0.000000	0.05858	0.000000	0.03702	0.216000	0.24613	0.004000	0.13106	0.096000	0.17463	0.305000	0.20034	CTT	ANKRD26	-	NULL	ENSG00000107890		0.254	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	-	0.00	42	0	G			27349452	-1	tier1	-	no_errors	ENST00000436985	ensembl	human	known	74_37	missense	67.27	18	37	SNP	0.000	A
ANKRD36C	400986	genome.wustl.edu	37	2	96587555	96587555	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:96587555G>C	ENST00000456556.1	-	33	2231	c.2147C>G	c.(2146-2148)tCt>tGt	p.S716C	ANKRD36C_ENST00000419039.2_5'UTR|ANKRD36C_ENST00000420871.2_5'UTR|ANKRD36C_ENST00000295246.5_5'UTR			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	716							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TTTCTGAGAAGACACTGAAAA	0.318																																																	0																																										SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.2147C>G	2.37:g.96587555G>C	ENSP00000403302:p.Ser716Cys		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S716C	ENST00000456556.1	37	c.2147		2	.	.	.	.	.	.	.	.	.	.	g	8.803	0.933296	0.18131	.	.	ENSG00000174501	ENST00000456556	T	0.78126	-1.15	0.564	0.564	0.17302	.	.	.	.	.	T	0.80314	0.4600	M	0.74881	2.28	0.09310	N	1	.	.	.	.	.	.	T	0.71431	-0.4595	6	0.87932	D	0	.	.	.	.	.	.	.	.	C	716	ENSP00000403302:S716C	ENSP00000403302:S716C	S	-	2	0	AC073995.2	95951282	0.008000	0.16893	0.004000	0.12327	0.048000	0.14542	1.211000	0.32382	0.599000	0.29845	0.194000	0.17425	TCT	ANKRD36C	-	NULL	ENSG00000174501		0.318	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	-	0.00	61	0	G	NM_001010914		96587555	-1	tier1	-	no_errors	ENST00000456556	ensembl	human	known	74_37	missense	14.66	99	17	SNP	0.004	C
ANXA5	308	genome.wustl.edu	37	4	122593740	122593740	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:122593740T>A	ENST00000296511.5	-	9	858	c.573A>T	c.(571-573)gaA>gaT	p.E191D	ANXA5_ENST00000515017.1_Missense_Mutation_p.E91D|ANXA5_ENST00000501272.2_Missense_Mutation_p.E131D	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	191					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						TAAACTTTTCTTCATCTGTCC	0.363																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)												0													97.0	91.0	93.0					4																	122593740		2203	4299	6502	SO:0001583	missense	0			U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.573A>T	4.37:g.122593740T>A	ENSP00000296511:p.Glu191Asp		D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinV,prints_AnnexinIV	p.E191D	ENST00000296511.5	37	c.573	CCDS3720.1	4	.	.	.	.	.	.	.	.	.	.	T	23.0	4.366385	0.82463	.	.	ENSG00000164111	ENST00000296511;ENST00000512232;ENST00000501272;ENST00000515017	T;T;T	0.04654	3.58;3.58;3.58	5.88	2.24	0.28232	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.19525	0.0469	M	0.83953	2.67	0.53688	D	0.999976	D;D;D;D	0.89917	0.999;0.998;1.0;0.998	D;D;D;D	0.97110	0.984;0.998;1.0;0.998	T	0.00304	-1.1832	10	0.87932	D	0	.	8.92	0.35605	0.0:0.2127:0.0:0.7873	.	91;131;191;191	D6RBE9;D6RBL5;E7ENQ5;P08758	.;.;.;ANXA5_HUMAN	D	191;191;131;91	ENSP00000296511:E191D;ENSP00000424106:E131D;ENSP00000424199:E91D	ENSP00000296511:E191D	E	-	3	2	ANXA5	122813190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.051000	0.30417	0.496000	0.27904	0.533000	0.62120	GAA	ANXA5	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin	ENSG00000164111		0.363	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA5	HGNC	protein_coding	OTTHUMT00000256636.2	-	0.00	70	0	T	NM_001154		122593740	-1	tier1	-	no_errors	ENST00000296511	ensembl	human	known	74_37	missense	11.40	101	13	SNP	1.000	A
APOD	347	genome.wustl.edu	37	3	195306288	195306288	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:195306288G>A	ENST00000343267.3	-	2	406	c.45C>T	c.(43-45)ttC>ttT	p.F15F		NM_001647.3	NP_001638.1	P05090	APOD_HUMAN	apolipoprotein D	15			F -> S (in dbSNP:rs5952). {ECO:0000269|PubMed:10391209}.		aging (GO:0007568)|angiogenesis (GO:0001525)|brain development (GO:0007420)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of lipoprotein lipid oxidation (GO:0060588)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of T cell migration (GO:2000405)|peripheral nervous system axon regeneration (GO:0014012)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to reactive oxygen species (GO:0000302)|tissue regeneration (GO:0042246)	cytosolic ribosome (GO:0022626)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTGCCGCACCGAAGAGGCCAG	0.577																																																	0													42.0	45.0	44.0					3																	195306288		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33925.1	3q29	2013-09-19			ENSG00000189058	ENSG00000189058		"""Lipocalins"", ""Apolipoproteins"""	612	protein-coding gene	gene with protein product		107740				2439269, 3453108	Standard	NM_001647		Approved		uc003fur.2	P05090	OTTHUMG00000155854	ENST00000343267.3:c.45C>T	3.37:g.195306288G>A			B2R579|D3DNW6|Q6IBG6	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_Triabin_pallidipin/procalin,superfamily_Calycin-like,pirsf_Lipocalin_ApoD,prints_ApolipopD,prints_Invtbrt_color,prints_Lipocalin,prints_Lipocalin_bac	p.F15	ENST00000343267.3	37	c.45	CCDS33925.1	3																																																																																			APOD	-	pirsf_Lipocalin_ApoD	ENSG00000189058		0.577	APOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOD	HGNC	protein_coding	OTTHUMT00000342004.1	-	0.00	61	0	G	NM_001647		195306288	-1	tier1	-	no_errors	ENST00000343267	ensembl	human	known	74_37	silent	32.65	33	16	SNP	0.000	A
ARHGEF9	23229	genome.wustl.edu	37	X	62944429	62944429	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:62944429G>T	ENST00000253401.6	-	2	972	c.172C>A	c.(172-174)Cct>Act	p.P58T	ARHGEF9_ENST00000374878.1_Missense_Mutation_p.P56T|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.P37T|ARHGEF9_ENST00000374870.4_Intron|ARHGEF9_ENST00000437457.2_Intron|ARHGEF9_ENST00000495564.1_5'UTR	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	58	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						AAGCTGGCAGGAAACCATCCC	0.542																																																	0													136.0	88.0	105.0					X																	62944429		2203	4300	6503	SO:0001583	missense	0			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.172C>A	X.37:g.62944429G>T	ENSP00000253401:p.Pro58Thr		A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.P58T	ENST00000253401.6	37	c.172	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927793	0.73327	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000374872	D;D;D	0.99454	-5.92;-5.92;-5.92	5.55	4.68	0.58851	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.99757	0.9902	H	0.99555	4.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97102	0.9798	10	0.62326	D	0.03	.	12.5526	0.56236	0.0853:0.0:0.9147:0.0	.	56;58	B1AMR4;O43307	.;ARHG9_HUMAN	T	58;56;37	ENSP00000253401:P58T;ENSP00000364012:P56T;ENSP00000364006:P37T	ENSP00000253401:P58T	P	-	1	0	ARHGEF9	62861154	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.626000	0.83164	2.310000	0.77875	0.550000	0.68814	CCT	ARHGEF9	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000131089		0.542	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1		0.00	34	0	G			62944429	-1			no_errors	ENST00000253401	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
BBS12	166379	genome.wustl.edu	37	4	123664621	123664621	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:123664621G>A	ENST00000314218.3	+	2	1767	c.1574G>A	c.(1573-1575)cGt>cAt	p.R525H	BBS12_ENST00000542236.1_Missense_Mutation_p.R525H	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	525			R -> H (in BBS12). {ECO:0000269|PubMed:21344540}.		cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)	p.R525H(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						TGTGCCTATCGTTTGTATTAT	0.403									Bardet-Biedl syndrome																																								1	Substitution - Missense(1)	lung(1)											142.0	141.0	141.0					4																	123664621		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1574G>A	4.37:g.123664621G>A	ENSP00000319062:p.Arg525His		D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.R525H	ENST00000314218.3	37	c.1574	CCDS3728.1	4	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185315	0.78677	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	T;T	0.78364	-1.17;-1.17	5.71	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.78830	0.4345	M	0.74258	2.255	0.58432	D	0.999998	D	0.53745	0.962	B	0.43386	0.418	T	0.81525	-0.0893	10	0.56958	D	0.05	-49.8867	14.6692	0.68932	0.0695:0.0:0.9305:0.0	.	525	Q6ZW61	BBS12_HUMAN	H	525	ENSP00000319062:R525H;ENSP00000438273:R525H	ENSP00000319062:R525H	R	+	2	0	BBS12	123884071	1.000000	0.71417	0.148000	0.22405	0.899000	0.52679	8.808000	0.91939	1.419000	0.47118	-0.229000	0.12294	CGT	BBS12	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000181004		0.403	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS12	HGNC	protein_coding	OTTHUMT00000256710.1	-	0.00	45	0	G	NM_152618		123664621	+1	tier1	-	no_errors	ENST00000314218	ensembl	human	known	74_37	missense	28.57	30	12	SNP	0.994	A
BTBD3	22903	genome.wustl.edu	37	20	11904297	11904297	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:11904297C>T	ENST00000405977.1	+	5	2177	c.1552C>T	c.(1552-1554)Ctt>Ttt	p.L518F	BTBD3_ENST00000378226.2_Missense_Mutation_p.L518F|BTBD3_ENST00000254977.3_Missense_Mutation_p.L457F|BTBD3_ENST00000399006.2_Missense_Mutation_p.L457F	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	518					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						GATCCCTGAACTTATATTCTA	0.478																																																	0													110.0	102.0	105.0					20																	11904297		2203	4300	6503	SO:0001583	missense	0			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.1552C>T	20.37:g.11904297C>T	ENSP00000384545:p.Leu518Phe		D3DW19|Q5JY73	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.L518F	ENST00000405977.1	37	c.1552	CCDS13113.1	20	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322472	0.81580	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226	D;D;D;D	0.84589	-1.8;-1.8;-1.87;-1.87	5.98	5.98	0.97165	PHR (1);	0.000000	0.85682	D	0.000000	D	0.92499	0.7618	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.92464	0.5980	10	0.87932	D	0	.	19.5094	0.95135	0.0:1.0:0.0:0.0	.	518	Q9Y2F9	BTBD3_HUMAN	F	457;457;518;518	ENSP00000254977:L457F;ENSP00000381971:L457F;ENSP00000384545:L518F;ENSP00000367471:L518F	ENSP00000254977:L457F	L	+	1	0	BTBD3	11852297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.815000	0.86186	2.861000	0.98227	0.650000	0.86243	CTT	BTBD3	-	pfam_PHR	ENSG00000132640		0.478	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	HGNC	protein_coding	OTTHUMT00000078021.3		0.00	53	0	C			11904297	+1			no_errors	ENST00000378226	ensembl	human	known	74_37	missense	15.69	43	8	SNP	1.000	T
BPIFB4	149954	genome.wustl.edu	37	20	31680384	31680384	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:31680384A>G	ENST00000375483.3	+	9	1264	c.1264A>G	c.(1264-1266)Atg>Gtg	p.M422V		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	422						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CCAGCTGGCCATGTCTGCCAA	0.582																																																	0													95.0	87.0	89.0					20																	31680384		2203	4300	6503	SO:0001583	missense	0			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1264A>G	20.37:g.31680384A>G	ENSP00000364632:p.Met422Val		Q5TDX6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.M422V	ENST00000375483.3	37	c.1264	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	A	0.899	-0.722941	0.03158	.	.	ENSG00000186191	ENST00000375483	T	0.04454	3.62	5.35	4.25	0.50352	.	0.246812	0.35013	N	0.003504	T	0.01454	0.0047	N	0.00554	-1.385	0.21841	N	0.999518	B	0.02656	0.0	B	0.01281	0.0	T	0.46331	-0.9199	9	.	.	.	-8.8996	9.7302	0.40357	0.8258:0.1742:0.0:0.0	.	422	P59827	BPIB4_HUMAN	V	422	ENSP00000364632:M422V	.	M	+	1	0	BPIFB4	31144045	1.000000	0.71417	1.000000	0.80357	0.151000	0.21798	2.408000	0.44574	0.969000	0.38237	-0.465000	0.05216	ATG	BPIFB4	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000186191		0.582	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	-	0.00	13	0	A	NM_182519		31680384	+1	tier1	-	no_errors	ENST00000375483	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	G
C10orf35	219738	genome.wustl.edu	37	10	71391541	71391541	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:71391541C>T	ENST00000373279.4	+	3	201	c.42C>T	c.(40-42)gaC>gaT	p.D14D	C10orf35_ENST00000491890.1_3'UTR	NM_145306.2	NP_660349.1	Q96D05	CJ035_HUMAN	chromosome 10 open reading frame 35	14						integral component of membrane (GO:0016021)		p.D14D(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						TGCAGGATGACGACCCCCGAG	0.597																																																	1	Substitution - coding silent(1)	breast(1)											164.0	121.0	135.0					10																	71391541		2203	4300	6503	SO:0001819	synonymous_variant	0			BC013587	CCDS7295.1	10q22.2	2003-11-21			ENSG00000171224	ENSG00000171224			23519	protein-coding gene	gene with protein product						12477932	Standard	NM_145306		Approved		uc001jpq.4	Q96D05	OTTHUMG00000018383	ENST00000373279.4:c.42C>T	10.37:g.71391541C>T				Silent	SNP	NULL	p.D14	ENST00000373279.4	37	c.42	CCDS7295.1	10																																																																																			C10orf35	-	NULL	ENSG00000171224		0.597	C10orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf35	HGNC	protein_coding	OTTHUMT00000048454.1		0.00	49	0	C	NM_145306		71391541	+1			no_errors	ENST00000373279	ensembl	human	known	74_37	silent	10.00	18	2	SNP	0.937	T
C18orf21	83608	genome.wustl.edu	37	18	33552863	33552863	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:33552863G>T	ENST00000592875.1	+	2	739	c.93G>T	c.(91-93)tcG>tcT	p.S31S	C18orf21_ENST00000593210.1_Intron|C18orf21_ENST00000333234.5_5'UTR	NM_031446.4	NP_113634.3	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	31										endometrium(1)|kidney(1)|large_intestine(1)|skin(2)	5						CCTACACTTCGTCGCACGGTA	0.557																																																	0													176.0	148.0	157.0					18																	33552863		2203	4300	6503	SO:0001819	synonymous_variant	0			BC025950	CCDS11916.2, CCDS56064.1, CCDS74212.1	18q12.2	2004-05-05			ENSG00000141428	ENSG00000141428			28802	protein-coding gene	gene with protein product						12477932	Standard	NM_031446		Approved	PNAS-131, PNAS-124, HsT3108	uc002kzc.3	Q32NC0	OTTHUMG00000128531	ENST00000592875.1:c.93G>T	18.37:g.33552863G>T			Q6GW03|Q9BXV6|Q9BXW2	Silent	SNP	NULL	p.S31	ENST00000592875.1	37	c.93	CCDS11916.2	18																																																																																			C18orf21	-	NULL	ENSG00000141428		0.557	C18orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf21	HGNC	protein_coding	OTTHUMT00000250364.1		0.00	43	0	G	NM_031446		33552863	+1			no_errors	ENST00000592875	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.045	T
C19orf57	79173	genome.wustl.edu	37	19	14001054	14001054	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:14001054C>G	ENST00000586783.1	-	5	614	c.615G>C	c.(613-615)caG>caC	p.Q205H	C19orf57_ENST00000346736.2_Missense_Mutation_p.Q205H|C19orf57_ENST00000454313.1_Missense_Mutation_p.Q205H|C19orf57_ENST00000591586.1_Intron			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	205					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			GGCTGGCCCTCTGTGAGGCGG	0.627																																																	0													107.0	93.0	98.0					19																	14001054		2203	4300	6503	SO:0001583	missense	0			BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.615G>C	19.37:g.14001054C>G	ENSP00000465822:p.Gln205His		Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	NULL	p.Q205H	ENST00000586783.1	37	c.615		19	.	.	.	.	.	.	.	.	.	.	C	14.20	2.463542	0.43736	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.32272	1.46;1.46	3.34	2.29	0.28610	.	0.564043	0.13296	N	0.398637	T	0.28001	0.0690	N	0.19112	0.55	0.09310	N	1	D;D	0.59767	0.986;0.986	P;P	0.53861	0.736;0.534	T	0.06534	-1.0821	10	0.62326	D	0.03	1.2243	6.7465	0.23464	0.0:0.8666:0.0:0.1334	.	205;205	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	H	205	ENSP00000404382:Q205H;ENSP00000254336:Q205H	ENSP00000254336:Q205H	Q	-	3	2	C19orf57	13862054	0.001000	0.12720	0.003000	0.11579	0.204000	0.24138	1.048000	0.30379	0.963000	0.38082	0.491000	0.48974	CAG	C19orf57	-	NULL	ENSG00000132016		0.627	C19orf57-003	NOVEL	basic	protein_coding	C19orf57	HGNC	protein_coding	OTTHUMT00000457947.1	-	0.00	63	0	C	NM_024323		14001054	-1	tier1	-	no_errors	ENST00000454313	ensembl	human	known	74_37	missense	18.56	79	18	SNP	0.003	G
C2orf61	285051	genome.wustl.edu	37	2	47317497	47317497	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:47317497G>T	ENST00000445927.2	-	6	662	c.536C>A	c.(535-537)cCa>cAa	p.P179Q	C2orf61_ENST00000464527.2_Intron|RP11-761B3.1_ENST00000422269.1_3'UTR	NM_001163561.1	NP_001157033.1	Q8N801	CB061_HUMAN	chromosome 2 open reading frame 61	179										endometrium(1)|kidney(1)|lung(2)	4		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ATAATGACCTGGACCAGGGCC	0.358																																																	0													114.0	105.0	108.0					2																	47317497		692	1591	2283	SO:0001583	missense	0			AK097491	CCDS1831.1, CCDS54356.1	2p21	2008-02-05			ENSG00000239605	ENSG00000239605			26850	protein-coding gene	gene with protein product							Standard	NM_173649		Approved	FLJ40172	uc010yog.2	Q8N801	OTTHUMG00000128851	ENST00000445927.2:c.536C>A	2.37:g.47317497G>T	ENSP00000408527:p.Pro179Gln		H7C2Z2	Missense_Mutation	SNP	NULL	p.P179Q	ENST00000445927.2	37	c.536	CCDS54356.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.84|12.84	2.057665|2.057665	0.36277|0.36277	.|.	.|.	ENSG00000239605|ENSG00000239605	ENST00000445927|ENST00000449846	D|.	0.90324|.	-2.65|.	4.31|4.31	4.31|4.31	0.51392|0.51392	.|.	.|.	.|.	.|.	.|.	T|T	0.58047|0.58047	0.2095|0.2095	M|M	0.71206|0.71206	2.165|2.165	0.29485|0.29485	N|N	0.85608|0.85608	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.56353|0.56353	-0.7993|-0.7993	7|5	0.87932|.	D|.	0|.	.|.	12.4484|12.4484	0.55664|0.55664	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	Q|K	179|59	ENSP00000408527:P179Q|.	ENSP00000408527:P179Q|.	P|Q	-|-	2|1	0|0	C2orf61|C2orf61	47171001|47171001	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.120000|0.120000	0.20174|0.20174	4.703000|4.703000	0.61824|0.61824	2.404000|2.404000	0.81709|0.81709	0.491000|0.491000	0.48974|0.48974	CCA|CAG	C2orf61	-	NULL	ENSG00000239605		0.358	C2orf61-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf61	HGNC	protein_coding		-	0.00	55	0	G	NM_173649		47317497	-1	tier1	-	no_errors	ENST00000445927	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
C3orf70	285382	genome.wustl.edu	37	3	184870595	184870595	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:184870595G>A	ENST00000335012.2	-	1	207	c.17C>T	c.(16-18)tCg>tTg	p.S6L		NM_001025266.1	NP_001020437.1	A6NLC5	CC070_HUMAN	chromosome 3 open reading frame 70	6								p.S6L(2)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|urinary_tract(1)	13						CGACGCCGGCGAGGCCGCCGC	0.716																																																	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)											16.0	17.0	17.0					3																	184870595		2196	4292	6488	SO:0001583	missense	0				CCDS33900.1	3q27	2008-08-08			ENSG00000187068	ENSG00000187068			33731	protein-coding gene	gene with protein product							Standard	NM_001025266		Approved		uc003fpd.3	A6NLC5	OTTHUMG00000156696	ENST00000335012.2:c.17C>T	3.37:g.184870595G>A	ENSP00000334974:p.Ser6Leu		B2RNY2|B9EH83	Missense_Mutation	SNP	NULL	p.S6L	ENST00000335012.2	37	c.17	CCDS33900.1	3	.	.	.	.	.	.	.	.	.	.	G	7.421	0.636714	0.14386	.	.	ENSG00000187068	ENST00000335012	.	.	.	2.01	2.01	0.26516	.	0.281820	0.29692	N	0.011445	T	0.20577	0.0495	N	0.08118	0	0.24817	N	0.992606	B	0.18013	0.025	B	0.08055	0.003	T	0.16364	-1.0405	9	0.22109	T	0.4	.	11.538	0.50651	0.0:0.0:1.0:0.0	.	6	A6NLC5	CC070_HUMAN	L	6	.	ENSP00000334974:S6L	S	-	2	0	C3orf70	186353289	0.741000	0.28217	0.135000	0.22099	0.031000	0.12232	2.664000	0.46783	0.951000	0.37770	0.195000	0.17529	TCG	C3orf70	-	NULL	ENSG00000187068		0.716	C3orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf70	HGNC	protein_coding	OTTHUMT00000345323.1	-	0.00	33	0	G	NM_001025266		184870595	-1	tier1	-	no_errors	ENST00000335012	ensembl	human	known	74_37	missense	23.08	29	9	SNP	0.804	A
C6orf141	135398	genome.wustl.edu	37	6	49518881	49518881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:49518881G>T	ENST00000529246.2	+	1	769	c.376G>T	c.(376-378)Gag>Tag	p.E126*	C6orf141_ENST00000424426.1_3'UTR	NM_001145652.1	NP_001139124	Q5SZD1	CF141_HUMAN	chromosome 6 open reading frame 141	126										breast(1)|prostate(1)	2						GGACCACGGCGAGGAGCCCAA	0.627																																																	0													28.0	31.0	30.0					6																	49518881		692	1591	2283	SO:0001587	stop_gained	0			AK054918	CCDS55018.1	6p12.3	2012-02-06			ENSG00000197261	ENSG00000197261			21351	protein-coding gene	gene with protein product							Standard	NM_001145652		Approved	MGC46457	uc011dwo.2	Q5SZD1	OTTHUMG00000014820	ENST00000529246.2:c.376G>T	6.37:g.49518881G>T	ENSP00000434602:p.Glu126*		A8K1H4|Q8N400|Q96NQ1	Nonsense_Mutation	SNP	NULL	p.E126*	ENST00000529246.2	37	c.376	CCDS55018.1	6	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473026	0.63737	.	.	ENSG00000197261	ENST00000529246	.	.	.	2.69	0.738	0.18319	.	6.921310	0.00829	U	0.001645	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	4.1608	0.10282	0.0:0.5972:0.2479:0.1549	.	.	.	.	X	126	.	ENSP00000431184:E126X	E	+	1	0	C6orf141	49626840	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.146000	0.16180	-0.136000	0.11475	-0.226000	0.12346	GAG	C6orf141	-	NULL	ENSG00000197261		0.627	C6orf141-005	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf141	HGNC	protein_coding	OTTHUMT00000390228.1	-	0.00	33	0	G	NM_153344		49518881	+1	tier1	-	no_errors	ENST00000371194	ensembl	human	known	74_37	nonsense	29.82	39	17	SNP	0.000	T
CABIN1	23523	genome.wustl.edu	37	22	24479322	24479322	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:24479322G>A	ENST00000398319.2	+	20	3275	c.2890G>A	c.(2890-2892)Gag>Aag	p.E964K	CABIN1_ENST00000405822.2_Missense_Mutation_p.E914K|CABIN1_ENST00000263119.5_Missense_Mutation_p.E964K	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	964					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CAGGTACCTGGAGGAACACTC	0.537																																																	0													73.0	62.0	66.0					22																	24479322		2203	4300	6503	SO:0001583	missense	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.2890G>A	22.37:g.24479322G>A	ENSP00000381364:p.Glu964Lys		G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E964K	ENST00000398319.2	37	c.2890	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778585	0.90195	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.65549	0.03;-0.16;0.03	4.94	3.92	0.45320	.	0.054132	0.64402	D	0.000001	T	0.73822	0.3636	L	0.59436	1.845	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.98	T	0.74968	-0.3483	10	0.52906	T	0.07	.	12.7253	0.57166	0.0804:0.0:0.9196:0.0	.	914;964	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	K	964;914;964	ENSP00000263119:E964K;ENSP00000384694:E914K;ENSP00000381364:E964K	ENSP00000263119:E964K	E	+	1	0	CABIN1	22809322	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.376000	0.97181	1.238000	0.43771	0.585000	0.79938	GAG	CABIN1	-	NULL	ENSG00000099991		0.537	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	-	0.00	20	0	G	NM_012295		24479322	+1	tier1	-	no_errors	ENST00000263119	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
CALHM3	119395	genome.wustl.edu	37	10	105236173	105236173	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:105236173C>T	ENST00000369783.4	-	2	628	c.421G>A	c.(421-423)Gcc>Acc	p.A141T		NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	141					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						GTCATGTTGGCAAAGTCCAGA	0.612																																																	0													63.0	62.0	62.0					10																	105236173		692	1591	2283	SO:0001583	missense	0			BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.421G>A	10.37:g.105236173C>T	ENSP00000358798:p.Ala141Thr		Q5W090|Q8IXR2	Missense_Mutation	SNP	NULL	p.A141T	ENST00000369783.4	37	c.421	CCDS44476.1	10	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568497	0.45798	.	.	ENSG00000183128	ENST00000369783	T	0.16743	2.32	5.48	3.61	0.41365	.	0.255042	0.39544	N	0.001329	T	0.12987	0.0315	L	0.35723	1.085	0.36357	D	0.860445	B	0.06786	0.001	B	0.10450	0.005	T	0.13548	-1.0505	10	0.12430	T	0.62	-12.8855	12.2774	0.54744	0.0:0.8597:0.0:0.1403	.	141	Q86XJ0-2	.	T	141	ENSP00000358798:A141T	ENSP00000358798:A141T	A	-	1	0	CALHM3	105226163	0.772000	0.28567	0.906000	0.35671	0.963000	0.63663	1.128000	0.31369	0.670000	0.31165	0.462000	0.41574	GCC	CALHM3	-	NULL	ENSG00000183128		0.612	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM3	HGNC	protein_coding	OTTHUMT00000050157.1	-	0.00	48	0	C	NM_182494		105236173	-1	tier1	-	no_errors	ENST00000369783	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.998	T
CAMSAP1	157922	genome.wustl.edu	37	9	138715799	138715800	+	Frame_Shift_Ins	INS	-	-	T	rs148250832|rs201838505	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:138715799_138715800insT	ENST00000389532.4	-	10	1460_1461	c.1396_1397insA	c.(1396-1398)accfs	p.T466fs	CAMSAP1_ENST00000409386.3_Frame_Shift_Ins_p.T477fs|CAMSAP1_ENST00000312405.6_Frame_Shift_Ins_p.T188fs|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	466					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GACTCACCTGGTTTTTTTTTCT	0.46																																																	0																																										SO:0001589	frameshift_variant	0			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1397dupA	9.37:g.138715808_138715808dupT	ENSP00000374183:p.Thr466fs		A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Frame_Shift_Ins	INS	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.T477fs	ENST00000389532.4	37	c.1430_1429	CCDS35176.2	9																																																																																			CAMSAP1	-	NULL	ENSG00000130559		0.460	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMSAP1	HGNC	protein_coding	OTTHUMT00000055024.2		0.00	45	0	-	XM_351857		138715800	-1	tier1		no_errors	ENST00000409386	ensembl	human	known	74_37	frame_shift_ins	12.50	21	3	INS	0.022:0.003	T
CAMTA1	23261	genome.wustl.edu	37	1	7724186	7724186	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:7724186G>A	ENST00000303635.7	+	9	1786	c.1579G>A	c.(1579-1581)Gtc>Atc	p.V527I	CAMTA1_ENST00000439411.2_Missense_Mutation_p.V527I	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTTTACCACCGTCCTCACCAA	0.642			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													52.0	53.0	53.0					1																	7724186		2203	4300	6503	SO:0001583	missense	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1579G>A	1.37:g.7724186G>A	ENSP00000306522:p.Val527Ile		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.V527I	ENST00000303635.7	37	c.1579	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	g	11.07	1.531985	0.27387	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.20332	2.08;2.08	4.86	2.91	0.33838	.	0.268665	0.36519	N	0.002553	T	0.11665	0.0284	N	0.22421	0.69	0.21256	N	0.999743	B	0.09022	0.002	B	0.01281	0.0	T	0.30268	-0.9984	10	0.14656	T	0.56	-18.0752	8.587	0.33664	0.2749:0.0:0.7251:0.0	.	527	Q9Y6Y1	CMTA1_HUMAN	I	527	ENSP00000306522:V527I;ENSP00000402561:V527I	ENSP00000306522:V527I	V	+	1	0	CAMTA1	7646773	0.999000	0.42202	1.000000	0.80357	0.951000	0.60555	2.780000	0.47742	0.989000	0.38761	0.493000	0.49557	GTC	CAMTA1	-	NULL	ENSG00000171735		0.642	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3		0.00	24	0	G	NM_015215		7724186	+1			no_errors	ENST00000303635	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.999	A
CBLN1	869	genome.wustl.edu	37	16	49313380	49313380	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:49313380G>A	ENST00000219197.6	-	3	882	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	CBLN1_ENST00000536749.1_Missense_Mutation_p.R173W	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	173	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				AAGTTTCCCCGCTCCAGCTTG	0.607																																																	0													109.0	105.0	106.0					16																	49313380		2200	4300	6500	SO:0001583	missense	0			M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.517C>T	16.37:g.49313380G>A	ENSP00000219197:p.Arg173Trp		B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.R173W	ENST00000219197.6	37	c.517	CCDS10736.1	16	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024287	0.75390	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	T;T	0.75938	-0.98;-0.98	5.49	5.49	0.81192	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.056391	0.64402	D	0.000002	D	0.85366	0.5680	M	0.79123	2.44	0.58432	D	0.999994	D	0.89917	1.0	D	0.74674	0.984	D	0.86671	0.1910	10	0.87932	D	0	-14.3437	13.73	0.62781	0.0:0.0:0.7449:0.2551	.	173	P23435	CBLN1_HUMAN	W	173	ENSP00000219197:R173W;ENSP00000444651:R173W	ENSP00000219197:R173W	R	-	1	2	CBLN1	47870881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.046000	0.49846	2.716000	0.92895	0.655000	0.94253	CGG	CBLN1	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q	ENSG00000102924		0.607	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN1	HGNC	protein_coding	OTTHUMT00000256845.4	-	0.00	106	0	G	NM_004352		49313380	-1	tier1	-	no_errors	ENST00000219197	ensembl	human	known	74_37	missense	21.69	65	18	SNP	1.000	A
CCDC73	493860	genome.wustl.edu	37	11	32697502	32697502	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:32697502C>G	ENST00000335185.5	-	8	538	c.495G>C	c.(493-495)gaG>gaC	p.E165D	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	165										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					CATAATATTTCTCAATTTCAC	0.284																																																	0													165.0	158.0	160.0					11																	32697502		1842	4075	5917	SO:0001583	missense	0			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.495G>C	11.37:g.32697502C>G	ENSP00000335325:p.Glu165Asp		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	NULL	p.E165D	ENST00000335185.5	37	c.495	CCDS41630.1	11	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569920	0.65765	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.89	4.01	0.46588	.	.	.	.	.	T	0.68668	0.3026	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.68116	-0.5494	8	0.62326	D	0.03	.	8.166	0.31226	0.0:0.6981:0.0:0.3018	.	165;165	Q6ZRK6-2;Q6ZRK6	.;CCD73_HUMAN	D	165	.	ENSP00000335325:E165D	E	-	3	2	CCDC73	32654078	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.423000	0.34837	0.814000	0.34374	0.585000	0.79938	GAG	CCDC73	-	NULL	ENSG00000186714		0.284	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC73	HGNC	protein_coding	OTTHUMT00000388874.2	-	0.00	52	0	C	NM_001008391		32697502	-1	tier1	-	no_errors	ENST00000335185	ensembl	human	known	74_37	missense	65.91	15	29	SNP	1.000	G
CCDC88B	283234	genome.wustl.edu	37	11	64110768	64110768	+	Silent	SNP	C	C	T	rs371409114		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:64110768C>T	ENST00000356786.5	+	11	1224	c.1180C>T	c.(1180-1182)Ctg>Ttg	p.L394L	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'Flank	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	394						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAACCTGCTGCTGCGAACCCG	0.677																																																	0													17.0	14.0	15.0					11																	64110768		2055	3979	6034	SO:0001819	synonymous_variant	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1180C>T	11.37:g.64110768C>T			A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	pfam_Hook-related_fam	p.L394	ENST00000356786.5	37	c.1180	CCDS8072.2	11																																																																																			CCDC88B	-	pfam_Hook-related_fam	ENSG00000168071		0.677	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1	-	0.00	36	0	C	NM_032251		64110768	+1	tier1	-	no_errors	ENST00000356786	ensembl	human	known	74_37	silent	8.16	44	4	SNP	1.000	T
CD248	57124	genome.wustl.edu	37	11	66082958	66082958	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:66082958G>T	ENST00000311330.3	-	1	1557	c.1541C>A	c.(1540-1542)cCc>cAc	p.P514H	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	514	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GATCATAGGGGGCTGGTGGGC	0.577																																																	0													77.0	82.0	80.0					11																	66082958		2200	4295	6495	SO:0001583	missense	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1541C>A	11.37:g.66082958G>T	ENSP00000308117:p.Pro514His		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd_dom,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_C-type_lectin	p.P514H	ENST00000311330.3	37	c.1541	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504400	0.64410	.	.	ENSG00000174807	ENST00000311330	D	0.93076	-3.16	4.44	0.273	0.15650	.	.	.	.	.	D	0.85647	0.5745	L	0.27053	0.805	0.09310	N	0.999999	B	0.15141	0.012	B	0.12156	0.007	T	0.74478	-0.3652	9	0.52906	T	0.07	-10.6789	3.5978	0.08013	0.3759:0.0:0.4543:0.1698	.	514	Q9HCU0	CD248_HUMAN	H	514	ENSP00000308117:P514H	ENSP00000308117:P514H	P	-	2	0	CD248	65839534	0.972000	0.33761	0.828000	0.32881	0.420000	0.31355	-0.203000	0.09438	0.138000	0.18790	0.460000	0.39030	CCC	CD248	-	NULL	ENSG00000174807		0.577	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2		0.00	48	0	G	NM_020404		66082958	-1			no_errors	ENST00000311330	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.020	T
CD7	924	genome.wustl.edu	37	17	80273253	80273253	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:80273253C>T	ENST00000312648.3	-	4	773	c.667G>A	c.(667-669)Gag>Aag	p.E223K	CD7_ENST00000583376.1_Missense_Mutation_p.E123K|CD7_ENST00000584284.1_3'UTR	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	223					homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GACATGTCCTCGTACACCACA	0.617																																					Pancreas(45;804 1068 19702 28207 28798)												0													101.0	78.0	86.0					17																	80273253		2203	4300	6503	SO:0001583	missense	0			X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.667G>A	17.37:g.80273253C>T	ENSP00000312027:p.Glu223Lys			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E223K	ENST00000312648.3	37	c.667	CCDS11807.1	17	.	.	.	.	.	.	.	.	.	.	C	7.002	0.555099	0.13436	.	.	ENSG00000173762	ENST00000312648	T	0.55052	0.54	2.2	2.2	0.27929	.	0.000000	0.41097	U	0.000942	T	0.56731	0.2005	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.55535	-0.8126	10	0.48119	T	0.1	-28.0661	7.9558	0.30042	0.0:1.0:0.0:0.0	.	223	P09564	CD7_HUMAN	K	223	ENSP00000312027:E223K	ENSP00000312027:E223K	E	-	1	0	CD7	77866542	0.008000	0.16893	0.845000	0.33349	0.075000	0.17131	1.935000	0.40173	1.548000	0.49413	0.313000	0.20887	GAG	CD7	-	NULL	ENSG00000173762		0.617	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD7	HGNC	protein_coding	OTTHUMT00000442826.1	-	0.00	126	0	C	NM_006137		80273253	-1	tier1	-	no_errors	ENST00000312648	ensembl	human	known	74_37	missense	15.97	100	19	SNP	0.862	T
CDC42BPA	8476	genome.wustl.edu	37	1	227333345	227333345	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:227333345C>G	ENST00000366769.3	-	8	2279	c.988G>C	c.(988-990)Ggt>Cgt	p.G330R	CDC42BPA_ENST00000366766.2_Missense_Mutation_p.G330R|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.G330R|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.G330R|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.G330R|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.G330R|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.G330R	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CCATTTTGACCAAGTCGATGT	0.388																																																	0													115.0	110.0	111.0					1																	227333345		2203	4300	6503	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.988G>C	1.37:g.227333345C>G	ENSP00000355731:p.Gly330Arg			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.G330R	ENST00000366769.3	37	c.988	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.495123	0.96339	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.81842	0.4908	M	0.81614	2.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.82814	-0.0271	10	0.87932	D	0	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	330;330;330;330	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	R	330	ENSP00000355731:G330R;ENSP00000355729:G330R;ENSP00000335341:G330R;ENSP00000355728:G330R;ENSP00000355726:G330R;ENSP00000443275:G330R;ENSP00000355727:G330R	ENSP00000335341:G330R	G	-	1	0	CDC42BPA	225399968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.805000	0.96524	0.655000	0.94253	GGT	CDC42BPA	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000143776		0.388	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	-	0.00	48	0	C	NM_014826		227333345	-1	tier1	-	no_errors	ENST00000334218	ensembl	human	known	74_37	missense	25.45	41	14	SNP	1.000	G
CDC42EP2	10435	genome.wustl.edu	37	11	65088922	65088922	+	Missense_Mutation	SNP	G	G	A	rs145388901	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:65088922G>A	ENST00000544348.1	+	2	1159	c.553G>A	c.(553-555)Gtg>Atg	p.V185M	CDC42EP2_ENST00000533419.1_Missense_Mutation_p.V185M|CDC42EP2_ENST00000279249.2_Missense_Mutation_p.V185M			O14613	BORG1_HUMAN	CDC42 effector protein (Rho GTPase binding) 2	185					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|Rho GTPase activator activity (GO:0005100)			lung(1)	1						GTCCCTGCACGTGGACCTGGG	0.617																																																	0								G	MET/VAL	6,4396	11.4+/-27.6	0,6,2195	63.0	62.0	62.0		553	4.2	1.0	11	dbSNP_134	62	0,8594		0,0,4297	yes	missense	CDC42EP2	NM_006779.3	21	0,6,6492	AA,AG,GG		0.0,0.1363,0.0462	possibly-damaging	185/211	65088922	6,12990	2201	4297	6498	SO:0001583	missense	0			AF098290	CCDS8099.1	11q13	2008-07-18				ENSG00000149798			16263	protein-coding gene	gene with protein product	"""CRIB-containing BOGR1 protein"""	606132				10490598, 11035016	Standard	NM_006779		Approved	CEP2, BORG1	uc001odl.3	O14613		ENST00000544348.1:c.553G>A	11.37:g.65088922G>A	ENSP00000442534:p.Val185Met		B2RD85|Q9UNS0	Missense_Mutation	SNP	pfam_CRIB_dom,smart_CRIB_dom,pirsf_Cdc42_effector_prot_2,pfscan_CRIB_dom	p.V185M	ENST00000544348.1	37	c.553	CCDS8099.1	11	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480769	0.63849	0.001363	0.0	ENSG00000149798	ENST00000279249;ENST00000533419;ENST00000544348	T;T;T	0.35789	1.29;1.29;1.29	5.08	4.17	0.49024	.	0.091679	0.44483	D	0.000457	T	0.31136	0.0787	L	0.60455	1.87	0.37258	D	0.906878	P	0.49635	0.926	B	0.37091	0.241	T	0.41716	-0.9493	10	0.51188	T	0.08	-10.7325	11.3074	0.49342	0.0882:0.0:0.9118:0.0	.	185	O14613	BORG1_HUMAN	M	185	ENSP00000279249:V185M;ENSP00000431660:V185M;ENSP00000442534:V185M	ENSP00000279249:V185M	V	+	1	0	CDC42EP2	64845498	0.836000	0.29430	0.957000	0.39632	0.978000	0.69477	1.292000	0.33342	1.374000	0.46228	0.591000	0.81541	GTG	CDC42EP2	-	pirsf_Cdc42_effector_prot_2	ENSG00000149798		0.617	CDC42EP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP2	HGNC	protein_coding	OTTHUMT00000387258.1	-	0.00	38	0	G	NM_006779		65088922	+1	tier1	rs145388901	no_errors	ENST00000279249	ensembl	human	known	74_37	missense	18.52	44	10	SNP	0.819	A
CEP170	9859	genome.wustl.edu	37	1	243303405	243303405	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:243303405A>C	ENST00000366542.1	-	16	4115	c.4064T>G	c.(4063-4065)gTt>gGt	p.V1355G	CEP170_ENST00000468254.1_5'UTR|CEP170_ENST00000366543.1_Missense_Mutation_p.V1231G|RP11-261C10.5_ENST00000439562.1_RNA|CEP170_ENST00000366544.1_Missense_Mutation_p.V1257G|CEP170_ENST00000490813.1_Missense_Mutation_p.V64G|CEP170_ENST00000481987.1_Missense_Mutation_p.V91G	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1355	Targeting to centrosomes.|Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AACACGATCAACCAACTAATG	0.368																																																	0													68.0	64.0	65.0					1																	243303405		1853	4094	5947	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.4064T>G	1.37:g.243303405A>C	ENSP00000355500:p.Val1355Gly		O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.V1355G	ENST00000366542.1	37	c.4064	CCDS44339.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.2|20.2	3.951697|3.951697	0.73787|0.73787	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543;ENST00000481987;ENST00000532008;ENST00000490813;ENST00000413359;ENST00000464936;ENST00000492145	.|T;T;T	.|0.62232	.|0.28;0.26;0.04	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.055575	.|0.64402	.|D	.|0.000001	T|T	0.74191|0.74191	0.3684|0.3684	L|L	0.55990|0.55990	1.75|1.75	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.992;0.992;0.999	.|D;D;D;D	.|0.87578	.|0.998;0.985;0.985;0.994	T|T	0.73151|0.73151	-0.4073|-0.4073	5|10	.|0.37606	.|T	.|0.19	-17.6798|-17.6798	14.674|14.674	0.68964|0.68964	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1328;1257;1231;1355	.|B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;.;CE170_HUMAN	V|G	1329|1355;1257;1231;91;290;64;147;64;64	.|ENSP00000355500:V1355G;ENSP00000355502:V1257G;ENSP00000355501:V1231G	.|ENSP00000355500:V1355G	L|V	-|-	1|2	2|0	CEP170|CEP170	241370028|241370028	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	8.694000|8.694000	0.91293|0.91293	2.122000|2.122000	0.65172|0.65172	0.455000|0.455000	0.32223|0.32223	TTG|GTT	CEP170	-	NULL	ENSG00000143702		0.368	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	-	0.00	90	0	A	NM_014812		243303405	-1	tier1	-	no_errors	ENST00000366542	ensembl	human	known	74_37	missense	27.61	97	37	SNP	1.000	C
CERS3	204219	genome.wustl.edu	37	15	101013168	101013168	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:101013168G>T	ENST00000394113.1	-	11	1389	c.699C>A	c.(697-699)ctC>ctA	p.L233L	CERS3_ENST00000538112.2_Silent_p.L233L|CERS3_ENST00000284382.4_Silent_p.L233L|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	233	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CAATCATCACGAGGGTCCCAC	0.438																																																	0													119.0	102.0	108.0					15																	101013168		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.699C>A	15.37:g.101013168G>T			Q8NE64|Q8NEN6	Silent	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeobox_dom	p.L233	ENST00000394113.1	37	c.699	CCDS10384.1	15																																																																																			CERS3	-	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000154227		0.438	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	CERS3	HGNC	protein_coding	OTTHUMT00000313594.4	-	0.00	53	0	G	NM_178842		101013168	-1	tier1	-	no_errors	ENST00000284382	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.904	T
CFHR2	3080	genome.wustl.edu	37	1	196928158	196928158	+	Missense_Mutation	SNP	G	G	A	rs370528458		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:196928158G>A	ENST00000367415.5	+	5	861	c.761G>A	c.(760-762)cGa>cAa	p.R254Q	CFHR2_ENST00000476712.2_Missense_Mutation_p.R238Q|CFHR2_ENST00000496448.1_3'UTR|CFHR2_ENST00000367421.3_Missense_Mutation_p.R254Q	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	254	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)		p.R254Q(1)		large_intestine(2)|ovary(1)|skin(3)	6						CATTCATTTCGAGCAATGTGT	0.323																																																	1	Substitution - Missense(1)	lung(1)											50.0	52.0	51.0					1																	196928158		2203	4293	6496	SO:0001583	missense	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.761G>A	1.37:g.196928158G>A	ENSP00000356385:p.Arg254Gln		Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R254Q	ENST00000367415.5	37	c.761	CCDS30959.1	1	.	.	.	.	.	.	.	.	.	.	.	8.340	0.828483	0.16749	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	D;D	0.84223	-1.82;-1.82	3.52	-1.19	0.09585	Complement control module (2);Sushi/SCR/CCP (2);	0.329287	0.17109	N	0.186673	T	0.73992	0.3658	M	0.62723	1.935	0.09310	N	1	P;B	0.47604	0.898;0.094	B;B	0.40165	0.321;0.025	T	0.64491	-0.6395	10	0.15499	T	0.54	.	1.1776	0.01838	0.2162:0.1697:0.4405:0.1736	.	227;254	P36980-2;P36980	.;FHR2_HUMAN	Q	254	ENSP00000356391:R254Q;ENSP00000356385:R254Q	ENSP00000356385:R254Q	R	+	2	0	CFHR2	195194781	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.331000	0.07914	-0.088000	0.12506	-1.330000	0.01273	CGA	CFHR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000080910		0.323	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR2	HGNC	protein_coding	OTTHUMT00000088815.2	-	0.00	11	0	G	NM_005666		196928158	+1	tier1	-	no_errors	ENST00000367415	ensembl	human	known	74_37	missense	33.33	20	10	SNP	0.000	A
CHD8	57680	genome.wustl.edu	37	14	21873596	21873596	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:21873596G>T	ENST00000557364.1	-	16	3342	c.3079C>A	c.(3079-3081)Cca>Aca	p.P1027T	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.P748T|CHD8_ENST00000399982.2_Missense_Mutation_p.P1027T			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1027					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGCATCATTGGCTTAAGAATG	0.368																																																	0													34.0	31.0	32.0					14																	21873596		1838	4089	5927	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3079C>A	14.37:g.21873596G>T	ENSP00000451601:p.Pro1027Thr		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1027T	ENST00000557364.1	37	c.3079	CCDS53885.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.462375|4.462375	0.84425|0.84425	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|D;D;D	.|0.94723	.|-3.5;-3.5;-3.5	5.33|5.33	5.33|5.33	0.75918|0.75918	.|SNF2-related (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97860|0.97860	0.9297|0.9297	M|M	0.91561|0.91561	3.22|3.22	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.997	D|D	0.98514|0.98514	1.0620|1.0620	5|10	.|0.87932	.|D	.|0	-14.6108|-14.6108	17.9616|17.9616	0.89087|0.89087	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1027;748	.|Q9HCK8;Q9HCK8-2	.|CHD8_HUMAN;.	D|T	252|748;1027;747;1027	.|ENSP00000406288:P748T;ENSP00000382863:P1027T;ENSP00000451601:P1027T	.|ENSP00000262707:P747T	A|P	-|-	2|1	0|0	CHD8|CHD8	20943436|20943436	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.912000|0.912000	0.54170|0.54170	9.515000|9.515000	0.98015|0.98015	2.775000|2.775000	0.95449|0.95449	0.655000|0.655000	0.94253|0.94253	GCC|CCA	CHD8	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000100888		0.368	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1		0.00	24	0	G	NM_020920		21873596	-1			no_errors	ENST00000399982	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
CHRNB4	1143	genome.wustl.edu	37	15	78921615	78921615	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:78921615G>T	ENST00000261751.3	-	5	1143	c.1032C>A	c.(1030-1032)ttC>ttA	p.F344L	CHRNB4_ENST00000560511.1_5'Flank|RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Intron	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	344					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	TCATGAAGAGGAAGGTAGGCA	0.657																																																	0													55.0	55.0	55.0					15																	78921615		2196	4293	6489	SO:0001583	missense	0			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1032C>A	15.37:g.78921615G>T	ENSP00000261751:p.Phe344Leu		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F344L	ENST00000261751.3	37	c.1032	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	G	3.839	-0.034213	0.07543	.	.	ENSG00000117971	ENST00000261751	T	0.68479	-0.33	5.3	3.38	0.38709	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.126685	0.56097	D	0.000035	T	0.37210	0.0995	N	0.04320	-0.23	0.80722	D	1	B	0.10296	0.003	B	0.17979	0.02	T	0.32188	-0.9916	10	0.02654	T	1	.	10.269	0.43473	0.0725:0.0:0.7938:0.1338	.	344	P30926	ACHB4_HUMAN	L	344	ENSP00000261751:F344L	ENSP00000261751:F344L	F	-	3	2	CHRNB4	76708670	0.717000	0.27966	1.000000	0.80357	0.996000	0.88848	-0.160000	0.10041	1.227000	0.43598	0.655000	0.94253	TTC	CHRNB4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000117971		0.657	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	HGNC	protein_coding	OTTHUMT00000290108.1	-	0.00	70	0	G			78921615	-1	tier1	-	no_errors	ENST00000261751	ensembl	human	known	74_37	missense	52.00	24	26	SNP	1.000	T
CLRN2	645104	genome.wustl.edu	37	4	17517125	17517125	+	Missense_Mutation	SNP	G	G	T	rs200144103		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:17517125G>T	ENST00000511148.2	+	1	338	c.236G>T	c.(235-237)cGc>cTc	p.R79L		NM_001079827.2	NP_001073296.1	A0PK11	CLRN2_HUMAN	clarin 2	79						integral component of membrane (GO:0016021)		p.R79H(1)		breast(1)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|upper_aerodigestive_tract(1)	15						CTTGGGGGCCGCCAATCCCAA	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		17741	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											50.0	49.0	49.0					4																	17517125		1898	4114	6012	SO:0001583	missense	0				CCDS47032.1	4p15.32	2008-01-17			ENSG00000249581	ENSG00000249581			33939	protein-coding gene	gene with protein product						12080385	Standard	NM_001079827		Approved		uc003gpg.1	A0PK11	OTTHUMG00000160273	ENST00000511148.2:c.236G>T	4.37:g.17517125G>T	ENSP00000424711:p.Arg79Leu			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.R79L	ENST00000511148.2	37	c.236	CCDS47032.1	4	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	19.41	3.823013	0.71028	.	.	ENSG00000249581	ENST00000511148	T	0.73469	-0.75	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	M	0.69823	2.125	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.86973	0.2099	10	0.66056	D	0.02	-20.3478	18.8264	0.92121	0.0:0.0:1.0:0.0	.	79	A0PK11	CLRN2_HUMAN	L	79	ENSP00000424711:R79L	ENSP00000424711:R79L	R	+	2	0	CLRN2	17126223	1.000000	0.71417	1.000000	0.80357	0.338000	0.28826	9.234000	0.95347	2.552000	0.86080	0.561000	0.74099	CGC	CLRN2	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000249581		0.488	CLRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN2	HGNC	protein_coding	OTTHUMT00000359990.2		0.00	26	0	G	NM_001079827		17517125	+1			no_errors	ENST00000511148	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
CNTN1	1272	genome.wustl.edu	37	12	41333274	41333274	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:41333274G>T	ENST00000551295.2	+	12	1483	c.1366G>T	c.(1366-1368)Gtc>Ttc	p.V456F	CNTN1_ENST00000360099.3_Missense_Mutation_p.V456F|CNTN1_ENST00000547849.1_Missense_Mutation_p.V456F|CNTN1_ENST00000347616.1_Missense_Mutation_p.V456F|CNTN1_ENST00000348761.2_Missense_Mutation_p.V445F|CNTN1_ENST00000547702.1_Missense_Mutation_p.V456F	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	456	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AGAGTGGCTTGTCAATAGCAG	0.363																																																	0													72.0	71.0	72.0					12																	41333274		2203	4300	6503	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1366G>T	12.37:g.41333274G>T	ENSP00000447006:p.Val456Phe		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V456F	ENST00000551295.2	37	c.1366	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	G	3.023	-0.201396	0.06219	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	4.98	4.98	0.66077	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.349986	0.30742	N	0.008976	T	0.50394	0.1613	N	0.25380	0.74	0.35090	D	0.76425	B;B;B	0.14012	0.002;0.007;0.009	B;B;B	0.18263	0.007;0.012;0.021	T	0.54330	-0.8310	10	0.24483	T	0.36	.	9.8909	0.41290	0.1548:0.0:0.8452:0.0	.	456;445;456	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	F	456;456;456;456;456;445	ENSP00000448004:V456F;ENSP00000447006:V456F;ENSP00000448653:V456F;ENSP00000325660:V456F;ENSP00000353213:V456F;ENSP00000261160:V445F	ENSP00000325660:V456F	V	+	1	0	CNTN1	39619541	0.994000	0.37717	0.999000	0.59377	0.790000	0.44656	2.276000	0.43408	2.689000	0.91719	0.561000	0.74099	GTC	CNTN1	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000018236		0.363	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2		0.00	44	0	G	NM_001843		41333274	+1			no_errors	ENST00000347616	ensembl	human	known	74_37	missense	6.58	71	5	SNP	0.984	T
CNTNAP3	79937	genome.wustl.edu	37	9	39174372	39174372	+	Intron	SNP	T	T	A	rs113196130		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:39174372T>A	ENST00000297668.6	-	7	1145				CNTNAP3_ENST00000377659.1_Intron|CNTNAP3_ENST00000358144.2_Intron|CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000323947.7_Intron|CNTNAP3_ENST00000377653.2_5'UTR	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3						cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTCAAACCCATCTTTTTTTTT	0.343																																																	0																																										SO:0001627	intron_variant	0			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1071+1573A>T	9.37:g.39174372T>A			B1AMA0|Q9C0E9	RNA	SNP	-	NULL	ENST00000297668.6	37	NULL	CCDS6616.1	9																																																																																			CNTNAP3	-	-	ENSG00000106714		0.343	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	HGNC	protein_coding	OTTHUMT00000052511.1	-	0.00	52	0	T	NM_033655		39174372	-1	tier1	rs200822754	no_errors	ENST00000377653	ensembl	human	known	74_37	rna	9.80	46	5	SNP	0.776	A
COL21A1	81578	genome.wustl.edu	37	6	55925539	55925539	+	Splice_Site	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:55925539C>A	ENST00000244728.5	-	27	2804	c.2407G>T	c.(2407-2409)Gcc>Tcc	p.A803S	COL21A1_ENST00000370819.1_Splice_Site_p.A800S|COL21A1_ENST00000535941.1_Splice_Site_p.A803S|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370808.2_Splice_Site_p.G203C	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	803					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGATACCTACCTCTTATTACA	0.313																																																	0													54.0	52.0	52.0					6																	55925539		1807	4073	5880	SO:0001630	splice_region_variant	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2407+1G>T	6.37:g.55925539C>A			A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.A803S	ENST00000244728.5	37	c.2407	CCDS55025.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.727|2.727	-0.265211|-0.265211	0.05754|0.05754	.|.	.|.	ENSG00000124749|ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811|ENST00000370808	D;D;D|D	0.89123|0.99369	-2.47;-2.42;-2.47|-5.78	4.9|4.9	3.13|3.13	0.36017|0.36017	.|.	0.351400|.	0.23466|.	N|.	0.047874|.	D|D	0.97031|0.97031	0.9030|0.9030	N|N	0.24115|0.24115	0.695|0.695	0.50467|0.50467	D|D	0.999876|0.999876	B;B;B|P	0.30793|0.49253	0.19;0.043;0.295|0.921	B;B;B|P	0.27608|0.56088	0.081;0.025;0.081|0.791	D|D	0.95329|0.95329	0.8428|0.8428	9|8	.|.	.|.	.|.	.|.	8.2823|8.2823	0.31908|0.31908	0.0:0.6885:0.0:0.3115|0.0:0.6885:0.0:0.3115	.|.	803;803;160|203	B7ZLK3;Q96P44;B3KU30|Q96P44-2	.;COLA1_HUMAN;.|.	S|C	803;800;803;800|203	ENSP00000244728:A803S;ENSP00000359855:A800S;ENSP00000444384:A803S|ENSP00000359844:G203C	.|.	A|G	-|-	1|1	0|0	COL21A1|COL21A1	56033498|56033498	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.081000|0.081000	0.17604|0.17604	1.084000|1.084000	0.30828|0.30828	0.595000|0.595000	0.29777|0.29777	-0.137000|-0.137000	0.14449|0.14449	GCC|GGC	COL21A1	-	NULL	ENSG00000124749		0.313	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	-	0.00	38	0	C		Missense_Mutation	55925539	-1	tier1	-	no_errors	ENST00000244728	ensembl	human	known	74_37	missense	18.46	53	12	SNP	1.000	A
COL4A6	1288	genome.wustl.edu	37	X	107408226	107408226	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:107408226G>C	ENST00000372216.4	-	39	3954	c.3854C>G	c.(3853-3855)tCc>tGc	p.S1285C	COL4A6_ENST00000538570.1_Missense_Mutation_p.S1260C|COL4A6_ENST00000545689.1_Missense_Mutation_p.S1260C|COL4A6_ENST00000334504.7_Missense_Mutation_p.S1284C|COL4A6_ENST00000394872.2_Missense_Mutation_p.S1285C	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1285	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TTGATTCGAGGATGGCCCAGG	0.622									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0													27.0	29.0	28.0					X																	107408226		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3854C>G	X.37:g.107408226G>C	ENSP00000361290:p.Ser1285Cys		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.S1285C	ENST00000372216.4	37	c.3854	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171211	0.38315	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24	4.36	4.36	0.52297	.	0.212641	0.24031	N	0.042193	D	0.95430	0.8516	M	0.61703	1.905	0.34802	D	0.736877	D;D;D;D	0.89917	0.998;0.963;1.0;1.0	D;P;D;D	0.72982	0.951;0.73;0.979;0.964	D	0.97801	1.0244	10	0.66056	D	0.02	.	12.7584	0.57350	0.0:0.1613:0.8387:0.0	.	1260;1260;1285;1284	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	C	1285;1284;1285;1284;1260;1260	ENSP00000361290:S1285C;ENSP00000334733:S1284C;ENSP00000378340:S1285C;ENSP00000443707:S1260C;ENSP00000445236:S1260C	ENSP00000334733:S1284C	S	-	2	0	COL4A6	107294882	1.000000	0.71417	0.996000	0.52242	0.817000	0.46193	3.814000	0.55643	2.112000	0.64535	0.544000	0.68410	TCC	COL4A6	-	pfam_Collagen	ENSG00000197565		0.622	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	-	0.00	22	0	G			107408226	-1	tier1	-	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	71.88	9	23	SNP	0.995	C
COLEC12	81035	genome.wustl.edu	37	18	333120	333120	+	Missense_Mutation	SNP	A	A	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:333120A>T	ENST00000400256.3	-	7	2047	c.1840T>A	c.(1840-1842)Ttc>Atc	p.F614I		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	614	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TTGTCTGTGAAGTTCTTCCAG	0.388																																																	0													65.0	70.0	68.0					18																	333120		2203	4300	6503	SO:0001583	missense	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1840T>A	18.37:g.333120A>T	ENSP00000383115:p.Phe614Ile		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.F614I	ENST00000400256.3	37	c.1840	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	A	25.0	4.597363	0.87055	.	.	ENSG00000158270	ENST00000400256	T	0.19394	2.15	5.91	5.91	0.95273	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.172694	0.53938	D	0.000057	T	0.33323	0.0859	M	0.92604	3.325	0.48395	D	0.999649	B	0.31931	0.347	B	0.20184	0.028	T	0.31943	-0.9925	10	0.23302	T	0.38	-16.2224	16.3512	0.83208	1.0:0.0:0.0:0.0	.	614	Q5KU26	COL12_HUMAN	I	614	ENSP00000383115:F614I	ENSP00000383115:F614I	F	-	1	0	COLEC12	323120	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.806000	0.69150	2.266000	0.75297	0.533000	0.62120	TTC	COLEC12	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	ENSG00000158270		0.388	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1	-	0.00	41	0	A			333120	-1	tier1	-	no_errors	ENST00000400256	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	T
CORO7	79585	genome.wustl.edu	37	16	4407996	4407996	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:4407996T>C	ENST00000251166.4	-	25	2711	c.2566A>G	c.(2566-2568)Agc>Ggc	p.S856G	CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.S856G|CORO7_ENST00000539968.1_Missense_Mutation_p.S636G|CORO7_ENST00000537233.2_Missense_Mutation_p.S838G|PAM16_ENST00000576217.1_5'Flank|CORO7_ENST00000574025.1_Missense_Mutation_p.S771G|CORO7-PAM16_ENST00000572274.1_5'UTR	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	856					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						GGCTGCAGGCTGAGAAGCCAG	0.632																																																	0													38.0	40.0	40.0					16																	4407996		2197	4300	6497	SO:0001583	missense	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2566A>G	16.37:g.4407996T>C	ENSP00000251166:p.Ser856Gly		B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	pfam_DUF1900,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S856G	ENST00000251166.4	37	c.2566	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572083	0.45798	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.37752	1.18;1.18	5.24	4.12	0.48240	Domain of unknown function DUF1900 (1);	0.568691	0.20367	N	0.093728	T	0.55909	0.1950	M	0.89785	3.06	0.80722	D	1	P;P;P;P	0.46020	0.843;0.454;0.565;0.871	P;B;B;P	0.51550	0.487;0.334;0.171;0.673	T	0.60870	-0.7177	10	0.87932	D	0	-11.3632	9.5676	0.39409	0.3738:0.0:0.0:0.6262	.	771;838;856;837	P57737-2;B4DFD6;P57737;B4DKU9	.;.;CORO7_HUMAN;.	G	856;771;636	ENSP00000251166:S856G;ENSP00000446221:S636G	ENSP00000251166:S856G	S	-	1	0	CORO7	4347997	1.000000	0.71417	0.997000	0.53966	0.050000	0.14768	3.716000	0.54904	0.785000	0.33685	0.467000	0.42956	AGC	CORO7-PAM16	-	pfam_DUF1900	ENSG00000103426		0.632	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	HGNC	protein_coding	OTTHUMT00000251628.2	-	0.00	44	0	T	NM_024535		4407996	-1	tier1	-	no_errors	ENST00000572467	ensembl	human	known	74_37	missense	68.29	13	28	SNP	1.000	C
CPLX1	10815	genome.wustl.edu	37	4	786256	786256	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:786256C>T	ENST00000304062.6	-	3	403	c.172G>A	c.(172-174)Gag>Aag	p.E58K	CPLX1_ENST00000505203.1_Intron	NM_006651.3	NP_006642.1	O14810	CPLX1_HUMAN	complexin 1	58	Interaction with the SNARE complex. {ECO:0000250}.				exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|insulin secretion (GO:0030073)|neurotransmitter secretion (GO:0007269)|regulation of exocytosis (GO:0017157)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|synapse (GO:0045202)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|synaptobrevin 2-SNAP-25-syntaxin-3-complexin complex (GO:0070554)	neurotransmitter transporter activity (GO:0005326)			kidney(1)|lung(2)	3				Colorectal(103;0.187)		GCCTCGCGCTCCGCCTCCATC	0.736																																																	0													25.0	28.0	27.0					4																	786256		2196	4280	6476	SO:0001583	missense	0			AF022383	CCDS46995.1	4p16.3	2008-08-07			ENSG00000168993	ENSG00000168993			2309	protein-coding gene	gene with protein product		605032				7553862	Standard	NM_006651		Approved	CPX-I	uc003gbi.3	O14810	OTTHUMG00000160005	ENST00000304062.6:c.172G>A	4.37:g.786256C>T	ENSP00000305613:p.Glu58Lys		A6NI80|B2R4R5|D3DVN3|F1T0G1	Missense_Mutation	SNP	pfam_Synaphin	p.E58K	ENST00000304062.6	37	c.172	CCDS46995.1	4	.	.	.	.	.	.	.	.	.	.	c	28.6	4.931210	0.92389	.	.	ENSG00000168993	ENST00000304062;ENST00000504062;ENST00000513195	.	.	.	3.57	3.57	0.40892	.	.	.	.	.	T	0.79299	0.4422	M	0.85777	2.775	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.83253	-0.0052	8	0.87932	D	0	.	13.0899	0.59162	0.0:1.0:0.0:0.0	.	58	O14810	CPLX1_HUMAN	K	58;43;141	.	ENSP00000305613:E58K	E	-	1	0	CPLX1	776256	1.000000	0.71417	0.990000	0.47175	0.893000	0.52053	5.263000	0.65507	2.009000	0.58944	0.537000	0.68136	GAG	CPLX1	-	pfam_Synaphin	ENSG00000168993		0.736	CPLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPLX1	HGNC	protein_coding	OTTHUMT00000358830.1		0.00	30	0	C			786256	-1			no_errors	ENST00000304062	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	T
CPS1	1373	genome.wustl.edu	37	2	211441123	211441123	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:211441123C>T	ENST00000233072.5	+	3	486	c.290C>T	c.(289-291)gCc>gTc	p.A97V	CPS1_ENST00000430249.2_Missense_Mutation_p.A103V	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	97	Anthranilate phosphoribosyltransferase homolog.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.A97D(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CTCACAATGGCCAACCCTATT	0.413																																																	1	Substitution - Missense(1)	large_intestine(1)											184.0	168.0	174.0					2																	211441123		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.290C>T	2.37:g.211441123C>T	ENSP00000233072:p.Ala97Val		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.A103V	ENST00000233072.5	37	c.308	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724355	0.48728	.	.	ENSG00000021826	ENST00000417946;ENST00000518043;ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.96	2.27	0.28462	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	0.162024	0.56097	N	0.000024	D	0.89753	0.6806	L	0.52011	1.625	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.14578	0.011;0.011	D	0.83454	0.0050	10	0.72032	D	0.01	-0.1181	10.0664	0.42306	0.0:0.6817:0.0:0.3183	.	107;97	Q59HF8;P31327	.;CPSM_HUMAN	V	97;97;103;103;105;97;97	ENSP00000388496:A97V;ENSP00000430697:A97V;ENSP00000430644:A103V;ENSP00000402608:A103V;ENSP00000233072:A97V	ENSP00000233072:A97V	A	+	2	0	CPS1	211149368	0.781000	0.28676	0.997000	0.53966	0.848000	0.48234	1.328000	0.33758	0.149000	0.19098	-0.808000	0.03180	GCC	CPS1	-	pfam_CarbamoylP_synth_ssu_N,superfamily_CarbamoylP_synth_ssu_N,tigrfam_CarbamoylP_synth_ssu	ENSG00000021826		0.413	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5		0.00	62	0	C			211441123	+1			no_errors	ENST00000430249	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
CRNN	49860	genome.wustl.edu	37	1	152384689	152384689	+	Missense_Mutation	SNP	G	G	C	rs370534840		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:152384689G>C	ENST00000271835.3	-	2	83	c.21C>G	c.(19-21)aaC>aaG	p.N7K	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	7					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCATTAATGTTTTGCAGTA	0.488																																																	0													111.0	105.0	107.0					1																	152384689		2203	4300	6503	SO:0001583	missense	0			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.21C>G	1.37:g.152384689G>C	ENSP00000271835:p.Asn7Lys		B2RE60|Q8N613	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.N7K	ENST00000271835.3	37	c.21	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904185	0.33628	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.09723	2.95	4.78	1.84	0.25277	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.000000	0.53938	D	0.000045	T	0.14270	0.0345	M	0.72894	2.215	0.29962	N	0.819322	D	0.89917	1.0	D	0.83275	0.996	T	0.02683	-1.1124	10	0.62326	D	0.03	.	6.936	0.24466	0.2879:0.0:0.7121:0.0	.	7	Q9UBG3	CRNN_HUMAN	K	7	ENSP00000271835:N7K	ENSP00000271835:N7K	N	-	3	2	CRNN	150651313	1.000000	0.71417	0.607000	0.28956	0.057000	0.15508	0.636000	0.24644	0.227000	0.20999	0.591000	0.81541	AAC	CRNN	-	pfam_S100_Ca-bd_sub	ENSG00000143536		0.488	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	HGNC	protein_coding	OTTHUMT00000034503.1	-	0.00	56	0	G	NM_016190		152384689	-1	tier1	-	no_errors	ENST00000271835	ensembl	human	known	74_37	missense	28.36	48	19	SNP	0.944	C
CYLD	1540	genome.wustl.edu	37	16	50818332	50818332	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:50818332T>C	ENST00000427738.3	+	11	2124	c.1919T>C	c.(1918-1920)cTg>cCg	p.L640P	RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000569418.1_Missense_Mutation_p.L637P|CYLD_ENST00000564326.1_Missense_Mutation_p.L637P|RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000540145.1_Missense_Mutation_p.L640P|CYLD_ENST00000311559.9_Missense_Mutation_p.L640P|CYLD_ENST00000568704.2_Missense_Mutation_p.L455P|CYLD_ENST00000566206.1_Missense_Mutation_p.L637P|CYLD_ENST00000398568.2_Missense_Mutation_p.L637P			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	640	USP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				CAAGAGCTACTGAGGACAGAA	0.338			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																														yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	0													101.0	96.0	97.0					16																	50818332		1833	4082	5915	SO:0001583	missense	0	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1919T>C	16.37:g.50818332T>C	ENSP00000392025:p.Leu640Pro		O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Peptidase_C19/C67,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain,pfscan_Peptidase_C19/C67	p.L640P	ENST00000427738.3	37	c.1919	CCDS45482.1	16	.	.	.	.	.	.	.	.	.	.	T	23.6	4.441337	0.83993	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T	0.76060	-0.99;-0.99;-0.99	5.54	5.54	0.83059	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.85911	0.5807	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.87633	0.2517	10	0.87932	D	0	-11.6679	15.971	0.80019	0.0:0.0:0.0:1.0	.	637;640;637;640	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	P	640;640;637;637	ENSP00000445447:L640P;ENSP00000308928:L640P;ENSP00000381574:L637P	ENSP00000308928:L640P	L	+	2	0	CYLD	49375833	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.358000	0.79466	2.223000	0.72356	0.533000	0.62120	CTG	CYLD	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000083799		0.338	CYLD-010	KNOWN	basic|CCDS	protein_coding	CYLD	HGNC	protein_coding	OTTHUMT00000422998.2	-	0.00	70	0	T			50818332	+1	tier1	-	no_errors	ENST00000311559	ensembl	human	known	74_37	missense	5.50	103	6	SNP	1.000	C
CYP51A1	1595	genome.wustl.edu	37	7	91743159	91743160	+	Splice_Site	INS	-	-	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:91743159_91743160insA	ENST00000003100.8	-	10	1517		c.e10-2		LRRD1_ENST00000422722.1_Splice_Site|CYP51A1_ENST00000450723.1_Splice_Site	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1						cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	GATGACGCCCTAAAAAAAAGAA	0.317																																					GBM(70;1100 1190 11592 25836 51397)												0																																										SO:0001630	splice_region_variant	0			U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.1352-2->T	7.37:g.91743167_91743167dupA			A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Splice_Site	INS	-	e10-2	ENST00000003100.8	37	c.1352-3_1352-2	CCDS5623.1	7																																																																																			CYP51A1	-	-	ENSG00000001630		0.317	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP51A1	HGNC	protein_coding	OTTHUMT00000253812.4		0.00	20	0	-		Intron	91743160	-1	tier1		no_errors	ENST00000003100	ensembl	human	known	74_37	splice_site_ins	7.14	26	2	INS	0.998:0.001	A
DCAF5	8816	genome.wustl.edu	37	14	69520682	69520682	+	Silent	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:69520682T>C	ENST00000341516.5	-	9	2868	c.2721A>G	c.(2719-2721)acA>acG	p.T907T	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000557386.1_Silent_p.T906T|DCAF5_ENST00000556847.1_Silent_p.T825T|DCAF5_ENST00000554215.1_Silent_p.T825T	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	907					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TGCTACTATCTGTGGCTGGGG	0.493																																																	0													73.0	78.0	76.0					14																	69520682		2203	4300	6503	SO:0001819	synonymous_variant	0			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2721A>G	14.37:g.69520682T>C			B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T907	ENST00000341516.5	37	c.2721	CCDS32106.1	14																																																																																			DCAF5	-	NULL	ENSG00000139990		0.493	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF5	HGNC	protein_coding	OTTHUMT00000414806.2		0.00	54	0	T	NM_003861		69520682	-1			no_errors	ENST00000341516	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.275	C
DCBLD2	131566	genome.wustl.edu	37	3	98518298	98518298	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:98518298A>G	ENST00000326840.6	-	16	2608	c.2246T>C	c.(2245-2247)gTg>gCg	p.V749A	DCBLD2_ENST00000326857.9_Missense_Mutation_p.V763A	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	749					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CACCTGGTACACCAATTCGTC	0.498																																																	0													209.0	208.0	208.0					3																	98518298		1959	4159	6118	SO:0001583	missense	0				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.2246T>C	3.37:g.98518298A>G	ENSP00000321573:p.Val749Ala		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB_dom,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_LCCL,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.V763A	ENST00000326840.6	37	c.2288	CCDS46878.1	3	.	.	.	.	.	.	.	.	.	.	A	9.703	1.154910	0.21371	.	.	ENSG00000057019	ENST00000326840;ENST00000326857	T;T	0.29917	1.55;1.55	6.02	4.84	0.62591	.	0.273865	0.37053	N	0.002279	T	0.25082	0.0609	L	0.51422	1.61	0.41210	D	0.986431	P;B	0.38395	0.629;0.278	B;B	0.36464	0.225;0.039	T	0.03443	-1.1036	10	0.08837	T	0.75	-8.3547	11.5703	0.50830	0.8505:0.1495:0.0:0.0	.	763;749	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	A	749;763	ENSP00000321573:V749A;ENSP00000321646:V763A	ENSP00000321573:V749A	V	-	2	0	DCBLD2	100000988	0.999000	0.42202	0.992000	0.48379	0.624000	0.37722	5.030000	0.64128	1.060000	0.40578	0.533000	0.62120	GTG	DCBLD2	-	NULL	ENSG00000057019		0.498	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	HGNC	protein_coding	OTTHUMT00000324675.2	-	0.00	47	0	A	NM_080927		98518298	-1	tier1	-	no_errors	ENST00000326857	ensembl	human	known	74_37	missense	24.05	60	19	SNP	0.997	G
DCUN1D3	123879	genome.wustl.edu	37	16	20873771	20873771	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:20873771G>T	ENST00000324344.4	-	2	375	c.90C>A	c.(88-90)agC>agA	p.S30R	DCUN1D3_ENST00000563934.1_Missense_Mutation_p.S30R|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	30					negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		CACCCCTCCTGCTATGTGACT	0.597																																																	0													226.0	206.0	213.0					16																	20873771		2201	4300	6501	SO:0001583	missense	0			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.90C>A	16.37:g.20873771G>T	ENSP00000319482:p.Ser30Arg		B3KVY4	Missense_Mutation	SNP	pfam_PONY_dom	p.S30R	ENST00000324344.4	37	c.90	CCDS10592.1	16	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869578	0.33069	.	.	ENSG00000188215	ENST00000324344	.	.	.	6.07	-1.09	0.09904	.	0.413204	0.33496	N	0.004857	T	0.30417	0.0764	L	0.44542	1.39	0.32591	N	0.527161	B	0.23128	0.08	B	0.17433	0.018	T	0.30268	-0.9984	9	0.15066	T	0.55	-8.3878	7.4078	0.27001	0.3405:0.1097:0.5498:0.0	.	30	Q8IWE4	DCNL3_HUMAN	R	30	.	ENSP00000319482:S30R	S	-	3	2	DCUN1D3	20781272	1.000000	0.71417	0.867000	0.34043	0.956000	0.61745	0.683000	0.25349	-0.036000	0.13669	0.655000	0.94253	AGC	DCUN1D3	-	NULL	ENSG00000188215		0.597	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D3	HGNC	protein_coding	OTTHUMT00000254415.2	-	0.00	58	0	G	NM_173475		20873771	-1	tier1	-	no_errors	ENST00000324344	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.994	T
DENND2C	163259	genome.wustl.edu	37	1	115127988	115127989	+	3'UTR	INS	-	-	A	rs375699722		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:115127988_115127989insA	ENST00000393274.1	-	0	3644_3645				DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_3'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C						positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGGCTGCTATAAAAAAAAAAT	0.406																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.*233->T	1.37:g.115127998_115127998dupA			B1AL26|Q5TCX6|Q6P3R3	RNA	INS	-	NULL	ENST00000393274.1	37	NULL	CCDS58018.1	1																																																																																			DENND2C	-	-	ENSG00000175984		0.406	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1		0.00	13	0	-	NM_198459		115127989	-1	tier1		no_errors	ENST00000495031	ensembl	human	known	74_37	rna	17.65	28	6	INS	0.000:0.000	A
DLG2	1740	genome.wustl.edu	37	11	83877920	83877920	+	Intron	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:83877920C>A	ENST00000532653.1	-	4	561				DLG2_ENST00000537455.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000398301.2_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000330014.6_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000531015.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)						nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATATGATTTTCAATTCCTTTT	0.348																																																	0																																										SO:0001627	intron_variant	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.259-3366G>T	11.37:g.83877920C>A			B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	RNA	SNP	-	NULL	ENST00000532653.1	37	NULL		11																																																																																			DLG2	-	-	ENSG00000150672		0.348	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	-	0.00	50	0	C	NM_001364		83877920	-1	tier1	-	no_errors	ENST00000524941	ensembl	human	known	74_37	rna	45.33	41	34	SNP	0.000	A
DNAH5	1767	genome.wustl.edu	37	5	13864573	13864573	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:13864573C>T	ENST00000265104.4	-	28	4633	c.4529G>A	c.(4528-4530)gGg>gAg	p.G1510E	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1510	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCTTTCATTCCCCACATCCAG	0.473									Kartagener syndrome																																								0													72.0	72.0	72.0					5																	13864573		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4529G>A	5.37:g.13864573C>T	ENSP00000265104:p.Gly1510Glu		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G1510E	ENST00000265104.4	37	c.4529	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	0.058	-1.230663	0.01518	.	.	ENSG00000039139	ENST00000265104	T	0.59906	0.23	5.32	4.33	0.51752	Dynein heavy chain, domain-2 (1);	0.221994	0.44688	D	0.000425	T	0.10252	0.0251	N	0.00025	-2.685	0.31319	N	0.686252	B	0.02656	0.0	B	0.04013	0.001	T	0.43294	-0.9400	10	0.02654	T	1	.	3.4722	0.07571	0.0:0.6297:0.0:0.3703	.	1510	Q8TE73	DYH5_HUMAN	E	1510	ENSP00000265104:G1510E	ENSP00000265104:G1510E	G	-	2	0	DNAH5	13917573	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	2.763000	0.47605	2.488000	0.83962	0.632000	0.83419	GGG	DNAH5	-	pfam_Dynein_heavy_dom-2	ENSG00000039139		0.473	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	37	0	C	NM_001369		13864573	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	5.80	130	8	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118506235	118506235	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:118506235G>T	ENST00000311085.8	+	24	5829	c.5749G>T	c.(5749-5751)Gat>Tat	p.D1917Y	DMXL1_ENST00000539542.1_Missense_Mutation_p.D1917Y	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1917										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TGCAAGGGAAGATAAGTCTTC	0.388																																																	0													118.0	115.0	116.0					5																	118506235		2202	4300	6502	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.5749G>T	5.37:g.118506235G>T	ENSP00000309690:p.Asp1917Tyr			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1917Y	ENST00000311085.8	37	c.5749	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	8.929	0.962898	0.18583	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10763	2.84;2.84	5.68	4.73	0.59995	.	0.561145	0.20319	N	0.094675	T	0.08626	0.0214	N	0.16656	0.425	0.36248	D	0.853745	B;B	0.20164	0.042;0.025	B;B	0.24269	0.052;0.022	T	0.16512	-1.0400	10	0.56958	D	0.05	-8.0199	13.6401	0.62246	0.0:0.1021:0.7564:0.1414	.	1917;1917	F5H269;Q9Y485	.;DMXL1_HUMAN	Y	1917	ENSP00000309690:D1917Y;ENSP00000439479:D1917Y	ENSP00000309690:D1917Y	D	+	1	0	DMXL1	118534134	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	3.469000	0.53093	2.679000	0.91253	0.557000	0.71058	GAT	DMXL1	-	NULL	ENSG00000172869		0.388	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	50	0	G	NM_005509		118506235	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.789	T
DNAH6	1768	genome.wustl.edu	37	2	84937415	84937415	+	Missense_Mutation	SNP	A	A	C	rs61752525	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:84937415A>C	ENST00000237449.6	+	55	9265	c.9257A>C	c.(9256-9258)aAc>aCc	p.N3086T	DNAH6_ENST00000389394.3_Missense_Mutation_p.N3086T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3086	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AAACAGGCAAACCGTTGGATA	0.363																																																	0													202.0	176.0	184.0					2																	84937415		692	1591	2283	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9257A>C	2.37:g.84937415A>C	ENSP00000237449:p.Asn3086Thr		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.N3086T	ENST00000237449.6	37	c.9257	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114773	0.77210	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.21031	2.03;2.03	5.11	5.11	0.69529	.	0.000000	0.49916	D	0.000135	T	0.34629	0.0904	M	0.72576	2.205	0.80722	D	1	P	0.47106	0.89	P	0.49252	0.604	T	0.17531	-1.0366	10	0.66056	D	0.02	.	14.1696	0.65500	1.0:0.0:0.0:0.0	rs61752525	3086	Q9C0G6	DYH6_HUMAN	T	3086	ENSP00000374045:N3086T;ENSP00000237449:N3086T	ENSP00000237449:N3086T	N	+	2	0	DNAH6	84790926	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.205000	0.77881	2.054000	0.61138	0.528000	0.53228	AAC	DNAH6	-	superfamily_P-loop_NTPase	ENSG00000115423		0.363	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	36	0	A	NM_001370		84937415	+1	tier1	rs61752525	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	35.09	37	20	SNP	1.000	C
DNAJC12	56521	genome.wustl.edu	37	10	69565494	69565494	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:69565494C>G	ENST00000225171.2	-	4	501	c.349G>C	c.(349-351)Gac>Cac	p.D117H	RNU6-1250P_ENST00000391218.1_RNA|DNAJC12_ENST00000483798.2_Missense_Mutation_p.D147H	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	117										breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						TGAGTCTTGTCAGATTCTTCC	0.368																																																	0													123.0	125.0	124.0					10																	69565494		2203	4300	6503	SO:0001583	missense	0			AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.349G>C	10.37:g.69565494C>G	ENSP00000225171:p.Asp117His		Q5JVQ1|Q9UKB2	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.D117H	ENST00000225171.2	37	c.349	CCDS7271.1	10	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315455	0.40996	.	.	ENSG00000108176	ENST00000225171	T	0.29142	1.58	5.72	3.85	0.44370	.	0.579370	0.20224	N	0.096636	T	0.41143	0.1146	L	0.57536	1.79	0.80722	D	1	P	0.51240	0.943	P	0.52856	0.711	T	0.24190	-1.0167	10	0.45353	T	0.12	-8.2937	11.7818	0.52020	0.0:0.8514:0.0:0.1486	.	117	Q9UKB3	DJC12_HUMAN	H	117	ENSP00000225171:D117H	ENSP00000225171:D117H	D	-	1	0	DNAJC12	69235500	0.978000	0.34361	0.520000	0.27837	0.118000	0.20060	1.633000	0.37113	1.400000	0.46741	0.655000	0.94253	GAC	DNAJC12	-	NULL	ENSG00000108176		0.368	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC12	HGNC	protein_coding	OTTHUMT00000048291.1	-	0.00	68	0	C	NM_021800		69565494	-1	tier1	-	no_errors	ENST00000225171	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.770	G
DOCK9	23348	genome.wustl.edu	37	13	99607799	99607799	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:99607799G>T	ENST00000376460.1	-	2	213	c.133C>A	c.(133-135)Cca>Aca	p.P45T	DOCK9_ENST00000448493.2_Missense_Mutation_p.P57T|DOCK9_ENST00000339416.2_Missense_Mutation_p.P46T|DOCK9_ENST00000442173.1_Missense_Mutation_p.P45T	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	46					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ATTAGCTTTGGCTTTGCCTGG	0.403																																																	0													86.0	78.0	80.0					13																	99607799		1907	4119	6026	SO:0001583	missense	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.133C>A	13.37:g.99607799G>T	ENSP00000365643:p.Pro45Thr		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P46T	ENST00000376460.1	37	c.136	CCDS45062.1	13	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495355	0.64186	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173;ENST00000427887	T;T;T;T	0.21031	2.4;2.45;2.03;2.08	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.38612	0.1047	M	0.70595	2.14	0.80722	D	1	B;P;P;B	0.39964	0.325;0.468;0.697;0.103	B;B;P;B	0.49477	0.299;0.241;0.612;0.041	T	0.05037	-1.0910	9	.	.	.	.	17.9484	0.89045	0.0:0.0:1.0:0.0	.	46;45;45;46	A6H8Z6;E9PFM9;Q9BZ29-5;Q9BZ29	.;.;.;DOCK9_HUMAN	T	45;46;46;46;45;46;57;45;46	ENSP00000365643:P45T;ENSP00000341086:P46T;ENSP00000401958:P57T;ENSP00000406883:P45T	.	P	-	1	0	DOCK9	98405800	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.841000	0.92131	2.534000	0.85438	0.561000	0.74099	CCA	DOCK9	-	NULL	ENSG00000088387		0.403	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	-	0.00	54	0	G	NM_015296		99607799	-1	tier1	-	no_errors	ENST00000339416	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
DSE	29940	genome.wustl.edu	37	6	116579745	116579745	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:116579745G>C	ENST00000540275.1	+	2	260	c.139G>C	c.(139-141)Gat>Cat	p.D47H	RP3-486I3.7_ENST00000448740.2_lincRNA			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	0					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TGGCAGCATTGATGAGCTCCT	0.557																																																	0																																										SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000540275.1:c.139G>C	6.37:g.116579745G>C	ENSP00000446378:p.Asp47His		Q5R3K6	Missense_Mutation	SNP	NULL	p.D47H	ENST00000540275.1	37	c.139		6	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881088	0.33255	.	.	ENSG00000111817	ENST00000540275	.	.	.	2.61	1.71	0.24356	.	.	.	.	.	T	0.46521	0.1397	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50808	-0.8784	5	0.87932	D	0	.	4.9591	0.14057	0.3069:0.0:0.6931:0.0	.	.	.	.	H	47	.	ENSP00000446378:D47H	D	+	1	0	DSE	116686438	1.000000	0.71417	0.856000	0.33681	0.968000	0.65278	2.998000	0.49465	0.447000	0.26695	0.420000	0.28162	GAT	DSE	-	NULL	ENSG00000111817		0.557	DSE-203	KNOWN	basic	protein_coding	DSE	HGNC	protein_coding		-	0.00	30	0	G	NM_013352		116579745	+1	tier1	-	no_errors	ENST00000540275	ensembl	human	known	74_37	missense	75.00	4	12	SNP	1.000	C
DTX2	113878	genome.wustl.edu	37	7	76129758	76129758	+	Splice_Site	SNP	G	G	A	rs147644708		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:76129758G>A	ENST00000324432.5	+	8	1661	c.1151G>A	c.(1150-1152)gGa>gAa	p.G384E	DTX2_ENST00000307569.8_Splice_Site_p.G337E|DTX2_ENST00000430490.2_Splice_Site_p.G384E|DTX2_ENST00000446600.1_Splice_Site_p.G293E|DTX2_ENST00000446820.2_Splice_Site_p.G337E|DTX2_ENST00000413936.2_Splice_Site_p.G384E	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	384			G -> E (in dbSNP:rs1638152). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:12670957, ECO:0000269|PubMed:15489334}.		Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						TCTCTTCTAGGAGCGACCCCG	0.567																																																	0													2.0	3.0	3.0					7																	76129758		1198	3039	4237	SO:0001630	splice_region_variant	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1151-1G>A	7.37:g.76129758G>A			Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.G384E	ENST00000324432.5	37	c.1151	CCDS5587.1	7	.	.	.	.	.	.	.	.	.	.	.	9.359	1.067449	0.20067	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	T;T;T;T;T;T	0.11821	2.84;2.74;2.84;2.84;2.84;2.74	4.31	2.26	0.28386	.	0.555878	0.18661	N	0.134738	T	0.18002	0.0432	L	0.29908	0.895	0.36128	P	0.15403599999999995	B;D;D;B	0.89917	0.009;0.986;1.0;0.003	B;P;D;B	0.77557	0.009;0.796;0.99;0.004	T	0.18461	-1.0336	9	0.20046	T	0.44	.	5.3155	0.15852	0.1218:0.3006:0.5776:0.0	.	293;15;337;384	F5GX89;Q6P2H0;Q86UW9-2;Q86UW9	.;.;.;DTX2_HUMAN	E	384;337;293;293;384;384;337	ENSP00000322885:G384E;ENSP00000305242:G337E;ENSP00000397648:G293E;ENSP00000390218:G384E;ENSP00000411986:G384E;ENSP00000392545:G337E	ENSP00000305242:G337E	G	+	2	0	AC005522.1	75967694	0.730000	0.28100	0.990000	0.47175	0.470000	0.32858	1.148000	0.31614	1.091000	0.41335	0.655000	0.94253	GGA	DTX2	-	NULL	ENSG00000091073		0.567	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	HGNC	protein_coding	OTTHUMT00000253104.2	-	0.00	29	0	G		Missense_Mutation	76129758	+1	tier1	rs147644708	no_errors	ENST00000324432	ensembl	human	known	74_37	missense	29.41	12	5	SNP	0.938	A
DYSF	8291	genome.wustl.edu	37	2	71801357	71801357	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:71801357C>T	ENST00000258104.3	+	30	3481	c.3204C>T	c.(3202-3204)ggC>ggT	p.G1068G	DYSF_ENST00000409366.1_Silent_p.G1069G|DYSF_ENST00000409762.1_Silent_p.G1085G|DYSF_ENST00000409651.1_Silent_p.G1100G|DYSF_ENST00000409744.1_Silent_p.G1055G|DYSF_ENST00000410020.3_Silent_p.G1086G|DYSF_ENST00000394120.2_Silent_p.G1069G|DYSF_ENST00000409582.3_Silent_p.G1085G|DYSF_ENST00000413539.2_Silent_p.G1099G|DYSF_ENST00000429174.2_Silent_p.G1068G|DYSF_ENST00000410041.1_Silent_p.G1086G	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1068	Arg-rich.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGGGCGAGGGCTGGGAGTACG	0.667																																																	0													58.0	69.0	65.0					2																	71801357		2203	4300	6503	SO:0001819	synonymous_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3204C>T	2.37:g.71801357C>T			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.G1099	ENST00000258104.3	37	c.3297	CCDS1918.1	2																																																																																			DYSF	-	smart_Peroxin/Ferlin	ENSG00000135636		0.667	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	-	0.00	74	0	C	NM_003494		71801357	+1	tier1	-	no_errors	ENST00000413539	ensembl	human	known	74_37	silent	65.91	20	58	SNP	1.000	T
EFHC2	80258	genome.wustl.edu	37	X	44007976	44007976	+	3'UTR	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:44007976C>G	ENST00000420999.1	-	0	2398				EFHC2_ENST00000343571.3_5'UTR	NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2								calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						GAAATTATATCTACTAAAGTA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.*65G>C	X.37:g.44007976C>G			Q5JST8|Q68DK4|Q8NEI0|Q9H653	RNA	SNP	-	NULL	ENST00000420999.1	37	NULL	CCDS55405.1	X																																																																																			EFHC2	-	-	ENSG00000183690		0.299	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	EFHC2	HGNC	protein_coding	OTTHUMT00000056312.2	-	0.00	33	0	C	NM_025184		44007976	-1	tier1	-	no_errors	ENST00000343571	ensembl	human	known	74_37	rna	64.86	13	24	SNP	0.001	G
EIF3A	8661	genome.wustl.edu	37	10	120801701	120801701	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:120801701G>T	ENST00000369144.3	-	19	3458	c.3331C>A	c.(3331-3333)Cga>Aga	p.R1111R	EIF3A_ENST00000541549.1_Silent_p.R1077R	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TCCAACCCTCGCCTGGGACCC	0.622																																																	0													140.0	141.0	141.0					10																	120801701		2203	4300	6503	SO:0001819	synonymous_variant	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3331C>A	10.37:g.120801701G>T			B7ZBG9|Q6IBN8|Q96TD5	Silent	SNP	pfam_PCI_dom,smart_PCI_dom	p.R1111	ENST00000369144.3	37	c.3331	CCDS7608.1	10																																																																																			EIF3A	-	NULL	ENSG00000107581		0.622	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1		0.00	44	0	G	NM_003750		120801701	-1			no_errors	ENST00000369144	ensembl	human	known	74_37	silent	6.98	40	3	SNP	1.000	T
EIF5B	9669	genome.wustl.edu	37	2	100015804	100015804	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:100015804G>T	ENST00000289371.6	+	24	3792	c.3590G>T	c.(3589-3591)tGg>tTg	p.W1197L		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	1197					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTCAAAGACTGGTTCAGAGAT	0.453																																					Colon(162;2388 2567 2705 3444)												0													128.0	118.0	121.0					2																	100015804		1935	4153	6088	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.3590G>T	2.37:g.100015804G>T	ENSP00000289371:p.Trp1197Leu		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.W1197L	ENST00000289371.6	37	c.3590	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116787	0.77323	.	.	ENSG00000158417	ENST00000289371	T	0.40756	1.02	6.08	6.08	0.98989	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	.	.	.	.	T	0.42653	0.1212	L	0.46157	1.445	0.80722	D	1	P	0.45634	0.863	B	0.41236	0.351	T	0.13229	-1.0517	8	.	.	.	-7.9878	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1197	O60841	IF2P_HUMAN	L	1197	ENSP00000289371:W1197L	.	W	+	2	0	EIF5B	99382236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.760000	0.98935	2.894000	0.99253	0.655000	0.94253	TGG	EIF5B	-	superfamily_Transl_B-barrel	ENSG00000158417		0.453	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	-	0.00	43	0	G	NM_015904		100015804	+1	tier1	-	no_errors	ENST00000289371	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
EMB	133418	genome.wustl.edu	37	5	49736952	49736952	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:49736952C>T	ENST00000303221.5	-	1	249	c.34G>A	c.(34-36)Gcg>Acg	p.A12T	EMB_ENST00000506190.1_Intron|EMB_ENST00000508934.1_Missense_Mutation_p.A12T	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	12					cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				GGCGTACGCGCCCTGGCCTCC	0.741																																																	0													4.0	4.0	4.0					5																	49736952		1564	2795	4359	SO:0001583	missense	0			BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.34G>A	5.37:g.49736952C>T	ENSP00000302289:p.Ala12Thr		B7Z6S3|B7Z902	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A12T	ENST00000303221.5	37	c.34	CCDS3953.1	5	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911648	0.72983	.	.	ENSG00000170571	ENST00000303221;ENST00000510295;ENST00000508934	T;T	0.50548	0.86;0.74	3.25	3.25	0.37280	.	0.613450	0.12358	U	0.475928	T	0.33818	0.0876	N	0.24115	0.695	0.37965	D	0.933087	B;P	0.35107	0.345;0.484	B;B	0.37198	0.133;0.243	T	0.18903	-1.0322	9	.	.	.	-1.4178	10.1893	0.43017	0.0:1.0:0.0:0.0	.	12;12	D6RDX7;Q6PCB8	.;EMB_HUMAN	T	12	ENSP00000302289:A12T;ENSP00000425215:A12T	.	A	-	1	0	EMB	49772709	0.010000	0.17322	0.011000	0.14972	0.025000	0.11179	2.737000	0.47393	1.826000	0.53198	0.184000	0.17185	GCG	EMB	-	NULL	ENSG00000170571		0.741	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMB	HGNC	protein_coding	OTTHUMT00000253853.1	-	0.00	20	0	C	NM_198449		49736952	-1	tier1	-	no_errors	ENST00000303221	ensembl	human	known	74_37	missense	44.44	10	8	SNP	0.020	T
AC026700.1	0	genome.wustl.edu	37	5	84823942	84823942	+	RNA	SNP	G	G	A	rs368649367		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:84823942G>A	ENST00000401134.1	-	0	10																											acatgcacatgcacacacaca	0.343																																																	0																																												0																															5.37:g.84823942G>A				RNA	SNP	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			AC026700.1	-	-	ENSG00000215953		0.343	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	Clone_based_ensembl_gene	miRNA		-	0.00	33	0	G			84823942	-1	tier1	-	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	13.16	32	5	SNP	0.022	A
MPP7	143098	genome.wustl.edu	37	10	28599876	28599876	+	RNA	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:28599876C>A	ENST00000410442.1	+	0	95																											ATATTTTTCTCTTAGCTAAAA	0.358																																																	0																																												0																															10.37:g.28599876C>A				RNA	SNP	-	NULL	ENST00000410442.1	37	NULL		10																																																																																			AC022021.1	-	-	ENSG00000222374		0.358	AC022021.1-201	NOVEL	basic	miRNA	ENSG00000222374	Clone_based_ensembl_gene	miRNA		-	0.00	34	0	C			28599876	+1	tier1	-	no_errors	ENST00000410442	ensembl	human	novel	74_37	rna	19.70	53	13	SNP	0.034	A
NRIP1	8204	genome.wustl.edu	37	21	16333779	16333779	+	3'UTR	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr21:16333779T>C	ENST00000400202.1	-	0	7447				AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_3'UTR|NRIP1_ENST00000318948.4_3'UTR			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1						androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		AATGTGCCTATATTCCAGTAT	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.*3258A>G	21.37:g.16333779T>C			Q8IWE8	RNA	SNP	-	NULL	ENST00000400202.1	37	NULL	CCDS13568.1	21																																																																																			AF127577.10	-	-	ENSG00000229047		0.294	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000229047	Clone_based_vega_gene	protein_coding	OTTHUMT00000157926.1	-	0.00	44	0	T	NM_003489		16333779	+1	tier1	-	no_errors	ENST00000446301	ensembl	human	known	74_37	rna	35.48	20	11	SNP	0.996	C
PMS2P5	5383	genome.wustl.edu	37	7	74312033	74312033	+	RNA	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:74312033G>A	ENST00000459002.1	+	0	98																											cttgactagTGTAAGGAAAAA	0.323																																																	0																																												0																															7.37:g.74312033G>A				RNA	SNP	-	NULL	ENST00000459002.1	37	NULL		7																																																																																			Y_RNA	-	-	ENSG00000239069		0.323	Y_RNA.717-201	NOVEL	basic	misc_RNA	ENSG00000239069	RFAM	misc_RNA		-	0.00	35	0	G			74312033	+1	tier1	-	no_errors	ENST00000459002	ensembl	human	novel	74_37	rna	10.53	34	4	SNP	0.051	A
LINC01330	646168	genome.wustl.edu	37	3	167630684	167630684	+	lincRNA	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:167630684G>A	ENST00000481578.1	+	0	483																											AAACTGGGAAGACTGCAAGGT	0.333																																																	0																																												0																															3.37:g.167630684G>A				RNA	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			RP11-298O21.5	-	-	ENSG00000244227		0.333	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	-	0.00	61	0	G			167630684	+1	tier1	-	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	20.25	63	16	SNP	1.000	A
RP11-807H22.7	0	genome.wustl.edu	37	11	71883646	71883646	+	RNA	SNP	G	G	A	rs542921244	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:71883646G>A	ENST00000378140.3	-	0	419				RP11-807H22.6_ENST00000539482.1_RNA																							CCCCGAGGACGAGCTGTATGG	0.602													g|||	2	0.000399361	0.0015	0.0	5008	,	,		19883	0.0		0.0	False		,,,				2504	0.0																0																																												0																															11.37:g.71883646G>A				RNA	SNP	-	NULL	ENST00000378140.3	37	NULL		11																																																																																			RP11-807H22.6	-	-	ENSG00000255860		0.602	RP11-807H22.7-001	KNOWN	basic|exp_conf	antisense	ENSG00000255860	Clone_based_vega_gene	antisense	OTTHUMT00000396768.1	-	0.00	33	0	G			71883646	+1	tier1	-	no_errors	ENST00000539482	ensembl	human	known	74_37	rna	25.00	24	8	SNP	0.039	A
MMP25	64386	genome.wustl.edu	37	16	3105828	3105828	+	Intron	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:3105828C>G	ENST00000336577.4	+	5	898				RP11-473M20.7_ENST00000573953.1_RNA|RP11-473M20.7_ENST00000570949.1_RNA|RP11-473M20.7_ENST00000572574.1_RNA|RP11-473M20.7_ENST00000576250.1_RNA|RP11-473M20.7_ENST00000572427.1_RNA|RP11-473M20.7_ENST00000573130.1_RNA|MMP25_ENST00000570755.1_Intron|RP11-473M20.7_ENST00000572930.1_RNA|RP11-473M20.7_ENST00000572222.1_RNA|RP11-473M20.7_ENST00000597579.1_RNA|RP11-473M20.7_ENST00000573878.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25						negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	TTGGTCTCTTCAGGCCTCTCA	0.617																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0																																										SO:0001627	intron_variant	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.662-1206C>G	16.37:g.3105828C>G			Q96F04|Q96TE2	RNA	SNP	-	NULL	ENST00000336577.4	37	NULL	CCDS10492.1	16																																																																																			RP11-473M20.7	-	-	ENSG00000261971		0.617	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261971	Clone_based_vega_gene	protein_coding	OTTHUMT00000437116.1	-	0.00	32	0	C	NM_022468		3105828	-1	tier1	-	no_errors	ENST00000570949	ensembl	human	known	74_37	rna	70.73	12	29	SNP	0.000	G
EPS15	2060	genome.wustl.edu	37	1	51875221	51875221	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:51875221C>T	ENST00000371733.3	-	14	1357	c.1261G>A	c.(1261-1263)Gag>Aag	p.E421K	EPS15_ENST00000371730.2_Missense_Mutation_p.E421K|EPS15_ENST00000396122.4_Missense_Mutation_p.E98K|EPS15_ENST00000493793.1_5'UTR	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	421					cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						TGGGCCTCCTCAGCACATTTC	0.468			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											153.0	131.0	138.0					1																	51875221		2203	4300	6503	SO:0001583	missense	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1261G>A	1.37:g.51875221C>T	ENSP00000360798:p.Glu421Lys		B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.E421K	ENST00000371733.3	37	c.1261	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928051	0.92389	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000396122	D;D;T	0.85629	-2.01;-2.01;2.19	5.75	4.81	0.61882	.	0.000000	0.32736	N	0.005713	D	0.91129	0.7207	M	0.65975	2.015	0.54753	D	0.999983	D;D;D	0.76494	0.997;0.978;0.999	D;P;D	0.83275	0.98;0.73;0.996	D	0.90218	0.4269	10	0.41790	T	0.15	.	16.8714	0.86041	0.0:0.8722:0.1277:0.0	.	421;421;107	B1AUU8;P42566;P42566-2	.;EPS15_HUMAN;.	K	421;421;98	ENSP00000360795:E421K;ENSP00000360798:E421K;ENSP00000379428:E98K	ENSP00000360795:E421K	E	-	1	0	EPS15	51647809	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	2.601000	0.46249	2.711000	0.92665	0.563000	0.77884	GAG	EPS15	-	NULL	ENSG00000085832		0.468	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	-	0.00	51	0	C	NM_001981		51875221	-1	tier1	-	no_errors	ENST00000371733	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ERBB2IP	55914	genome.wustl.edu	37	5	65350089	65350089	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:65350089C>A	ENST00000284037.5	+	21	3332	c.2943C>A	c.(2941-2943)taC>taA	p.Y981*	ERBB2IP_ENST00000506030.1_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000508515.1_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000380939.2_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000380938.2_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000380943.2_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000380936.1_Nonsense_Mutation_p.Y981*|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000511297.1_Nonsense_Mutation_p.Y977*|ERBB2IP_ENST00000380935.1_Nonsense_Mutation_p.Y981*	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	981					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ATATCCAATACAGTAGCAGTG	0.443																																																	0													64.0	69.0	67.0					5																	65350089		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2943C>A	5.37:g.65350089C>A	ENSP00000284037:p.Tyr981*		A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.Y981*	ENST00000284037.5	37	c.2943	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.155539	0.98680	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	.	.	.	5.56	0.553	0.17235	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4281	0.38592	0.0:0.5693:0.0:0.4307	.	.	.	.	X	981;981;981;981;981;981;977;981;981	.	ENSP00000284037:Y981X	Y	+	3	2	ERBB2IP	65385845	0.969000	0.33509	0.989000	0.46669	0.957000	0.61999	0.173000	0.16724	-0.203000	0.10251	-0.982000	0.02568	TAC	ERBB2IP	-	NULL	ENSG00000112851		0.443	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	-	0.00	21	0	C	NM_018695		65350089	+1	tier1	-	no_errors	ENST00000284037	ensembl	human	known	74_37	nonsense	23.33	23	7	SNP	1.000	A
ERCC1	2067	genome.wustl.edu	37	19	45922395	45922395	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:45922395C>A	ENST00000300853.3	-	5	1077	c.486G>T	c.(484-486)aaG>aaT	p.K162N	ERCC1_ENST00000340192.7_Missense_Mutation_p.K162N|ERCC1_ENST00000013807.5_Missense_Mutation_p.K162N|ERCC1_ENST00000589165.1_Missense_Mutation_p.K162N|ERCC1_ENST00000423698.2_Missense_Mutation_p.K90N|ERCC1_ENST00000591636.1_Missense_Mutation_p.K162N	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	162					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		AGGCGAAGTTCTTCCCCAGGC	0.627								Nucleotide excision repair (NER)																																									0													69.0	56.0	60.0					19																	45922395		2202	4299	6501	SO:0001583	missense	0				CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.486G>T	19.37:g.45922395C>A	ENSP00000300853:p.Lys162Asn		B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	pfam_DNA_repair_Rad10,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,tigrfam_DNA_repair_Rad10	p.K162N	ENST00000300853.3	37	c.486	CCDS12662.1	19	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317851	0.81469	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000423698;ENST00000013807	T;T;T;T	0.52295	0.71;0.67;0.75;0.68	4.71	4.71	0.59529	Restriction endonuclease, type II-like (1);	0.191250	0.46442	D	0.000290	T	0.55940	0.1952	L	0.42632	1.34	0.43819	D	0.996382	D;P;D;D	0.67145	0.996;0.723;0.981;0.991	P;B;P;P	0.61132	0.884;0.241;0.844;0.884	T	0.56613	-0.7950	10	0.49607	T	0.09	-29.6619	13.1551	0.59511	0.0:1.0:0.0:0.0	.	162;90;162;162	Q7Z7F5;B3KRR0;Q96S40;P07992	.;.;.;ERCC1_HUMAN	N	162;162;90;162	ENSP00000300853:K162N;ENSP00000345203:K162N;ENSP00000394875:K90N;ENSP00000013807:K162N	ENSP00000013807:K162N	K	-	3	2	ERCC1	50614235	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.968000	0.49224	2.159000	0.67721	0.462000	0.41574	AAG	ERCC1	-	pfam_DNA_repair_Rad10,superfamily_Restrct_endonuc-II-like,tigrfam_DNA_repair_Rad10	ENSG00000012061		0.627	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC1	HGNC	protein_coding	OTTHUMT00000459542.1	-	0.00	26	0	C	NM_001983		45922395	-1	tier1	-	no_errors	ENST00000013807	ensembl	human	known	74_37	missense	40.74	16	11	SNP	1.000	A
ERVK13-1	100507321	genome.wustl.edu	37	16	2712500	2712501	+	RNA	INS	-	-	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:2712500_2712501insT	ENST00000568395.1	-	0	4226_4227					NR_040023.1		Q9NX77	ENK13_HUMAN	endogenous retrovirus group K13, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)	structural molecule activity (GO:0005198)										agcataaggtatttttgctgga	0.416																																																	0																																												0					16p13.3	2011-12-16				ENSG00000260565			27548	other	endogenous retrovirus	"""HERV-K_16p3.3 provirus ancestral Env polyprotein"""						Standard	NR_040023		Approved		uc010bss.2	Q9NX77			16.37:g.2712505_2712505dupT			A8K9G3	RNA	INS	-	NULL	ENST00000568395.1	37	NULL		16																																																																																			ERVK13-1	-	-	ENSG00000260565		0.416	ERVK13-1-001	KNOWN	basic	lincRNA	ERVK13-1	HGNC	processed_transcript	OTTHUMT00000431428.1		0.00	47	0	-	NR_040023		2712501	-1	tier1		no_errors	ENST00000568395	ensembl	human	known	74_37	rna	13.79	25	4	INS	0.093:0.090	T
ESPNP	284729	genome.wustl.edu	37	1	17017676	17017676	+	RNA	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:17017676C>T	ENST00000492551.1	-	0	2015					NR_026567.1				espin pseudogene																		AGTCAAGACCCGCTGCCAGGC	0.662																																																	0																																												0			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17017676C>T				RNA	SNP	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			ESPNP	-	-	ENSG00000268869		0.662	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	HGNC	pseudogene	OTTHUMT00000326311.1	-	0.00	151	0	C			17017676	-1	tier1	-	no_errors	ENST00000414828	ensembl	human	putative	74_37	rna	27.71	120	46	SNP	0.000	T
ETFDH	2110	genome.wustl.edu	37	4	159627784	159627784	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:159627784C>T	ENST00000511912.1	+	12	1804	c.1472C>T	c.(1471-1473)tCt>tTt	p.S491F	ETFDH_ENST00000307738.5_Missense_Mutation_p.S444F	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	491					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		GTTGAAGGTTCTGACTTTGAA	0.373																																																	0													138.0	134.0	135.0					4																	159627784		2203	4300	6503	SO:0001583	missense	0			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1472C>T	4.37:g.159627784C>T	ENSP00000426638:p.Ser491Phe		B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	pfam_ETFD_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Pyridine_nuc-diS_OxRdtase_2	p.S491F	ENST00000511912.1	37	c.1472	CCDS3800.1	4	.	.	.	.	.	.	.	.	.	.	C	13.52	2.260650	0.39995	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	D;D	0.94417	-3.42;-3.42	5.89	3.14	0.36123	.	0.892392	0.09929	N	0.737428	D	0.92153	0.7512	L	0.43152	1.355	0.09310	N	0.999994	B;B;B	0.29766	0.256;0.256;0.176	B;B;B	0.37144	0.195;0.126;0.242	D	0.84711	0.0734	10	0.72032	D	0.01	-2.9529	7.5921	0.28027	0.0:0.6081:0.2565:0.1353	.	444;430;491	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	F	491;444	ENSP00000426638:S491F;ENSP00000303552:S444F	ENSP00000303552:S444F	S	+	2	0	ETFDH	159847234	0.000000	0.05858	0.977000	0.42913	0.994000	0.84299	0.741000	0.26202	0.348000	0.23949	0.591000	0.81541	TCT	ETFDH	-	pfam_ETFD_OxRdtase	ENSG00000171503		0.373	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFDH	HGNC	protein_coding	OTTHUMT00000365718.2	-	0.00	57	0	C			159627784	+1	tier1	-	no_errors	ENST00000511912	ensembl	human	known	74_37	missense	54.00	23	27	SNP	0.042	T
FAM151A	338094	genome.wustl.edu	37	1	55089016	55089016	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:55089016C>T	ENST00000302250.2	-	1	213	c.53G>A	c.(52-54)gGc>gAc	p.G18D	ACOT11_ENST00000371316.3_Intron|RP11-240D10.4_ENST00000416119.1_RNA|FAM151A_ENST00000371304.2_Missense_Mutation_p.G18D	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	18						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						ACAGGTAATGCCGGCAAACAC	0.597																																																	0													234.0	181.0	199.0					1																	55089016		2203	4300	6503	SO:0001583	missense	0			AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.53G>A	1.37:g.55089016C>T	ENSP00000306888:p.Gly18Asp		Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	pfam_DUF2181	p.G18D	ENST00000302250.2	37	c.53	CCDS594.1	1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429833	0.43122	.	.	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	T;T	0.17213	2.29;2.44	3.53	2.6	0.31112	.	0.749959	0.11828	N	0.525494	T	0.17109	0.0411	L	0.42245	1.32	0.09310	N	1	D	0.54047	0.964	P	0.44811	0.461	T	0.10613	-1.0622	10	0.59425	D	0.04	-6.4856	8.2755	0.31871	0.2364:0.7636:0.0:0.0	.	18	Q8WW52	F151A_HUMAN	D	18	ENSP00000306888:G18D;ENSP00000360353:G18D	ENSP00000294370:G18D	G	-	2	0	FAM151A	54861604	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.922000	0.28734	1.036000	0.39998	-0.182000	0.12963	GGC	FAM151A	-	NULL	ENSG00000162391		0.597	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151A	HGNC	protein_coding	OTTHUMT00000027342.1		0.00	50	0	C	NM_176782		55089016	-1			no_errors	ENST00000302250	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.002	T
FAM178A	55719	genome.wustl.edu	37	10	102672870	102672870	+	Start_Codon_SNP	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:102672870G>T	ENST00000238961.4	+	1	545	c.3G>T	c.(1-3)atG>atT	p.M1I	FAM178A_ENST00000370271.3_Start_Codon_SNP_p.M1I|RP11-179B2.2_ENST00000608554.1_RNA|FAM178A_ENST00000609386.1_Start_Codon_SNP_p.M1I|FAM178A_ENST00000370269.3_Start_Codon_SNP_p.M1I	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	1						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											GCGCCGACATGACAAGGCGCT	0.697																																																	0													23.0	26.0	25.0					10																	102672870		2201	4296	6497	SO:0001582	initiator_codon_variant	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.3G>T	10.37:g.102672870G>T	ENSP00000238961:p.Met1Ile		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.M1I	ENST00000238961.4	37	c.3	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	29.6	5.023072	0.93462	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.52526	0.66;1.31;1.29	5.25	5.25	0.73442	.	0.159461	0.45606	D	0.000346	T	0.66867	0.2833	.	.	.	0.21719	N	0.999577	P;P;D	0.61080	0.954;0.954;0.989	D;D;D	0.72982	0.943;0.943;0.979	T	0.60757	-0.7200	9	0.87932	D	0	-16.5542	14.5433	0.68011	0.0:0.0:1.0:0.0	.	1;1;1	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	I	1	ENSP00000359294:M1I;ENSP00000238961:M1I;ENSP00000359292:M1I	ENSP00000238961:M1I	M	+	3	0	FAM178A	102662860	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.007000	0.49536	2.894000	0.99253	0.591000	0.81541	ATG	FAM178A	-	NULL	ENSG00000119906		0.697	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	-	0.00	44	0	G		Missense_Mutation	102672870	+1	tier1	-	no_errors	ENST00000370269	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48714182	48714182	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:48714182G>T	ENST00000316623.5	-	61	7992	c.7537C>A	c.(7537-7539)Ccc>Acc	p.P2513T		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2513	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTAAATCCGGGAGGACATTTG	0.423																																																	0													115.0	97.0	103.0					15																	48714182		2198	4296	6494	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7537C>A	15.37:g.48714182G>T	ENSP00000325527:p.Pro2513Thr		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.P2513T	ENST00000316623.5	37	c.7537	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374102	0.82573	.	.	ENSG00000166147	ENST00000316623	D	0.92099	-2.97	5.89	5.89	0.94794	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.048812	0.85682	D	0.000000	D	0.89458	0.6721	L	0.31120	0.905	0.80722	D	1	P	0.38300	0.626	B	0.40782	0.34	D	0.87951	0.2723	10	0.37606	T	0.19	.	19.8568	0.96762	0.0:0.0:1.0:0.0	.	2513	P35555	FBN1_HUMAN	T	2513	ENSP00000325527:P2513T	ENSP00000325527:P2513T	P	-	1	0	FBN1	46501474	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.641000	0.74324	2.793000	0.96121	0.655000	0.94253	CCC	FBN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.423	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	37	0	G			48714182	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	26.00	37	13	SNP	1.000	T
FHOD3	80206	genome.wustl.edu	37	18	34298670	34298670	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:34298670G>T	ENST00000359247.4	+	15	2833	c.2833G>T	c.(2833-2835)Gtc>Ttc	p.V945F	FHOD3_ENST00000591635.1_Missense_Mutation_p.V158F|FHOD3_ENST00000257209.4_Missense_Mutation_p.V962F|FHOD3_ENST00000590592.1_Missense_Mutation_p.V1137F|FHOD3_ENST00000592128.1_5'UTR|FHOD3_ENST00000445677.1_Missense_Mutation_p.V924F	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	945	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GGAACTGTCTGTCTCAAAGGT	0.443																																																	0													122.0	126.0	125.0					18																	34298670		2202	4300	6502	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2833G>T	18.37:g.34298670G>T	ENSP00000352186:p.Val945Phe		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.V962F	ENST00000359247.4	37	c.2884		18	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867226	0.72065	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.24723	1.84;1.84;1.84	4.46	4.46	0.54185	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	M	0.67953	2.075	0.80722	D	1	D;D;B	0.76494	0.999;0.999;0.251	D;D;B	0.87578	0.997;0.998;0.176	T	0.48875	-0.8996	10	0.45353	T	0.12	.	15.6858	0.77409	0.0:0.0:1.0:0.0	.	924;945;962	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	F	962;945;924	ENSP00000257209:V962F;ENSP00000352186:V945F;ENSP00000411430:V924F	ENSP00000257209:V962F	V	+	1	0	FHOD3	32552668	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	9.823000	0.99369	2.034000	0.60081	0.555000	0.69702	GTC	FHOD3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000134775		0.443	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1		0.00	27	0	G	XM_371114		34298670	+1			no_errors	ENST00000257209	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
FLJ34503	285759	genome.wustl.edu	37	6	114238199	114238199	+	RNA	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:114238199C>T	ENST00000314481.3	+	0	700					NR_027060.1																						tctacaccctcactagcactt	0.378																																																	0																																												0																															6.37:g.114238199C>T				RNA	SNP	-	NULL	ENST00000314481.3	37	NULL		6																																																																																			RP11-544L8__B.4	-	-	ENSG00000175967		0.378	RP11-544L8__B.4-001	KNOWN	basic	antisense	FLJ34503	Clone_based_vega_gene	antisense	OTTHUMT00000257661.1	-	0.00	25	0	C			114238199	+1	tier1	-	no_errors	ENST00000314481	ensembl	human	known	74_37	rna	60.00	6	9	SNP	0.040	T
FLNB	2317	genome.wustl.edu	37	3	58089741	58089741	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:58089741C>G	ENST00000295956.4	+	10	1704	c.1539C>G	c.(1537-1539)ttC>ttG	p.F513L	FLNB_ENST00000348383.5_Missense_Mutation_p.F513L|FLNB_ENST00000358537.3_Missense_Mutation_p.F513L|FLNB_ENST00000357272.4_Missense_Mutation_p.F513L|FLNB_ENST00000490882.1_Missense_Mutation_p.F513L|FLNB_ENST00000493452.1_Missense_Mutation_p.F344L|FLNB_ENST00000419752.2_Missense_Mutation_p.F344L|FLNB_ENST00000429972.2_Missense_Mutation_p.F513L	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	513					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TCTACGCATTCGAGTATTACC	0.547																																																	0													81.0	81.0	81.0					3																	58089741		2203	4300	6503	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1539C>G	3.37:g.58089741C>G	ENSP00000295956:p.Phe513Leu		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F513L	ENST00000295956.4	37	c.1539	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884734	0.51908	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84;-2.84	6.17	-4.47	0.03525	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.047891	0.85682	D	0.000000	D	0.86990	0.6066	L	0.38175	1.15	0.50813	D	0.999896	B;B;B;B;B;B	0.28552	0.005;0.215;0.003;0.096;0.003;0.003	B;B;B;B;B;B	0.40602	0.022;0.334;0.011;0.105;0.011;0.011	T	0.75534	-0.3284	10	0.48119	T	0.1	.	15.5948	0.76569	0.0:0.1475:0.0:0.8525	.	513;513;344;344;513;513	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	L	513;513;513;513;513;513;344;344	ENSP00000295956:F513L;ENSP00000420213:F513L;ENSP00000351339:F513L;ENSP00000415599:F513L;ENSP00000232447:F513L;ENSP00000349819:F513L;ENSP00000418510:F344L;ENSP00000414532:F344L	ENSP00000295956:F513L	F	+	3	2	FLNB	58064781	1.000000	0.71417	0.899000	0.35326	0.939000	0.58152	0.625000	0.24477	-0.618000	0.05656	-0.768000	0.03414	TTC	FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.547	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	-	0.00	74	0	C	NM_001457		58089741	+1	tier1	-	no_errors	ENST00000295956	ensembl	human	known	74_37	missense	52.94	23	27	SNP	0.974	G
FMN2	56776	genome.wustl.edu	37	1	240421329	240421329	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:240421329C>G	ENST00000319653.9	+	7	4380	c.4150C>G	c.(4150-4152)Cat>Gat	p.H1384D	FMN2_ENST00000545751.1_Intron	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1384	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGACATACAACATGGTAAGTG	0.323																																																	0													76.0	75.0	75.0					1																	240421329		2203	4298	6501	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4150C>G	1.37:g.240421329C>G	ENSP00000318884:p.His1384Asp		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.H1384D	ENST00000319653.9	37	c.4150	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123509	0.37436	.	.	ENSG00000155816	ENST00000319653;ENST00000441342	T;T	0.16457	2.34;2.34	5.42	4.52	0.55395	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.087441	0.48286	D	0.000197	T	0.26955	0.0660	N	0.25286	0.73	0.80722	D	1	B;D;P	0.69078	0.12;0.997;0.823	B;D;P	0.67382	0.098;0.951;0.685	T	0.06023	-1.0850	10	0.72032	D	0.01	.	14.4287	0.67233	0.0:0.9288:0.0:0.0712	.	30;13;1384	F5H2C1;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	D	1384;30	ENSP00000318884:H1384D;ENSP00000388922:H30D	ENSP00000318884:H1384D	H	+	1	0	FMN2	238487952	0.997000	0.39634	1.000000	0.80357	0.964000	0.63967	2.689000	0.46993	1.435000	0.47434	0.561000	0.74099	CAT	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.323	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	41	0	C	XM_371352		240421329	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	21.31	48	13	SNP	1.000	G
FNIP1	96459	genome.wustl.edu	37	5	131042140	131042140	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:131042140T>A	ENST00000510461.1	-	9	973	c.878A>T	c.(877-879)cAa>cTa	p.Q293L	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000511848.1_Missense_Mutation_p.Q293L|FNIP1_ENST00000307954.8_Missense_Mutation_p.Q248L|FNIP1_ENST00000307968.7_Missense_Mutation_p.Q265L	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	293					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		ACTTGTTGTTTGGCTGCGTCG	0.448																																																	0													98.0	94.0	95.0					5																	131042140		2203	4300	6503	SO:0001583	missense	0			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.878A>T	5.37:g.131042140T>A	ENSP00000421985:p.Gln293Leu		D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	NULL	p.Q293L	ENST00000510461.1	37	c.878	CCDS34227.1	5	.	.	.	.	.	.	.	.	.	.	T	33	5.209366	0.95069	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.25749	2.56;2.57;2.54;1.78	5.6	5.6	0.85130	.	.	.	.	.	T	0.45196	0.1330	L	0.48935	1.535	0.80722	D	1	D;D;D;D	0.67145	0.996;0.992;0.996;0.995	D;D;D;D	0.77557	0.99;0.979;0.99;0.92	T	0.32134	-0.9918	9	0.54805	T	0.06	-6.8236	16.0773	0.80976	0.0:0.0:0.0:1.0	.	293;293;265;293	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	L	265;248;53;293;293	ENSP00000309266:Q265L;ENSP00000310453:Q248L;ENSP00000421985:Q293L;ENSP00000425619:Q293L	ENSP00000310453:Q248L	Q	-	2	0	FNIP1	131070039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.254000	0.74563	0.482000	0.46254	CAA	FNIP1	-	NULL	ENSG00000217128		0.448	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP1	HGNC	protein_coding	OTTHUMT00000370077.1	-	0.00	58	0	T	NM_133372		131042140	-1	tier1	-	no_errors	ENST00000510461	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	A
DDX42	11325	genome.wustl.edu	37	17	61897353	61897353	+	IGR	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:61897353G>T	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Splice_Site_p.L785I	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TTCTTGTAGAGACTACAGGGG	0.552																																																	0													103.0	101.0	102.0					17																	61897353		2203	4300	6503	SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61897353G>T			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.L785I	ENST00000578681.1	37	c.2353	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434930	0.25813	.	.	ENSG00000108592	ENST00000427159	T	0.36520	1.25	4.77	4.77	0.60923	Ribosomal RNA methyltransferase, Spb1, C-terminal (1);	0.094394	0.43416	D	0.000563	T	0.18800	0.0451	N	0.11789	0.175	0.40042	D	0.975667	B	0.32409	0.37	B	0.30316	0.114	T	0.10382	-1.0632	10	0.21014	T	0.42	-13.0642	10.3993	0.44220	0.0:0.0:0.805:0.195	.	785	Q8IY81	RRMJ3_HUMAN	I	785	ENSP00000396673:L785I	ENSP00000396673:L785I	L	-	1	0	FTSJ3	59251085	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	6.674000	0.74487	2.475000	0.83589	0.467000	0.42956	CTC	FTSJ3	-	pfam_rRNA_MeTfrase_Spb1_C	ENSG00000108592		0.552	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1	-	0.00	65	0	G	NM_007372		61897353	-1	tier1	-	no_errors	ENST00000427159	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
FZD5	7855	genome.wustl.edu	37	2	208632719	208632719	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:208632719A>G	ENST00000295417.3	-	2	1298	c.745T>C	c.(745-747)Tcc>Ccc	p.S249P		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	249					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		GTGGACGTGGAGATGAAGCAC	0.617																																																	0													83.0	76.0	79.0					2																	208632719		2202	4299	6501	SO:0001583	missense	0			U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.745T>C	2.37:g.208632719A>G	ENSP00000354607:p.Ser249Pro		A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S249P	ENST00000295417.3	37	c.745	CCDS33366.1	2	.	.	.	.	.	.	.	.	.	.	A	17.78	3.473465	0.63737	.	.	ENSG00000163251	ENST00000295417	D	0.85629	-2.01	5.05	5.05	0.67936	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	D	0.94108	0.8111	H	0.96518	3.835	0.80722	D	1	D	0.61080	0.989	D	0.71656	0.974	D	0.95154	0.8275	10	0.87932	D	0	.	11.2015	0.48743	0.8464:0.1536:0.0:0.0	.	249	Q13467	FZD5_HUMAN	P	249	ENSP00000354607:S249P	ENSP00000354607:S249P	S	-	1	0	FZD5	208340964	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.383000	0.79741	1.908000	0.55244	0.459000	0.35465	TCC	FZD5	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000163251		0.617	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD5	HGNC	protein_coding	OTTHUMT00000337060.1		0.00	42	0	A	NM_003468		208632719	-1			no_errors	ENST00000295417	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	G
GABRB1	2560	genome.wustl.edu	37	4	47163327	47163327	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:47163327G>C	ENST00000295454.3	+	4	594	c.302G>C	c.(301-303)gGa>gCa	p.G101A	GABRB1_ENST00000538619.1_Missense_Mutation_p.G31A	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	101					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCTTATTCTGGAATCCCACTG	0.388																																																	0													108.0	111.0	110.0					4																	47163327		2203	4299	6502	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.302G>C	4.37:g.47163327G>C	ENSP00000295454:p.Gly101Ala		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.G101A	ENST00000295454.3	37	c.302	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820697	0.32145	.	.	ENSG00000163288	ENST00000513567;ENST00000295454;ENST00000538619	T;T;T	0.80123	-1.34;-1.34;-1.34	5.01	5.01	0.66863	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	D	0.000002	T	0.80221	0.4583	L	0.55990	1.75	0.48511	D	0.999666	B;B	0.33135	0.007;0.399	B;B	0.39503	0.019;0.301	T	0.77319	-0.2632	10	0.30078	T	0.28	-8.055	17.4825	0.87677	0.0:0.0:1.0:0.0	.	31;101	F5GXV5;P18505	.;GBRB1_HUMAN	A	68;101;31	ENSP00000426753:G68A;ENSP00000295454:G101A;ENSP00000440330:G31A	ENSP00000295454:G101A	G	+	2	0	GABRB1	46858084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.714000	0.54889	2.611000	0.88343	0.650000	0.86243	GGA	GABRB1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAb_rcpt,tigrfam_Neur_channel	ENSG00000163288		0.388	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	56	0	G			47163327	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	missense	19.81	84	21	SNP	1.000	C
GABRB1	2560	genome.wustl.edu	37	4	47408746	47408746	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:47408746G>A	ENST00000295454.3	+	8	1175	c.883G>A	c.(883-885)Gag>Aag	p.E295K	GABRB1_ENST00000538619.1_Missense_Mutation_p.E225K	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	295	Allosteric effector binding. {ECO:0000250}.				cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCACCTCAGGGAGACCCTGCC	0.443																																																	0													173.0	160.0	165.0					4																	47408746		2203	4300	6503	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.883G>A	4.37:g.47408746G>A	ENSP00000295454:p.Glu295Lys		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.E295K	ENST00000295454.3	37	c.883	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861566	0.91433	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.85013	-1.93;-1.93	4.74	4.74	0.60224	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.079408	0.48767	D	0.000165	D	0.88370	0.6418	L	0.39147	1.195	0.80722	D	1	P;D	0.69078	0.749;0.997	P;D	0.79108	0.511;0.992	D	0.85097	0.0955	10	0.19590	T	0.45	-21.119	17.5289	0.87808	0.0:0.0:1.0:0.0	.	225;295	F5GXV5;P18505	.;GBRB1_HUMAN	K	295;225	ENSP00000295454:E295K;ENSP00000440330:E225K	ENSP00000295454:E295K	E	+	1	0	GABRB1	47103503	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.657000	0.98554	2.464000	0.83262	0.467000	0.42956	GAG	GABRB1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000163288		0.443	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	38	0	G			47408746	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	missense	18.67	61	14	SNP	1.000	A
GAREM	64762	genome.wustl.edu	37	18	29868054	29868054	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:29868054T>C	ENST00000269209.6	-	4	509	c.506A>G	c.(505-507)aAg>aGg	p.K169R	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'UTR|GAREM_ENST00000399218.4_Missense_Mutation_p.K169R			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	169	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TGACTTTTCCTTGAATGTCTT	0.423																																																	0													104.0	86.0	92.0					18																	29868054		2203	4300	6503	SO:0001583	missense	0			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.506A>G	18.37:g.29868054T>C	ENSP00000269209:p.Lys169Arg		Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	superfamily_SAM/pointed	p.K169R	ENST00000269209.6	37	c.506	CCDS56057.1	18	.	.	.	.	.	.	.	.	.	.	T	14.32	2.498934	0.44455	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.15952	2.38;2.38	5.34	5.34	0.76211	.	0.092744	0.64402	D	0.000001	T	0.14657	0.0354	L	0.28192	0.835	0.50313	D	0.999868	B;B	0.29301	0.241;0.108	B;B	0.30105	0.111;0.099	T	0.05632	-1.0873	10	0.42905	T	0.14	-23.7767	15.4543	0.75299	0.0:0.0:0.0:1.0	.	169;169	Q9H706;Q9H706-3	FA59A_HUMAN;.	R	169	ENSP00000382165:K169R;ENSP00000269209:K169R	ENSP00000269209:K169R	K	-	2	0	FAM59A	28122052	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.346000	0.59367	2.237000	0.73441	0.533000	0.62120	AAG	GAREM	-	NULL	ENSG00000141441		0.423	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GAREM	HGNC	protein_coding	OTTHUMT00000255365.1	-	0.00	57	0	T	NM_022751		29868054	-1	tier1	-	no_errors	ENST00000269209	ensembl	human	known	74_37	missense	21.05	60	16	SNP	1.000	C
GCC2	9648	genome.wustl.edu	37	2	109067569	109067569	+	Splice_Site	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:109067569G>A	ENST00000309863.6	+	3	862		c.e3+1			NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2						Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.?(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AGGTGTACAGGTATTGGGTTG	0.358																																																	1	Unknown(1)	lung(1)											113.0	108.0	109.0					2																	109067569		2203	4300	6503	SO:0001630	splice_region_variant	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.148+1G>A	2.37:g.109067569G>A			A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Splice_Site	SNP	-	e3+1	ENST00000309863.6	37	c.148+1	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895011	0.72639	.	.	ENSG00000135968	ENST00000435553;ENST00000309863;ENST00000409821;ENST00000409896	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1033	0.86655	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GCC2	108434001	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.678000	0.74508	2.332000	0.79248	0.563000	0.77884	.	GCC2	-	-	ENSG00000135968		0.358	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	-	0.00	60	0	G	NM_014635	Intron	109067569	+1	tier1	-	no_errors	ENST00000309863	ensembl	human	known	74_37	splice_site	46.88	68	60	SNP	1.000	A
GJB6	10804	genome.wustl.edu	37	13	20797357	20797357	+	Missense_Mutation	SNP	G	G	A	rs28937872		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:20797357G>A	ENST00000356192.6	-	5	883	c.263C>T	c.(262-264)gCg>gTg	p.A88V	GJB6_ENST00000241124.6_Missense_Mutation_p.A88V|GJB6_ENST00000400066.3_Missense_Mutation_p.A88V|GJB6_ENST00000400065.3_Missense_Mutation_p.A88V	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	88			A -> V (in ECTD2; dbSNP:rs28937872). {ECO:0000269|PubMed:11017065}.		apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)		p.A88V(1)		biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		CACCAGCAGCGCTGGGGTGGA	0.542																																																	1	Substitution - Missense(1)	endometrium(1)	GRCh37	CM002606	GJB6	M	rs28937872						54.0	47.0	49.0					13																	20797357		2203	4300	6503	SO:0001583	missense	0			AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.263C>T	13.37:g.20797357G>A	ENSP00000348521:p.Ala88Val		B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.A88V	ENST00000356192.6	37	c.263	CCDS9291.1	13	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960559	0.92791	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	D;D;D;D	0.99121	-5.45;-5.45;-5.45;-5.45	5.28	5.28	0.74379	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	M	0.83692	2.655	0.80722	A	1	D	0.89917	1.0	D	0.74674	0.984	D	0.99387	1.0924	9	0.87932	D	0	.	18.9412	0.92605	0.0:0.0:1.0:0.0	rs28937872	88	O95452	CXB6_HUMAN	V	88	ENSP00000241124:A88V;ENSP00000382938:A88V;ENSP00000382939:A88V;ENSP00000348521:A88V	ENSP00000241124:A88V	A	-	2	0	GJB6	19695357	1.000000	0.71417	0.710000	0.30468	0.697000	0.40408	9.562000	0.98145	2.450000	0.82876	0.655000	0.94253	GCG	GJB6	-	pfam_Connexin_N,prints_Connexin	ENSG00000121742		0.542	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB6	HGNC	protein_coding	OTTHUMT00000272906.1		0.00	40	0	G			20797357	-1			no_errors	ENST00000241124	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.991	A
GLUL	2752	genome.wustl.edu	37	1	182354682	182354682	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:182354682G>C	ENST00000331872.6	-	6	1153	c.613C>G	c.(613-615)Cag>Gag	p.Q205E	GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000311223.5_Missense_Mutation_p.Q205E|GLUL_ENST00000417584.2_Missense_Mutation_p.Q205E|GLUL_ENST00000339526.4_Missense_Mutation_p.Q205E	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	205					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GGTCCAATCTGAAATTCCCAC	0.458																																																	0													83.0	80.0	81.0					1																	182354682		2203	4300	6503	SO:0001583	missense	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.613C>G	1.37:g.182354682G>C	ENSP00000356537:p.Gln205Glu		Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.Q205E	ENST00000331872.6	37	c.613	CCDS1344.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.7|28.7	4.940725|4.940725	0.92526|0.92526	.|.	.|.	ENSG00000135821|ENSG00000135821	ENST00000435013|ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	.|D;D;D;D	.|0.86164	.|-2.08;-2.08;-2.08;-2.08	5.44|5.44	5.44|5.44	0.79542|0.79542	.|Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96380|0.96380	0.8819|0.8819	H|H	0.98333|0.98333	4.205|4.205	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77557	.|0.99	D|D	0.98001|0.98001	1.0360|1.0360	6|10	0.02654|0.87932	T|D	1|0	-23.7093|-23.7093	17.8071|17.8071	0.88605|0.88605	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|205	.|P15104	.|GLNA_HUMAN	L|E	204|205	.|ENSP00000356537:Q205E;ENSP00000307900:Q205E;ENSP00000398320:Q205E;ENSP00000344958:Q205E	ENSP00000388535:F204L|ENSP00000307900:Q205E	F|Q	-|-	3|1	2|0	GLUL|GLUL	180621305|180621305	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.814000|0.814000	0.46013|0.46013	7.453000|7.453000	0.80700|0.80700	2.542000|2.542000	0.85734|0.85734	0.655000|0.655000	0.94253|0.94253	TTC|CAG	GLUL	-	pfam_Gln_synth_cat_dom	ENSG00000135821		0.458	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	-	0.00	34	0	G	NM_002065		182354682	-1	tier1	-	no_errors	ENST00000311223	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	C
GPR137B	7107	genome.wustl.edu	37	1	236306222	236306222	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:236306222C>A	ENST00000366592.3	+	1	391	c.300C>A	c.(298-300)ttC>ttA	p.F100L	GPR137B_ENST00000366591.4_Missense_Mutation_p.F100L	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	100						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)		p.F100L(2)		endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CCTTCTACTTCAAAGACTTCG	0.572																																																	2	Substitution - Missense(2)	lung(2)											153.0	150.0	151.0					1																	236306222		2203	4300	6503	SO:0001583	missense	0			AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.300C>A	1.37:g.236306222C>A	ENSP00000355551:p.Phe100Leu		Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	NULL	p.F100L	ENST00000366592.3	37	c.300	CCDS1609.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.121669	0.94385	.	.	ENSG00000077585	ENST00000366592;ENST00000366591;ENST00000391852	T;T	0.57436	0.44;0.4	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.72170	0.3427	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.74899	-0.3507	10	0.54805	T	0.06	-27.7464	18.1047	0.89516	0.0:1.0:0.0:0.0	.	100	O60478	G137B_HUMAN	L	100;100;99	ENSP00000355551:F100L;ENSP00000355550:F100L	ENSP00000355550:F100L	F	+	3	2	GPR137B	234372845	1.000000	0.71417	0.985000	0.45067	0.982000	0.71751	5.841000	0.69409	2.264000	0.75181	0.549000	0.68633	TTC	GPR137B	-	NULL	ENSG00000077585		0.572	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137B	HGNC	protein_coding	OTTHUMT00000092761.1		0.00	21	0	C	NM_003272		236306222	+1			no_errors	ENST00000366592	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	A
GPRC5B	51704	genome.wustl.edu	37	16	19883970	19883970	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:19883970G>A	ENST00000300571.2	-	2	389	c.198C>T	c.(196-198)ggC>ggT	p.G66G	GPRC5B_ENST00000535671.1_Silent_p.G66G|GPRC5B_ENST00000537135.1_Silent_p.G92G|GPRC5B_ENST00000569479.1_Silent_p.G66G|GPRC5B_ENST00000569847.1_Silent_p.G66G	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	66					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGATCAGGGCGCCCGCCCCGG	0.642																																																	0																																										SO:0001819	synonymous_variant	0			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.198C>T	16.37:g.19883970G>A			D2DFB0|O75205|Q8NBZ8	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.G92	ENST00000300571.2	37	c.276	CCDS10581.1	16																																																																																			GPRC5B	-	pfam_GPCR_3_C	ENSG00000167191		0.642	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	HGNC	protein_coding	OTTHUMT00000254285.1	-	0.00	92	0	G			19883970	-1	tier1	-	no_errors	ENST00000537135	ensembl	human	known	74_37	silent	21.13	56	15	SNP	0.866	A
GPSM1	26086	genome.wustl.edu	37	9	139244051	139244051	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:139244051G>A	ENST00000440944.1	+	11	1511	c.1291G>A	c.(1291-1293)Gac>Aac	p.D431N		NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	431	Interaction with STK11/LKB1. {ECO:0000250}.|Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		GCAGAATGGAGACAGCCACCA	0.657																																																	0													12.0	8.0	10.0					9																	139244051		1959	3846	5805	SO:0001583	missense	0			AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1291G>A	9.37:g.139244051G>A	ENSP00000392828:p.Asp431Asn		A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D431N	ENST00000440944.1	37	c.1291	CCDS48055.1	9	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003522	0.35320	.	.	ENSG00000160360	ENST00000440944;ENST00000354753	D;D	0.90261	-2.64;-2.64	4.62	4.62	0.57501	.	1.018290	0.07843	N	0.963312	D	0.84124	0.5403	N	0.26042	0.785	0.80722	D	1	P	0.36753	0.568	B	0.37550	0.253	T	0.73757	-0.3882	10	0.02654	T	1	-28.6456	13.335	0.60512	0.0:0.0:1.0:0.0	.	431	Q86YR5	GPSM1_HUMAN	N	431;408	ENSP00000392828:D431N;ENSP00000346797:D408N	ENSP00000346797:D408N	D	+	1	0	GPSM1	138363872	0.009000	0.17119	1.000000	0.80357	0.992000	0.81027	1.185000	0.32065	2.268000	0.75426	0.655000	0.94253	GAC	GPSM1	-	NULL	ENSG00000160360		0.657	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM1	HGNC	protein_coding		-	0.00	69	0	G	NM_015597		139244051	+1	tier1	-	no_errors	ENST00000440944	ensembl	human	known	74_37	missense	43.40	30	23	SNP	1.000	A
GRIP1	23426	genome.wustl.edu	37	12	66838411	66838411	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:66838411G>A	ENST00000398016.3	-	12	1552	c.1484C>T	c.(1483-1485)tCt>tTt	p.S495F	GRIP1_ENST00000286445.7_Missense_Mutation_p.S547F|GRIP1_ENST00000359742.4_Missense_Mutation_p.S547F	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	246					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CGTGATTGAAGAGTCTCGGAG	0.458																																																	0													121.0	122.0	121.0					12																	66838411		1960	4144	6104	SO:0001583	missense	0			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1484C>T	12.37:g.66838411G>A	ENSP00000381098:p.Ser495Phe		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S547F	ENST00000398016.3	37	c.1640	CCDS41807.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.561847|4.561847	0.86335|0.86335	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000538164|ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	.|T;T;T;T;T;T	.|0.30981	.|1.51;1.51;1.51;1.51;1.51;1.51	5.61|5.61	5.61|5.61	0.85477|0.85477	.|PDZ/DHR/GLGF (4);	.|0.119122	.|0.64402	.|D	.|0.000015	T|T	0.62417|0.62417	0.2426|0.2426	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.71674	.|0.996;0.997;0.996;0.998	.|D;D;D;D	.|0.76071	.|0.974;0.985;0.987;0.983	T|T	0.65331|0.65331	-0.6194|-0.6194	5|9	.|.	.|.	.|.	-12.1286|-12.1286	19.6387|19.6387	0.95748|0.95748	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|495;547;495;547	.|F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.|.;GRIP1_HUMAN;.;.	F|F	362|495;547;547;495;439;387	.|ENSP00000381098:S495F;ENSP00000352780:S547F;ENSP00000286445:S547F;ENSP00000446047:S495F;ENSP00000446024:S439F;ENSP00000446011:S387F	.|.	L|S	-|-	1|2	0|0	GRIP1|GRIP1	65124678|65124678	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	9.476000|9.476000	0.97823|0.97823	2.641000|2.641000	0.89580|0.89580	0.544000|0.544000	0.68410|0.68410	CTT|TCT	GRIP1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000155974		0.458	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	-	0.00	74	0	G			66838411	-1	tier1	-	no_errors	ENST00000359742	ensembl	human	known	74_37	missense	6.06	93	6	SNP	1.000	A
GRK5	2869	genome.wustl.edu	37	10	121182726	121182726	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:121182726G>T	ENST00000392870.2	+	5	717	c.388G>T	c.(388-390)Gag>Tag	p.E130*	GRK5_ENST00000369108.3_Nonsense_Mutation_p.E25*	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	130	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		CTCCCAGACGGAGGAGAAGCT	0.582																																																	0													247.0	241.0	243.0					10																	121182726		2203	4300	6503	SO:0001587	stop_gained	0			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.388G>T	10.37:g.121182726G>T	ENSP00000376609:p.Glu130*		D3DRD0|Q5T059	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.E130*	ENST00000392870.2	37	c.388	CCDS7612.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.664387	0.97747	.	.	ENSG00000198873	ENST00000392870;ENST00000457057;ENST00000369108	.	.	.	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-4.9739	17.6809	0.88242	0.0:0.0:1.0:0.0	.	.	.	.	X	130;25;25	.	ENSP00000358104:E25X	E	+	1	0	GRK5	121172716	0.937000	0.31787	1.000000	0.80357	0.971000	0.66376	1.450000	0.35134	2.166000	0.68216	0.563000	0.77884	GAG	GRK5	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000198873		0.582	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK5	HGNC	protein_coding	OTTHUMT00000050652.2	-	0.00	66	0	G	NM_005308		121182726	+1	tier1	-	no_errors	ENST00000392870	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	0.998	T
GTF2F1	2962	genome.wustl.edu	37	19	6381858	6381858	+	Missense_Mutation	SNP	C	C	T	rs140441631		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:6381858C>T	ENST00000394456.5	-	7	1150	c.686G>A	c.(685-687)gGc>gAc	p.G229D	GTF2F1_ENST00000429701.2_Missense_Mutation_p.G144D|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	229					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GGGGACTCTGCCCCCTGGGAA	0.532																																																	0								C	ASP/GLY	0,4406		0,0,2203	32.0	26.0	28.0		686	2.7	0.3	19	dbSNP_134	28	1,8599		0,1,4299	no	missense	GTF2F1	NM_002096.2	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	229/518	6381858	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.686G>A	19.37:g.6381858C>T	ENSP00000377969:p.Gly229Asp		B2RCS0|Q9BWN0	Missense_Mutation	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.G229D	ENST00000394456.5	37	c.686	CCDS12165.1	19	.	.	.	.	.	.	.	.	.	.	C	5.868	0.344258	0.11126	0.0	1.16E-4	ENSG00000125651	ENST00000394456;ENST00000429701;ENST00000542045;ENST00000543921	T;T	0.38560	1.13;1.13	4.9	2.69	0.31865	.	0.521273	0.19915	N	0.103208	T	0.28433	0.0703	L	0.38175	1.15	0.32523	N	0.535998	B;B;B	0.23442	0.025;0.085;0.027	B;B;B	0.27887	0.057;0.084;0.055	T	0.27872	-1.0061	10	0.11485	T	0.65	-18.2133	8.0582	0.30617	0.1606:0.7509:0.0:0.0885	.	144;127;229	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	D	229;144;289;145	ENSP00000377969:G229D;ENSP00000392107:G144D	ENSP00000377969:G229D	G	-	2	0	GTF2F1	6332858	0.858000	0.29795	0.277000	0.24703	0.279000	0.26890	1.202000	0.32271	1.169000	0.42739	0.655000	0.94253	GGC	GTF2F1	-	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	ENSG00000125651		0.532	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1		0.00	59	0	C	NM_002096		6381858	-1			no_errors	ENST00000394456	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.892	T
GYS1	2997	genome.wustl.edu	37	19	49481244	49481244	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:49481244G>T	ENST00000323798.3	-	10	1441	c.1245C>A	c.(1243-1245)gaC>gaA	p.D415E	GYS1_ENST00000544287.1_Missense_Mutation_p.D48E|GYS1_ENST00000540532.1_3'UTR|GYS1_ENST00000263276.6_Missense_Mutation_p.D351E|GYS1_ENST00000541188.1_Missense_Mutation_p.D335E	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	415					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		TCTTGTTCATGTCGGGAAGGC	0.532																																																	0													158.0	123.0	135.0					19																	49481244		2203	4300	6503	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1245C>A	19.37:g.49481244G>T	ENSP00000317904:p.Asp415Glu		Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.D415E	ENST00000323798.3	37	c.1245	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599288	0.46318	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.22	2.86	0.33363	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.39514	1.22	0.80722	D	1	P;D;D	0.67145	0.65;0.961;0.996	P;P;D	0.66716	0.615;0.828;0.946	T	0.55224	-0.8174	10	0.30854	T	0.27	-44.5736	7.8267	0.29320	0.2851:0.0:0.7149:0.0	.	335;351;415	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	E	415;351;335;48	ENSP00000317904:D415E;ENSP00000263276:D351E;ENSP00000437922:D335E;ENSP00000444004:D48E	ENSP00000263276:D351E	D	-	3	2	GYS1	54173056	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	0.642000	0.24735	0.737000	0.32582	-0.339000	0.08088	GAC	GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.532	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	-	0.00	57	0	G	NM_002103		49481244	-1	tier1	-	no_errors	ENST00000323798	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
GZF1	64412	genome.wustl.edu	37	20	23345551	23345551	+	Silent	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:23345551C>G	ENST00000338121.5	+	2	608	c.531C>G	c.(529-531)ctC>ctG	p.L177L	GZF1_ENST00000377051.2_Silent_p.L177L|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000542987.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	177					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CCAGTGGTCTCACGGATTCCT	0.567																																																	0													51.0	53.0	52.0					20																	23345551		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.531C>G	20.37:g.23345551C>G			A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L177	ENST00000338121.5	37	c.531	CCDS13151.1	20																																																																																			GZF1	-	NULL	ENSG00000125812		0.567	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1	-	0.00	36	0	C	NM_022482		23345551	+1	tier1	-	no_errors	ENST00000338121	ensembl	human	known	74_37	silent	35.85	34	19	SNP	0.000	G
HELZ	9931	genome.wustl.edu	37	17	65074534	65074534	+	Missense_Mutation	SNP	G	G	T	rs201422510		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:65074534G>T	ENST00000358691.5	-	33	5829	c.5663C>A	c.(5662-5664)gCg>gAg	p.A1888E	HELZ_ENST00000580168.1_Missense_Mutation_p.A1889E	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1888						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CTTGCCCCCCGCAGAGCTCTG	0.617																																																	0													66.0	71.0	69.0					17																	65074534		1900	4104	6004	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5663C>A	17.37:g.65074534G>T	ENSP00000351524:p.Ala1888Glu		I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,superfamily_P-loop_NTPase,smart_Znf_CCCH	p.A1888E	ENST00000358691.5	37	c.5663	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	G	5.914	0.352748	0.11182	.	.	ENSG00000198265	ENST00000358691	D	0.84298	-1.83	5.46	-0.604	0.11626	.	0.972357	0.08510	N	0.935027	T	0.76378	0.3979	N	0.19112	0.55	0.09310	N	1	B;B	0.22146	0.065;0.065	B;B	0.22601	0.04;0.04	T	0.62473	-0.6847	10	0.72032	D	0.01	0.6009	13.1813	0.59655	0.1085:0.3585:0.533:0.0	.	1889;1888	B7ZLW2;P42694	.;HELZ_HUMAN	E	1888	ENSP00000351524:A1888E	ENSP00000351524:A1888E	A	-	2	0	HELZ	62504996	0.001000	0.12720	0.000000	0.03702	0.846000	0.48090	0.450000	0.21762	-0.351000	0.08249	-0.165000	0.13383	GCG	HELZ	-	NULL	ENSG00000198265		0.617	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1		0.00	32	0	G	NM_014877		65074534	-1			no_errors	ENST00000358691	ensembl	human	known	74_37	missense	7.69	47	4	SNP	0.001	T
HERC1	8925	genome.wustl.edu	37	15	64021787	64021787	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:64021787G>T	ENST00000443617.2	-	15	3017	c.2930C>A	c.(2929-2931)tCa>tAa	p.S977*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	977					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACTGTTTTCTGATGATGATGT	0.368																																																	0													109.0	101.0	104.0					15																	64021787		1886	4137	6023	SO:0001587	stop_gained	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2930C>A	15.37:g.64021787G>T	ENSP00000390158:p.Ser977*		Q8IW65	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.S977*	ENST00000443617.2	37	c.2930	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	41	9.097351	0.99064	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.33	5.33	0.75918	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0306	0.92955	0.0:0.0:1.0:0.0	.	.	.	.	X	977	.	ENSP00000390158:S977X	S	-	2	0	HERC1	61808840	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	5.680000	0.68168	2.481000	0.83766	0.563000	0.77884	TCA	HERC1	-	NULL	ENSG00000103657		0.368	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	45	0	G	NM_003922		64021787	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	0.997	T
HIST1H4C	8364	genome.wustl.edu	37	6	26104467	26104467	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:26104467C>T	ENST00000377803.2	+	1	364	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	98					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GGGGCGCACTCTGTATGGCTT	0.498																																																	0													55.0	50.0	52.0					6																	26104467		2203	4300	6503	SO:0001819	synonymous_variant	0			X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.292C>T	6.37:g.26104467C>T			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.L98	ENST00000377803.2	37	c.292	CCDS4583.1	6																																																																																			HIST1H4C	-	superfamily_Histone-fold,prints_Histone_H4	ENSG00000197061		0.498	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	HGNC	protein_coding	OTTHUMT00000040092.2	-	0.00	35	0	C	NM_003542		26104467	+1	tier1	-	no_errors	ENST00000377803	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	T
HIST1H4L	8368	genome.wustl.edu	37	6	27841093	27841093	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:27841093C>G	ENST00000355981.2	-	1	196	c.196G>C	c.(196-198)Gta>Cta	p.V66L	HIST1H3I_ENST00000328488.2_5'Flank	NM_003546.2	NP_003537.1	P62805	H4_HUMAN	histone cluster 1, H4l	66					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	13						TCGCGGATTACATTCTCCAAA	0.577																																																	0													108.0	91.0	97.0					6																	27841093		2203	4300	6503	SO:0001583	missense	0			X83548	CCDS4637.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198558	ENSG00000275126		"""Histones / Replication-dependent"""	4791	protein-coding gene	gene with protein product		602831	"""H4 histone family, member K"", ""histone 1, H4l"""	H4FK		9031620, 9439656, 12408966	Standard	NM_003546		Approved	H4.k, H4/k	uc003njz.3	P62805	OTTHUMG00000016211	ENST00000355981.2:c.196G>C	6.37:g.27841093C>G	ENSP00000348258:p.Val66Leu		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.V66L	ENST00000355981.2	37	c.196	CCDS4637.1	6	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608675	0.46527	.	.	ENSG00000198558	ENST00000355981	T	0.63096	-0.02	4.52	4.52	0.55395	.	0.000000	0.64402	D	0.000015	T	0.69314	0.3097	.	.	.	0.50813	D	0.999891	.	.	.	.	.	.	T	0.72080	-0.4398	7	0.54805	T	0.06	.	16.7018	0.85351	0.0:1.0:0.0:0.0	.	.	.	.	L	66	ENSP00000348258:V66L	ENSP00000348258:V66L	V	-	1	0	HIST1H4L	27949072	1.000000	0.71417	0.997000	0.53966	0.011000	0.07611	7.203000	0.77864	2.439000	0.82584	0.655000	0.94253	GTA	HIST1H4L	-	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198558		0.577	HIST1H4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4L	HGNC	protein_coding	OTTHUMT00000043513.1	-	0.00	85	0	C	NM_003546		27841093	-1	tier1	-	no_errors	ENST00000355981	ensembl	human	known	74_37	missense	21.84	68	19	SNP	1.000	G
HIVEP2	3097	genome.wustl.edu	37	6	143091068	143091068	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:143091068C>A	ENST00000367604.1	-	4	5447	c.4808G>T	c.(4807-4809)cGg>cTg	p.R1603L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.R1603L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.R1603L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1603					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCCAACAGGCCGCTTGTGGCC	0.562																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													65.0	71.0	69.0					6																	143091068		2114	4238	6352	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4808G>T	6.37:g.143091068C>A	ENSP00000356576:p.Arg1603Leu		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1603L	ENST00000367604.1	37	c.4808	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	0.340	-0.951159	0.02285	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02103	4.45;4.45;4.45	5.95	0.69	0.18039	.	0.983197	0.08363	N	0.957452	T	0.00178	0.0005	N	0.00583	-1.355	0.19775	N	0.999956	B	0.02656	0.0	B	0.01281	0.0	T	0.42949	-0.9421	10	0.02654	T	1	-0.4785	1.6766	0.02823	0.5309:0.1493:0.2031:0.1167	.	1603	P31629	ZEP2_HUMAN	L	1603	ENSP00000356576:R1603L;ENSP00000356575:R1603L;ENSP00000012134:R1603L	ENSP00000012134:R1603L	R	-	2	0	HIVEP2	143132761	0.897000	0.30589	0.997000	0.53966	0.957000	0.61999	2.047000	0.41269	0.149000	0.19098	-0.274000	0.10170	CGG	HIVEP2	-	NULL	ENSG00000010818		0.562	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1		0.00	25	0	C			143091068	-1			no_errors	ENST00000012134	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.630	A
HIVEP3	59269	genome.wustl.edu	37	1	42047900	42047900	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:42047900C>G	ENST00000372583.1	-	4	3454	c.2569G>C	c.(2569-2571)Gag>Cag	p.E857Q	HIVEP3_ENST00000247584.5_Missense_Mutation_p.E857Q|HIVEP3_ENST00000372584.1_Missense_Mutation_p.E857Q|HIVEP3_ENST00000429157.2_Missense_Mutation_p.E857Q|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	857	Glu/Pro-rich.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				ACTAGGATCTCAGGAACCTGA	0.622																																																	0													72.0	82.0	79.0					1																	42047900		2203	4300	6503	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2569G>C	1.37:g.42047900C>G	ENSP00000361664:p.Glu857Gln		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E857Q	ENST00000372583.1	37	c.2569	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705382	0.89018	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.95	4.95	0.65309	.	0.000000	0.53938	D	0.000057	T	0.69806	0.3152	M	0.76727	2.345	0.53688	D	0.999977	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.73805	-0.3867	10	0.87932	D	0	-0.1176	17.9567	0.89072	0.0:1.0:0.0:0.0	.	857;857	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Q	857	ENSP00000361665:E857Q;ENSP00000361664:E857Q;ENSP00000247584:E857Q;ENSP00000410828:E857Q	ENSP00000247584:E857Q	E	-	1	0	HIVEP3	41820487	1.000000	0.71417	0.970000	0.41538	0.984000	0.73092	7.651000	0.83577	2.562000	0.86427	0.462000	0.41574	GAG	HIVEP3	-	NULL	ENSG00000127124		0.622	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	-	0.00	39	0	C	NM_024503		42047900	-1	tier1	-	no_errors	ENST00000247584	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	G
HLA-A	3105	genome.wustl.edu	37	6	29910769	29910769	+	Silent	SNP	G	G	A	rs61760916		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:29910769G>A	ENST00000396634.1	+	4	650	c.309G>A	c.(307-309)ggG>ggA	p.G103G	HLA-A_ENST00000376802.2_Silent_p.G103G|HLA-A_ENST00000376809.5_Silent_p.G103G|HLA-A_ENST00000376806.5_Silent_p.G103G			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	103	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TGGACCTGGGGACCCTGCGCG	0.697									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																							0													60.0	64.0	63.0					6																	29910769		2194	4281	6475	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.309G>A	6.37:g.29910769G>A			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.G103	ENST00000396634.1	37	c.309	CCDS34373.1	6																																																																																			HLA-A	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a	ENSG00000206503		0.697	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	-	0.00	48	0	G	NM_002116		29910769	+1	tier1	-	no_errors	ENST00000376806	ensembl	human	known	74_37	silent	50.00	17	17	SNP	0.000	A
HOMEZ	57594	genome.wustl.edu	37	14	23745409	23745409	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:23745409C>G	ENST00000357460.5	-	2	1192	c.1028G>C	c.(1027-1029)aGa>aCa	p.R343T	HOMEZ_ENST00000431326.2_Missense_Mutation_p.R345T|HOMEZ_ENST00000561013.1_Missense_Mutation_p.R345T	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GGGGCCAACTCTACCTGGTAC	0.527																																																	0													156.0	157.0	157.0					14																	23745409		1984	4145	6129	SO:0001583	missense	0			AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1028G>C	14.37:g.23745409C>G	ENSP00000350049:p.Arg343Thr		A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R345T	ENST00000357460.5	37	c.1034	CCDS45085.1	14	.	.	.	.	.	.	.	.	.	.	C	4.028	0.002751	0.07866	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.24350	1.86;1.86	6.17	5.28	0.74379	.	0.509864	0.16694	N	0.203411	T	0.20740	0.0499	L	0.29908	0.895	0.09310	N	1	P;P	0.42296	0.775;0.666	B;B	0.39660	0.306;0.162	T	0.07986	-1.0744	10	0.25106	T	0.35	-2.6624	14.0518	0.64742	0.0:0.7141:0.2859:0.0	.	345;343	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	T	343;345	ENSP00000350049:R343T;ENSP00000406579:R345T	ENSP00000350049:R343T	R	-	2	0	HOMEZ	22815249	0.022000	0.18835	0.004000	0.12327	0.003000	0.03518	2.669000	0.46825	1.601000	0.50113	0.655000	0.94253	AGA	HOMEZ	-	NULL	ENSG00000215271		0.527	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HOMEZ	HGNC	protein_coding	OTTHUMT00000416939.2	-	0.00	27	0	C	NM_020834		23745409	-1	tier1	-	no_errors	ENST00000431326	ensembl	human	known	74_37	missense	15.87	53	10	SNP	0.007	G
HSF2	3298	genome.wustl.edu	37	6	122743335	122743335	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:122743335G>T	ENST00000368455.4	+	8	914	c.722G>T	c.(721-723)aGg>aTg	p.R241M	HSF2_ENST00000452194.1_Missense_Mutation_p.R241M	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	241					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		CCAAGGGAGAGGATTTCAGAT	0.318																																																	0													103.0	107.0	106.0					6																	122743335		2203	4297	6500	SO:0001583	missense	0			M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.722G>T	6.37:g.122743335G>T	ENSP00000357440:p.Arg241Met		B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Missense_Mutation	SNP	pfam_Vert_HSTF_C,pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.R241M	ENST00000368455.4	37	c.722	CCDS5124.1	6	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478112	0.44044	.	.	ENSG00000025156	ENST00000368455;ENST00000452194	.	.	.	5.65	4.56	0.56223	Vertebrate heat shock transcription factor (1);	0.256244	0.32852	N	0.005576	T	0.11793	0.0287	N	0.08118	0	0.33620	D	0.604638	B;B	0.15719	0.011;0.014	B;B	0.18263	0.012;0.021	T	0.07083	-1.0791	9	0.44086	T	0.13	-5.9395	4.9711	0.14115	0.2159:0.0:0.7841:0.0	.	241;241	Q03933-2;Q03933	.;HSF2_HUMAN	M	241	.	ENSP00000357440:R241M	R	+	2	0	HSF2	122785034	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.422000	0.59854	2.827000	0.97445	0.650000	0.86243	AGG	HSF2	-	pfam_Vert_HSTF_C	ENSG00000025156		0.318	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2	HGNC	protein_coding	OTTHUMT00000043520.1		0.00	49	0	G	NM_004506		122743335	+1			no_errors	ENST00000368455	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
HTRA4	203100	genome.wustl.edu	37	8	38831859	38831859	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:38831859T>C	ENST00000302495.4	+	1	177	c.77T>C	c.(76-78)gTc>gCc	p.V26A	CTD-2544N14.3_ENST00000520863.1_RNA	NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	26					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			CTGGTGCCCGTCCTCTGGGCC	0.706																																																	0													21.0	21.0	21.0					8																	38831859		2200	4296	6496	SO:0001583	missense	0			AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.77T>C	8.37:g.38831859T>C	ENSP00000305919:p.Val26Ala		Q542Z4|Q6PF13	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PDZ,pfam_Kazal_dom,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_Kazal_dom,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.V26A	ENST00000302495.4	37	c.77	CCDS6110.1	8	.	.	.	.	.	.	.	.	.	.	T	5.050	0.194903	0.09599	.	.	ENSG00000169495	ENST00000302495	D	0.84298	-1.83	3.71	-3.66	0.04489	.	1.719510	0.03617	N	0.235759	T	0.70150	0.3191	N	0.17312	0.475	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.53351	-0.8451	10	0.54805	T	0.06	-0.078	1.3068	0.02090	0.1299:0.1844:0.1931:0.4926	.	26	P83105	HTRA4_HUMAN	A	26	ENSP00000305919:V26A	ENSP00000305919:V26A	V	+	2	0	HTRA4	38951016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.011000	0.12721	-1.023000	0.03342	-0.912000	0.02778	GTC	HTRA4	-	NULL	ENSG00000169495		0.706	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA4	HGNC	protein_coding	OTTHUMT00000377077.1	-	0.00	43	0	T	NM_153692		38831859	+1	tier1	-	no_errors	ENST00000302495	ensembl	human	known	74_37	missense	47.89	37	34	SNP	0.000	C
HYDIN	54768	genome.wustl.edu	37	16	70884449	70884449	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:70884449C>T	ENST00000393567.2	-	74	12703	c.12553G>A	c.(12553-12555)Gag>Aag	p.E4185K	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4185					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.E4136K(2)|p.E4184K(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTGTAGCCCTCGGCCTTGACA	0.433																																																	4	Substitution - Missense(4)	breast(4)											26.0	24.0	24.0					16																	70884449		1804	4055	5859	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12553G>A	16.37:g.70884449C>T	ENSP00000377197:p.Glu4185Lys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.E4185K	ENST00000393567.2	37	c.12553	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380412	0.61845	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01113	5.32	5.56	3.6	0.41247	.	0.647023	0.11835	U	0.524801	T	0.04318	0.0119	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.55673	-0.8104	10	0.26408	T	0.33	.	6.5989	0.22689	0.0:0.6794:0.1694:0.1512	.	4184	F8WD23	.	K	4185;4184	ENSP00000377197:E4185K	ENSP00000313052:E4184K	E	-	1	0	HYDIN	69441950	0.848000	0.29623	0.958000	0.39756	0.559000	0.35586	1.344000	0.33941	1.338000	0.45544	0.511000	0.50034	GAG	HYDIN	-	NULL	ENSG00000157423		0.433	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	34	0	C			70884449	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	70.73	12	29	SNP	0.831	T
IFNAR1	3454	genome.wustl.edu	37	21	34713474	34713474	+	Missense_Mutation	SNP	C	C	T	rs142890975	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr21:34713474C>T	ENST00000270139.3	+	3	522	c.370C>T	c.(370-372)Cgc>Tgc	p.R124C	IFNAR1_ENST00000442357.2_Missense_Mutation_p.R124C|IFNAR1_ENST00000416947.2_Missense_Mutation_p.R55C	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	124	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TACACCATTTCGCAAAGGTAA	0.328																																					Esophageal Squamous(73;817 1211 32990 35667 42746)												0								C	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	59.0	59.0	59.0		370	-5.0	0.0	21	dbSNP_134	59	16,8582	11.9+/-42.8	1,14,4284	yes	missense	IFNAR1	NM_000629.2	180	1,18,6483	TT,TC,CC		0.1861,0.0908,0.1538	possibly-damaging	124/558	34713474	20,12984	2203	4299	6502	SO:0001583	missense	0				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.370C>T	21.37:g.34713474C>T	ENSP00000270139:p.Arg124Cys		B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	p.R124C	ENST00000270139.3	37	c.370	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	C	9.004	0.980751	0.18812	9.08E-4	0.001861	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442071;ENST00000442357	T;T;T;T	0.57273	0.9;0.9;0.41;0.9	5.76	-5.01	0.02991	Fibronectin, type III (1);Immunoglobulin-like fold (1);	3.067170	0.00877	N	0.002091	T	0.34164	0.0888	L	0.29908	0.895	0.09310	N	0.999998	P	0.52577	0.954	B	0.37239	0.244	T	0.47100	-0.9143	10	0.48119	T	0.1	4.7639	5.5377	0.17021	0.566:0.1696:0.1963:0.0681	.	124	P17181	INAR1_HUMAN	C	55;124;124;124	ENSP00000395606:R55C;ENSP00000270139:R124C;ENSP00000400161:R124C;ENSP00000407406:R124C	ENSP00000270139:R124C	R	+	1	0	IFNAR1	33635344	0.000000	0.05858	0.000000	0.03702	0.211000	0.24417	-1.162000	0.03141	-1.573000	0.01659	-0.261000	0.10672	CGC	IFNAR1	-	superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	ENSG00000142166		0.328	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	-	0.00	29	0	C			34713474	+1	tier1	rs142890975	no_errors	ENST00000270139	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.001	T
IGHMBP2	3508	genome.wustl.edu	37	11	68701368	68701368	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:68701368G>A	ENST00000255078.3	+	10	1635	c.1524G>A	c.(1522-1524)tcG>tcA	p.S508S	IGHMBP2_ENST00000541229.1_3'UTR	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	508					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ACGAACAGTCGAAAGGGAACC	0.527																																																	0													62.0	62.0	62.0					11																	68701368		2197	4294	6491	SO:0001819	synonymous_variant	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.1524G>A	11.37:g.68701368G>A			A0PJD2|Q00443|Q14177	Silent	SNP	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.S508	ENST00000255078.3	37	c.1524	CCDS8187.1	11																																																																																			IGHMBP2	-	superfamily_P-loop_NTPase,tigrfam_DNA_helicase_put	ENSG00000132740		0.527	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	-	0.00	100	0	G	NM_002180		68701368	+1	tier1	-	no_errors	ENST00000255078	ensembl	human	known	74_37	silent	11.88	178	24	SNP	0.467	A
IPO5	3843	genome.wustl.edu	37	13	98660331	98660331	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:98660331G>A	ENST00000490680.1	+	15	1800	c.1735G>A	c.(1735-1737)Gat>Aat	p.D579N	IPO5_ENST00000261574.5_Missense_Mutation_p.D597N|IPO5_ENST00000539640.1_Missense_Mutation_p.D454N			O00410	IPO5_HUMAN	importin 5	579					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)	p.D597H(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GGATGCATCAGATGTGATGCA	0.383																																																	1	Substitution - Missense(1)	breast(1)											162.0	144.0	150.0					13																	98660331		2203	4300	6503	SO:0001583	missense	0			U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1735G>A	13.37:g.98660331G>A	ENSP00000418393:p.Asp579Asn		B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_Importin-beta_N	p.D597N	ENST00000490680.1	37	c.1789		13	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486184	0.63962	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.24	5.24	0.73138	Armadillo-type fold (1);	0.097389	0.64402	N	0.000001	T	0.12987	0.0315	N	0.05177	-0.1	0.58432	D	0.999998	B;B;B	0.18013	0.003;0.015;0.025	B;B;B	0.26416	0.013;0.019;0.069	T	0.17440	-1.0369	10	0.15499	T	0.54	-21.9067	18.7784	0.91922	0.0:0.0:1.0:0.0	.	454;579;597	B4E0R6;O00410;O00410-3	.;IPO5_HUMAN;.	N	597;579;579;454	ENSP00000261574:D597N;ENSP00000350219:D579N;ENSP00000418393:D579N;ENSP00000445126:D454N	ENSP00000261574:D597N	D	+	1	0	IPO5	97458332	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.294000	0.96088	2.594000	0.87642	0.563000	0.77884	GAT	IPO5	-	superfamily_ARM-type_fold	ENSG00000065150		0.383	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	IPO5	HGNC	protein_coding	OTTHUMT00000354655.1	-	0.00	28	0	G	NM_002271		98660331	+1	tier1	-	no_errors	ENST00000261574	ensembl	human	known	74_37	missense	76.92	9	30	SNP	1.000	A
ISX	91464	genome.wustl.edu	37	22	35481509	35481509	+	Silent	SNP	G	G	T	rs202084562		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:35481509G>T	ENST00000308700.6	+	4	1513	c.561G>T	c.(559-561)tcG>tcT	p.S187S	ISX_ENST00000404699.2_Silent_p.S187S	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	187					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S187S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GTTGTCCATCGGCTCAAGATC	0.617													g|||	1	0.000199681	0.0	0.0	5008	,	,		19555	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	ovary(1)											161.0	129.0	140.0					22																	35481509		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.561G>T	22.37:g.35481509G>T			Q68DJ5	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S187	ENST00000308700.6	37	c.561	CCDS33640.1	22																																																																																			ISX	-	NULL	ENSG00000175329		0.617	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1		0.00	24	0	G	NM_001008494		35481509	+1			no_errors	ENST00000308700	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.000	T
PLA2G4B	100137049	genome.wustl.edu	37	15	42138148	42138148	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:42138148G>C	ENST00000452633.1	+	17	1855	c.1503G>C	c.(1501-1503)tgG>tgC	p.W501C	PLA2G4B_ENST00000458483.1_Missense_Mutation_p.W501C|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.W732C|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.W732C|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.W732C			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	501	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CAGGTATCTGGAGCAACCTGT	0.602																																																	0													45.0	48.0	47.0					15																	42138148		2203	4300	6503	SO:0001583	missense	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1503G>C	15.37:g.42138148G>C	ENSP00000396045:p.Trp501Cys		B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.W732C	ENST00000452633.1	37	c.2196	CCDS45241.1	15	.	.	.	.	.	.	.	.	.	.	.	18.25	3.582226	0.65992	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	5.04	5.04	0.67666	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.64402	D	0.000005	T	0.25791	0.0628	M	0.79011	2.435	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;1.0;0.999	T	0.00282	-1.1850	10	0.87932	D	0	-18.554	14.6296	0.68647	0.0:0.0:1.0:0.0	.	501;732;202;732	P0C869;P0C869-7;P0C869-4;P0C869-6	PA24B_HUMAN;.;.;.	C	732;732;501;501	ENSP00000371886:W732C;ENSP00000342785:W732C;ENSP00000416610:W501C;ENSP00000396045:W501C	ENSP00000342785:W732C	W	+	3	0	JMJD7-PLA2G4B;PLA2G4B	39925440	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.191000	0.58372	2.724000	0.93272	0.561000	0.74099	TGG	JMJD7-PLA2G4B	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000168970		0.602	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	-	0.00	61	0	G	NM_001114633		42138148	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	missense	69.23	16	36	SNP	1.000	C
KCNA3	3738	genome.wustl.edu	37	1	111215886	111215886	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:111215886G>A	ENST00000369769.2	-	1	1769	c.1546C>T	c.(1546-1548)Cga>Tga	p.R516*		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	516					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	CTTGCTTTTCGGAGCTCCTCG	0.522																																																	0													86.0	77.0	80.0					1																	111215886		2203	4300	6503	SO:0001587	stop_gained	0			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1546C>T	1.37:g.111215886G>A	ENSP00000358784:p.Arg516*		Q5VWN2	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.3,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.R516*	ENST00000369769.2	37	c.1546	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	G	38	7.052051	0.98029	.	.	ENSG00000177272	ENST00000369769	.	.	.	5.91	2.76	0.32466	.	0.203988	0.39341	U	0.001398	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	8.6787	0.34196	0.0:0.1102:0.3799:0.5099	.	.	.	.	X	516	.	ENSP00000358784:R516X	R	-	1	2	KCNA3	111017409	0.997000	0.39634	0.998000	0.56505	0.990000	0.78478	1.353000	0.34045	1.435000	0.47434	0.655000	0.94253	CGA	KCNA3	-	NULL	ENSG00000177272		0.522	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	HGNC	protein_coding	OTTHUMT00000083391.1	-	0.00	47	0	G	NM_002232		111215886	-1	tier1	-	no_errors	ENST00000369769	ensembl	human	known	74_37	nonsense	60.71	11	17	SNP	1.000	A
KCNQ3	3786	genome.wustl.edu	37	8	133141661	133141661	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:133141661C>A	ENST00000388996.4	-	15	2887	c.2467G>T	c.(2467-2469)Ggg>Tgg	p.G823W	KCNQ3_ENST00000521134.1_Missense_Mutation_p.G703W|KCNQ3_ENST00000519445.1_Missense_Mutation_p.G811W	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	823					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CAGCTCGACCCCCCATTGGGG	0.612																																																	0													64.0	57.0	60.0					8																	133141661		2203	4300	6503	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2467G>T	8.37:g.133141661C>A	ENSP00000373648:p.Gly823Trp		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.G823W	ENST00000388996.4	37	c.2467	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851366	0.51270	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	T;T;T	0.48522	0.81;0.81;0.81	5.63	5.63	0.86233	.	10.601200	0.00597	N	0.000370	T	0.65354	0.2683	N	0.22421	0.69	0.48830	D	0.999716	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.52139	-0.8615	10	0.72032	D	0.01	-18.274	18.678	0.91535	0.0:1.0:0.0:0.0	.	811;823	E7ET42;O43525	.;KCNQ3_HUMAN	W	823;703;811;800;702	ENSP00000373648:G823W;ENSP00000429799:G703W;ENSP00000428790:G811W	ENSP00000373648:G823W	G	-	1	0	KCNQ3	133210843	0.941000	0.31946	0.949000	0.38748	0.516000	0.34256	3.510000	0.53393	2.669000	0.90835	0.655000	0.94253	GGG	KCNQ3	-	pfam_Ankyrin-G_BS	ENSG00000184156		0.612	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	27	0	C	NM_004519		133141661	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	missense	33.33	28	14	SNP	1.000	A
KDM4D	55693	genome.wustl.edu	37	11	94730891	94730891	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:94730891G>A	ENST00000335080.5	+	3	1187	c.355G>A	c.(355-357)Gaa>Aaa	p.E119K	KDM4D_ENST00000536741.1_Missense_Mutation_p.E119K	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	119					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CCAGAATTTCGAAGATTTGGA	0.393																																																	0													88.0	87.0	87.0					11																	94730891		2201	4298	6499	SO:0001583	missense	0			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.355G>A	11.37:g.94730891G>A	ENSP00000334181:p.Glu119Lys		B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.E119K	ENST00000335080.5	37	c.355	CCDS8302.1	11	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261520	0.59431	.	.	ENSG00000186280	ENST00000335080	T	0.30981	1.51	4.57	1.49	0.22878	.	0.239591	0.32624	U	0.005850	T	0.27765	0.0683	M	0.67397	2.05	0.41880	D	0.99031	B	0.25048	0.117	B	0.16289	0.015	T	0.07102	-1.0790	10	0.45353	T	0.12	-13.3241	8.6094	0.33793	0.0844:0.2874:0.6282:0.0	.	119	Q6B0I6	KDM4D_HUMAN	K	119	ENSP00000334181:E119K	ENSP00000334181:E119K	E	+	1	0	KDM4D	94370539	1.000000	0.71417	0.008000	0.14137	0.435000	0.31806	2.932000	0.48940	0.199000	0.20427	0.563000	0.77884	GAA	KDM4D	-	NULL	ENSG00000186280		0.393	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4D	HGNC	protein_coding	OTTHUMT00000396558.2	-	0.00	36	0	G	NM_018039		94730891	+1	tier1	-	no_errors	ENST00000335080	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.974	A
KHDRBS3	10656	genome.wustl.edu	37	8	136594204	136594204	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:136594204G>A	ENST00000355849.5	+	6	1105	c.695G>A	c.(694-696)cGa>cAa	p.R232Q	KHDRBS3_ENST00000520981.1_Intron	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	232	Interaction with SIAH1.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			CTGTCCACCCGAGGGCCAGTG	0.612																																																	0													62.0	61.0	61.0					8																	136594204		2203	4300	6503	SO:0001583	missense	0			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.695G>A	8.37:g.136594204G>A	ENSP00000348108:p.Arg232Gln		Q6NUL8|Q9UPA8	Missense_Mutation	SNP	smart_KH_dom	p.R232Q	ENST00000355849.5	37	c.695	CCDS6374.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.432477|3.432477	0.62844|0.62844	.|.	.|.	ENSG00000131773|ENSG00000131773	ENST00000524282|ENST00000355849;ENST00000524199	.|T	.|0.47177	.|0.85	6.07|6.07	5.19|5.19	0.71726|0.71726	.|.	.|1.574780	.|0.04987	.|N	.|0.466611	T|T	0.68192|0.68192	0.2974|0.2974	M|M	0.76170|0.76170	2.325|2.325	0.80722|0.80722	D|D	1|1	.|P;D	.|0.76494	.|0.935;0.999	.|B;P	.|0.58721	.|0.211;0.844	T|T	0.54364|0.54364	-0.8305|-0.8305	5|10	.|0.18710	.|T	.|0.47	-19.4473|-19.4473	16.6221|16.6221	0.84933|0.84933	0.0:0.1299:0.8701:0.0|0.0:0.1299:0.8701:0.0	.|.	.|232;232	.|O75525-2;O75525	.|.;KHDR3_HUMAN	K|Q	147|232;204	.|ENSP00000348108:R232Q	.|ENSP00000348108:R232Q	E|R	+|+	1|2	0|0	KHDRBS3|KHDRBS3	136663386|136663386	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.413000|0.413000	0.31143|0.31143	6.744000|6.744000	0.74854|0.74854	1.572000|1.572000	0.49736|0.49736	-0.172000|-0.172000	0.13284|0.13284	GAG|CGA	KHDRBS3	-	NULL	ENSG00000131773		0.612	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	HGNC	protein_coding	OTTHUMT00000377529.1	-	0.00	40	0	G			136594204	+1	tier1	-	no_errors	ENST00000355849	ensembl	human	known	74_37	missense	47.69	34	31	SNP	0.991	A
KIAA0319	9856	genome.wustl.edu	37	6	24572926	24572926	+	Splice_Site	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:24572926C>T	ENST00000378214.3	-	11	2259	c.1735G>A	c.(1735-1737)Gga>Aga	p.G579R	KIAA0319_ENST00000535378.1_Splice_Site_p.G570R|KIAA0319_ENST00000543707.1_Splice_Site_p.G579R|KIAA0319_ENST00000430948.2_Splice_Site_p.G534R|KIAA0319_ENST00000537886.1_Splice_Site_p.G579R	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	579	PKD 3. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GTCTGTACTCCCTaagtaata	0.328																																																	0													87.0	76.0	80.0					6																	24572926		2203	4300	6503	SO:0001630	splice_region_variant	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1735-1G>A	6.37:g.24572926C>T			A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.G579R	ENST00000378214.3	37	c.1735	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912518	0.52439	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	4.31	4.31	0.51392	PKD/Chitinase domain (1);PKD/REJ-like protein (1);PKD domain (3);	1.577660	0.04270	N	0.341865	T	0.80757	0.4684	M	0.88031	2.925	0.50171	D	0.999858	D;D;D	0.67145	0.996;0.973;0.978	D;P;P	0.66196	0.942;0.893;0.897	T	0.73000	-0.4120	10	0.87932	D	0	-1.1866	10.5987	0.45354	0.0:0.9115:0.0:0.0885	.	579;570;579	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	R	579;570;534;579;579	ENSP00000439700:G579R;ENSP00000442403:G570R;ENSP00000401086:G534R;ENSP00000367459:G579R;ENSP00000437656:G579R	ENSP00000367459:G579R	G	-	1	0	KIAA0319	24680905	1.000000	0.71417	0.962000	0.40283	0.087000	0.18053	5.106000	0.64597	2.207000	0.71202	0.655000	0.94253	GGA	KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	ENSG00000137261		0.328	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	-	0.00	36	0	C	NM_014809	Missense_Mutation	24572926	-1	tier1	-	no_errors	ENST00000378214	ensembl	human	known	74_37	missense	39.47	23	15	SNP	1.000	T
KIAA0586	9786	genome.wustl.edu	37	14	58924677	58924677	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:58924677C>G	ENST00000556134.1	+	12	1792	c.1518C>G	c.(1516-1518)atC>atG	p.I506M	KIAA0586_ENST00000423743.3_Missense_Mutation_p.I477M|KIAA0586_ENST00000261244.5_Missense_Mutation_p.I521M|KIAA0586_ENST00000354386.6_Missense_Mutation_p.I574M|KIAA0586_ENST00000538571.2_3'UTR	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	506	Required for centrosomal localization. {ECO:0000250}.				cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATTCGCTTATCAATGCTTTAT	0.358																																																	0													49.0	48.0	49.0					14																	58924677		1852	4100	5952	SO:0001583	missense	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.1518C>G	14.37:g.58924677C>G	ENSP00000452351:p.Ile506Met		B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	NULL	p.I506M	ENST00000556134.1	37	c.1518	CCDS58321.1	14	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876249	0.51801	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.99	4.93	0.64822	.	0.081823	0.51477	D	0.000083	T	0.59473	0.2196	L	0.51422	1.61	0.31152	N	0.70536	P;P;D;P;P;P	0.89917	0.717;0.717;1.0;0.717;0.717;0.717	B;B;D;B;B;B	0.91635	0.352;0.352;0.999;0.352;0.352;0.352	T	0.63782	-0.6559	10	0.44086	T	0.13	.	3.2487	0.06806	0.2243:0.5161:0.1273:0.1323	.	381;381;574;521;506;477	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	M	574;506;477;521;381	ENSP00000346359:I574M;ENSP00000452351:I506M;ENSP00000399427:I477M;ENSP00000261244:I521M	ENSP00000261244:I521M	I	+	3	3	KIAA0586	57994430	0.950000	0.32346	1.000000	0.80357	0.959000	0.62525	-0.008000	0.12788	2.840000	0.97914	0.655000	0.94253	ATC	KIAA0586	-	NULL	ENSG00000100578		0.358	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1	-	0.00	50	0	C	NM_014749		58924677	+1	tier1	-	no_errors	ENST00000556134	ensembl	human	known	74_37	missense	21.43	33	9	SNP	0.998	G
KIAA0895	23366	genome.wustl.edu	37	7	36373465	36373465	+	Splice_Site	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:36373465C>A	ENST00000297063.6	-	5	1356	c.1306G>T	c.(1306-1308)Ggg>Tgg	p.G436W	KIAA0895_ENST00000436884.1_Splice_Site_p.G333W|KIAA0895_ENST00000453212.1_Splice_Site_p.G191W|KIAA0895_ENST00000440378.1_Splice_Site_p.G433W|KIAA0895_ENST00000317020.6_Splice_Site_p.G385W|KIAA0895_ENST00000338533.5_Splice_Site_p.G423W|KIAA0895_ENST00000480192.1_5'UTR	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	436										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GGACACCCACCTGGTTGGGAA	0.403																																																	0													77.0	78.0	78.0					7																	36373465		1889	4117	6006	SO:0001630	splice_region_variant	0			BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.1306+1G>T	7.37:g.36373465C>A			B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	pfam_DUF1704	p.G436W	ENST00000297063.6	37	c.1306	CCDS43570.1	7	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761507	0.89932	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000436884;ENST00000453212	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.996;0.995;0.996;0.996	T	0.81684	-0.0821	9	0.87932	D	0	-7.7734	18.7786	0.91922	0.0:1.0:0.0:0.0	.	433;333;436;423;385	B7ZLT4;B4DF35;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;K0895_HUMAN;.;.	W	436;423;385;433;333;191	.	ENSP00000297063:G436W	G	-	1	0	KIAA0895	36339990	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.357000	0.79456	2.515000	0.84797	0.655000	0.94253	GGG	KIAA0895	-	pfam_DUF1704	ENSG00000164542		0.403	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	KIAA0895	HGNC	protein_coding	OTTHUMT00000337717.1	-	0.00	58	0	C	NM_015314	Missense_Mutation	36373465	-1	tier1	-	no_errors	ENST00000297063	ensembl	human	known	74_37	missense	75.51	12	37	SNP	1.000	A
KIAA1161	57462	genome.wustl.edu	37	9	34371966	34371966	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:34371966G>T	ENST00000297625.7	-	2	1099	c.874C>A	c.(874-876)Cgc>Agc	p.R292S		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	326					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		TCCACGGCGCGCCCGTACAGC	0.602																																																	0													84.0	87.0	86.0					9																	34371966		2146	4225	6371	SO:0001583	missense	0			AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.874C>A	9.37:g.34371966G>T	ENSP00000297625:p.Arg292Ser		Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	p.R292S	ENST00000297625.7	37	c.874		9	.	.	.	.	.	.	.	.	.	.	G	8.464	0.856052	0.17106	.	.	ENSG00000164976	ENST00000297625	T	0.42513	0.97	5.76	4.79	0.61399	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.250711	0.42294	D	0.000738	T	0.30696	0.0773	L	0.38953	1.18	0.29696	N	0.84056	B	0.24651	0.108	B	0.28232	0.087	T	0.14420	-1.0473	10	0.11182	T	0.66	-10.7155	10.9457	0.47299	0.0:0.0:0.6572:0.3428	.	326	Q6NSJ0	K1161_HUMAN	S	292	ENSP00000297625:R292S	ENSP00000297625:R292S	R	-	1	0	KIAA1161	34361966	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.915000	0.56409	2.724000	0.93272	0.561000	0.74099	CGC	KIAA1161	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000164976		0.602	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	KIAA1161	HGNC	protein_coding	OTTHUMT00000052158.1		0.00	19	0	G	XM_351807		34371966	-1			no_errors	ENST00000297625	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.999	T
KIAA1324L	222223	genome.wustl.edu	37	7	86569422	86569422	+	Nonsense_Mutation	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:86569422T>A	ENST00000450689.2	-	6	936	c.751A>T	c.(751-753)Aaa>Taa	p.K251*	KIAA1324L_ENST00000297222.6_Nonsense_Mutation_p.K11*|KIAA1324L_ENST00000444627.1_Nonsense_Mutation_p.K251*|KIAA1324L_ENST00000416314.1_Nonsense_Mutation_p.K84*	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	251						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GTGCCTGATTTCAGCATTACC	0.388																																																	0													142.0	131.0	135.0					7																	86569422		2203	4300	6503	SO:0001587	stop_gained	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.751A>T	7.37:g.86569422T>A	ENSP00000413445:p.Lys251*		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Nonsense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.K251*	ENST00000450689.2	37	c.751	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	40|40	8.257212|8.257212	0.98729|0.98729	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.38214|.	0.1032|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35525|.	-0.9785|.	3|.	.|0.02654	.|T	.|1	.|.	15.5086|15.5086	0.75760|0.75760	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	V|X	211|251;11;251;84	.|.	.|ENSP00000297222:K11X	E|K	-|-	2|1	0|0	KIAA1324L|KIAA1324L	86407358|86407358	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	5.130000|5.130000	0.64745|0.64745	2.266000|2.266000	0.75297|0.75297	0.528000|0.528000	0.53228|0.53228	GAA|AAA	KIAA1324L	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000164659		0.388	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	-	0.00	47	0	T	NM_152748		86569422	-1	tier1	-	no_errors	ENST00000450689	ensembl	human	known	74_37	nonsense	63.75	29	51	SNP	1.000	A
KIAA1328	57536	genome.wustl.edu	37	18	34740346	34740346	+	Splice_Site	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:34740346T>A	ENST00000280020.5	+	8	1436		c.e8+2		KIAA1328_ENST00000586135.1_Splice_Site|KIAA1328_ENST00000435985.2_Splice_Site|KIAA1328_ENST00000591619.1_Splice_Site|KIAA1328_ENST00000543923.1_Splice_Site	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328											central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		CCCAAAGAGGTAAGTTTAACA	0.403																																																	0													53.0	50.0	51.0					18																	34740346		1889	4113	6002	SO:0001630	splice_region_variant	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.1414+2T>A	18.37:g.34740346T>A			Q05DL0|Q49AG6|Q9P2L8	Splice_Site	SNP	-	e8+2	ENST00000280020.5	37	c.1414+2	CCDS45855.1	18	.	.	.	.	.	.	.	.	.	.	T	14.06	2.421681	0.43020	.	.	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055;ENST00000435985	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5161	0.61541	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1328	32994344	1.000000	0.71417	0.999000	0.59377	0.240000	0.25518	4.360000	0.59455	2.182000	0.69389	0.482000	0.46254	.	KIAA1328	-	-	ENSG00000150477		0.403	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	-	0.00	54	0	T	NM_020776	Intron	34740346	+1	tier1	-	no_errors	ENST00000280020	ensembl	human	known	74_37	splice_site	32.73	37	18	SNP	1.000	A
KIAA1731	85459	genome.wustl.edu	37	11	93420958	93420958	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:93420958G>T	ENST00000325212.6	+	10	1425	c.1263G>T	c.(1261-1263)gaG>gaT	p.E421D	KIAA1731_ENST00000411936.1_Missense_Mutation_p.E421D|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	421						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTGAAATTGAGAGTAAAGCAC	0.378																																																	0													90.0	88.0	89.0					11																	93420958		692	1591	2283	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.1263G>T	11.37:g.93420958G>T	ENSP00000316681:p.Glu421Asp		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.E421D	ENST00000325212.6	37	c.1263	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360067	0.61403	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.11385	2.79;2.78	5.72	0.88	0.19161	.	0.919520	0.09059	N	0.854655	T	0.09512	0.0234	L	0.43923	1.385	0.44685	D	0.997677	P	0.40731	0.728	B	0.41764	0.366	T	0.41910	-0.9482	10	0.52906	T	0.07	0.3399	0.1858	0.00128	0.2947:0.1906:0.2878:0.2269	.	421	Q9C0D2	K1731_HUMAN	D	421	ENSP00000316681:E421D;ENSP00000406505:E421D	ENSP00000316681:E421D	E	+	3	2	KIAA1731	93060606	0.209000	0.23505	0.118000	0.21660	0.144000	0.21451	-0.020000	0.12525	0.256000	0.21614	-0.274000	0.10170	GAG	KIAA1731	-	NULL	ENSG00000166004		0.378	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	-	0.00	72	0	G	NM_033395		93420958	+1	tier1	-	no_errors	ENST00000411936	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.441	T
KIAA2026	158358	genome.wustl.edu	37	9	5922290	5922290	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:5922290G>T	ENST00000399933.3	-	8	3705	c.3706C>A	c.(3706-3708)Ctg>Atg	p.L1236M	KIAA2026_ENST00000381461.2_Missense_Mutation_p.L1206M	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1236										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GTTGATGACAGAGGCTGACCT	0.478																																																	0													108.0	103.0	105.0					9																	5922290		2041	4194	6235	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3706C>A	9.37:g.5922290G>T	ENSP00000382815:p.Leu1236Met		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.L1236M	ENST00000399933.3	37	c.3706		9	.	.	.	.	.	.	.	.	.	.	G	7.901	0.734443	0.15574	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.75	2.89	0.33648	.	0.322422	0.21906	N	0.067368	T	0.28499	0.0705	N	0.19112	0.55	0.23780	N	0.996867	P	0.44429	0.835	P	0.49332	0.607	T	0.05451	-1.0884	9	0.48119	T	0.1	0.0063	5.6614	0.17670	0.1876:0.1652:0.6472:0.0	.	1236	Q5HYC2	K2026_HUMAN	M	1236;1206	.	ENSP00000370870:L1206M	L	-	1	2	KIAA2026	5912290	0.727000	0.28069	0.989000	0.46669	0.825000	0.46686	0.172000	0.16704	0.612000	0.30071	0.555000	0.69702	CTG	KIAA2026	-	NULL	ENSG00000183354		0.478	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	-	0.00	64	0	G	NM_001017969		5922290	-1	tier1	-	no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	5.56	68	4	SNP	0.965	T
KIF15	56992	genome.wustl.edu	37	3	44819628	44819628	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:44819628G>T	ENST00000326047.4	+	4	417	c.268G>T	c.(268-270)Gct>Tct	p.A90S		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	90	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CGCAACTGTGGCTAAAAGCAT	0.338																																																	0													296.0	270.0	279.0					3																	44819628		2203	4300	6503	SO:0001583	missense	0			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.268G>T	3.37:g.44819628G>T	ENSP00000324020:p.Ala90Ser		Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A90S	ENST00000326047.4	37	c.268	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	11.31	1.602436	0.28534	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	T	0.76060	-0.99	5.41	3.58	0.41010	Kinesin, motor domain (4);	0.000000	0.49916	D	0.000127	T	0.79879	0.4522	L	0.47190	1.495	0.80722	D	1	D	0.64830	0.994	D	0.72075	0.976	T	0.78455	-0.2197	10	0.56958	D	0.05	.	10.2207	0.43194	0.0709:0.0:0.7931:0.136	.	90	Q9NS87	KIF15_HUMAN	S	90;89	ENSP00000324020:A90S	ENSP00000324020:A90S	A	+	1	0	KIF15	44794632	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.009000	0.88606	0.626000	0.30322	0.462000	0.41574	GCT	KIF15	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000163808		0.338	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	HGNC	protein_coding	OTTHUMT00000343831.2	-	0.00	72	0	G			44819628	+1	tier1	-	no_errors	ENST00000326047	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
KIF26B	55083	genome.wustl.edu	37	1	245849901	245849901	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:245849901C>T	ENST00000407071.2	+	12	4056	c.3616C>T	c.(3616-3618)Cgc>Tgc	p.R1206C	KIF26B_ENST00000366518.4_Missense_Mutation_p.R825C	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1206					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGACAGCGGCCGCCCCACCAG	0.657																																																	0													20.0	26.0	24.0					1																	245849901		2149	4244	6393	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3616C>T	1.37:g.245849901C>T	ENSP00000385545:p.Arg1206Cys		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1206C	ENST00000407071.2	37	c.3616	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516840	0.64634	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.83163	-1.69;-1.68	5.77	5.77	0.91146	.	.	.	.	.	D	0.92224	0.7534	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.92350	0.5889	9	0.66056	D	0.02	.	19.9961	0.97386	0.0:1.0:0.0:0.0	.	825;1206	B7WPD9;Q2KJY2	.;KI26B_HUMAN	C	1206;825;822	ENSP00000385545:R1206C;ENSP00000355475:R825C	ENSP00000355475:R825C	R	+	1	0	KIF26B	243916524	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.863000	0.69568	2.744000	0.94065	0.561000	0.74099	CGC	KIF26B	-	NULL	ENSG00000162849		0.657	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	-	0.00	61	0	C	XM_371354		245849901	+1	tier1	-	no_errors	ENST00000407071	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	T
KIF26B	55083	genome.wustl.edu	37	1	245865859	245865862	+	Frame_Shift_Del	DEL	CCCA	CCCA	-			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	CCCA	CCCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:245865859_245865862delCCCA	ENST00000407071.2	+	15	6718_6721	c.6278_6281delCCCA	c.(6277-6282)gcccatfs	p.AH2093fs	KIF26B_ENST00000366518.4_Frame_Shift_Del_p.AH1712fs	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2093					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TTCTGCAAGGCCCATCTCATGATG	0.588																																																	0																																										SO:0001589	frameshift_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6278_6281delCCCA	1.37:g.245865859_245865862delCCCA	ENSP00000385545:p.Ala2093fs		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A2093fs	ENST00000407071.2	37	c.6278_6281	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.588	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1		0.00	54	0	CCCA	XM_371354		245865862	+1	tier1		no_errors	ENST00000407071	ensembl	human	known	74_37	frame_shift_del	10.42	43	5	DEL	1.000:0.270:0.995:0.995	-
KIF26B	55083	genome.wustl.edu	37	1	245865863	245865864	+	Frame_Shift_Ins	INS	-	-	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:245865863_245865864insG	ENST00000407071.2	+	15	6722_6723	c.6282_6283insG	c.(6283-6285)ctcfs	p.L2095fs	KIF26B_ENST00000366518.4_Frame_Shift_Ins_p.L1714fs	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2095					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCAAGGCCCATCTCATGATGAT	0.589																																																	0																																										SO:0001589	frameshift_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	Exception_encountered	1.37:g.245865863_245865864insG	ENSP00000385545:p.Leu2095fs		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L2094fs	ENST00000407071.2	37	c.6282_6283	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.589	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1		0.00	60	0	-	XM_371354		245865864	+1	tier1		no_errors	ENST00000407071	ensembl	human	known	74_37	frame_shift_ins	10.42	43	5	INS	0.646:0.999	G
KIF26B	55083	genome.wustl.edu	37	1	245865864	245865864	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:245865864C>A	ENST00000407071.2	+	15	6723	c.6283C>A	c.(6283-6285)Ctc>Atc	p.L2095I	KIF26B_ENST00000366518.4_Missense_Mutation_p.L1714I	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2095					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CAAGGCCCATCTCATGATGAT	0.592																																																	0													89.0	92.0	91.0					1																	245865864		2044	4186	6230	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6283C>A	1.37:g.245865864C>A	ENSP00000385545:p.Leu2095Ile		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L2095I	ENST00000407071.2	37	c.6283	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146500	0.57044	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.78003	-1.14;-1.13	5.86	5.86	0.93980	.	.	.	.	.	T	0.71307	0.3324	N	0.24115	0.695	0.47547	D	0.99945	P	0.48503	0.911	B	0.43838	0.433	T	0.71328	-0.4626	9	0.37606	T	0.19	.	20.1837	0.98210	0.0:1.0:0.0:0.0	.	2095	Q2KJY2	KI26B_HUMAN	I	2095;1714;1711	ENSP00000385545:L2095I;ENSP00000355475:L1714I	ENSP00000355475:L1714I	L	+	1	0	KIF26B	243932487	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	3.778000	0.55371	2.774000	0.95407	0.650000	0.86243	CTC	KIF26B	-	NULL	ENSG00000162849		0.592	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	-	0.00	60	0	C	XM_371354		245865864	+1	tier1	-	no_errors	ENST00000407071	ensembl	human	known	74_37	missense	10.20	44	5	SNP	0.999	A
KLHL2	11275	genome.wustl.edu	37	4	166220690	166220690	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:166220690G>A	ENST00000226725.6	+	8	1062	c.803G>A	c.(802-804)aGc>aAc	p.S268N	KLHL2_ENST00000509028.1_3'UTR|KLHL2_ENST00000514860.1_Missense_Mutation_p.S272N|KLHL2_ENST00000538127.1_Missense_Mutation_p.S180N|KLHL2_ENST00000421009.2_Missense_Mutation_p.S171N|KLHL2_ENST00000506761.1_Missense_Mutation_p.S102N	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	268					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GTCAAGAATAGCAGTGCTTGC	0.433																																																	0													111.0	105.0	107.0					4																	166220690		2203	4300	6503	SO:0001583	missense	0			AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.803G>A	4.37:g.166220690G>A	ENSP00000226725:p.Ser268Asn		A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S268N	ENST00000226725.6	37	c.803	CCDS34094.1	4	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769810	0.31320	.	.	ENSG00000109466	ENST00000226725;ENST00000514860;ENST00000538127;ENST00000421009;ENST00000506761	T;T;T;T;T	0.74002	-0.76;-0.76;-0.8;-0.56;-0.59	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	N	0.11927	0.2	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.57335	-0.7829	10	0.02654	T	1	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	272;268	B4DFH7;O95198	.;KLHL2_HUMAN	N	268;272;180;171;102	ENSP00000226725:S268N;ENSP00000424198:S272N;ENSP00000437526:S180N;ENSP00000408974:S171N;ENSP00000424108:S102N	ENSP00000226725:S268N	S	+	2	0	KLHL2	166440140	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.761000	0.68801	2.894000	0.99253	0.655000	0.94253	AGC	KLHL2	-	pirsf_Kelch-like_gigaxonin	ENSG00000109466		0.433	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLHL2	HGNC	protein_coding	OTTHUMT00000364439.1	-	0.00	61	0	G			166220690	+1	tier1	-	no_errors	ENST00000226725	ensembl	human	known	74_37	missense	60.38	21	32	SNP	1.000	A
KLHL25	64410	genome.wustl.edu	37	15	86311930	86311930	+	Missense_Mutation	SNP	G	G	A	rs542141942		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:86311930G>A	ENST00000337975.5	-	2	1386	c.1112C>T	c.(1111-1113)gCg>gTg	p.A371V	KLHL25_ENST00000559131.1_Intron|KLHL25_ENST00000536947.1_Missense_Mutation_p.A371V|MIR1276_ENST00000408707.1_RNA	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	371					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						CATGGGCGCCGCCTTGGACCA	0.622																																																	0													41.0	42.0	42.0					15																	86311930		2202	4299	6501	SO:0001583	missense	0				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1112C>T	15.37:g.86311930G>A	ENSP00000336800:p.Ala371Val		B2RDH2|B3KRT7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A371V	ENST00000337975.5	37	c.1112	CCDS10339.1	15	.	.	.	.	.	.	.	.	.	.	G	14.49	2.552413	0.45487	.	.	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	T;T	0.75821	-0.97;-0.97	5.18	5.18	0.71444	Kelch-type beta propeller (1);	0.125191	0.52532	D	0.000061	T	0.57475	0.2056	N	0.13098	0.295	0.43283	D	0.99525	B	0.22276	0.067	B	0.25987	0.065	T	0.55755	-0.8091	10	0.02654	T	1	.	17.6839	0.88251	0.0:0.0:1.0:0.0	.	371	Q9H0H3	ENC2_HUMAN	V	371;340;371	ENSP00000336800:A371V;ENSP00000444739:A371V	ENSP00000336800:A371V	A	-	2	0	KLHL25	84112934	1.000000	0.71417	0.996000	0.52242	0.842000	0.47809	4.320000	0.59203	2.426000	0.82243	0.462000	0.41574	GCG	KLHL25	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000183655		0.622	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL25	HGNC	protein_coding	OTTHUMT00000309023.1		0.00	49	0	G	NM_022480		86311930	-1			no_errors	ENST00000337975	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.995	A
KMT2E	55904	genome.wustl.edu	37	7	104730616	104730616	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:104730616C>A	ENST00000311117.3	+	14	2064	c.1519C>A	c.(1519-1521)Cag>Aag	p.Q507K	KMT2E_ENST00000257745.4_Missense_Mutation_p.Q507K|KMT2E_ENST00000476671.1_Missense_Mutation_p.Q507K|KMT2E_ENST00000334877.4_Missense_Mutation_p.Q507K|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	507					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TACACAAAATCAGAATATTAC	0.323																																																	0													66.0	74.0	71.0					7																	104730616		2203	4300	6503	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1519C>A	7.37:g.104730616C>A	ENSP00000312379:p.Gln507Lys		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.Q507K	ENST00000311117.3	37	c.1519	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267554	0.80469	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000257745;ENST00000476671	D;D;D;D	0.93659	-2.94;-2.55;-2.94;-3.26	5.83	5.83	0.93111	.	0.115050	0.64402	D	0.000009	D	0.96473	0.8849	M	0.74258	2.255	0.80722	D	1	D;D	0.63880	0.993;0.982	D;D	0.70227	0.952;0.968	D	0.94998	0.8140	10	0.34782	T	0.22	.	20.1338	0.98010	0.0:1.0:0.0:0.0	.	507;507	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	K	507	ENSP00000312379:Q507K;ENSP00000335599:Q507K;ENSP00000257745:Q507K;ENSP00000417888:Q507K	ENSP00000257745:Q507K	Q	+	1	0	MLL5	104517852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.770000	0.95276	0.655000	0.94253	CAG	KMT2E	-	NULL	ENSG00000005483		0.323	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	-	0.00	50	0	C			104730616	+1	tier1	-	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	A
KPNA6	23633	genome.wustl.edu	37	1	32632773	32632773	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:32632773G>T	ENST00000373625.3	+	12	1213	c.1120G>T	c.(1120-1122)Gtt>Ttt	p.V374F	KPNA6_ENST00000537234.1_Missense_Mutation_p.V371F|KPNA6_ENST00000545542.1_Missense_Mutation_p.V379F	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	374	NLS binding site (minor). {ECO:0000250}.				maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CTCTCAGGCTGTTATAGATGC	0.438																																																	0													135.0	131.0	132.0					1																	32632773		2203	4300	6503	SO:0001583	missense	0			AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.1120G>T	1.37:g.32632773G>T	ENSP00000362728:p.Val374Phe		B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.V379F	ENST00000373625.3	37	c.1135	CCDS352.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.303618	0.95601	.	.	ENSG00000025800	ENST00000373625;ENST00000373617;ENST00000537234;ENST00000545542;ENST00000446515	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	5.0	5.0	0.66597	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88209	0.6375	M	0.90542	3.125	0.80722	D	1	D;D;D	0.67145	0.977;0.982;0.996	P;P;D	0.63381	0.777;0.857;0.914	D	0.90488	0.4465	10	0.87932	D	0	-15.6105	19.1901	0.93663	0.0:0.0:1.0:0.0	.	379;379;374	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	F	374;304;371;379;281	ENSP00000362728:V374F;ENSP00000444930:V371F;ENSP00000440609:V379F;ENSP00000415677:V281F	ENSP00000362719:V304F	V	+	1	0	KPNA6	32405360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.849000	0.99510	2.706000	0.92434	0.643000	0.83706	GTT	KPNA6	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000025800		0.438	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KPNA6	HGNC	protein_coding	OTTHUMT00000012527.4	-	0.00	60	0	G	NM_012316		32632773	+1	tier1	-	no_errors	ENST00000545542	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
KRT10	3858	genome.wustl.edu	37	17	38975315	38975317	+	Missense_Mutation	TNP	TGG	TGG	GAA			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T|G|G	T|G|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:38975315_38975317TGG>GAA	ENST00000269576.5	-	7	1479_1481	c.1470_1472CCA>TTC	c.(1468-1473)ggCCAc>ggTTCc	p.H491S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	491	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 1; AAA60544). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				actgccgccgtggccgccgccgt	0.798																																																	0																																										SO:0001583	missense	0			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1470_1472CCA>TTC	17.37:g.38975315TGG>GAA	ENSP00000269576:p.His491Ser		Q14664|Q8N175	Missense_Mutation|Missense_Mutation|Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.H491P|p.H491Y|p.G490	ENST00000269576.5	37	c.1472|c.1471|c.1470	CCDS11377.1	17																																																																																			KRT10	-	NULL	ENSG00000186395		0.798	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	HGNC	protein_coding	OTTHUMT00000257875.1		0.00	13|13|12	0	T|G|G	NM_000421		38975315|38975316|38975317	-1			no_errors	ENST00000269576	ensembl	human	known	74_37	missense|missense|silent	19.05|21.05|27.78	16|15|12	4|4|5	SNP	0.060|0.001|0.098	G|A|A
LACC1	144811	genome.wustl.edu	37	13	44456456	44456456	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:44456456C>T	ENST00000441843.1	+	3	1183	c.698C>T	c.(697-699)gCg>gTg	p.A233V	CCDC122_ENST00000444614.3_5'Flank|LACC1_ENST00000325686.6_Missense_Mutation_p.A233V|CCDC122_ENST00000476570.2_5'Flank	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	233																	CGTAGGTTGGCGAATGCTGCA	0.343																																																	0													83.0	85.0	84.0					13																	44456456		2203	4300	6503	SO:0001583	missense	0			AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.698C>T	13.37:g.44456456C>T	ENSP00000391747:p.Ala233Val		A2A3Z6|Q8N8X5	Missense_Mutation	SNP	pfam_Cu_polyphenol_OxRdtase_Laccase,superfamily_Cytotoxic_necrot_fac-like_cat	p.A233V	ENST00000441843.1	37	c.698	CCDS9391.1	13	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044497	0.75732	.	.	ENSG00000179630	ENST00000441843;ENST00000325686	T;T	0.48836	0.8;0.8	5.86	5.02	0.67125	.	0.101153	0.64402	D	0.000002	T	0.48978	0.1530	M	0.79693	2.465	0.40189	D	0.977384	P	0.46952	0.887	B	0.37601	0.254	T	0.59107	-0.7516	10	0.48119	T	0.1	-25.5209	13.8296	0.63373	0.0:0.5947:0.4053:0.0	.	233	Q8IV20	LACC1_HUMAN	V	233	ENSP00000391747:A233V;ENSP00000317619:A233V	ENSP00000317619:A233V	A	+	2	0	LACC1	43354456	0.998000	0.40836	0.961000	0.40146	0.981000	0.71138	3.733000	0.55029	1.491000	0.48482	0.609000	0.83330	GCG	LACC1	-	pfam_Cu_polyphenol_OxRdtase_Laccase,superfamily_Cytotoxic_necrot_fac-like_cat	ENSG00000179630		0.343	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LACC1	HGNC	protein_coding	OTTHUMT00000044726.3	-	0.00	37	0	C	NM_153218		44456456	+1	tier1	-	no_errors	ENST00000325686	ensembl	human	known	74_37	missense	38.64	27	17	SNP	0.920	T
LARP4B	23185	genome.wustl.edu	37	10	909779	909779	+	Missense_Mutation	SNP	C	C	T	rs375571598		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:909779C>T	ENST00000316157.3	-	4	374	c.334G>A	c.(334-336)Gca>Aca	p.A112T		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	112					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TCTGGCAATGCGGCATTCTCA	0.507																																																	0													100.0	96.0	98.0					10																	909779		2203	4300	6503	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.334G>A	10.37:g.909779C>T	ENSP00000326128:p.Ala112Thr		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.A112T	ENST00000316157.3	37	c.334	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	C	7.182	0.589863	0.13812	.	.	ENSG00000107929	ENST00000316157;ENST00000406525	T	0.30981	1.51	5.42	4.51	0.55191	.	0.369134	0.27473	N	0.019220	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	P	0.37352	0.591	B	0.25140	0.058	T	0.11518	-1.0584	10	0.32370	T	0.25	-2.9526	9.7813	0.40649	0.1399:0.7871:0.0:0.073	.	112	Q92615	LAR4B_HUMAN	T	112	ENSP00000326128:A112T	ENSP00000326128:A112T	A	-	1	0	LARP4B	899779	0.612000	0.27000	0.033000	0.17914	0.005000	0.04900	2.461000	0.45040	1.245000	0.43885	0.655000	0.94253	GCA	LARP4B	-	NULL	ENSG00000107929		0.507	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	-	0.00	29	0	C	NM_015155		909779	-1	tier1	-	no_errors	ENST00000316157	ensembl	human	known	74_37	missense	45.00	33	27	SNP	0.227	T
LATS2	26524	genome.wustl.edu	37	13	21557918	21557918	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:21557918G>T	ENST00000382592.4	-	5	2332	c.1927C>A	c.(1927-1929)Cag>Aag	p.Q643K	LATS2_ENST00000542899.1_Missense_Mutation_p.Q643K	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.Q643E(4)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTCCGCATCTGCTCCTGCTCA	0.458																																																	4	Substitution - Missense(4)	lung(4)											69.0	74.0	72.0					13																	21557918		2203	4300	6503	SO:0001583	missense	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1927C>A	13.37:g.21557918G>T	ENSP00000372035:p.Gln643Lys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.Q643K	ENST00000382592.4	37	c.1927	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647893	0.67358	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.44881	0.91;0.91	5.19	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000002	T	0.47021	0.1423	M	0.66378	2.025	0.80722	D	1	P	0.37824	0.609	B	0.37550	0.253	T	0.52668	-0.8545	10	0.59425	D	0.04	.	18.9571	0.92662	0.0:0.0:1.0:0.0	.	643	Q9NRM7	LATS2_HUMAN	K	643	ENSP00000372035:Q643K;ENSP00000441817:Q643K	ENSP00000372035:Q643K	Q	-	1	0	LATS2	20455918	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.202000	0.95026	2.709000	0.92574	0.555000	0.69702	CAG	LATS2	-	superfamily_Kinase-like_dom	ENSG00000150457		0.458	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1		0.00	23	0	G			21557918	-1			no_errors	ENST00000382592	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
LAYN	143903	genome.wustl.edu	37	11	111430916	111430916	+	Silent	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:111430916C>G	ENST00000375615.3	+	8	1067	c.882C>G	c.(880-882)gtC>gtG	p.V294V	LAYN_ENST00000375614.2_Silent_p.V286V|LAYN_ENST00000436913.2_Silent_p.V141V|LAYN_ENST00000525126.1_3'UTR|LAYN_ENST00000533265.1_3'UTR	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	294						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	TCTACAATGTCATAAGAAAAC	0.517																																					Ovarian(17;551 586 12136 22082 22900)												0													71.0	72.0	72.0					11																	111430916		2201	4297	6498	SO:0001819	synonymous_variant	0				CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.882C>G	11.37:g.111430916C>G			A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.V294	ENST00000375615.3	37	c.882	CCDS58178.1	11																																																																																			LAYN	-	NULL	ENSG00000204381		0.517	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1	-	0.00	43	0	C	NM_178834		111430916	+1	tier1	-	no_errors	ENST00000375615	ensembl	human	known	74_37	silent	11.11	24	3	SNP	1.000	G
LBX2	85474	genome.wustl.edu	37	2	74725123	74725123	+	Silent	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:74725123G>C	ENST00000377566.4	-	2	706	c.528C>G	c.(526-528)ctC>ctG	p.L176L	AC005041.17_ENST00000479098.1_RNA|LBX2_ENST00000550249.1_5'UTR|LBX2_ENST00000341396.2_3'UTR|LBX2_ENST00000460508.3_Silent_p.L172L	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						GGCCGAGGCAGAGGCCGGGAT	0.667																																																	0													28.0	32.0	31.0					2																	74725123		2202	4299	6501	SO:0001819	synonymous_variant	0			AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595	ENST00000377566.4:c.528C>G	2.37:g.74725123G>C			Q7Z5Y8	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.L176	ENST00000377566.4	37	c.528		2																																																																																			LBX2	-	NULL	ENSG00000179528		0.667	LBX2-002	KNOWN	basic|appris_principal	protein_coding	LBX2	HGNC	protein_coding	OTTHUMT00000328490.1	-	0.00	114	0	G	NM_001009812		74725123	-1	tier1	-	no_errors	ENST00000377566	ensembl	human	known	74_37	silent	67.16	44	90	SNP	0.000	C
LINC01128	643837	genome.wustl.edu	37	1	762524	762524	+	RNA	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:762524G>C	ENST00000445118.2	+	0	0				LINC00115_ENST00000473798.1_lincRNA	NR_047519.1|NR_047520.1|NR_047521.1|NR_047522.1|NR_047523.1|NR_047524.1|NR_047525.1																						GGGCTGCCCTGAGGGGCCAAG	0.672																																																	0																																												0																															1.37:g.762524G>C				RNA	SNP	-	NULL	ENST00000445118.2	37	NULL		1																																																																																			LINC00115	-	-	ENSG00000225880		0.672	RP11-206L10.11-001	KNOWN	basic	lincRNA	LINC00115	HGNC	processed_transcript	OTTHUMT00000007015.2	-	0.00	89	0	G			762524	-1	tier1	-	no_errors	ENST00000473798	ensembl	human	known	74_37	rna	15.22	78	14	SNP	0.523	C
LINC00514	283875	genome.wustl.edu	37	16	3041080	3041080	+	lincRNA	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:3041080C>T	ENST00000571152.1	+	0	231									long intergenic non-protein coding RNA 514																		CAGCGGCCTTCCCAGTGGCCG	0.652																																																	0																																												0			AK098017		16p13.3	2012-10-12				ENSG00000262152		"""Long non-coding RNAs"""	27549	non-coding RNA	RNA, long non-coding							Standard	NR_033861		Approved		uc002css.1				16.37:g.3041080C>T				RNA	SNP	-	NULL	ENST00000571152.1	37	NULL		16																																																																																			LINC00514	-	-	ENSG00000262152		0.652	LINC00514-002	KNOWN	basic	lincRNA	LINC00514	HGNC	lincRNA	OTTHUMT00000436956.1	-	0.00	46	0	C	NR_033861		3041080	+1	tier1	-	no_errors	ENST00000571152	ensembl	human	known	74_37	rna	62.07	11	18	SNP	0.391	T
LINC00618	145249	genome.wustl.edu	37	14	97411612	97411612	+	lincRNA	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:97411612G>A	ENST00000435624.1	+	0	329				AL133168.3_ENST00000557090.1_RNA					long intergenic non-protein coding RNA 618																		GCCACCCAGCGTCAGAGCTTG	0.537																																																	0																																												0			AA055628		14q32.2	2012-10-12	2012-07-05	2012-07-05	ENSG00000225163	ENSG00000225163		"""Long non-coding RNAs"""	20110	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 63"""	C14orf63			Standard	NR_104113		Approved				OTTHUMG00000171460		14.37:g.97411612G>A				RNA	SNP	-	NULL	ENST00000435624.1	37	NULL		14	.	.	.	.	.	.	.	.	.	.	G	5.067	0.198023	0.09652	.	.	ENSG00000225163	ENST00000435624;ENST00000495064	.	.	.	1.6	0.619	0.17630	.	.	.	.	.	T	0.45617	0.1351	.	.	.	.	.	.	.	.	.	.	.	.	T	0.54853	-0.8231	4	0.87932	D	0	.	5.5824	0.17256	0.0:0.3518:0.6482:0.0	.	.	.	.	H	110;61	.	ENSP00000415291:R110H	R	+	2	0	AL133168.2	96481365	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.888000	0.04148	0.200000	0.20447	0.557000	0.71058	CGT	LINC00618	-	-	ENSG00000225163		0.537	LINC00618-001	KNOWN	basic	lincRNA	LINC00618	HGNC	lincRNA	OTTHUMT00000072303.1	-	0.00	52	0	G			97411612	+1	tier1	-	no_errors	ENST00000435624	ensembl	human	known	74_37	rna	26.83	30	11	SNP	0.000	A
ATP2B1	490	genome.wustl.edu	37	12	90103606	90103606	+	5'Flank	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:90103606C>G	ENST00000428670.3	-	0	0				LINC00936_ENST00000605386.1_lincRNA			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1						blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						GGGCCGCTGCCGCGACGTGTG	0.751																																																	0																																										SO:0001631	upstream_gene_variant	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020			12.37:g.90103606C>G	Exception_encountered		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	RNA	SNP	-	NULL	ENST00000428670.3	37	NULL	CCDS9035.1	12																																																																																			LINC00936	-	-	ENSG00000271614		0.751	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LINC00936	HGNC	protein_coding	OTTHUMT00000406653.1	-	0.00	34	0	C	NM_001682		90103606	+1	tier1	-	no_errors	ENST00000605386	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.031	G
LMX1B	4010	genome.wustl.edu	37	9	129377702	129377702	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:129377702G>T	ENST00000373474.4	+	2	187	c.180G>T	c.(178-180)caG>caT	p.Q60H	LMX1B_ENST00000561065.1_Missense_Mutation_p.Q37H|RP11-123K19.1_ENST00000432418.1_RNA|RP11-123K19.1_ENST00000451449.2_RNA|LMX1B_ENST00000355497.5_Missense_Mutation_p.Q60H|RP11-123K19.1_ENST00000425370.1_RNA|LMX1B_ENST00000526117.1_Missense_Mutation_p.Q60H|LMX1B_ENST00000425646.2_Missense_Mutation_p.Q37H			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	60	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						AGGGCTGCCAGCGGCCCATCT	0.711									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)												0													37.0	37.0	37.0					9																	129377702		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.180G>T	9.37:g.129377702G>T	ENSP00000362573:p.Gln60His		F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.Q60H	ENST00000373474.4	37	c.180	CCDS55342.1	9	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323202	0.60634	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	4.71	4.71	0.59529	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	T	0.79370	0.4434	N	0.16478	0.41	0.80722	D	1	B;B;B	0.15141	0.005;0.008;0.012	B;B;B	0.14578	0.008;0.011;0.009	T	0.75918	-0.3148	10	0.54805	T	0.06	.	16.2213	0.82258	0.0:0.0:1.0:0.0	.	37;37;60	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	H	60;60;60;37	ENSP00000436930:Q60H;ENSP00000362573:Q60H;ENSP00000347684:Q60H;ENSP00000390923:Q37H	ENSP00000347684:Q60H	Q	+	3	2	LMX1B	128417523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.653000	0.67967	2.180000	0.69256	0.561000	0.74099	CAG	LMX1B	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000136944		0.711	LMX1B-002	KNOWN	basic|CCDS	protein_coding	LMX1B	HGNC	protein_coding	OTTHUMT00000054123.2	-	0.00	62	0	G			129377702	+1	tier1	-	no_errors	ENST00000355497	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
MAD1L1	8379	genome.wustl.edu	37	7	1885473	1885473	+	Intron	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:1885473G>T	ENST00000406869.1	-	19	2556				AC110781.3_ENST00000318959.3_Intron|AC110781.3_ENST00000402221.1_Intron|MAD1L1_ENST00000399654.2_Intron|MAD1L1_ENST00000265854.7_Intron|MAD1L1_ENST00000402746.1_Intron|AC110781.3_ENST00000480694.1_3'UTR|MIR4655_ENST00000580817.1_RNA			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TGGGCATTCAGAGCCAGGAGC	0.632																																																	0																																										SO:0001627	intron_variant	0			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1999-29609C>A	7.37:g.1885473G>T			B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	RNA	SNP	-	NULL	ENST00000406869.1	37	NULL	CCDS43539.1	7																																																																																			AC110781.3	-	-	ENSG00000176349		0.632	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100128374	Clone_based_vega_gene	protein_coding	OTTHUMT00000322871.1	-	0.00	38	0	G	NM_003550		1885473	+1	tier1	-	no_errors	ENST00000480694	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.003	T
OTUD6B	51633	genome.wustl.edu	37	8	92082397	92082397	+	5'Flank	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:92082397C>T	ENST00000285420.4	+	0	0				GS1-251I9.4_ENST00000524003.1_RNA|GS1-251I9.4_ENST00000522817.1_RNA|OTUD6B_ENST00000404789.3_5'Flank	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B								cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			CCTGCCGCCCCGCCCATCACG	0.622																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758		8.37:g.92082397C>T	Exception_encountered		A8K6I1|B4DEY0|Q9NTA4|Q9Y387	RNA	SNP	-	NULL	ENST00000285420.4	37	NULL	CCDS6253.2	8																																																																																			GS1-251I9.4	-	-	ENSG00000253738		0.622	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC100506365	Clone_based_vega_gene	protein_coding	OTTHUMT00000319968.1	-	0.00	12	0	C	NM_016023		92082397	-1	tier1	-	no_errors	ENST00000524003	ensembl	human	known	74_37	rna	33.33	8	4	SNP	0.001	T
TTLL1	25809	genome.wustl.edu	37	22	43435575	43435576	+	IGR	INS	-	-	AAA	rs60944727|rs537490054|rs36120119|rs541681211	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:43435575_43435576insAAA	ENST00000266254.7	-	0	1645				TTLL1_ENST00000331018.7_3'UTR|AL022476.2_ENST00000443063.1_RNA	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GGTTAAAAATTAAAAAAAAAAG	0.312														1094	0.21845	0.1936	0.2795	5008	,	,		17971	0.4276		0.0805	False		,,,				2504	0.135																0																																										SO:0001628	intergenic_variant	0			AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699		22.37:g.43435582_43435584dupAAA			B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	RNA	INS	-	NULL	ENST00000266254.7	37	NULL	CCDS14043.1	22																																																																																			AL022476.2	-	-	ENSG00000230319		0.312	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100506679	Clone_based_vega_gene	protein_coding	OTTHUMT00000319659.1		0.00	10	0	-	NM_012263		43435576	+1	tier1		no_errors	ENST00000443063	ensembl	human	known	74_37	rna	42.86	8	6	INS	0.009:0.002	AAA
GPM6A	2823	genome.wustl.edu	37	4	176733208	176733208	+	Intron	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:176733208G>A	ENST00000280187.7	-	2	83				GPM6A_ENST00000506894.1_Intron|GPM6A_ENST00000393658.2_Intron|RP11-806K15.1_ENST00000514864.1_RNA	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A						neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GTGAGGAACAGACTAAAGGAG	0.378																																																	0																																										SO:0001627	intron_variant	0				CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.37+133C>T	4.37:g.176733208G>A			B7Z642|E9PHI5|Q92602	RNA	SNP	-	NULL	ENST00000280187.7	37	NULL	CCDS3824.1	4																																																																																			RP11-806K15.1	-	-	ENSG00000249106		0.378	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC101928590	Clone_based_vega_gene	protein_coding	OTTHUMT00000362163.1	-	0.00	18	0	G			176733208	+1	tier1	-	no_errors	ENST00000514864	ensembl	human	known	74_37	rna	26.47	25	9	SNP	0.000	A
MZT2A	653784	genome.wustl.edu	37	2	132250426	132250426	+	5'Flank	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:132250426G>T	ENST00000309451.6	-	0	0				MIR4784_ENST00000579560.1_RNA|AC093838.4_ENST00000438378.2_RNA|MZT2A_ENST00000410036.2_5'Flank	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A							centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						GAGAAAGTGCGTGAGCCCTAC	0.657																																																	0																																										SO:0001631	upstream_gene_variant	0			BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606		2.37:g.132250426G>T	Exception_encountered		Q3SWV8|Q8WVB2	RNA	SNP	-	NULL	ENST00000309451.6	37	NULL	CCDS42758.1	2																																																																																			AC093838.4	-	-	ENSG00000152117		0.657	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC150776	Clone_based_vega_gene	protein_coding	OTTHUMT00000331811.2	-	0.00	142	0	G			132250426	+1	tier1	-	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	32.61	62	30	SNP	0.000	T
LRFN5	145581	genome.wustl.edu	37	14	42357021	42357021	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:42357021C>G	ENST00000298119.4	+	3	2382	c.1193C>G	c.(1192-1194)tCa>tGa	p.S398*	LRFN5_ENST00000554171.1_Nonsense_Mutation_p.S398*|LRFN5_ENST00000554120.1_Nonsense_Mutation_p.S398*	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	398						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TCAGATATCTCAACTTCTACC	0.378										HNSCC(30;0.082)																																							0													85.0	86.0	86.0					14																	42357021		2203	4300	6503	SO:0001587	stop_gained	0			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1193C>G	14.37:g.42357021C>G	ENSP00000298119:p.Ser398*		B3KU78|Q86XL2	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S398*	ENST00000298119.4	37	c.1193	CCDS9678.1	14	.	.	.	.	.	.	.	.	.	.	C	46	12.922443	0.99706	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	.	.	.	5.4	4.51	0.55191	.	0.138612	0.33382	N	0.004964	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	12.1129	0.53850	0.0:0.9157:0.0:0.0843	.	.	.	.	X	398	.	ENSP00000298119:S398X	S	+	2	0	LRFN5	41426771	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.049000	0.71053	1.393000	0.46605	0.563000	0.77884	TCA	LRFN5	-	NULL	ENSG00000165379		0.378	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	-	0.00	31	0	C	NM_152447		42357021	+1	tier1	-	no_errors	ENST00000298119	ensembl	human	known	74_37	nonsense	32.76	39	19	SNP	1.000	G
LRIT3	345193	genome.wustl.edu	37	4	110791095	110791095	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:110791095T>C	ENST00000594814.1	+	4	1190	c.1190T>C	c.(1189-1191)tTt>tCt	p.F397S	LRIT3_ENST00000409621.2_Missense_Mutation_p.F214S|LRIT3_ENST00000379920.3_Missense_Mutation_p.F352S|LRIT3_ENST00000327908.3_Missense_Mutation_p.F214S	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	397	Ser-rich.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		acatcttctttttctgcttct	0.473																																																	0													213.0	169.0	184.0					4																	110791095		2203	4300	6503	SO:0001583	missense	0			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1190T>C	4.37:g.110791095T>C	ENSP00000469759:p.Phe397Ser		C9J1C2|Q6ZTG1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F397S	ENST00000594814.1	37	c.1190	CCDS3688.3	4	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.934620	0.00053	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.56611	0.45;0.64;0.45	2.84	1.65	0.23941	.	1.360810	0.05611	N	0.578215	T	0.36358	0.0964	N	0.22421	0.69	0.09310	N	1	B;B	0.16166	0.009;0.016	B;B	0.15052	0.004;0.012	T	0.20974	-1.0259	10	0.20519	T	0.43	.	5.9578	0.19283	0.0:0.2422:0.0:0.7578	.	352;214	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	S	214;352;214	ENSP00000328222:F214S;ENSP00000369252:F352S;ENSP00000386734:F214S	ENSP00000328222:F214S	F	+	2	0	LRIT3	111010544	0.000000	0.05858	0.009000	0.14445	0.023000	0.10783	0.287000	0.18920	0.510000	0.28216	0.533000	0.62120	TTT	LRIT3	-	NULL	ENSG00000183423		0.473	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT3	HGNC	protein_coding	OTTHUMT00000335270.2		0.00	80	0	T	NM_198506		110791095	+1			no_errors	ENST00000594814	ensembl	human	known	74_37	missense	5.26	107	6	SNP	0.012	C
LRP1B	53353	genome.wustl.edu	37	2	141267497	141267497	+	Splice_Site	SNP	C	C	T	rs376234911		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:141267497C>T	ENST00000389484.3	-	52	9369	c.8398G>A	c.(8398-8400)Gct>Act	p.A2800T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2800	LDL-receptor class A 17. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTGTTCATACCGCAGCCTGCT	0.507										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	122.0	105.0	111.0		8398	6.2	1.0	2		111	0,8600		0,0,4300	no	missense-near-splice	LRP1B	NM_018557.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2800/4600	141267497	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8398+1G>A	2.37:g.141267497C>T			Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A2800T	ENST00000389484.3	37	c.8398	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782827	0.70222	2.27E-4	0.0	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.42131	0.98	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	L	0.31476	0.935	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.43669	-0.9377	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2800	Q9NZR2	LRP1B_HUMAN	T	2800;2738	ENSP00000374135:A2800T	.	A	-	1	0	LRP1B	140983967	1.000000	0.71417	0.991000	0.47740	0.945000	0.59286	4.563000	0.60823	2.941000	0.99782	0.655000	0.94253	GCT	LRP1B	-	smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.507	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	18	0	C	NM_018557	Missense_Mutation	141267497	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	75.00	4	12	SNP	1.000	T
LRRC32	2615	genome.wustl.edu	37	11	76371217	76371217	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:76371217A>C	ENST00000407242.2	-	3	1662	c.1420T>G	c.(1420-1422)Tct>Gct	p.S474A	LRRC32_ENST00000404995.1_Missense_Mutation_p.S474A|LRRC32_ENST00000260061.5_Missense_Mutation_p.S474A|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	474					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGATTGGAAGAAAGGTCCAGC	0.647																																																	0													37.0	30.0	32.0					11																	76371217		2197	4292	6489	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1420T>G	11.37:g.76371217A>C	ENSP00000384126:p.Ser474Ala		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.S474A	ENST00000407242.2	37	c.1420	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	A	15.68	2.903679	0.52333	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.06068	3.35;3.35;3.35	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.18257	0.0438	L	0.49571	1.57	0.54753	D	0.999985	D	0.76494	0.999	D	0.78314	0.991	T	0.01033	-1.1474	10	0.36615	T	0.2	.	13.981	0.64304	1.0:0.0:0.0:0.0	.	474	Q14392	LRC32_HUMAN	A	474	ENSP00000260061:S474A;ENSP00000384126:S474A;ENSP00000385766:S474A	ENSP00000260061:S474A	S	-	1	0	LRRC32	76048865	1.000000	0.71417	0.996000	0.52242	0.675000	0.39556	6.838000	0.75359	1.895000	0.54865	0.402000	0.26972	TCT	LRRC32	-	NULL	ENSG00000137507		0.647	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	27	0	A	NM_005512		76371217	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	C
LRRK1	79705	genome.wustl.edu	37	15	101549252	101549252	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr15:101549252G>A	ENST00000388948.3	+	7	1332	c.973G>A	c.(973-975)Gaa>Aaa	p.E325K	LRRK1_ENST00000284395.5_Missense_Mutation_p.E322K	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTCATCGGACGAAATCATCTG	0.622											OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													33.0	34.0	33.0					15																	101549252		1924	4134	6058	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.973G>A	15.37:g.101549252G>A	ENSP00000373600:p.Glu325Lys	1359		Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.E325K	ENST00000388948.3	37	c.973	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855611	0.71834	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.24350	1.86;1.86	5.64	5.64	0.86602	.	0.063428	0.64402	D	0.000012	T	0.13457	0.0326	N	0.08118	0	0.58432	D	0.999999	P	0.44044	0.825	B	0.32980	0.156	T	0.09552	-1.0669	10	0.30078	T	0.28	.	18.6966	0.91603	0.0:0.0:1.0:0.0	.	325	Q38SD2	LRRK1_HUMAN	K	325;322	ENSP00000373600:E325K;ENSP00000284395:E322K	ENSP00000284395:E322K	E	+	1	0	LRRK1	99366775	1.000000	0.71417	0.431000	0.26735	0.260000	0.26232	7.280000	0.78610	2.648000	0.89879	0.561000	0.74099	GAA	LRRK1	-	NULL	ENSG00000154237		0.622	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	-	0.00	12	0	G	NM_024652		101549252	+1	tier1	-	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	72.22	5	13	SNP	0.999	A
LSR	51599	genome.wustl.edu	37	19	35758275	35758275	+	Missense_Mutation	SNP	G	G	A	rs397751431|rs79703261|rs142507475		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:35758275G>A	ENST00000361790.3	+	9	1711	c.1552G>A	c.(1552-1554)Ggg>Agg	p.G518R	USF2_ENST00000594064.1_5'Flank|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000602122.1_Missense_Mutation_p.G498R|USF2_ENST00000595068.1_5'Flank|LSR_ENST00000427250.1_Missense_Mutation_p.G362R|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000379134.3_5'Flank|LSR_ENST00000360798.3_Missense_Mutation_p.G450R|LSR_ENST00000347609.4_Missense_Mutation_p.G460R|LSR_ENST00000354900.3_Missense_Mutation_p.G499R|USF2_ENST00000222305.3_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	518				G -> GR (in Ref. 2; BAC86714, 3; BAC11614 and 5; AAH04381). {ECO:0000305}.	embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAGTAATGGTGGGAGAAGCCG	0.721																																																	0													10.0	15.0	14.0					19																	35758275		2108	4146	6254	SO:0001583	missense	0			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1552G>A	19.37:g.35758275G>A	ENSP00000354575:p.Gly518Arg		A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like_dom	p.G518R	ENST00000361790.3	37	c.1552	CCDS12450.1	19	.	.	.	.	.	.	.	.	.	.	G	0.212	-1.035894	0.02029	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.64438	0.56;0.69;0.33;0.4;-0.1	0.199	0.199	0.15175	.	0.251577	0.39210	N	0.001427	T	0.26557	0.0649	N	0.02539	-0.55	0.26982	N	0.965347	P;B;B;B;B;B	0.43094	0.799;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.39258	0.295;0.0;0.004;0.001;0.0;0.0	T	0.42666	-0.9438	9	0.10111	T	0.7	-5.1652	.	.	.	.	456;460;498;450;499;518	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	R	518;499;450;460;362	ENSP00000354575:G518R;ENSP00000346976:G499R;ENSP00000354034:G450R;ENSP00000262627:G460R;ENSP00000394479:G362R	ENSP00000262627:G460R	G	+	1	0	LSR	40450115	0.999000	0.42202	0.742000	0.31022	0.527000	0.34593	0.345000	0.19979	0.300000	0.22699	0.306000	0.20318	GGG	LSR	-	NULL	ENSG00000105699		0.721	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	HGNC	protein_coding	OTTHUMT00000465513.2		0.00	11	0	G	NM_015925		35758275	+1			no_errors	ENST00000361790	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.950	A
LTBP4	8425	genome.wustl.edu	37	19	41111456	41111456	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:41111456G>T	ENST00000308370.7	+	6	789	c.789G>T	c.(787-789)gcG>gcT	p.A263A	RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000396819.3_Silent_p.A196A|LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Silent_p.A226A	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	263					extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			gggcggaggcggcagcgCCCT	0.731																																																	0													8.0	11.0	10.0					19																	41111456		1840	3865	5705	SO:0001819	synonymous_variant	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.789G>T	19.37:g.41111456G>T			O00508|O75412|O75413	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A263	ENST00000308370.7	37	c.789		19																																																																																			LTBP4	-	NULL	ENSG00000090006		0.731	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		-	0.00	40	0	G	NM_003573		41111456	+1	tier1	-	no_errors	ENST00000308370	ensembl	human	known	74_37	silent	39.34	37	24	SNP	0.986	T
LYRM2	57226	genome.wustl.edu	37	6	90347493	90347493	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:90347493C>G	ENST00000523377.1	-	2	190	c.154G>C	c.(154-156)Gaa>Caa	p.E52Q	LYRM2_ENST00000517396.1_5'UTR|LYRM2_ENST00000520318.1_Missense_Mutation_p.E52Q|LYRM2_ENST00000520441.1_Missense_Mutation_p.E52Q	NM_020466.4	NP_065199.1	Q9NU23	LYRM2_HUMAN	LYR motif containing 2	52						mitochondrion (GO:0005739)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		CTTCTGAATTCTTCTCTTGCC	0.373																																																	0													174.0	170.0	171.0					6																	90347493		2203	4300	6503	SO:0001583	missense	0			BC009782	CCDS5023.1	6q15	2006-09-19			ENSG00000083099	ENSG00000083099		"""LYR motif containing"""	25229	protein-coding gene	gene with protein product						12477932	Standard	NM_020466		Approved	DJ122O8.2	uc003pnm.3	Q9NU23	OTTHUMG00000015203	ENST00000523377.1:c.154G>C	6.37:g.90347493C>G	ENSP00000430025:p.Glu52Gln		B2R4U2|E1P517	Missense_Mutation	SNP	pfam_Complex1_LYR	p.E52Q	ENST00000523377.1	37	c.154	CCDS5023.1	6	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926796	0.92319	.	.	ENSG00000083099	ENST00000520441;ENST00000523377;ENST00000520318	T;T;T	0.72942	-0.7;-0.7;-0.7	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.83644	0.5299	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84297	0.0503	9	0.72032	D	0.01	.	18.7558	0.91832	0.0:1.0:0.0:0.0	.	52	Q9NU23	LYRM2_HUMAN	Q	52	ENSP00000427859:E52Q;ENSP00000430025:E52Q;ENSP00000428207:E52Q	ENSP00000430316:E52Q	E	-	1	0	LYRM2	90404214	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.064000	0.76721	2.868000	0.98415	0.557000	0.71058	GAA	LYRM2	-	pfam_Complex1_LYR	ENSG00000083099		0.373	LYRM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYRM2	HGNC	protein_coding	OTTHUMT00000041498.2	-	0.00	80	0	C	NM_020466		90347493	-1	tier1	-	no_errors	ENST00000412237	ensembl	human	known	74_37	missense	14.94	74	13	SNP	1.000	G
MAGEB2	4113	genome.wustl.edu	37	X	30236789	30236789	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:30236789C>G	ENST00000378988.4	+	2	193	c.92C>G	c.(91-93)aCt>aGt	p.T31S		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	31										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						CCTCAGGTCACTGAAGCAGAG	0.592																																																	0													38.0	35.0	36.0					X																	30236789		2202	4300	6502	SO:0001583	missense	0			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.92C>G	X.37:g.30236789C>G	ENSP00000368273:p.Thr31Ser		O75860	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.T31S	ENST00000378988.4	37	c.92	CCDS14219.1	X	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005639	0.35415	.	.	ENSG00000099399	ENST00000378988	T	0.05081	3.5	3.43	0.448	0.16614	Melanoma associated antigen, MAGE, N-terminal (1);	1.597600	0.03359	N	0.197417	T	0.18676	0.0448	M	0.73319	2.225	0.09310	N	1	D	0.71674	0.998	D	0.68353	0.957	T	0.10474	-1.0628	10	0.35671	T	0.21	.	1.2353	0.01952	0.2272:0.4132:0.2187:0.1408	.	31	O15479	MAGB2_HUMAN	S	31	ENSP00000368273:T31S	ENSP00000368273:T31S	T	+	2	0	MAGEB2	30146710	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.352000	0.07701	-0.022000	0.13986	0.513000	0.50165	ACT	MAGEB2	-	pfam_Melanoma_ass_antigen_N	ENSG00000099399		0.592	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB2	HGNC	protein_coding	OTTHUMT00000056157.1	-	0.00	34	0	C	NM_002364		30236789	+1	tier1	-	no_errors	ENST00000378988	ensembl	human	known	74_37	missense	50.00	23	23	SNP	0.000	G
MAGEB3	4114	genome.wustl.edu	37	X	30254354	30254354	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:30254354C>T	ENST00000361644.2	+	5	1050	c.313C>T	c.(313-315)Cag>Tag	p.Q105*		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	105										NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						CTCCACTGTGCAGTCTCGCAC	0.408																																																	0													50.0	43.0	46.0					X																	30254354		2202	4300	6502	SO:0001587	stop_gained	0			AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.313C>T	X.37:g.30254354C>T	ENSP00000355198:p.Gln105*		A0AVE4|B3KQ52|O75861	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.Q105*	ENST00000361644.2	37	c.313	CCDS14220.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.563040	0.97667	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	.	.	.	4.1	-4.72	0.03269	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	10.0324	0.42109	0.7336:0.1553:0.111:0.0	.	.	.	.	X	105	.	ENSP00000355198:Q105X	Q	+	1	0	MAGEB3	30164275	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.969000	0.00668	-1.180000	0.02734	-0.237000	0.12165	CAG	MAGEB3	-	NULL	ENSG00000198798		0.408	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB3	HGNC	protein_coding	OTTHUMT00000056158.2		0.00	18	0	C	NM_002365		30254354	+1			no_errors	ENST00000361644	ensembl	human	known	74_37	nonsense	14.29	18	3	SNP	0.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140996200	140996200	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:140996200C>T	ENST00000285879.4	+	4	3296	c.3010C>T	c.(3010-3012)Ctg>Ttg	p.L1004L	MAGEC1_ENST00000406005.2_Silent_p.L71L	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1004	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GATTCTTATTCTGAGTATCAT	0.507										HNSCC(15;0.026)																																							0													91.0	83.0	85.0					X																	140996200		2203	4300	6503	SO:0001819	synonymous_variant	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3010C>T	X.37:g.140996200C>T			A0PK03|O75451|Q8TCV4	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L1004	ENST00000285879.4	37	c.3010	CCDS35417.1	X																																																																																			MAGEC1	-	pfam_MAGE,pfscan_MAGE	ENSG00000155495		0.507	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	30	0	C	NM_005462		140996200	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	silent	80.49	8	33	SNP	0.006	T
MAML2	84441	genome.wustl.edu	37	11	95825386	95825386	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:95825386C>T	ENST00000524717.1	-	2	3093	c.1809G>A	c.(1807-1809)caG>caA	p.Q603Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	603					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgct	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													20.0	30.0	26.0					11																	95825386		1926	3789	5715	SO:0001819	synonymous_variant	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1809G>A	11.37:g.95825386C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q603	ENST00000524717.1	37	c.1809	CCDS44714.1	11																																																																																			MAML2	-	NULL	ENSG00000184384		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	-	0.00	46	0	C			95825386	-1	tier1	-	no_errors	ENST00000524717	ensembl	human	known	74_37	silent	10.71	50	6	SNP	0.000	T
MAPK10	5602	genome.wustl.edu	37	4	86985430	86985430	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:86985430C>T	ENST00000359221.3	-	11	1625	c.1099G>A	c.(1099-1101)Gaa>Aaa	p.E367K	MAPK10_ENST00000395161.2_Missense_Mutation_p.E367K|MAPK10_ENST00000449047.2_Missense_Mutation_p.E222K|MAPK10_ENST00000361569.2_Missense_Mutation_p.E367K|MAPK10_ENST00000395157.3_Missense_Mutation_p.E222K|MAPK10_ENST00000395166.1_Missense_Mutation_p.E329K|MAPK10_ENST00000395169.3_Missense_Mutation_p.E329K|MAPK10_ENST00000395160.3_Missense_Mutation_p.E222K			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	367					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GCCTCCACTTCGGCTGGGTCA	0.443																																																	0													155.0	142.0	146.0					4																	86985430		2203	4300	6503	SO:0001583	missense	0			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.1099G>A	4.37:g.86985430C>T	ENSP00000352157:p.Glu367Lys		A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_MAPK_JNK,pfscan_Prot_kinase_dom	p.E367K	ENST00000359221.3	37	c.1099	CCDS34026.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.379491|5.379491	0.95945|0.95945	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	D;D;D;D;D;D;D;D|.	0.82803|.	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82986|0.82986	0.5156|0.5156	M|M	0.83312|0.83312	2.635|2.635	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.67145|.	0.993;0.964;0.979;0.979;0.996|.	B;B;P;P;P|.	0.57425|.	0.426;0.444;0.64;0.64;0.82|.	T|T	0.82697|0.82697	-0.0329|-0.0329	10|5	0.87932|.	D|.	0|.	-21.3618|-21.3618	20.3932|20.3932	0.98965|0.98965	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	253;222;329;367;367|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	K|Q	329;367;222;367;329;222;222;367|279	ENSP00000378598:E329K;ENSP00000352157:E367K;ENSP00000378586:E222K;ENSP00000355297:E367K;ENSP00000378595:E329K;ENSP00000378589:E222K;ENSP00000414469:E222K;ENSP00000378590:E367K|.	ENSP00000352157:E367K|.	E|R	-|-	1|2	0|0	MAPK10|MAPK10	87204454|87204454	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.757000|0.757000	0.42996|0.42996	7.776000|7.776000	0.85560|0.85560	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GAA|CGA	MAPK10	-	superfamily_Kinase-like_dom,prints_MAPK_JNK	ENSG00000109339		0.443	MAPK10-012	KNOWN	basic|CCDS	protein_coding	MAPK10	HGNC	protein_coding	OTTHUMT00000361363.2	-	0.00	52	0	C			86985430	-1	tier1	-	no_errors	ENST00000359221	ensembl	human	known	74_37	missense	11.67	53	7	SNP	1.000	T
MB21D2	151963	genome.wustl.edu	37	3	192516720	192516720	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:192516720G>C	ENST00000392452.2	-	2	1251	c.931C>G	c.(931-933)Cag>Gag	p.Q311E		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	311							protein complex binding (GO:0032403)	p.Q309E(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						TTGCAGGCCTGATAGGCCTGC	0.557																																																	2	Substitution - Missense(2)	lung(2)											34.0	35.0	34.0					3																	192516720		2203	4300	6503	SO:0001583	missense	0			AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.931C>G	3.37:g.192516720G>C	ENSP00000376246:p.Gln311Glu		Q86VD8	Missense_Mutation	SNP	pfam_Mab-21_dom	p.Q311E	ENST00000392452.2	37	c.931	CCDS3302.2	3	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453077	0.43531	.	.	ENSG00000180611	ENST00000392452	T	0.07800	3.16	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.10252	0.0251	L	0.51422	1.61	0.80722	D	1	P	0.46784	0.884	B	0.42959	0.403	T	0.07102	-1.0790	10	0.05351	T	0.99	.	18.2403	0.89966	0.0:0.0:1.0:0.0	.	311	Q8IYB1	M21D2_HUMAN	E	311	ENSP00000376246:Q311E	ENSP00000376246:Q311E	Q	-	1	0	MB21D2	193999414	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.542000	0.85734	0.655000	0.94253	CAG	MB21D2	-	pfam_Mab-21_dom	ENSG00000180611		0.557	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MB21D2	HGNC	protein_coding	OTTHUMT00000341543.1	-	0.00	30	0	G	NM_178496		192516720	-1	tier1	-	no_errors	ENST00000392452	ensembl	human	known	74_37	missense	33.33	24	12	SNP	1.000	C
MBD5	55777	genome.wustl.edu	37	2	149243356	149243356	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:149243356C>G	ENST00000407073.1	+	11	3888	c.2891C>G	c.(2890-2892)aCt>aGt	p.T964S	MBD5_ENST00000404807.1_Missense_Mutation_p.T1197S	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	964					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CATCAACTGACTCATCTACAG	0.383																																																	0													67.0	61.0	63.0					2																	149243356		2203	4300	6503	SO:0001583	missense	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2891C>G	2.37:g.149243356C>G	ENSP00000386049:p.Thr964Ser		A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP_dom	p.T964S	ENST00000407073.1	37	c.2891	CCDS33302.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.420|6.420	0.445593|0.445593	0.12164|0.12164	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	.|T;T	.|0.19669	.|2.13;2.13	5.47|5.47	4.58|4.58	0.56647|0.56647	.|.	.|0.095562	.|0.46442	.|D	.|0.000296	T|T	0.10423|0.10423	0.0255|0.0255	N|N	0.08118|0.08118	0|0	0.22479|0.22479	N|N	0.999065|0.999065	.|B;B	.|0.09022	.|0.002;0.0	.|B;B	.|0.10450	.|0.005;0.001	T|T	0.29027|0.29027	-1.0025|-1.0025	5|10	.|0.18710	.|T	.|0.47	-5.5759|-5.5759	10.7344|10.7344	0.46115|0.46115	0.1295:0.5902:0.2803:0.0|0.1295:0.5902:0.2803:0.0	.|.	.|1197;964	.|E9PHH0;Q9P267	.|.;MBD5_HUMAN	V|S	937|964;1197	.|ENSP00000386049:T964S;ENSP00000384672:T1197S	.|ENSP00000384672:T1197S	L|T	+|+	1|2	0|0	MBD5|MBD5	148959826|148959826	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.718000|1.718000	0.38001|0.38001	1.278000|1.278000	0.44430|0.44430	0.591000|0.591000	0.81541|0.81541	CTC|ACT	MBD5	-	NULL	ENSG00000204406		0.383	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	-	0.00	42	0	C			149243356	+1	tier1	-	no_errors	ENST00000407073	ensembl	human	known	74_37	missense	58.73	26	37	SNP	1.000	G
MBTD1	54799	genome.wustl.edu	37	17	49296311	49296311	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:49296311T>C	ENST00000586178.1	-	5	726	c.383A>G	c.(382-384)aAt>aGt	p.N128S	MBTD1_ENST00000376381.2_Missense_Mutation_p.N128S|MBTD1_ENST00000415868.1_Missense_Mutation_p.N128S	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	128					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			CTTTGCTTGATTTTGCAAGGT	0.338																																																	0													213.0	160.0	176.0					17																	49296311		692	1591	2283	SO:0001583	missense	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.383A>G	17.37:g.49296311T>C	ENSP00000468304:p.Asn128Ser		Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.N128S	ENST00000586178.1	37	c.383	CCDS11581.2	17	.	.	.	.	.	.	.	.	.	.	T	6.088	0.384530	0.11524	.	.	ENSG00000011258	ENST00000405860;ENST00000415868;ENST00000376381	T;T	0.22945	1.93;1.94	5.33	3.02	0.34903	.	17.098600	0.00166	N	0.000000	T	0.25754	0.0627	L	0.47716	1.5	0.51233	D	0.999916	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.002	T	0.25152	-1.0140	10	0.12766	T	0.61	.	8.9159	0.35581	0.0:0.205:0.0:0.795	.	128;128	Q05BQ5;Q05BQ5-2	MBTD1_HUMAN;.	S	128	ENSP00000403946:N128S;ENSP00000365561:N128S	ENSP00000365561:N128S	N	-	2	0	MBTD1	46651310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.945000	0.56637	0.868000	0.35678	0.459000	0.35465	AAT	MBTD1	-	NULL	ENSG00000011258		0.338	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	-	0.00	54	0	T			49296311	-1	tier1	-	no_errors	ENST00000415868	ensembl	human	known	74_37	missense	81.11	17	73	SNP	1.000	C
MDN1	23195	genome.wustl.edu	37	6	90503483	90503483	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:90503483G>T	ENST00000369393.3	-	5	968	c.853C>A	c.(853-855)Ctg>Atg	p.L285M	MDN1_ENST00000428876.1_Missense_Mutation_p.L285M			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	285					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAACATACCAGCTCTCCAGGG	0.547																																																	0													51.0	54.0	53.0					6																	90503483		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.853C>A	6.37:g.90503483G>T	ENSP00000358400:p.Leu285Met		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L285M	ENST00000369393.3	37	c.853	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300326	0.23650	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.19532	3.94;3.94;2.14	5.63	4.75	0.60458	.	0.373918	0.27941	N	0.017226	T	0.04363	0.0120	N	0.08118	0	0.20638	N	0.999877	B;P	0.40553	0.343;0.721	B;B	0.39738	0.116;0.308	T	0.19976	-1.0289	10	0.34782	T	0.22	.	10.8189	0.46593	0.0:0.2657:0.5968:0.1375	.	285;285	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	M	285	ENSP00000358400:L285M;ENSP00000413970:L285M;ENSP00000409664:L285M	ENSP00000358400:L285M	L	-	1	2	MDN1	90560204	1.000000	0.71417	0.703000	0.30354	0.003000	0.03518	3.942000	0.56614	1.361000	0.45981	-0.182000	0.12963	CTG	MDN1	-	superfamily_P-loop_NTPase,pirsf_Midasin	ENSG00000112159		0.547	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	32	0	G			90503483	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	9.09	39	4	SNP	0.998	T
MED12L	116931	genome.wustl.edu	37	3	150840754	150840754	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:150840754C>T	ENST00000474524.1	+	3	427	c.389C>T	c.(388-390)gCa>gTa	p.A130V	MED12L_ENST00000273432.4_Missense_Mutation_p.A130V|MED12L_ENST00000422248.2_Missense_Mutation_p.A130V|MED12L_ENST00000309237.4_Missense_Mutation_p.A130V	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	130						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTATTTTGGCAAAAAAGGTA	0.313																																																	0													51.0	53.0	52.0					3																	150840754		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.389C>T	3.37:g.150840754C>T	ENSP00000417235:p.Ala130Val		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.A130V	ENST00000474524.1	37	c.389	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839818	0.91117	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.62639	0.33;0.32;0.22;0.01	5.36	5.36	0.76844	Mediator complex, subunit Med12 (1);	0.000000	0.64402	D	0.000001	T	0.78194	0.4245	M	0.65975	2.015	0.40507	D	0.980702	D;D;D;D	0.71674	0.965;0.986;0.982;0.998	P;P;P;D	0.76071	0.78;0.86;0.78;0.987	T	0.77368	-0.2614	9	.	.	.	-14.0011	19.0399	0.92993	0.0:1.0:0.0:0.0	.	130;130;130;130	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	V	130	ENSP00000403308:A130V;ENSP00000310760:A130V;ENSP00000417235:A130V;ENSP00000273432:A130V	.	A	+	2	0	MED12L	152323444	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	7.370000	0.79589	2.688000	0.91661	0.655000	0.94253	GCA	MED12L	-	pfam_Mediator_Med12	ENSG00000144893		0.313	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	-	0.00	49	0	C	NM_053002		150840754	+1	tier1	-	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
MICALL1	85377	genome.wustl.edu	37	22	38313800	38313800	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:38313800C>T	ENST00000215957.6	+	4	550	c.424C>T	c.(424-426)Cag>Tag	p.Q142*		NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	142					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					AGATGTGGCTCAGGTAGGCAG	0.587																																																	0													72.0	61.0	64.0					22																	38313800		2203	4300	6503	SO:0001587	stop_gained	0			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.424C>T	22.37:g.38313800C>T	ENSP00000215957:p.Gln142*		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Nonsense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.Q142*	ENST00000215957.6	37	c.424	CCDS13961.1	22	.	.	.	.	.	.	.	.	.	.	C	17.62	3.433615	0.62955	.	.	ENSG00000100139	ENST00000445494;ENST00000215957	.	.	.	3.8	1.6	0.23607	.	0.591514	0.15289	N	0.270291	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	10.0289	0.42087	0.0:0.5993:0.4007:0.0	.	.	.	.	X	58;142	.	ENSP00000215957:Q142X	Q	+	1	0	MICALL1	36643746	0.954000	0.32549	0.914000	0.36105	0.107000	0.19398	1.163000	0.31798	0.528000	0.28580	-0.485000	0.04761	CAG	MICALL1	-	NULL	ENSG00000100139		0.587	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	HGNC	protein_coding	OTTHUMT00000319545.4		0.00	31	0	C	NM_033386		38313800	+1			no_errors	ENST00000215957	ensembl	human	known	74_37	nonsense	31.03	20	9	SNP	0.924	T
MEI1	150365	genome.wustl.edu	37	22	42114165	42114165	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:42114165C>G	ENST00000401548.3	+	6	660	c.620C>G	c.(619-621)tCc>tGc	p.S207C	MEI1_ENST00000540833.1_5'UTR|MEI1_ENST00000400107.1_5'UTR|MEI1_ENST00000300398.4_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						AAGCTATACTCCTCACCAGTG	0.507																																																	0													88.0	86.0	87.0					22																	42114165		1953	4136	6089	SO:0001583	missense	0			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.620C>G	22.37:g.42114165C>G	ENSP00000384115:p.Ser207Cys			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S207C	ENST00000401548.3	37	c.620	CCDS46718.1	22	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155504	0.78114	.	.	ENSG00000167077	ENST00000401548	T	0.18174	2.23	5.63	5.63	0.86233	Armadillo-type fold (1);	0.340546	0.29218	N	0.012794	T	0.39306	0.1073	M	0.61703	1.905	0.80722	D	1	D;D	0.67145	0.963;0.996	P;P	0.60473	0.639;0.875	T	0.08638	-1.0712	10	0.72032	D	0.01	-7.1038	19.6736	0.95921	0.0:1.0:0.0:0.0	.	207;207	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	C	207	ENSP00000384115:S207C	ENSP00000384115:S207C	S	+	2	0	MEI1	40444111	1.000000	0.71417	0.931000	0.37212	0.894000	0.52154	3.604000	0.54081	2.664000	0.90586	0.561000	0.74099	TCC	MEI1	-	superfamily_ARM-type_fold	ENSG00000167077		0.507	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3	-	0.00	36	0	C	NM_152513		42114165	+1	tier1	-	no_errors	ENST00000401548	ensembl	human	known	74_37	missense	60.00	16	24	SNP	1.000	G
MKKS	8195	genome.wustl.edu	37	20	10388273	10388273	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:10388273G>C	ENST00000347364.3	-	5	2025	c.1263C>G	c.(1261-1263)atC>atG	p.I421M	MKKS_ENST00000399054.2_Missense_Mutation_p.I421M	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	421					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						CCTTGTGTCTGATATATGCAG	0.413																																					Melanoma(79;1979 2212 6640)												0													117.0	89.0	98.0					20																	10388273		2203	4300	6503	SO:0001583	missense	0			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1263C>G	20.37:g.10388273G>C	ENSP00000246062:p.Ile421Met		A8K7B0|D3DW18	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.I421M	ENST00000347364.3	37	c.1263	CCDS13111.1	20	.	.	.	.	.	.	.	.	.	.	G	15.14	2.746018	0.49151	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	T;T	0.80738	-1.41;-1.41	5.93	1.56	0.23342	.	0.298223	0.36444	N	0.002599	T	0.81394	0.4813	M	0.65975	2.015	0.30370	N	0.782937	P	0.48162	0.906	P	0.55577	0.779	T	0.76680	-0.2870	10	0.72032	D	0.01	-23.3699	2.6747	0.05078	0.2245:0.099:0.5156:0.1609	.	421	Q9NPJ1	MKKS_HUMAN	M	421	ENSP00000246062:I421M;ENSP00000382008:I421M	ENSP00000246062:I421M	I	-	3	3	MKKS	10336273	0.990000	0.36364	0.999000	0.59377	0.625000	0.37756	0.313000	0.19415	0.424000	0.26061	-0.253000	0.11424	ATC	MKKS	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000125863		0.413	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKKS	HGNC	protein_coding	OTTHUMT00000077991.3	-	0.00	44	0	G			10388273	-1	tier1	-	no_errors	ENST00000347364	ensembl	human	known	74_37	missense	30.95	58	26	SNP	0.987	C
MOB2	81532	genome.wustl.edu	37	11	1501649	1501649	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:1501649C>T	ENST00000329957.6	-	3	528	c.339G>A	c.(337-339)acG>acA	p.T113T	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	82					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)	4						TCGTCTGACACGTCTCTCCTG	0.577																																																	0													110.0	116.0	114.0					11																	1501649		2087	4214	6301	SO:0001819	synonymous_variant	0				CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.339G>A	11.37:g.1501649C>T			B4DKP3|Q96M67	Silent	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.T113	ENST00000329957.6	37	c.339	CCDS53591.1	11																																																																																			MOB2	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000182208		0.577	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MOB2	HGNC	protein_coding	OTTHUMT00000384770.1		0.00	10	0	C	NM_053005		1501649	-1			no_errors	ENST00000329957	ensembl	human	novel	74_37	silent	14.29	12	2	SNP	0.735	T
MMP13	4322	genome.wustl.edu	37	11	102815028	102815028	+	Silent	SNP	G	G	A	rs374512736		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:102815028G>A	ENST00000260302.3	-	10	1411	c.1383C>T	c.(1381-1383)cgC>cgT	p.R461R		NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	461	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CTGGCATGACGCGAACAATAC	0.358																																																	0								G		0,4404		0,0,2202	137.0	150.0	146.0		1383	-12.0	0.2	11		146	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	MMP13	NM_002427.3		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		461/472	102815028	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	0			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1383C>T	11.37:g.102815028G>A			A8K846|B2RCZ3|Q6NWN6	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.R461	ENST00000260302.3	37	c.1383	CCDS8324.1	11																																																																																			MMP13	-	pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans	ENSG00000137745		0.358	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	HGNC	protein_coding	OTTHUMT00000386648.1	-	0.00	40	0	G	NM_002427		102815028	-1	tier1	-	no_errors	ENST00000260302	ensembl	human	novel	74_37	silent	33.33	26	13	SNP	0.003	A
MORC3	23515	genome.wustl.edu	37	21	37705976	37705976	+	Silent	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr21:37705976T>C	ENST00000400485.1	+	2	148	c.72T>C	c.(70-72)acT>acC	p.T24T	MORC3_ENST00000487909.1_Intron	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	24					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CAAATTCTACTAGTCACACCT	0.308																																																	0													141.0	132.0	134.0					21																	37705976		1831	4087	5918	SO:0001819	synonymous_variant	0			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.72T>C	21.37:g.37705976T>C			A8KA92|Q9UEZ2	Silent	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.T24	ENST00000400485.1	37	c.72	CCDS42924.1	21																																																																																			MORC3	-	superfamily_HATPase_ATP-bd	ENSG00000159256		0.308	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	HGNC	protein_coding	OTTHUMT00000194640.1	-	0.00	89	0	T	NM_015358		37705976	+1	tier1	-	no_errors	ENST00000400485	ensembl	human	known	74_37	silent	66.18	23	45	SNP	1.000	C
MROH9	80133	genome.wustl.edu	37	1	170952649	170952649	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:170952649C>G	ENST00000367758.3	+	9	802	c.703C>G	c.(703-705)Caa>Gaa	p.Q235E	MROH9_ENST00000367759.4_Missense_Mutation_p.Q235E	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	235																	CAAGGAGTTTCAACAAGACGA	0.363																																																	0													81.0	74.0	77.0					1																	170952649		1810	4079	5889	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.703C>G	1.37:g.170952649C>G	ENSP00000356732:p.Gln235Glu		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q235E	ENST00000367758.3	37	c.703	CCDS41436.1	1	.	.	.	.	.	.	.	.	.	.	C	6.287	0.421099	0.11928	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.28069	4.07;1.63	4.12	0.881	0.19166	.	0.934110	0.08816	N	0.889532	T	0.11110	0.0271	L	0.60455	1.87	0.09310	N	1	B;B	0.30281	0.047;0.275	B;B	0.27715	0.027;0.082	T	0.33548	-0.9864	10	0.52906	T	0.07	0.7036	4.3416	0.11113	0.3869:0.4964:0.0:0.1167	.	235;235	F5GWX6;Q5TGP6	.;CA129_HUMAN	E	235	ENSP00000356733:Q235E;ENSP00000356732:Q235E	ENSP00000356732:Q235E	Q	+	1	0	C1orf129	169219273	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.262000	0.08682	0.070000	0.16634	0.655000	0.94253	CAA	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.363	MROH9-001	KNOWN	basic|CCDS	protein_coding	MROH9	HGNC	protein_coding	OTTHUMT00000099327.1	-	0.00	53	0	C	NM_025063		170952649	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	21.25	63	17	SNP	0.000	G
MRPL45	84311	genome.wustl.edu	37	17	36476532	36476532	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:36476532G>T	ENST00000312513.5	+	6	702	c.541G>T	c.(541-543)Gtc>Ttc	p.V181F		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	181						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATATAAGACCGTCCGCTGGAG	0.483																																																	0													197.0	184.0	189.0					17																	36476532		2203	4300	6503	SO:0001583	missense	0			BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.541G>T	17.37:g.36476532G>T	ENSP00000308901:p.Val181Phe		A1L436|Q6ZMJ5	Missense_Mutation	SNP	pfam_Tim44-like_dom,smart_Tim44-like_dom	p.V181F	ENST00000312513.5	37	c.541	CCDS11326.1	17	.	.	.	.	.	.	.	.	.	.	G	8.897	0.955400	0.18507	.	.	ENSG00000174100	ENST00000312513	T	0.76578	-1.03	5.0	5.0	0.66597	.	0.122675	0.53938	D	0.000042	T	0.82070	0.4957	L	0.58101	1.795	0.43798	D	0.996347	D	0.71674	0.998	D	0.67900	0.954	T	0.81602	-0.0858	10	0.49607	T	0.09	-13.9395	6.3672	0.21461	0.2172:0.0:0.7828:0.0	.	181	Q9BRJ2	RM45_HUMAN	F	181	ENSP00000308901:V181F	ENSP00000308901:V181F	V	+	1	0	MRPL45	33730059	1.000000	0.71417	0.718000	0.30602	0.377000	0.30045	4.485000	0.60279	2.593000	0.87608	0.455000	0.32223	GTC	MRPL45	-	pfam_Tim44-like_dom,smart_Tim44-like_dom	ENSG00000174100		0.483	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	MRPL45	HGNC	protein_coding	OTTHUMT00000256792.3		0.00	35	0	G	NM_032351		36476532	+1			no_errors	ENST00000312513	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.857	T
MSLNL	401827	genome.wustl.edu	37	16	822739	822739	+	Missense_Mutation	SNP	G	G	T	rs7199313	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:822739G>T	ENST00000442466.1	-	11	1314	c.1315C>A	c.(1315-1317)Cgc>Agc	p.R439S	MSLNL_ENST00000293892.3_Missense_Mutation_p.R790S|MIR662_ENST00000384847.1_RNA			Q96KJ4	MSLNL_HUMAN	mesothelin-like	439					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						CAGCACAGGCGGGTGCCCCCG	0.662																																																	0													13.0	17.0	16.0					16																	822739		1946	4122	6068	SO:0001583	missense	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1315C>A	16.37:g.822739G>T	ENSP00000415767:p.Arg439Ser			Missense_Mutation	SNP	pfam_Mesothelin	p.R790S	ENST00000442466.1	37	c.2368		16	.	.	.	.	.	.	.	.	.	.	g	2.752	-0.259917	0.05791	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.10960	2.82;2.82;2.82	4.66	2.69	0.31865	.	0.224825	0.37348	N	0.002123	T	0.04907	0.0132	.	.	.	0.26684	N	0.971489	B	0.11235	0.004	B	0.12837	0.008	T	0.40270	-0.9572	9	0.13853	T	0.58	-26.3247	5.1692	0.15101	0.1053:0.0:0.6882:0.2066	.	439	Q96KJ4	MSLNL_HUMAN	S	489;439;790	ENSP00000441381:R489S;ENSP00000415767:R439S;ENSP00000293892:R790S	ENSP00000293892:R790S	R	-	1	0	MSLNL	762740	0.871000	0.30034	0.992000	0.48379	0.280000	0.26924	1.085000	0.30840	0.979000	0.38497	-0.240000	0.12126	CGC	MSLNL	-	pfam_Mesothelin	ENSG00000162006		0.662	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding			0.00	70	0	G	NM_001025190		822739	-1			no_errors	ENST00000293892	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.990	T
MYPN	84665	genome.wustl.edu	37	10	69948764	69948764	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:69948764G>A	ENST00000358913.5	+	13	3294	c.2806G>A	c.(2806-2808)Gag>Aag	p.E936K	MYPN_ENST00000540630.1_Missense_Mutation_p.E936K|MYPN_ENST00000354393.2_Missense_Mutation_p.E661K	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	936					sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCAACATGATGAGATCCCCAC	0.433																																																	0													106.0	98.0	101.0					10																	69948764		2203	4300	6503	SO:0001583	missense	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.2806G>A	10.37:g.69948764G>A	ENSP00000351790:p.Glu936Lys		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E936K	ENST00000358913.5	37	c.2806	CCDS7275.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.625630	0.96671	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.58210	0.35;0.42;0.4	5.83	5.83	0.93111	.	0.055231	0.64402	D	0.000001	T	0.68769	0.3037	L	0.59436	1.845	0.80722	D	1	D;D;D	0.69078	0.993;0.993;0.997	P;P;P	0.62740	0.84;0.84;0.906	T	0.64931	-0.6291	9	.	.	.	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	936;661;936	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	K	661;661;936;936	ENSP00000346369:E661K;ENSP00000351790:E936K;ENSP00000441668:E936K	.	E	+	1	0	MYPN	69618770	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	9.796000	0.99103	2.757000	0.94681	0.563000	0.77884	GAG	MYPN	-	NULL	ENSG00000138347		0.433	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	-	0.00	38	0	G	NM_032578		69948764	+1	tier1	-	no_errors	ENST00000358913	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
NCR1	9437	genome.wustl.edu	37	19	55417912	55417912	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:55417912G>T	ENST00000291890.4	+	3	140	c.102G>T	c.(100-102)gaG>gaT	p.E34D	NCR1_ENST00000350790.5_Intron|NCR1_ENST00000338835.5_Missense_Mutation_p.E34D|NCR1_ENST00000447255.1_Missense_Mutation_p.E34D|NCR1_ENST00000598576.1_Missense_Mutation_p.E22D|NCR1_ENST00000594765.1_Missense_Mutation_p.E34D|NCR1_ENST00000357397.5_Intron	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	34	Ig-like 1.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		TCTGGGCCGAGCCCCATTTCA	0.542																																																	0													60.0	64.0	63.0					19																	55417912		2203	4300	6503	SO:0001583	missense	0			AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.102G>T	19.37:g.55417912G>T	ENSP00000291890:p.Glu34Asp		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	smart_Ig_sub	p.E34D	ENST00000291890.4	37	c.102	CCDS12911.1	19	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673884	0.29693	.	.	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835	T;T;T	0.14516	2.5;2.5;2.5	3.87	-7.75	0.01236	Immunoglobulin-like fold (1);	0.972768	0.08460	N	0.942522	T	0.13884	0.0336	L	0.48260	1.515	0.09310	N	0.999997	B;B;B	0.29805	0.257;0.157;0.018	B;B;B	0.33392	0.163;0.148;0.039	T	0.20371	-1.0277	10	0.87932	D	0	.	15.3793	0.74641	0.188:0.0:0.812:0.0	.	34;34;34	B0V3L5;O76036-6;O76036	.;.;NCTR1_HUMAN	D	34	ENSP00000291890:E34D;ENSP00000404434:E34D;ENSP00000339515:E34D	ENSP00000291890:E34D	E	+	3	2	NCR1	60109724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.544000	0.06077	-2.229000	0.00720	-1.027000	0.02421	GAG	NCR1	-	smart_Ig_sub	ENSG00000189430		0.542	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR1	HGNC	protein_coding	OTTHUMT00000465680.1		0.00	32	0	G			55417912	+1			no_errors	ENST00000291890	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
NDST2	8509	genome.wustl.edu	37	10	75565407	75565407	+	Missense_Mutation	SNP	G	G	T	rs71471642		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:75565407G>T	ENST00000309979.6	-	8	2240	c.1684C>A	c.(1684-1686)Cct>Act	p.P562T	RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.P562T|NDST2_ENST00000299641.4_Missense_Mutation_p.P439T			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	562	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					AGTGGGACAGGAGGAAGGGTC	0.532																																																	0													75.0	69.0	71.0					10																	75565407		2203	4300	6503	SO:0001583	missense	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1684C>A	10.37:g.75565407G>T	ENSP00000310657:p.Pro562Thr		Q2TB32|Q59H89	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.P562T	ENST00000309979.6	37	c.1684	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946138	0.92593	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.53423	0.86;0.62	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.71929	0.3398	M	0.76938	2.355	0.80722	D	1	D;P;D	0.89917	1.0;0.757;0.999	D;P;D	0.91635	0.999;0.661;0.971	T	0.72830	-0.4174	10	0.59425	D	0.04	.	20.053	0.97634	0.0:0.0:1.0:0.0	.	439;232;562	B4E139;B4DQU1;P52849	.;.;NDST2_HUMAN	T	562;439	ENSP00000310657:P562T;ENSP00000299641:P439T	ENSP00000299641:P439T	P	-	1	0	NDST2	75235413	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.733000	0.93635	0.650000	0.86243	CCT	NDST2	-	NULL	ENSG00000166507		0.532	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	-	0.00	28	0	G	NM_003635		75565407	-1	tier1	-	no_errors	ENST00000309979	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
NDUFC2	4718	genome.wustl.edu	37	11	77790692	77790692	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:77790692G>C	ENST00000281031.4	-	1	573	c.99C>G	c.(97-99)atC>atG	p.I33M	NDUFC2-KCTD14_ENST00000528251.1_Missense_Mutation_p.I33M|NDUFC2_ENST00000528164.1_Missense_Mutation_p.I33M|NDUFC2_ENST00000527806.1_Missense_Mutation_p.I33M|NDUFC2_ENST00000525085.1_Missense_Mutation_p.I33M|NDUFC2-KCTD14_ENST00000530054.1_Missense_Mutation_p.I33M|NDUFC2_ENST00000534029.1_Missense_Mutation_p.I33M	NM_001204055.1|NM_004549.5	NP_001190984.1|NP_004540.1	O95298	NDUC2_HUMAN	NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa	33					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			large_intestine(1)|lung(2)|prostate(1)	4	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)		Carvedilol(DB01136)	CCAAGAAGCCGATGTAGAGGA	0.672																																																	0													13.0	14.0	14.0					11																	77790692		2193	4286	6479	SO:0001583	missense	0			AF087659	CCDS8257.1, CCDS55779.1, CCDS55781.1	11q14.1	2011-07-04	2002-08-29		ENSG00000151366	ENSG00000151366		"""Mitochondrial respiratory chain complex / Complex I"""	7706	protein-coding gene	gene with protein product	"""human lung cancer oncogene 1"", ""complex I subunit B14.5b"""	603845	"""NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2 (14.5kD, B14.5b)"""			9878551	Standard	NM_001204055		Approved	B14.5b, HLC-1		O95298		ENST00000281031.4:c.99C>G	11.37:g.77790692G>C	ENSP00000281031:p.Ile33Met		E9PNU8|E9PRB2|Q549M5|Q6FIH8|Q9UBJ9	Missense_Mutation	SNP	pfam_NADH-UbQ_OxRdtase_b14.5b_su,pirsf_NADH-UbQ_OxRdtase_b14.5b_su	p.I33M	ENST00000281031.4	37	c.99	CCDS8257.1	11	.	.	.	.	.	.	.	.	.	.	G	7.365	0.625627	0.14257	.	.	ENSG00000259112;ENSG00000259112;ENSG00000151366;ENSG00000151366;ENSG00000151366;ENSG00000151366;ENSG00000151366;ENSG00000151366	ENST00000528251;ENST00000530054;ENST00000281031;ENST00000527806;ENST00000534029;ENST00000525085;ENST00000324742;ENST00000528164	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	4.79	-9.59	0.00556	.	2.572970	0.01171	N	0.006870	T	0.15696	0.0378	N	0.01352	-0.895	0.09310	N	1	B	0.15473	0.013	B	0.17098	0.017	T	0.21143	-1.0254	10	0.25751	T	0.34	.	4.6132	0.12413	0.138:0.4886:0.1215:0.2519	.	33	O95298	NDUC2_HUMAN	M	33	ENSP00000435967:I33M;ENSP00000432614:I33M;ENSP00000281031:I33M;ENSP00000432739:I33M;ENSP00000432253:I33M;ENSP00000434262:I33M;ENSP00000435017:I33M	ENSP00000281031:I33M	I	-	3	3	NDUFC2;RP11-7I15.5	77468340	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-3.161000	0.00577	-2.457000	0.00539	-0.230000	0.12252	ATC	NDUFC2	-	pfam_NADH-UbQ_OxRdtase_b14.5b_su,pirsf_NADH-UbQ_OxRdtase_b14.5b_su	ENSG00000151366		0.672	NDUFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFC2	HGNC	protein_coding	OTTHUMT00000390821.1	-	0.00	25	0	G	NM_004549		77790692	-1	tier1	-	no_errors	ENST00000281031	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.000	C
NELFE	7936	genome.wustl.edu	37	6	31920162	31920162	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:31920162G>T	ENST00000375429.3	-	11	1285	c.1059C>A	c.(1057-1059)agC>agA	p.S353R	NELFE_ENST00000375425.5_Missense_Mutation_p.S360R|NELFE_ENST00000444811.2_Missense_Mutation_p.S323R	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	353					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										AACCCTTAGGGCTGTTCTGGA	0.527																																																	0													90.0	79.0	83.0					6																	31920162		2203	4300	6503	SO:0001583	missense	0			M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.1059C>A	6.37:g.31920162G>T	ENSP00000364578:p.Ser353Arg		A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S353R	ENST00000375429.3	37	c.1059	CCDS4730.1	6	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769157	0.69992	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811	T;T;T	0.50001	0.8;0.8;0.76	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.50939	0.1645	L	0.55990	1.75	0.58432	D	0.999991	D;D	0.65815	0.995;0.995	D;D	0.72982	0.979;0.979	T	0.58787	-0.7575	10	0.87932	D	0	-20.0347	9.3416	0.38082	0.16:0.0:0.8399:0.0	.	323;353	B4DUN1;P18615	.;NELFE_HUMAN	R	353;360;323	ENSP00000364578:S353R;ENSP00000364574:S360R;ENSP00000388400:S323R	ENSP00000364574:S360R	S	-	3	2	RDBP	32028141	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.779000	0.38624	1.578000	0.49821	0.655000	0.94253	AGC	NELFE	-	NULL	ENSG00000204356		0.527	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NELFE	HGNC	protein_coding	OTTHUMT00000076047.4		0.00	74	0	G			31920162	-1			no_errors	ENST00000375429	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
NKAIN3	286183	genome.wustl.edu	37	8	63492202	63492202	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:63492202G>T	ENST00000523211.1	+	2	291	c.159G>T	c.(157-159)ggG>ggT	p.G53G	NKAIN3_ENST00000328472.5_Silent_p.G53G|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				GTTTGTTTGGGACCATTCAGT	0.333																																																	0													155.0	145.0	148.0					8																	63492202		1812	4079	5891	SO:0001819	synonymous_variant	0			AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.159G>T	8.37:g.63492202G>T				Silent	SNP	pfam_Na/K-Atpase_Interacting	p.G53	ENST00000523211.1	37	c.159	CCDS55239.1	8																																																																																			NKAIN3	-	pfam_Na/K-Atpase_Interacting	ENSG00000185942		0.333	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	HGNC	protein_coding	OTTHUMT00000378447.2	-	0.00	45	0	G	NM_173688		63492202	+1	tier1	-	no_errors	ENST00000328472	ensembl	human	known	74_37	silent	5.21	91	5	SNP	1.000	T
NKRF	55922	genome.wustl.edu	37	X	118722357	118722358	+	3'UTR	INS	-	-	T	rs374040551		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:118722357_118722358insT	ENST00000371527.1	-	0	3682_3683				NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000304449.5_3'UTR|NKRF_ENST00000542113.1_3'UTR	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						CTTTTTATACATTTTTTTTTTT	0.366																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.*958->A	X.37:g.118722368_118722368dupT			G3V1N1|Q4VC41|Q9UJ91	RNA	INS	-	NULL	ENST00000371527.1	37	NULL	CCDS35375.1	X																																																																																			NKRF	-	-	ENSG00000186416		0.366	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1		0.00	35	0	-	NM_017544		118722358	-1	tier1		no_errors	ENST00000487600	ensembl	human	known	74_37	rna	10.42	43	5	INS	0.999:0.949	T
NLRP1	22861	genome.wustl.edu	37	17	5486100	5486100	+	Missense_Mutation	SNP	G	G	A	rs201858694		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:5486100G>A	ENST00000572272.1	-	2	337	c.338C>T	c.(337-339)tCc>tTc	p.S113F	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000269280.4_Missense_Mutation_p.S113F|NLRP1_ENST00000354411.3_Missense_Mutation_p.S113F|NLRP1_ENST00000262467.5_Missense_Mutation_p.S113F|NLRP1_ENST00000577119.1_Missense_Mutation_p.S113F|NLRP1_ENST00000345221.3_Missense_Mutation_p.S113F			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	113					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CACTGCGGTGGAGGTGGGTTG	0.587																																																	0													48.0	46.0	46.0					17																	5486100		2203	4300	6503	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.338C>T	17.37:g.5486100G>A	ENSP00000460475:p.Ser113Phe		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.S113F	ENST00000572272.1	37	c.338	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857041	0.51376	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	T;T;T;T;T	0.74632	-0.86;-0.86;-0.83;-0.82;-0.83	2.85	2.85	0.33270	.	.	.	.	.	T	0.75398	0.3844	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D	0.71674	0.998;0.998;0.995;0.998;0.99	D;D;P;D;P	0.68943	0.961;0.961;0.852;0.961;0.723	T	0.62129	-0.6919	9	0.37606	T	0.19	.	9.3633	0.38208	0.0:0.0:1.0:0.0	.	113;113;113;113;113	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	F	113	ENSP00000442029:S113F;ENSP00000262467:S113F;ENSP00000269280:S113F;ENSP00000346390:S113F;ENSP00000324366:S113F	ENSP00000262467:S113F	S	-	2	0	NLRP1	5426824	0.904000	0.30761	0.012000	0.15200	0.002000	0.02628	2.899000	0.48679	1.895000	0.54865	0.555000	0.69702	TCC	NLRP1	-	NULL	ENSG00000091592		0.587	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	-	0.00	76	0	G	NM_033004		5486100	-1	tier1	rs201858694	no_errors	ENST00000572272	ensembl	human	known	74_37	missense	42.86	32	24	SNP	0.013	A
NOL7	51406	genome.wustl.edu	37	6	13615843	13615843	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:13615843G>C	ENST00000451315.2	+	1	285	c.253G>C	c.(253-255)Gag>Cag	p.E85Q	AL441883.1_ENST00000600057.1_3'UTR|RP1-223E5.4_ENST00000566170.1_RNA|NOL7_ENST00000474485.1_3'UTR	NM_016167.3	NP_057251.2	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa	85						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(1)	5	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			GCGAGTGCGGGAGACCGTGCG	0.652											OREG0017200	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													12.0	16.0	15.0					6																	13615843		2198	4294	6492	SO:0001583	missense	0			AF172066	CCDS4528.1	6p23	2008-05-23	2004-02-10		ENSG00000225921	ENSG00000225921			21040	protein-coding gene	gene with protein product		611533	"""chromosome 6 open reading frame 90"", ""polyglutamine binding protein 3"""	C6orf90, PQBP3		16205646	Standard	NM_016167		Approved	NOP27, RARG-1, dJ223E5.2	uc003naz.3	Q9UMY1	OTTHUMG00000014277	ENST00000451315.2:c.253G>C	6.37:g.13615843G>C	ENSP00000405674:p.Glu85Gln	688	Q5T297|Q9Y3U7	Missense_Mutation	SNP	pfam_NUC129	p.E85Q	ENST00000451315.2	37	c.253	CCDS4528.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.56|18.56	3.650761|3.650761	0.67472|0.67472	.|.	.|.	ENSG00000225921|ENSG00000225921	ENST00000451315|ENST00000420088	T|.	0.28895|.	1.59|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	0.267267|.	0.36066|.	N|.	0.002807|.	T|T	0.20740|0.20740	0.0499|0.0499	L|L	0.29908|0.29908	0.895|0.895	0.29842|0.29842	N|N	0.82915|0.82915	P|.	0.37466|.	0.596|.	B|.	0.37888|.	0.26|.	T|T	0.09100|0.09100	-1.0690|-1.0690	10|5	0.37606|.	T|.	0.19|.	-2.0857|-2.0857	10.8761|10.8761	0.46913|0.46913	0.0881:0.0:0.9119:0.0|0.0881:0.0:0.9119:0.0	.|.	85|.	Q9UMY1|.	NOL7_HUMAN|.	Q|A	85|22	ENSP00000405674:E85Q|.	ENSP00000405674:E85Q|.	E|G	+|+	1|2	0|0	NOL7|NOL7	13723822|13723822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.539000|6.539000	0.73856|0.73856	2.330000|2.330000	0.79161|0.79161	0.650000|0.650000	0.86243|0.86243	GAG|GGA	NOL7	-	NULL	ENSG00000225921		0.652	NOL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL7	HGNC	protein_coding	OTTHUMT00000039904.1	-	0.00	38	0	G	NM_016167		13615843	+1	tier1	-	no_errors	ENST00000451315	ensembl	human	known	74_37	missense	20.97	49	13	SNP	1.000	C
NRP1	8829	genome.wustl.edu	37	10	33502640	33502640	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:33502640G>T	ENST00000265371.4	-	10	1813	c.1288C>A	c.(1288-1290)Cct>Act	p.P430T	NRP1_ENST00000374816.3_Missense_Mutation_p.P430T|NRP1_ENST00000374822.4_Missense_Mutation_p.P430T|NRP1_ENST00000374821.5_Missense_Mutation_p.P430T|NRP1_ENST00000374823.5_Missense_Mutation_p.P430T|NRP1_ENST00000432372.2_Missense_Mutation_p.P430T|RP11-342D11.2_ENST00000451530.1_RNA|NRP1_ENST00000395995.1_Missense_Mutation_p.P430T|NRP1_ENST00000374875.1_Missense_Mutation_p.P249T|NRP1_ENST00000374867.2_Missense_Mutation_p.P430T			O14786	NRP1_HUMAN	neuropilin 1	430					angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	CCAGAGCAAGGATAATCTGGG	0.398																																					Melanoma(104;886 1489 44640 45944 51153)												0													72.0	70.0	71.0					10																	33502640		2203	4300	6503	SO:0001583	missense	0			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1288C>A	10.37:g.33502640G>T	ENSP00000265371:p.Pro430Thr		B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.P430T	ENST00000265371.4	37	c.1288	CCDS7177.1	10	.	.	.	.	.	.	.	.	.	.	G	19.62	3.860878	0.71834	.	.	ENSG00000099250	ENST00000265371;ENST00000374875;ENST00000374867;ENST00000395995;ENST00000374822;ENST00000374821;ENST00000374823;ENST00000374816;ENST00000432372	D;D;D;D;D;D;D;D;D	0.98914	-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23	5.41	5.41	0.78517	Coagulation factor 5/8 C-terminal type domain (1);	0.000000	0.85682	D	0.000000	D	0.98682	0.9558	L	0.43923	1.385	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.997;0.993;0.998;0.998;0.998	D	0.99929	1.1308	10	0.87932	D	0	-14.0508	19.1846	0.93637	0.0:0.0:1.0:0.0	.	430;430;430;430;430;430;430;249;430	A8K9V7;E7EX60;Q5T7F0;Q5T7F1;O14786-2;Q68DN3;O14786;Q5JWQ6;E9PEP6	.;.;.;.;.;.;NRP1_HUMAN;.;.	T	430;249;430;430;430;430;430;430;103	ENSP00000265371:P430T;ENSP00000364009:P249T;ENSP00000364001:P430T;ENSP00000379317:P430T;ENSP00000363955:P430T;ENSP00000363954:P430T;ENSP00000363956:P430T;ENSP00000363949:P430T;ENSP00000408911:P103T	ENSP00000265371:P430T	P	-	1	0	NRP1	33542646	1.000000	0.71417	0.997000	0.53966	0.387000	0.30353	9.864000	0.99589	2.529000	0.85273	0.491000	0.48974	CCT	NRP1	-	pirsf_Neuropilin,smart_Coagulation_fac_5/8-C_type_dom	ENSG00000099250		0.398	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	HGNC	protein_coding	OTTHUMT00000051203.2	-	0.00	66	0	G			33502640	-1	tier1	-	no_errors	ENST00000265371	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	T
NTRK2	4915	genome.wustl.edu	37	9	87563393	87563393	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:87563393G>T	ENST00000323115.4	+	14	2086	c.1733G>T	c.(1732-1734)aGt>aTt	p.S578I	NTRK2_ENST00000376214.1_Missense_Mutation_p.S594I|NTRK2_ENST00000277120.3_Missense_Mutation_p.S594I|NTRK2_ENST00000376213.1_Missense_Mutation_p.S578I			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	578	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AAGGATGCCAGTGACAATGCA	0.522										TSP Lung(25;0.17)																																							0													108.0	79.0	89.0					9																	87563393		2203	4300	6503	SO:0001583	missense	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1733G>T	9.37:g.87563393G>T	ENSP00000314586:p.Ser578Ile		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.S594I	ENST00000323115.4	37	c.1781	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100594	0.76983	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6	5.34	5.34	0.76211	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94781	0.8315	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.75484	0.98;0.986;0.938	D	0.95206	0.8321	10	0.87932	D	0	.	19.0469	0.93025	0.0:0.0:1.0:0.0	.	578;594;624	Q16620;Q16620-4;Q59GJ1	NTRK2_HUMAN;.;.	I	594;578;594;578	ENSP00000365387:S594I;ENSP00000365386:S578I;ENSP00000277120:S594I;ENSP00000314586:S578I	ENSP00000277120:S594I	S	+	2	0	NTRK2	86753213	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	3.972000	0.56838	2.509000	0.84616	0.655000	0.94253	AGT	NTRK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000148053		0.522	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1	-	0.00	49	0	G			87563393	+1	tier1	-	no_errors	ENST00000277120	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
NUDT10	170685	genome.wustl.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					NSCLC(90;1817 2035 37909 38249)												8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)											52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	0			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.E69	ENST00000376006.3	37	c.207	CCDS35278.1	X																																																																																			NUDT10	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	ENSG00000122824		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUDT10	HGNC	protein_coding	OTTHUMT00000056578.1		0.00	55	0	G	NM_153183		51076024	+1			no_errors	ENST00000356450	ensembl	human	known	74_37	silent	7.58	61	5	SNP	1.000	A
NXN	64359	genome.wustl.edu	37	17	704261	704261	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:704261C>G	ENST00000336868.3	-	8	1327	c.1236G>C	c.(1234-1236)gaG>gaC	p.E412D	NXN_ENST00000537628.2_Missense_Mutation_p.E163D|NXN_ENST00000538650.1_Missense_Mutation_p.E103D|NXN_ENST00000575801.1_Missense_Mutation_p.E304D	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	412					cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		CGGGGGTGATCTCCTCCACGT	0.587																																																	0													72.0	65.0	67.0					17																	704261		2203	4300	6503	SO:0001583	missense	0				CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.1236G>C	17.37:g.704261C>G	ENSP00000337443:p.Glu412Asp		B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.E412D	ENST00000336868.3	37	c.1236	CCDS10998.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.027241	0.93518	.	.	ENSG00000167693	ENST00000336868;ENST00000538650;ENST00000537628	T;T	0.34072	1.38;2.51	5.99	5.02	0.67125	Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	L	0.37630	1.12	0.80722	D	1	D;D;D	0.69078	0.979;0.974;0.997	D;D;D	0.79108	0.973;0.953;0.992	T	0.13282	-1.0515	10	0.28530	T	0.3	-30.7004	13.391	0.60825	0.0:0.9246:0.0:0.0754	.	304;103;412	B4DXQ0;B4DNN6;Q6DKJ4	.;.;NXN_HUMAN	D	412;103;304	ENSP00000337443:E412D;ENSP00000445087:E103D	ENSP00000337443:E412D	E	-	3	2	NXN	651011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.317000	0.51968	2.840000	0.97914	0.655000	0.94253	GAG	NXN	-	superfamily_Thioredoxin-like_fold	ENSG00000167693		0.587	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXN	HGNC	protein_coding	OTTHUMT00000206669.1	-	0.00	100	0	C			704261	-1	tier1	-	no_errors	ENST00000336868	ensembl	human	known	74_37	missense	41.18	50	35	SNP	1.000	G
NYAP1	222950	genome.wustl.edu	37	7	100086030	100086030	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:100086030G>A	ENST00000300179.2	+	4	845	c.686G>A	c.(685-687)cGa>cAa	p.R229Q	NYAP1_ENST00000454988.1_Missense_Mutation_p.R172Q|NYAP1_ENST00000423930.1_Missense_Mutation_p.R229Q	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	229					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GGAGGAGGACGAAGTGGAGGA	0.647																																																	0																																										SO:0001583	missense	0			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.686G>A	7.37:g.100086030G>A	ENSP00000300179:p.Arg229Gln		Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	NULL	p.R229Q	ENST00000300179.2	37	c.686	CCDS5696.1	7	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261035	0.59431	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.41065	1.01;1.01;1.01	5.14	4.26	0.50523	.	0.349980	0.20559	N	0.089943	T	0.20820	0.0501	N	0.08118	0	0.37210	D	0.904782	B;B	0.33198	0.229;0.401	B;B	0.26693	0.033;0.072	T	0.16837	-1.0389	10	0.44086	T	0.13	-3.4947	9.659	0.39943	0.0972:0.0:0.9028:0.0	.	172;229	C9JS30;Q6ZVC0	.;CG051_HUMAN	Q	229;229;172	ENSP00000300179:R229Q;ENSP00000411861:R229Q;ENSP00000394424:R172Q	ENSP00000300179:R229Q	R	+	2	0	C7orf51	99923966	0.993000	0.37304	0.998000	0.56505	0.967000	0.64934	1.560000	0.36331	1.177000	0.42855	0.407000	0.27541	CGA	NYAP1	-	NULL	ENSG00000166924		0.647	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2		0.00	27	0	G	NM_173564		100086030	+1			no_errors	ENST00000423930	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.999	A
OLIG1	116448	genome.wustl.edu	37	21	34443982	34443982	+	3'UTR	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr21:34443982C>T	ENST00000382348.1	+	0	1533				AP000282.2_ENST00000454622.1_RNA|OLIG1_ENST00000333063.5_3'UTR|OLIG1_ENST00000498799.1_3'UTR|AP000282.2_ENST00000420356.1_RNA	NM_138983.2	NP_620450.2	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1						neuron fate commitment (GO:0048663)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)	1						GACGGACCCTCGGCGGACAGG	0.642																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AP000109	CCDS42920.1, CCDS42920.2	21q22.11	2013-05-21			ENSG00000184221	ENSG00000184221		"""Basic helix-loop-helix proteins"""	16983	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 1"", ""oligodendrocyte lineage transcription factor 1"", ""basic domain, helix-loop-helix protein, class B, 6"""	606385				11526205	Standard	NM_138983		Approved	BHLHB6, bHLHe21	uc002yqz.3	Q8TAK6	OTTHUMG00000065064	ENST00000382348.1:c.*614C>T	21.37:g.34443982C>T			Q7RTS0	RNA	SNP	-	NULL	ENST00000382348.1	37	NULL	CCDS42920.2	21																																																																																			OLIG1	-	-	ENSG00000184221		0.642	OLIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLIG1	HGNC	protein_coding	OTTHUMT00000139730.1	-	0.00	137	0	C	NM_138983		34443982	+1	tier1	-	no_errors	ENST00000498799	ensembl	human	known	74_37	rna	29.59	69	29	SNP	0.000	T
OR13C2	392376	genome.wustl.edu	37	9	107367331	107367331	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:107367331G>C	ENST00000542196.1	-	1	620	c.578C>G	c.(577-579)tCa>tGa	p.S193*		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						CTCATTGTCTGAGATGTCAGC	0.393																																																	0													156.0	151.0	153.0					9																	107367331		2201	4300	6501	SO:0001587	stop_gained	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.578C>G	9.37:g.107367331G>C	ENSP00000438815:p.Ser193*		B9EGV8|Q6IF54	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S193*	ENST00000542196.1	37	c.578	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209120	0.58343	.	.	ENSG00000257019	ENST00000542196	.	.	.	3.53	2.61	0.31194	.	0.000000	0.33235	U	0.005132	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	10.379	0.44099	0.0:0.2019:0.7981:0.0	.	.	.	.	X	193	.	ENSP00000438815:S193X	S	-	2	0	OR13C2	106407152	0.000000	0.05858	0.203000	0.23512	0.730000	0.41778	-0.446000	0.06837	0.661000	0.30985	0.462000	0.41574	TCA	OR13C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000257019		0.393	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	-	0.00	33	0	G	NM_001004481		107367331	-1	tier1	-	no_errors	ENST00000542196	ensembl	human	known	74_37	nonsense	29.17	34	14	SNP	0.202	C
OR2A5	393046	genome.wustl.edu	37	7	143748358	143748358	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:143748358G>C	ENST00000408906.2	+	1	898	c.864G>C	c.(862-864)ttG>ttC	p.L288F		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TGAACCCCTTGATCTATAGCC	0.527																																																	0													109.0	106.0	107.0					7																	143748358		1962	4170	6132	SO:0001583	missense	0			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.864G>C	7.37:g.143748358G>C	ENSP00000386208:p.Leu288Phe		B9EGX2|O43885|O43888	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L288F	ENST00000408906.2	37	c.864	CCDS43668.1	7	.	.	.	.	.	.	.	.	.	.	G	7.407	0.633950	0.14322	.	.	ENSG00000221836	ENST00000408906	T	0.38887	1.11	5.37	1.29	0.21616	GPCR, rhodopsin-like superfamily (1);	0.000000	0.26450	U	0.024303	T	0.36193	0.0958	L	0.41356	1.27	0.31605	N	0.652205	B	0.28082	0.2	B	0.33620	0.167	T	0.45071	-0.9286	10	0.66056	D	0.02	.	12.3971	0.55391	0.0:0.6107:0.2654:0.1239	.	288	Q96R48	OR2A5_HUMAN	F	288	ENSP00000386208:L288F	ENSP00000386208:L288F	L	+	3	2	OR2A5	143379291	0.204000	0.23447	0.988000	0.46212	0.221000	0.24807	-0.367000	0.07553	0.034000	0.15491	-0.181000	0.13052	TTG	OR2A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000221836		0.527	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A5	HGNC	protein_coding	OTTHUMT00000349986.1	-	0.00	62	0	G			143748358	+1	tier1	-	no_errors	ENST00000408906	ensembl	human	known	74_37	missense	64.71	24	44	SNP	0.880	C
OR5K1	26339	genome.wustl.edu	37	3	98188847	98188847	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:98188847C>G	ENST00000332650.5	+	1	524	c.427C>G	c.(427-429)Cag>Gag	p.Q143E		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ACTCTGCATTCAGATGACCAC	0.468																																																	0													137.0	138.0	137.0					3																	98188847		2203	4300	6503	SO:0001583	missense	0			X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.427C>G	3.37:g.98188847C>G	ENSP00000373193:p.Gln143Glu		B9EGY5|Q6IF46	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q143E	ENST00000332650.5	37	c.427	CCDS43115.1	3	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876111	0.51801	.	.	ENSG00000232382	ENST00000332650	T	0.00130	8.69	4.8	4.8	0.61643	GPCR, rhodopsin-like superfamily (1);	0.176890	0.27311	N	0.019949	T	0.00271	0.0008	M	0.71206	2.165	0.23381	N	0.997795	P	0.46142	0.873	P	0.48738	0.588	T	0.57207	-0.7851	10	0.27082	T	0.32	-0.8172	11.1255	0.48315	0.0:0.8133:0.1867:0.0	.	143	Q8NHB7	OR5K1_HUMAN	E	143	ENSP00000373193:Q143E	ENSP00000373193:Q143E	Q	+	1	0	OR5K1	99671537	0.000000	0.05858	0.996000	0.52242	0.898000	0.52572	0.583000	0.23849	2.483000	0.83821	0.563000	0.77884	CAG	OR5K1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000232382		0.468	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K1	HGNC	protein_coding	OTTHUMT00000359019.1	-	0.00	101	0	C			98188847	+1	tier1	-	no_errors	ENST00000332650	ensembl	human	known	74_37	missense	28.76	109	44	SNP	0.998	G
OSBPL6	114880	genome.wustl.edu	37	2	179238625	179238625	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:179238625G>T	ENST00000190611.4	+	15	1780	c.1404G>T	c.(1402-1404)gaG>gaT	p.E468D	OSBPL6_ENST00000409045.3_Missense_Mutation_p.E437D|OSBPL6_ENST00000357080.4_Missense_Mutation_p.E401D|OSBPL6_ENST00000315022.2_Missense_Mutation_p.E472D|OSBPL6_ENST00000409631.1_Missense_Mutation_p.E432D|OSBPL6_ENST00000392505.2_Missense_Mutation_p.E493D|OSBPL6_ENST00000359685.3_Missense_Mutation_p.E432D	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	468					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AGGCTGGTGAGCAAATCCATG	0.443																																																	0													91.0	79.0	83.0					2																	179238625		2203	4300	6503	SO:0001583	missense	0			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1404G>T	2.37:g.179238625G>T	ENSP00000190611:p.Glu468Asp		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E472D	ENST00000190611.4	37	c.1416	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	G	12.58	1.982115	0.34942	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.12984	2.75;2.7;2.63;2.75;2.75;2.7;2.74	6.01	5.14	0.70334	.	0.138471	0.49305	D	0.000157	T	0.20536	0.0494	L	0.28115	0.83	0.37986	D	0.933761	B;B;D;B;B;B	0.56035	0.0;0.057;0.974;0.057;0.012;0.099	B;B;D;B;B;B	0.67725	0.003;0.05;0.953;0.05;0.007;0.024	T	0.11792	-1.0573	10	0.27785	T	0.31	-20.0662	9.9613	0.41697	0.1915:0.0:0.8085:0.0	.	437;472;432;493;468;401	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	D	493;432;401;437;468;432;472	ENSP00000376293:E493D;ENSP00000352713:E432D;ENSP00000349591:E401D;ENSP00000387248:E437D;ENSP00000190611:E468D;ENSP00000386885:E432D;ENSP00000318723:E472D	ENSP00000190611:E468D	E	+	3	2	OSBPL6	178946871	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.518000	0.35877	1.557000	0.49525	0.651000	0.88453	GAG	OSBPL6	-	NULL	ENSG00000079156		0.443	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2		0.00	25	0	G	NM_032523		179238625	+1			no_errors	ENST00000315022	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
OTUD4	54726	genome.wustl.edu	37	4	146095823	146095823	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:146095823T>C	ENST00000447906.2	-	2	420	c.233A>G	c.(232-234)aAa>aGa	p.K78R	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000296579.6_Missense_Mutation_p.K13R|OTUD4_ENST00000509620.2_Missense_Mutation_p.K13R|OTUD4_ENST00000454497.2_Missense_Mutation_p.K13R			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	78	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CGCTTCAAATTTCTCTCTGTT	0.383																																																	0													98.0	96.0	97.0					4																	146095823		2203	4300	6503	SO:0001583	missense	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.233A>G	4.37:g.146095823T>C	ENSP00000395487:p.Lys78Arg		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.K78R	ENST00000447906.2	37	c.233		4	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406876	0.62399	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973;ENST00000509620;ENST00000296579;ENST00000504501	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.62	4.4	0.53042	Ovarian tumour, otubain (2);	0.112676	0.38326	N	0.001721	T	0.35128	0.0921	L	0.31664	0.95	0.35999	D	0.837269	P;P	0.49961	0.913;0.93	P;P	0.49999	0.596;0.628	T	0.31336	-0.9947	10	0.13470	T	0.59	-14.3931	8.9638	0.35863	0.1652:0.0:0.0:0.8348	.	78;78	G3V0I6;Q01804	.;OTUD4_HUMAN	R	13;78;13;13;13;13	ENSP00000409279:K13R;ENSP00000395487:K78R;ENSP00000425972:K13R;ENSP00000424192:K13R;ENSP00000296579:K13R;ENSP00000423453:K13R	ENSP00000296579:K13R	K	-	2	0	OTUD4	146315273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.756000	0.38390	1.002000	0.39104	0.533000	0.62120	AAA	OTUD4	-	pfam_OTU,pfscan_OTU	ENSG00000164164		0.383	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	-	0.00	67	0	T	NM_017493		146095823	-1	tier1	-	no_errors	ENST00000447906	ensembl	human	known	74_37	missense	25.00	48	16	SNP	1.000	C
PANK1	53354	genome.wustl.edu	37	10	91353688	91353688	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:91353688C>T	ENST00000307534.4	-	4	1524	c.1369G>A	c.(1369-1371)Gaa>Aaa	p.E457K	MIR107_ENST00000362127.1_RNA|PANK1_ENST00000342512.3_Missense_Mutation_p.E232K|PANK1_ENST00000322191.6_Intron|PANK1_ENST00000371774.2_Missense_Mutation_p.E259K	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	457					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						AGAGCTTCTTCAAAGGTCTCA	0.413																																																	0													135.0	121.0	126.0					10																	91353688		2203	4300	6503	SO:0001583	missense	0			AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1369G>A	10.37:g.91353688C>T	ENSP00000302108:p.Glu457Lys		A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.E457K	ENST00000307534.4	37	c.1369	CCDS31244.1	10	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793905	0.90453	.	.	ENSG00000152782	ENST00000342512;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D	0.99567	-6.18;-6.18;-6.18	6.17	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	M	0.78049	2.395	0.80722	D	1	P;B;P	0.52170	0.951;0.004;0.839	P;B;P	0.51866	0.682;0.011;0.592	D	0.99323	1.0907	10	0.35671	T	0.21	.	15.8556	0.78975	0.0:0.9356:0.0:0.0644	.	259;457;232	Q8TE04-4;Q8TE04;Q8TE04-2	.;PANK1_HUMAN;.	K	232;259;457;320	ENSP00000345118:E232K;ENSP00000360839:E259K;ENSP00000302108:E457K	ENSP00000302108:E457K	E	-	1	0	PANK1	91343668	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	1.644000	0.50603	-0.119000	0.15052	GAA	PANK1	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000152782		0.413	PANK1-201	KNOWN	basic|CCDS	protein_coding	PANK1	HGNC	protein_coding		-	0.00	61	0	C			91353688	-1	tier1	-	no_errors	ENST00000307534	ensembl	human	known	74_37	missense	33.33	40	20	SNP	1.000	T
PASD1	139135	genome.wustl.edu	37	X	150840072	150840072	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:150840072G>A	ENST00000370357.4	+	13	1503	c.1258G>A	c.(1258-1260)Gtc>Atc	p.V420I		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	420						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					ACGCCACGTTGTCATTCCTGA	0.498																																																	0													213.0	169.0	184.0					X																	150840072		2203	4300	6503	SO:0001583	missense	0			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1258G>A	X.37:g.150840072G>A	ENSP00000359382:p.Val420Ile		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	superfamily_PAS,smart_PAS,pfscan_PAS	p.V420I	ENST00000370357.4	37	c.1258	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404034	0.25291	.	.	ENSG00000166049	ENST00000370357	T	0.19250	2.16	3.64	-3.79	0.04320	.	.	.	.	.	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	1	P	0.41848	0.763	B	0.33196	0.159	T	0.12553	-1.0543	9	0.44086	T	0.13	-25.5295	1.144	0.01771	0.3717:0.2983:0.1897:0.1403	.	420	Q8IV76	PASD1_HUMAN	I	420	ENSP00000359382:V420I	ENSP00000359382:V420I	V	+	1	0	PASD1	150590728	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.808000	0.04515	-1.212000	0.02620	0.529000	0.55759	GTC	PASD1	-	NULL	ENSG00000166049		0.498	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	-	0.00	30	0	G	NM_173493		150840072	+1	tier1	-	no_errors	ENST00000370357	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.000	A
PCDH12	51294	genome.wustl.edu	37	5	141334669	141334669	+	Silent	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:141334669G>C	ENST00000231484.3	-	1	3958	c.2748C>G	c.(2746-2748)ctC>ctG	p.L916L	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	916					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGCCATTGAGATGTCGCT	0.657																																																	0													43.0	48.0	47.0					5																	141334669		2203	4300	6503	SO:0001819	synonymous_variant	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2748C>G	5.37:g.141334669G>C			Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L916	ENST00000231484.3	37	c.2748	CCDS4269.1	5																																																																																			PCDH12	-	NULL	ENSG00000113555		0.657	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	-	0.00	82	0	G	NM_016580		141334669	-1	tier1	-	no_errors	ENST00000231484	ensembl	human	known	74_37	silent	72.22	25	65	SNP	0.999	C
PCLO	27445	genome.wustl.edu	37	7	82545336	82545336	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:82545336G>T	ENST00000333891.9	-	7	12303	c.11966C>A	c.(11965-11967)gCa>gAa	p.A3989E	PCLO_ENST00000437081.1_Missense_Mutation_p.A709E|PCLO_ENST00000423517.2_Missense_Mutation_p.A3989E	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGAAACAGGTGCTATCATAAG	0.403																																																	0													390.0	368.0	375.0					7																	82545336		1930	4136	6066	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11966C>A	7.37:g.82545336G>T	ENSP00000334319:p.Ala3989Glu			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.A3989E	ENST00000333891.9	37	c.11966	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069489	0.55539	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.20200	2.09;2.09	5.85	5.85	0.93711	.	.	.	.	.	T	0.47266	0.1436	M	0.61703	1.905	0.51482	D	0.999925	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.74674	0.915;0.984;0.984	T	0.35025	-0.9805	9	0.87932	D	0	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	3920;3989;3989	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	E	3989;3989;709	ENSP00000334319:A3989E;ENSP00000388393:A3989E	ENSP00000334319:A3989E	A	-	2	0	PCLO	82383272	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.125000	0.57931	2.767000	0.95098	0.563000	0.77884	GCA	PCLO	-	NULL	ENSG00000186472		0.403	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	48	0	G	NM_014510		82545336	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
PDCD1	5133	genome.wustl.edu	37	2	242795101	242795101	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:242795101G>A	ENST00000334409.5	-	2	177	c.108C>T	c.(106-108)acC>acT	p.T36T		NM_005018.2	NP_005009.2	Q15116	PDCD1_HUMAN	programmed cell death 1	36	Ig-like V-type.				apoptotic process (GO:0006915)|humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			endometrium(1)|lung(2)|ovary(1)|prostate(3)|skin(1)	8		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		CTGGGGAGAAGGTGGGGGGGT	0.632																																																	0													21.0	19.0	20.0					2																	242795101		2199	4296	6495	SO:0001819	synonymous_variant	0			AY206416	CCDS33428.1	2q37.3	2014-01-29			ENSG00000188389	ENSG00000188389		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	8760	protein-coding gene	gene with protein product		600244	"""systemic lupus erythematosus susceptibility 2"""	SLEB2		7851902, 12402038	Standard	NM_005018		Approved	CD279, PD1, hSLE1	uc002wcq.4	Q15116	OTTHUMG00000151342	ENST00000334409.5:c.108C>T	2.37:g.242795101G>A			O00517|Q8IX89	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.T36	ENST00000334409.5	37	c.108	CCDS33428.1	2																																																																																			PDCD1	-	pfscan_Ig-like_dom	ENSG00000188389		0.632	PDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD1	HGNC	protein_coding	OTTHUMT00000322313.1	-	0.00	81	0	G	NM_005018		242795101	-1	tier1	-	no_errors	ENST00000334409	ensembl	human	known	74_37	silent	68.97	18	40	SNP	0.929	A
PDE3B	5140	genome.wustl.edu	37	11	14889244	14889244	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:14889244G>A	ENST00000282096.4	+	15	3432	c.3079G>A	c.(3079-3081)Gat>Aat	p.D1027N	PDE3B_ENST00000455098.2_Missense_Mutation_p.D976N	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	1027	Catalytic. {ECO:0000250}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	AAGTGGTGATGATGAAGACGG	0.373																																																	0													124.0	126.0	126.0					11																	14889244		2200	4294	6494	SO:0001583	missense	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.3079G>A	11.37:g.14889244G>A	ENSP00000282096:p.Asp1027Asn		B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.D1027N	ENST00000282096.4	37	c.3079	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001536	0.74818	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.76316	-1.01;-1.01	5.73	5.73	0.89815	.	1.084620	0.07247	N	0.865166	T	0.76090	0.3939	L	0.44542	1.39	0.48762	D	0.999703	B;P	0.39665	0.008;0.682	B;B	0.36534	0.003;0.227	T	0.68458	-0.5403	10	0.31617	T	0.26	.	19.9031	0.96996	0.0:0.0:1.0:0.0	.	976;1027	B7ZM37;Q13370	.;PDE3B_HUMAN	N	1027;976	ENSP00000282096:D1027N;ENSP00000388644:D976N	ENSP00000282096:D1027N	D	+	1	0	PDE3B	14845820	1.000000	0.71417	0.951000	0.38953	0.926000	0.56050	9.090000	0.94144	2.710000	0.92621	0.561000	0.74099	GAT	PDE3B	-	NULL	ENSG00000152270		0.373	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	-	0.00	38	0	G	NM_000922		14889244	+1	tier1	-	no_errors	ENST00000282096	ensembl	human	known	74_37	missense	57.89	16	22	SNP	0.999	A
PDE4DIP	9659	genome.wustl.edu	37	1	144994964	144994964	+	5'Flank	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:144994964G>A	ENST00000369354.3	-	0	0				PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369356.4_5'UTR|PDE4DIP_ENST00000369351.3_5'Flank|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000369347.4_5'Flank|PDE4DIP_ENST00000369349.3_5'Flank|PDE4DIP_ENST00000369359.4_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACCTCAGGGAGATATTTGCGG	0.572			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													81.0	80.0	80.0					1																	144994964		876	1991	2867	SO:0001631	upstream_gene_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846		1.37:g.144994964G>A	Exception_encountered		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc	p.L11F	ENST00000369354.3	37	c.31	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323353	0.60634	.	.	ENSG00000178104	ENST00000534536	T	0.11277	2.79	5.79	5.79	0.91817	.	.	.	.	.	T	0.03053	0.0090	N	0.20766	0.605	0.80722	D	1	B	0.11235	0.004	B	0.15870	0.014	T	0.31336	-0.9947	9	0.08381	T	0.77	.	17.5201	0.87784	0.0:0.0:1.0:0.0	.	11	E9PS60	.	F	11	ENSP00000435920:L11F	ENSP00000431777:L11F	L	-	1	0	PDE4DIP	143706321	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	3.138000	0.50570	2.735000	0.93741	0.655000	0.94253	CTC	PDE4DIP	-	NULL	ENSG00000178104		0.572	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	126	0	G	NM_022359		144994964	-1	tier1	-	no_errors	ENST00000528129	ensembl	human	known	74_37	missense	11.54	138	18	SNP	1.000	A
PDE6C	5146	genome.wustl.edu	37	10	95372506	95372506	+	Silent	SNP	C	C	T	rs564460310		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:95372506C>T	ENST00000371447.3	+	1	162	c.24C>T	c.(22-24)gcC>gcT	p.A8A		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	8					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	ACCAAGTTGCCGTGGAGAAAT	0.517													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21117	0.0		0.0	False		,,,				2504	0.0																0													112.0	105.0	108.0					10																	95372506		2203	4300	6503	SO:0001819	synonymous_variant	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.24C>T	10.37:g.95372506C>T			A6NCR6|Q5VY29	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A8	ENST00000371447.3	37	c.24	CCDS7429.1	10																																																																																			PDE6C	-	NULL	ENSG00000095464		0.517	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1	-	0.00	64	0	C	NM_006204		95372506	+1	tier1	-	no_errors	ENST00000371447	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.008	T
PDIK1L	149420	genome.wustl.edu	37	1	26448574	26448574	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:26448574G>T	ENST00000374271.4	+	4	819	c.532G>T	c.(532-534)Gat>Tat	p.D178Y	PDIK1L_ENST00000374269.1_Missense_Mutation_p.D178Y	NM_001243532.1|NM_001243533.1|NM_152835.4	NP_001230461.1|NP_001230462.1|NP_690048.1	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AACCAGGTTGGATACCAGTGA	0.458																																																	0													145.0	141.0	142.0					1																	26448574		2203	4300	6503	SO:0001583	missense	0			AF411102	CCDS274.1	1p35.1	2008-02-05			ENSG00000175087	ENSG00000175087			18981	protein-coding gene	gene with protein product		610785				14631099	Standard	NM_152835		Approved	CLIK1L	uc009vsb.3	Q8N165	OTTHUMG00000007511	ENST00000374271.4:c.532G>T	1.37:g.26448574G>T	ENSP00000363389:p.Asp178Tyr		B2R777|D3DPK2|Q5T2I0|Q8NDB3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D178Y	ENST00000374271.4	37	c.532	CCDS274.1	1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578223	0.45902	.	.	ENSG00000175087	ENST00000444713;ENST00000374271;ENST00000374269	T;T;T	0.66995	0.15;-0.24;-0.24	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.101189	0.64402	D	0.000002	T	0.62853	0.2462	L	0.48174	1.505	0.31282	N	0.690488	P	0.42357	0.777	B	0.39840	0.311	T	0.72080	-0.4398	10	0.72032	D	0.01	-20.7167	16.2389	0.82396	0.0:0.1329:0.8671:0.0	.	178	Q8N165	PDK1L_HUMAN	Y	178	ENSP00000406510:D178Y;ENSP00000363389:D178Y;ENSP00000363387:D178Y	ENSP00000363387:D178Y	D	+	1	0	PDIK1L	26321161	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.767000	0.62286	2.750000	0.94351	0.655000	0.94253	GAT	PDIK1L	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000175087		0.458	PDIK1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIK1L	HGNC	protein_coding	OTTHUMT00000019752.1		0.00	40	0	G	NM_152835		26448574	+1			no_errors	ENST00000374269	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
PDS5B	23047	genome.wustl.edu	37	13	33316842	33316842	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:33316842C>A	ENST00000315596.10	+	23	2775	c.2589C>A	c.(2587-2589)gaC>gaA	p.D863E		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	863					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GTGATGGAGACTTGACAGAAC	0.353																																																	0													145.0	135.0	138.0					13																	33316842		1862	4116	5978	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2589C>A	13.37:g.33316842C>A	ENSP00000313851:p.Asp863Glu		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D863E	ENST00000315596.10	37	c.2589	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117336	0.77323	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.84	4.1	0.47936	Armadillo-like helical (1);Armadillo-type fold (1);	0.040834	0.85682	D	0.000000	T	0.67258	0.2874	M	0.64997	1.995	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.65853	-0.6067	9	0.06625	T	0.88	-3.8015	11.8702	0.52517	0.0:0.8031:0.0:0.1969	.	863	Q9NTI5	PDS5B_HUMAN	E	863	.	ENSP00000313851:D863E	D	+	3	2	PDS5B	32214842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.554000	0.36266	0.787000	0.33731	0.591000	0.81541	GAC	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.353	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	-	0.00	36	0	C	NM_015032		33316842	+1	tier1	-	no_errors	ENST00000315596	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	A
PFAS	5198	genome.wustl.edu	37	17	8158990	8158990	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:8158990G>C	ENST00000314666.6	+	5	688	c.555G>C	c.(553-555)gaG>gaC	p.E185D	PFAS_ENST00000545834.1_Intron	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	185					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)	p.E185E(1)		central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TTGCGCTGGAGAAGGCCAACC	0.587																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											45.0	44.0	44.0					17																	8158990		2203	4300	6503	SO:0001583	missense	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.555G>C	17.37:g.8158990G>C	ENSP00000313490:p.Glu185Asp		A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.E185D	ENST00000314666.6	37	c.555	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927830	0.73327	.	.	ENSG00000178921	ENST00000314666	T	0.35789	1.29	5.55	2.45	0.29901	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	M	0.85710	2.77	0.80722	D	1	D	0.55800	0.973	P	0.51229	0.663	T	0.35400	-0.9790	10	0.36615	T	0.2	-26.0032	4.377	0.11275	0.2464:0.0:0.5954:0.1581	.	185	O15067	PUR4_HUMAN	D	185	ENSP00000313490:E185D	ENSP00000313490:E185D	E	+	3	2	PFAS	8099715	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	1.926000	0.40084	0.296000	0.22592	0.462000	0.41574	GAG	PFAS	-	tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.587	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	-	0.00	98	0	G			8158990	+1	tier1	-	no_errors	ENST00000314666	ensembl	human	known	74_37	missense	53.10	52	60	SNP	1.000	C
PGBD3	267004	genome.wustl.edu	37	10	50724205	50724205	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:50724205T>A	ENST00000374127.3	-	2	1157	c.956A>T	c.(955-957)aAt>aTt	p.N319I	ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.N787I|ERCC6_ENST00000355832.5_Intron|PGBD3_ENST00000603152.1_Missense_Mutation_p.N787I|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.N787I|PGBD3_ENST00000508005.2_Missense_Mutation_p.N319I	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	319										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						ATGTTTAGTATTTGGGTTTTT	0.458																																																	0													50.0	48.0	49.0					10																	50724205		2203	4300	6503	SO:0001583	missense	0			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.956A>T	10.37:g.50724205T>A	ENSP00000363242:p.Asn319Ile		B3KQC4|Q5W0M0|Q6PIH0	Missense_Mutation	SNP	NULL	p.N787I	ENST00000374127.3	37	c.2360	CCDS7230.1	10	.	.	.	.	.	.	.	.	.	.	T	12.23	1.875731	0.33162	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	0.699	0.699	0.18093	.	.	.	.	.	T	0.12050	0.0293	N	0.14661	0.345	0.09310	N	1	D;B	0.59357	0.985;0.425	P;B	0.48654	0.585;0.371	T	0.22626	-1.0211	8	0.38643	T	0.18	-25.7861	.	.	.	.	787;319	E7EV46;Q8N328	.;PGBD3_HUMAN	I	319;319;787;787	ENSP00000363242:N319I;ENSP00000426963:N319I;ENSP00000423550:N787I;ENSP00000387966:N787I	ENSP00000387966:N787I	N	-	2	0	PGBD3;RP11-123B3.6	50394211	0.011000	0.17503	0.029000	0.17559	0.982000	0.71751	0.782000	0.26788	0.548000	0.28955	0.402000	0.26972	AAT	PGBD3	-	NULL	ENSG00000243251		0.458	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	HGNC	protein_coding	OTTHUMT00000047988.1	-	0.00	20	0	T			50724205	-1	tier1	-	no_errors	ENST00000603152	ensembl	human	known	74_37	missense	33.33	6	3	SNP	0.004	A
PITPNM1	9600	genome.wustl.edu	37	11	67260979	67260979	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:67260979G>T	ENST00000534749.1	-	21	3432	c.3244C>A	c.(3244-3246)Cag>Aag	p.Q1082K	PITPNM1_ENST00000356404.3_Missense_Mutation_p.Q1082K|PITPNM1_ENST00000526450.1_5'UTR|PITPNM1_ENST00000436757.2_Missense_Mutation_p.Q1081K			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1082					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						AAGTTGTGCTGCGACAGCCAT	0.647																																					GBM(28;144 709 4607 5525)												0													32.0	32.0	32.0					11																	67260979		2183	4285	6468	SO:0001583	missense	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3244C>A	11.37:g.67260979G>T	ENSP00000437286:p.Gln1082Lys		A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.Q1082K	ENST00000534749.1	37	c.3244	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.265350	0.95399	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.75938	-0.98;-0.98;-0.98	4.41	4.41	0.53225	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.148155	0.31872	N	0.006928	D	0.87485	0.6189	M	0.87900	2.915	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.76071	0.984;0.987	D	0.90030	0.4134	10	0.72032	D	0.01	-12.7974	15.9604	0.79926	0.0:0.0:1.0:0.0	.	1081;1082	O00562-2;O00562	.;PITM1_HUMAN	K	1082;1081;1082	ENSP00000437286:Q1082K;ENSP00000398787:Q1081K;ENSP00000348772:Q1082K	ENSP00000348772:Q1082K	Q	-	1	0	PITPNM1	67017555	1.000000	0.71417	0.978000	0.43139	0.963000	0.63663	9.808000	0.99193	2.178000	0.69098	0.491000	0.48974	CAG	PITPNM1	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2	ENSG00000110697		0.647	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1		0.00	28	0	G	NM_004910		67260979	-1			no_errors	ENST00000356404	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
PIH1D2	120379	genome.wustl.edu	37	11	111941292	111941292	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:111941292C>G	ENST00000280350.4	-	5	903	c.681G>C	c.(679-681)caG>caC	p.Q227H	PIH1D2_ENST00000532211.1_Missense_Mutation_p.Q227H|PIH1D2_ENST00000530641.1_Missense_Mutation_p.Q227H|PIH1D2_ENST00000528775.1_Missense_Mutation_p.Q227H|PIH1D2_ENST00000521853.2_5'Flank|PIH1D2_ENST00000431456.1_Missense_Mutation_p.Q227H	NM_138789.3	NP_620144.1	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2	227										endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TCATCTCCACCTGGATTTCAG	0.393																																																	0													176.0	177.0	177.0					11																	111941292		2201	4297	6498	SO:0001583	missense	0			BC019238	CCDS8355.1, CCDS44730.1	11q23.1	2007-01-31			ENSG00000150773	ENSG00000150773			25210	protein-coding gene	gene with protein product						12477932	Standard	NM_138789		Approved		uc001pmp.4	Q8WWB5	OTTHUMG00000166925	ENST00000280350.4:c.681G>C	11.37:g.111941292C>G	ENSP00000280350:p.Gln227His		B4DU48|E9PD82	Missense_Mutation	SNP	pfam_PIH	p.Q227H	ENST00000280350.4	37	c.681	CCDS8355.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.655|8.655	0.899066|0.899066	0.17686|0.17686	.|.	.|.	ENSG00000150773|ENSG00000150773	ENST00000525072|ENST00000528775;ENST00000431456;ENST00000532211;ENST00000280350;ENST00000530641	.|T;T;T;T;T	.|0.18810	.|2.19;2.19;2.19;2.19;2.19	5.72|5.72	-4.83|-4.83	0.03161|0.03161	.|.	.|0.752000	.|0.13317	.|N	.|0.397016	T|T	0.25717|0.25717	0.0626|0.0626	M|M	0.71581|0.71581	2.175|2.175	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.48162	.|0.484;0.773;0.906	.|B;B;P	.|0.52514	.|0.445;0.445;0.701	T|T	0.09292|0.09292	-1.0681|-1.0681	5|10	.|0.39692	.|T	.|0.17	0.161|0.161	4.4307|4.4307	0.11525|0.11525	0.0961:0.3221:0.0953:0.4865|0.0961:0.3221:0.0953:0.4865	.|.	.|227;227;227	.|B4DU48;E9PD82;Q8WWB5	.|.;.;PIHD2_HUMAN	R|H	183|227	.|ENSP00000434275:Q227H;ENSP00000388209:Q227H;ENSP00000431841:Q227H;ENSP00000280350:Q227H;ENSP00000431147:Q227H	.|ENSP00000280350:Q227H	G|Q	-|-	1|3	0|2	PIH1D2|PIH1D2	111446502|111446502	0.189000|0.189000	0.23263|0.23263	0.002000|0.002000	0.10522|0.10522	0.003000|0.003000	0.03518|0.03518	0.021000|0.021000	0.13489|0.13489	-0.463000|-0.463000	0.06973|0.06973	-1.087000|-1.087000	0.02190|0.02190	GGT|CAG	PIH1D2	-	pfam_PIH	ENSG00000150773		0.393	PIH1D2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PIH1D2	HGNC	protein_coding	OTTHUMT00000391916.1	-	0.00	47	0	C	NM_138789		111941292	-1	tier1	-	no_errors	ENST00000280350	ensembl	human	known	74_37	missense	67.35	16	33	SNP	0.000	G
PKHD1	5314	genome.wustl.edu	37	6	51824753	51824753	+	Silent	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:51824753T>C	ENST00000371117.3	-	36	6098	c.5823A>G	c.(5821-5823)caA>caG	p.Q1941Q	PKHD1_ENST00000340994.4_Silent_p.Q1941Q	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1941	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGTCGCCATCTTGTGGCAGCC	0.493											OREG0017492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													171.0	151.0	158.0					6																	51824753		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5823A>G	6.37:g.51824753T>C		980	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.Q1941	ENST00000371117.3	37	c.5823	CCDS4935.1	6																																																																																			PKHD1	-	pfam_G8_domain	ENSG00000170927		0.493	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	42	0	T	NM_138694		51824753	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	24.24	50	16	SNP	1.000	C
PKP1	5317	genome.wustl.edu	37	1	201292166	201292166	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:201292166C>T	ENST00000352845.3	+	10	1592	c.1592C>T	c.(1591-1593)cCt>cTt	p.P531L	PKP1_ENST00000367324.3_Missense_Mutation_p.P510L|PKP1_ENST00000263946.3_Missense_Mutation_p.P531L			Q13835	PKP1_HUMAN	plakophilin 1	531					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						TGCCCCCTGCCTGAGGAAGAG	0.562																																																	0													119.0	123.0	121.0					1																	201292166		2203	4300	6503	SO:0001583	missense	0			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1592C>T	1.37:g.201292166C>T	ENSP00000295597:p.Pro531Leu		O00645|Q14CA0|Q15152	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P531L	ENST00000352845.3	37	c.1592	CCDS30966.1	1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853503	0.32791	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	D;D;D	0.84660	-1.88;-1.88;-1.88	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84433	0.5471	L	0.51422	1.61	0.32461	N	0.544156	B;P;P	0.45569	0.069;0.794;0.861	B;B;B	0.43052	0.051;0.406;0.391	D	0.87775	0.2608	10	0.51188	T	0.08	-14.8689	19.2755	0.94030	0.0:1.0:0.0:0.0	.	118;510;531	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	L	510;531;531	ENSP00000356293:P510L;ENSP00000263946:P531L;ENSP00000295597:P531L	ENSP00000263946:P531L	P	+	2	0	PKP1	199558789	0.958000	0.32768	0.326000	0.25389	0.199000	0.23934	3.992000	0.56980	2.618000	0.88619	0.655000	0.94253	CCT	PKP1	-	superfamily_ARM-type_fold	ENSG00000081277		0.562	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	-	0.00	79	0	C	NM_000299		201292166	+1	tier1	-	no_errors	ENST00000263946	ensembl	human	known	74_37	missense	17.11	63	13	SNP	0.265	T
PMEPA1	56937	genome.wustl.edu	37	20	56227196	56227196	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:56227196G>T	ENST00000341744.3	-	4	1096	c.777C>A	c.(775-777)acC>acA	p.T259T	PMEPA1_ENST00000347215.4_Silent_p.T224T|PMEPA1_ENST00000395816.3_Silent_p.T209T|PMEPA1_ENST00000395814.1_Silent_p.T209T|PMEPA1_ENST00000265626.4_Silent_p.T209T	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	259					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GGTGGAGCCGGGTCCCCTCCA	0.657																																																	0													20.0	21.0	20.0					20																	56227196		2195	4294	6489	SO:0001819	synonymous_variant	0			AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.777C>A	20.37:g.56227196G>T			Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	NULL	p.T259	ENST00000341744.3	37	c.777	CCDS13463.1	20																																																																																			PMEPA1	-	NULL	ENSG00000124225		0.657	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEPA1	HGNC	protein_coding	OTTHUMT00000079858.2	-	0.00	41	0	G	NM_020182		56227196	-1	tier1	-	no_errors	ENST00000341744	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.989	T
POTEF	728378	genome.wustl.edu	37	2	130877817	130877817	+	Missense_Mutation	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:130877817A>G	ENST00000409914.2	-	3	671	c.272T>C	c.(271-273)aTg>aCg	p.M91T	POTEF_ENST00000360967.5_Missense_Mutation_p.M91T|POTEF_ENST00000357462.5_Missense_Mutation_p.M91T|POTEF_ENST00000361163.4_Missense_Mutation_p.M91T	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	91					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GAGTGTCTTCATAGCAGAGTC	0.612																																																	0													94.0	118.0	110.0					2																	130877817		2203	4295	6498	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.272T>C	2.37:g.130877817A>G	ENSP00000386786:p.Met91Thr		A6NC34	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.M91T	ENST00000409914.2	37	c.272	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	3.176	-0.168987	0.06461	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.78364	-1.17;-1.17;1.63;1.69	0.62	0.62	0.17637	.	.	.	.	.	T	0.68979	0.3060	L	0.53249	1.67	0.09310	N	1	B	0.25169	0.119	B	0.11329	0.006	T	0.61773	-0.6994	8	0.87932	D	0	.	.	.	.	.	91	A5A3E0	POTEF_HUMAN	T	91	ENSP00000350052:M91T;ENSP00000386786:M91T;ENSP00000354232:M91T;ENSP00000355012:M91T	ENSP00000350052:M91T	M	-	2	0	POTEF	130594287	0.755000	0.28372	0.036000	0.18154	0.027000	0.11550	1.362000	0.34148	0.500000	0.27991	0.138000	0.15974	ATG	POTEF	-	NULL	ENSG00000196604		0.612	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2		0.00	194	0	A	NM_001099771		130877817	-1			no_errors	ENST00000357462	ensembl	human	known	74_37	missense	6.43	160	11	SNP	0.066	G
POTEE	445582	genome.wustl.edu	37	2	131976247	131976247	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:131976247T>C	ENST00000356920.5	+	1	366	c.272T>C	c.(271-273)aTg>aCg	p.M91T	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.M91T|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	91					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GACTCTGCTATGAAGACACTC	0.612																																																	0													54.0	51.0	52.0					2																	131976247		2190	4262	6452	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.272T>C	2.37:g.131976247T>C	ENSP00000439189:p.Met91Thr		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.M91T	ENST00000356920.5	37	c.272	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	3.619	-0.078032	0.07184	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.78364	-1.17;1.57	0.619	0.619	0.17630	.	.	.	.	.	T	0.62938	0.2469	L	0.29908	0.895	0.09310	N	1	B	0.25169	0.119	B	0.11329	0.006	T	0.55755	-0.8091	8	0.87932	D	0	.	.	.	.	.	91	Q6S8J3	POTEE_HUMAN	T	91	ENSP00000439189:M91T;ENSP00000443049:M91T	ENSP00000439189:M91T	M	+	2	0	AC131180.1	131692717	0.873000	0.30073	0.032000	0.17829	0.023000	0.10783	1.278000	0.33179	0.499000	0.27970	0.136000	0.15936	ATG	POTEE	-	NULL	ENSG00000188219		0.612	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding		-	0.00	79	0	T	NM_001083538		131976247	+1	tier1	-	no_errors	ENST00000356920	ensembl	human	known	74_37	missense	35.06	50	27	SNP	0.053	C
PMS1	5378	genome.wustl.edu	37	2	190660632	190660632	+	Silent	SNP	C	C	T	rs149723996	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:190660632C>T	ENST00000441310.2	+	3	503	c.270C>T	c.(268-270)taC>taT	p.Y90Y	PMS1_ENST00000447232.2_Silent_p.Y90Y|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000409823.3_Silent_p.Y90Y|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000409985.1_Silent_p.Y90Y|PMS1_ENST00000374826.4_Silent_p.Y90Y|PMS1_ENST00000432292.3_Intron	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	90					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TGACAACTTACGGTTTTCGTG	0.368			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0								C	,,	0,4406		0,0,2203	110.0	108.0	109.0		270,270,270	-6.8	0.9	2	dbSNP_134	109	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	PMS1	NM_000534.4,NM_001128143.1,NM_001128144.1	,,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,,	90/933,90/894,90/771	190660632	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.270C>T	2.37:g.190660632C>T			D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Silent	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_box_dom,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom,tigrfam_DNA_mismatch_repair_N	p.Y90	ENST00000441310.2	37	c.270	CCDS2302.1	2																																																																																			PMS1	-	pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000064933		0.368	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	-	0.00	46	0	C			190660632	+1	tier1	rs149723996	no_errors	ENST00000441310	ensembl	human	known	74_37	silent	19.72	57	14	SNP	0.386	T
POTEH	23784	genome.wustl.edu	37	22	16278260	16278260	+	Intron	SNP	C	C	A	rs200660281|rs376762014	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr22:16278260C>A	ENST00000343518.6	-	5	1080				POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GGTAAAATAACTAAGAGCTCT	0.363													A|||	1506	0.300719	0.3177	0.2406	5008	,	,		29734	0.254		0.2913	False		,,,				2504	0.3783																0																																										SO:0001627	intron_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1029-375G>T	22.37:g.16278260C>A			A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			POTEH-AS1	-	-	ENSG00000236666		0.363	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	9	0	C	NM_001136213		16278260	+1	tier1	rs200660281	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	66.67	3	6	SNP	0.000	A
POTEM	641455	genome.wustl.edu	37	14	20020113	20020113	+	Silent	SNP	C	C	T	rs199622050		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr14:20020113C>T	ENST00000551509.1	-	1	159	c.108G>A	c.(106-108)agG>agA	p.R36R		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	36										endometrium(4)|kidney(1)|lung(4)	9						TGCCGCTCCCCCTGCACCAGG	0.587																																																	0													5.0	6.0	6.0					14																	20020113		197	578	775	SO:0001819	synonymous_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.108G>A	14.37:g.20020113C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R36	ENST00000551509.1	37	c.108	CCDS45076.1	14																																																																																			POTEM	-	NULL	ENSG00000187537		0.587	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	-	0.00	45	0	C	NM_001145442		20020113	-1	tier1	rs199622050	no_errors	ENST00000547848	ensembl	human	known	74_37	silent	13.16	66	10	SNP	0.101	T
POU6F1	5463	genome.wustl.edu	37	12	51584241	51584241	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:51584241G>C	ENST00000389243.4	-	11	1634	c.695C>G	c.(694-696)tCc>tGc	p.S232C	POU6F1_ENST00000333640.10_Missense_Mutation_p.S232C|POU6F1_ENST00000550824.1_Missense_Mutation_p.S232C			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	232					brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GCGTTTCTTGGAGGGCTCGCC	0.562																																																	0													144.0	137.0	139.0					12																	51584241		2203	4300	6503	SO:0001583	missense	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.695C>G	12.37:g.51584241G>C	ENSP00000373895:p.Ser232Cys		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.S232C	ENST00000389243.4	37	c.695	CCDS31803.1	12	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025252	0.93518	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.95724	-3.79;-3.79;-3.79	5.43	5.43	0.79202	Homeodomain-related (1);Homeobox (1);	0.000000	0.85682	D	0.000000	D	0.96448	0.8841	L	0.55103	1.725	0.80722	D	1	D	0.54047	0.964	P	0.57911	0.829	D	0.96914	0.9669	10	0.87932	D	0	.	18.0148	0.89236	0.0:0.0:1.0:0.0	.	232	Q14863	PO6F1_HUMAN	C	232	ENSP00000373895:S232C;ENSP00000330190:S232C;ENSP00000448389:S232C	ENSP00000330190:S232C	S	-	2	0	POU6F1	49870508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.673000	0.74482	2.553000	0.86117	0.561000	0.74099	TCC	POU6F1	-	pfscan_Homeobox_dom	ENSG00000184271		0.562	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1	-	0.00	51	0	G	NM_002702		51584241	-1	tier1	-	no_errors	ENST00000333640	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	C
PPP1R18	170954	genome.wustl.edu	37	6	30652643	30652643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:30652643delC	ENST00000274853.3	-	1	3029	c.1153delG	c.(1153-1155)gctfs	p.A385fs	PPP1R18_ENST00000399199.3_Frame_Shift_Del_p.A385fs|PPP1R18_ENST00000488324.1_Intron	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	385						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CTGCCCTGAGCCCCCGCCTCC	0.622																																																	0													56.0	64.0	62.0					6																	30652643		1232	2530	3762	SO:0001589	frameshift_variant	0			AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.1153delG	6.37:g.30652643delC	ENSP00000274853:p.Ala385fs		A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Frame_Shift_Del	DEL	NULL	p.A385fs	ENST00000274853.3	37	c.1153	CCDS43444.1	6																																																																																			PPP1R18	-	NULL	ENSG00000146112		0.622	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R18	HGNC	protein_coding	OTTHUMT00000076498.2		0.00	33	0	C	NM_133471		30652643	-1	tier1		no_errors	ENST00000274853	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.002	-
PPP2R3B	28227	genome.wustl.edu	37	X	307471	307471	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:307471C>T	ENST00000390665.3	-	5	775	c.757G>A	c.(757-759)Gag>Aag	p.E253K		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	253					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCGGACGCCTCCTTCAGGAAC	0.711																																																	0													57.0	69.0	65.0					X																	307471		2078	4211	6289	SO:0001583	missense	0			AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.757G>A	X.37:g.307471C>T	ENSP00000375080:p.Glu253Lys		Q6P4G9|Q7RTT1|Q96H01	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.E253K	ENST00000390665.3	37	c.757	CCDS14104.1	X	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361342	0.82353	.	.	ENSG00000167393	ENST00000390665	T	0.29655	1.56	0.789	0.789	0.18607	.	0.073939	0.53938	U	0.000058	T	0.52322	0.1727	M	0.87180	2.865	0.09310	N	0.999998	D;D	0.65815	0.995;0.972	D;P	0.69142	0.962;0.621	T	0.35251	-0.9796	10	0.72032	D	0.01	.	7.359	0.26735	0.0:0.9999:0.0:1.0E-4	.	92;253	B4DE79;Q9Y5P8	.;P2R3B_HUMAN	K	253	ENSP00000375080:E253K	ENSP00000375080:E253K	E	-	1	0	PPP2R3B	227471	1.000000	0.71417	0.997000	0.53966	0.521000	0.34408	3.784000	0.55416	0.717000	0.32145	0.115000	0.15696	GAG	PPP2R3B	-	NULL	ENSG00000167393		0.711	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3B	HGNC	protein_coding	OTTHUMT00000055577.2	-	0.00	112	0	C	NM_013239		307471	-1	tier1	-	no_errors	ENST00000390665	ensembl	human	known	74_37	missense	48.15	28	26	SNP	1.000	T
PRR19	284338	genome.wustl.edu	37	19	42814490	42814490	+	Silent	SNP	A	A	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:42814490A>T	ENST00000499536.2	+	2	1480	c.669A>T	c.(667-669)ccA>ccT	p.P223P	PRR19_ENST00000598490.1_3'UTR|PRR19_ENST00000341747.3_Silent_p.P223P|TMEM145_ENST00000301204.3_5'Flank			A6NJB7	PRR19_HUMAN	proline rich 19	223										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				ATCAAGTCCCAGAGCAGGAGA	0.562																																																	0													94.0	89.0	91.0					19																	42814490		2203	4300	6503	SO:0001819	synonymous_variant	0			AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.669A>T	19.37:g.42814490A>T			A8K663|B3KW48|Q6P584	Silent	SNP	NULL	p.P223	ENST00000499536.2	37	c.669	CCDS33036.1	19																																																																																			PRR19	-	NULL	ENSG00000188368		0.562	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR19	HGNC	protein_coding	OTTHUMT00000463735.1	-	0.00	36	0	A	NM_199285		42814490	+1	tier1	-	no_errors	ENST00000341747	ensembl	human	known	74_37	silent	31.58	26	12	SNP	0.002	T
PRSS1	5644	genome.wustl.edu	37	7	142460779	142460779	+	Missense_Mutation	SNP	G	G	T	rs574391339		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:142460779G>T	ENST00000311737.7	+	5	658	c.652G>T	c.(652-654)Gat>Tat	p.D218Y	PRSS1_ENST00000486171.1_Missense_Mutation_p.D232Y	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	218	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CTCCTGGGGTGATGGCTGTGC	0.522													g|||	1	0.000199681	0.0	0.0	5008	,	,		16476	0.001		0.0	False		,,,				2504	0.0																0													81.0	82.0	82.0					7																	142460779		2203	4300	6503	SO:0001583	missense	0			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.652G>T	7.37:g.142460779G>T	ENSP00000308720:p.Asp218Tyr		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D218Y	ENST00000311737.7	37	c.652	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.097197	0.00034	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.88896	-2.44;-2.44	3.18	1.99	0.26369	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.434585	0.27223	N	0.020352	T	0.65417	0.2689	N	0.02765	-0.5	0.24198	N	0.995522	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56444	-0.7978	10	0.02654	T	1	.	4.1291	0.10141	0.3145:0.0:0.1737:0.5118	.	232;218	E7EQ64;P07477	.;TRY1_HUMAN	Y	232;218;208	ENSP00000417854:D232Y;ENSP00000308720:D218Y	ENSP00000308720:D218Y	D	+	1	0	PRSS1	142140353	0.000000	0.05858	0.995000	0.50966	0.013000	0.08279	0.233000	0.17911	0.385000	0.24970	-1.375000	0.01183	GAT	PRSS1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000204983		0.522	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2		0.00	73	0	G			142460779	+1			no_errors	ENST00000311737	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.978	T
PSG4	5672	genome.wustl.edu	37	19	43699413	43699413	+	Missense_Mutation	SNP	T	T	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:43699413T>A	ENST00000405312.3	-	4	959	c.722A>T	c.(721-723)aAg>aTg	p.K241M	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Missense_Mutation_p.K148M	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	241	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				GATGTAGGGCTTGGACAGCTT	0.453																																																	0													239.0	259.0	252.0					19																	43699413		2202	4295	6497	SO:0001583	missense	0				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.722A>T	19.37:g.43699413T>A	ENSP00000384770:p.Lys241Met		E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K241M	ENST00000405312.3	37	c.722	CCDS46093.1	19	.	.	.	.	.	.	.	.	.	.	t	2.315	-0.356953	0.05138	.	.	ENSG00000243137	ENST00000405312;ENST00000433626	T;T	0.57752	0.38;1.46	1.79	-3.57	0.04612	Immunoglobulin-like (1);	.	.	.	.	T	0.62368	0.2422	M	0.91196	3.185	0.09310	N	1	B;B	0.32573	0.376;0.023	P;B	0.44732	0.459;0.133	T	0.60910	-0.7169	9	0.45353	T	0.12	.	4.1595	0.10277	0.0:0.3329:0.2806:0.3865	.	148;241	E7EX79;Q00888	.;PSG4_HUMAN	M	241;148	ENSP00000384770:K241M;ENSP00000387864:K148M	ENSP00000384770:K241M	K	-	2	0	PSG4	48391253	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.418000	0.02462	-1.691000	0.01430	-0.441000	0.05720	AAG	PSG4	-	pfscan_Ig-like_dom	ENSG00000243137		0.453	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG4	HGNC	protein_coding	OTTHUMT00000323073.1	-	0.00	126	0	T	NM_213633		43699413	-1	tier1	-	no_errors	ENST00000405312	ensembl	human	known	74_37	missense	21.33	166	45	SNP	0.002	A
PTHLH	5744	genome.wustl.edu	37	12	28114897	28114898	+	Intron	INS	-	-	T	rs377014358		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:28114897_28114898insT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000354417.3_Frame_Shift_Ins_p.K186fs|PTHLH_ENST00000395872.1_Intron|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000538310.1_Frame_Shift_Ins_p.K186fs|PTHLH_ENST00000539239.1_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					TGTTGTTTTCCTTTTTTTTTTT	0.337																																																	0																																										SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382->A	12.37:g.28114908_28114908dupT			Q15251|Q6FH74	Frame_Shift_Ins	INS	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.E187fs	ENST00000545234.1	37	c.558_557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.337	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1		0.00	17	0	-	NM_198965		28114898	-1	tier1		no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_ins	22.22	14	4	INS	0.126:0.135	T
PTPRC	5788	genome.wustl.edu	37	1	198701611	198701611	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:198701611G>T	ENST00000367376.2	+	20	2233	c.2062G>T	c.(2062-2064)Gat>Tat	p.D688Y	PTPRC_ENST00000348564.6_Missense_Mutation_p.D529Y|PTPRC_ENST00000442510.2_Missense_Mutation_p.D690Y|PTPRC_ENST00000352140.3_Missense_Mutation_p.D640Y|PTPRC_ENST00000594404.1_Missense_Mutation_p.D527Y	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	688	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TTAAACAGATGATTATAACCG	0.318																																																	0													82.0	82.0	82.0					1																	198701611		2203	4300	6503	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2062G>T	1.37:g.198701611G>T	ENSP00000356346:p.Asp688Tyr		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D690Y	ENST00000367376.2	37	c.2068		1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498629	0.85069	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	D	0.89123	-2.47	5.82	5.82	0.92795	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.50627	D	0.000109	D	0.96911	0.8991	H	0.99104	4.43	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97771	1.0226	10	0.87932	D	0	.	13.3203	0.60428	0.072:0.0:0.928:0.0	.	624;624;529;640;688	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	Y	690;624;640;640;574;688;622;527	ENSP00000193532:D640Y	ENSP00000306782:D527Y	D	+	1	0	PTPRC	196968234	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.032000	0.88838	2.748000	0.94277	0.655000	0.94253	GAT	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000081237		0.318	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding			0.00	41	0	G			198701611	+1			no_errors	ENST00000442510	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
PTPRH	5794	genome.wustl.edu	37	19	55698885	55698885	+	Silent	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:55698885C>A	ENST00000376350.3	-	14	2584	c.2562G>T	c.(2560-2562)ctG>ctT	p.L854L	PTPRH_ENST00000263434.5_Silent_p.L676L	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	854	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ACTCACAGGGCAGCACATTTC	0.587																																																	0													113.0	87.0	95.0					19																	55698885		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2562G>T	19.37:g.55698885C>A			C9JCH2|Q15426|Q2NKN9|Q2NKP0	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.L854	ENST00000376350.3	37	c.2562	CCDS33110.1	19																																																																																			PTPRH	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000080031		0.587	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	-	0.00	53	0	C			55698885	-1	tier1	-	no_errors	ENST00000376350	ensembl	human	known	74_37	silent	43.48	39	30	SNP	1.000	A
RAB11FIP3	9727	genome.wustl.edu	37	16	570264	570264	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:570264G>A	ENST00000262305.4	+	12	2391	c.2003G>A	c.(2002-2004)cGc>cAc	p.R668H	RAB11FIP3_ENST00000450428.1_Missense_Mutation_p.R372H|RAB11FIP3_ENST00000457159.1_Missense_Mutation_p.R713H	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	668					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				CAGGAGGTCCGCAGGCTGAAG	0.697																																					Melanoma(160;2366 2595 4474 8099)												0													7.0	11.0	10.0					16																	570264		2126	4209	6335	SO:0001583	missense	0			AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.2003G>A	16.37:g.570264G>A	ENSP00000262305:p.Arg668His		B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_hand_dom	p.R713H	ENST00000262305.4	37	c.2138	CCDS32351.1	16	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171212	0.78452	.	.	ENSG00000090565	ENST00000262305;ENST00000457159;ENST00000434585;ENST00000450428;ENST00000448401	T;T	0.17691	2.26;2.26	5.27	5.27	0.74061	.	.	.	.	.	T	0.32912	0.0845	L	0.53249	1.67	0.48975	D	0.99973	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.74023	0.982;0.88;0.939	T	0.02654	-1.1128	9	0.59425	D	0.04	-32.5325	8.7346	0.34521	0.0799:0.0:0.7678:0.1523	.	713;372;668	O75154-3;O75154-2;O75154	.;.;RFIP3_HUMAN	H	668;713;589;372;372	ENSP00000399644:R589H;ENSP00000415919:R372H	ENSP00000262305:R668H	R	+	2	0	RAB11FIP3	510265	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.273000	0.58914	2.466000	0.83321	0.491000	0.48974	CGC	RAB11FIP3	-	NULL	ENSG00000090565		0.697	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	RAB11FIP3	HGNC	protein_coding	OTTHUMT00000109066.4		0.00	11	0	G	NM_014700		570264	+1			no_errors	ENST00000457159	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.992	A
RAB39A	54734	genome.wustl.edu	37	11	107799511	107799511	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:107799511G>A	ENST00000320578.2	+	1	283	c.217G>A	c.(217-219)Gag>Aag	p.E73K	SLC35F2_ENST00000429869.1_5'Flank|SLC35F2_ENST00000525071.1_5'Flank	NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	73					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)										GGCGGGACAGGAGCGGTTCAG	0.736																																																	0													18.0	18.0	18.0					11																	107799511		2194	4296	6490	SO:0001583	missense	0			X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.217G>A	11.37:g.107799511G>A	ENSP00000322594:p.Glu73Lys		A8KAA4|Q8N6W2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E73K	ENST00000320578.2	37	c.217	CCDS8338.1	11	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976394	0.92982	.	.	ENSG00000179331	ENST00000320578	D	0.83992	-1.79	4.76	4.76	0.60689	Small GTP-binding protein domain (1);	0.287098	0.26859	N	0.022125	D	0.89136	0.6629	H	0.97783	4.075	0.58432	D	0.999998	P	0.39311	0.667	B	0.34418	0.182	D	0.92733	0.6201	10	0.87932	D	0	.	17.0468	0.86505	0.0:0.0:1.0:0.0	.	73	Q14964	RB39A_HUMAN	K	73	ENSP00000322594:E73K	ENSP00000322594:E73K	E	+	1	0	RAB39	107304721	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.321000	0.96353	2.628000	0.89032	0.555000	0.69702	GAG	RAB39A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000179331		0.736	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39A	HGNC	protein_coding	OTTHUMT00000389423.1	-	0.00	131	0	G	NM_017516		107799511	+1	tier1	-	no_errors	ENST00000320578	ensembl	human	known	74_37	missense	63.46	38	66	SNP	1.000	A
RAB3D	9545	genome.wustl.edu	37	19	11446226	11446226	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:11446226G>T	ENST00000222120.3	-	4	629	c.369C>A	c.(367-369)taC>taA	p.Y123*	RAB3D_ENST00000589655.1_Nonsense_Mutation_p.Y123*	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	123					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						TGTCCCAGGAGTAGGTCTTGA	0.612																																																	0													92.0	80.0	84.0					19																	11446226		2203	4300	6503	SO:0001587	stop_gained	0			AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.369C>A	19.37:g.11446226G>T	ENSP00000222120:p.Tyr123*			Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y123*	ENST00000222120.3	37	c.369	CCDS12257.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.732850	0.97796	.	.	ENSG00000105514	ENST00000222120	.	.	.	4.64	1.3	0.21679	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4204	0.27069	0.3683:0.0:0.6317:0.0	.	.	.	.	X	123	.	ENSP00000222120:Y123X	Y	-	3	2	RAB3D	11307226	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.288000	0.43514	0.272000	0.22027	0.462000	0.41574	TAC	RAB3D	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000105514		0.612	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3D	HGNC	protein_coding	OTTHUMT00000453211.1	-	0.00	77	0	G	NM_004283		11446226	-1	tier1	-	no_errors	ENST00000222120	ensembl	human	known	74_37	nonsense	5.19	73	4	SNP	1.000	T
RABEP2	79874	genome.wustl.edu	37	16	28920007	28920007	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:28920007C>T	ENST00000358201.4	-	8	1756	c.1168G>A	c.(1168-1170)Gag>Aag	p.E390K	RABEP2_ENST00000357573.6_Missense_Mutation_p.E358K|RABEP2_ENST00000544477.1_Missense_Mutation_p.E319K	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	390					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						GGCAGCTGCTCGGCCCGGAGC	0.602																																					Pancreas(66;639 1284 10093 31061 49099)												0													96.0	104.0	101.0					16																	28920007		2010	4177	6187	SO:0001583	missense	0			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.1168G>A	16.37:g.28920007C>T	ENSP00000350934:p.Glu390Lys			Missense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.E390K	ENST00000358201.4	37	c.1168	CCDS42140.1	16	.	.	.	.	.	.	.	.	.	.	C	5.406	0.260126	0.10239	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.50277	0.75;0.75;0.75	4.78	3.75	0.43078	Rabaptin, GTPase-Rab5 binding (1);	0.734841	0.11882	N	0.520426	T	0.31040	0.0784	N	0.20530	0.585	0.27750	N	0.94418	P;P;B	0.44006	0.824;0.789;0.045	B;B;B	0.35413	0.202;0.128;0.02	T	0.17745	-1.0359	10	0.66056	D	0.02	-21.7569	11.7519	0.51853	0.0:0.8042:0.1958:0.0	.	319;358;390	B4DHR0;Q9H5N1-2;Q9H5N1	.;.;RABE2_HUMAN	K	390;358;319	ENSP00000350934:E390K;ENSP00000350186:E358K;ENSP00000442798:E319K	ENSP00000350186:E358K	E	-	1	0	RABEP2	28827508	0.852000	0.29690	0.995000	0.50966	0.820000	0.46376	1.421000	0.34815	2.210000	0.71456	0.462000	0.41574	GAG	RABEP2	-	pfam_Rabaptin_Rab5-bd_dom	ENSG00000177548		0.602	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	HGNC	protein_coding	OTTHUMT00000432691.1	-	0.00	84	0	C	NM_024816		28920007	-1	tier1	-	no_errors	ENST00000358201	ensembl	human	known	74_37	missense	32.31	44	21	SNP	0.792	T
RAD17	5884	genome.wustl.edu	37	5	68692375	68692376	+	Splice_Site	INS	-	-	AA	rs377737971|rs34097088|rs75928221		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:68692375_68692376insAA	ENST00000509734.1	+	15	2283		c.e15+2		RAD17_ENST00000305138.4_Splice_Site|RAD17_ENST00000282891.6_Splice_Site|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000521422.1_Splice_Site|RAD17_ENST00000354312.3_Splice_Site|RAD17_ENST00000354868.5_Splice_Site|RAD17_ENST00000358030.2_Splice_Site|RAD17_ENST00000361732.2_Splice_Site|RAD17_ENST00000345306.6_Splice_Site|RAD17_ENST00000380774.3_Splice_Site			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)						cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		AATAAAAAGGTAAAAAAAAAAA	0.322								Other conserved DNA damage response genes																																									0																																										SO:0001630	splice_region_variant	0			AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.1605+2->AA	5.37:g.68692384_68692385dupAA			A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Splice_Site	INS	-	e13+2	ENST00000509734.1	37	c.1605+2_1605+1	CCDS4003.1	5																																																																																			RAD17	-	-	ENSG00000152942		0.322	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RAD17	HGNC	protein_coding	OTTHUMT00000369171.1		0.00	18	0	-	NM_133344	Intron	68692376	+1	tier1		no_errors	ENST00000380774	ensembl	human	known	74_37	splice_site_ins	19.05	17	4	INS	1.000:0.992	AA
RASA1	5921	genome.wustl.edu	37	5	86658398	86658398	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:86658398G>T	ENST00000274376.6	+	10	1927	c.1363G>T	c.(1363-1365)Gat>Tat	p.D455Y	RASA1_ENST00000512763.1_Missense_Mutation_p.D288Y|RASA1_ENST00000456692.2_Missense_Mutation_p.D278Y|RASA1_ENST00000506290.1_Missense_Mutation_p.D289Y	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	455					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TGACACAGTGGATGGCAAGGA	0.294																																																	0													75.0	79.0	78.0					5																	86658398		2203	4297	6500	SO:0001583	missense	0				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1363G>T	5.37:g.86658398G>T	ENSP00000274376:p.Asp455Tyr		B2R6W3|Q9UDI1	Missense_Mutation	SNP	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.D455Y	ENST00000274376.6	37	c.1363	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626163	0.87560	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.74526	-0.84;-0.85;-0.85;-0.85	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.82783	0.5112	L	0.44542	1.39	0.80722	D	1	D;P;B;P;P	0.76494	0.999;0.718;0.25;0.775;0.557	D;B;B;B;B	0.77557	0.99;0.195;0.07;0.283;0.123	D	0.84078	0.0383	10	0.72032	D	0.01	.	19.2594	0.93961	0.0:0.0:1.0:0.0	.	289;288;289;278;455	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	Y	455;488;278;288;289	ENSP00000274376:D455Y;ENSP00000411221:D278Y;ENSP00000422008:D288Y;ENSP00000420905:D289Y	ENSP00000274376:D455Y	D	+	1	0	RASA1	86694154	1.000000	0.71417	0.997000	0.53966	0.756000	0.42949	9.721000	0.98766	2.614000	0.88457	0.455000	0.32223	GAT	RASA1	-	NULL	ENSG00000145715		0.294	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	HGNC	protein_coding	OTTHUMT00000369729.1	-	0.00	54	0	G	NM_002890		86658398	+1	tier1	-	no_errors	ENST00000274376	ensembl	human	known	74_37	missense	19.15	38	9	SNP	1.000	T
RANBP17	64901	genome.wustl.edu	37	5	170319525	170319525	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:170319525G>A	ENST00000523189.1	+	4	555	c.391G>A	c.(391-393)Gaa>Aaa	p.E131K		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	131					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGTCTTCAGAGAAATTATTGC	0.388			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	0													177.0	171.0	173.0					5																	170319525		2203	4300	6503	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.391G>A	5.37:g.170319525G>A	ENSP00000427975:p.Glu131Lys		Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.E131K	ENST00000523189.1	37	c.391	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443415	0.63067	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.70045	-0.45	5.78	5.78	0.91487	Armadillo-type fold (1);	0.287209	0.30219	N	0.010133	T	0.52058	0.1711	L	0.31476	0.935	0.40817	D	0.983471	B;B	0.19817	0.018;0.039	B;B	0.19148	0.017;0.024	T	0.47598	-0.9105	10	0.12430	T	0.62	-6.7573	12.9017	0.58128	0.0748:0.0:0.9252:0.0	.	131;181	Q9H2T7;B4DQG2	RBP17_HUMAN;.	K	131;49	ENSP00000427975:E131K	ENSP00000373770:E131K	E	+	1	0	RANBP17	170252103	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.238000	0.65366	2.726000	0.93360	0.561000	0.74099	GAA	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.388	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	-	0.00	40	0	G	NM_022897		170319525	+1	tier1	-	no_errors	ENST00000523189	ensembl	human	known	74_37	missense	30.30	46	20	SNP	1.000	A
RBBP7	5931	genome.wustl.edu	37	X	16887221	16887221	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrX:16887221G>A	ENST00000380087.2	-	2	499	c.139C>T	c.(139-141)Cag>Tag	p.Q47*	RBBP7_ENST00000380084.4_Nonsense_Mutation_p.Q91*|RBBP7_ENST00000404022.1_Nonsense_Mutation_p.Q47*			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	47					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					GGAAGCCACTGAACGGTAAGA	0.388																																																	0													112.0	98.0	103.0					X																	16887221		2203	4300	6503	SO:0001587	stop_gained	0			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.139C>T	X.37:g.16887221G>A	ENSP00000369427:p.Gln47*		Q5JP00	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q47*	ENST00000380087.2	37	c.139	CCDS14179.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.877102	0.98539	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000468092	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.1258	16.8394	0.85964	0.0:0.0:1.0:0.0	.	.	.	.	X	47;91;47;13	.	ENSP00000369424:Q91X	Q	-	1	0	RBBP7	16797142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.287000	0.76781	0.594000	0.82650	CAG	RBBP7	-	pfam_Histone-bd_RBBP4_N	ENSG00000102054		0.388	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	HGNC	protein_coding	OTTHUMT00000055920.2	-	0.00	32	0	G	NM_002893		16887221	-1	tier1	-	no_errors	ENST00000380087	ensembl	human	known	74_37	nonsense	77.78	8	28	SNP	1.000	A
RGS3	5998	genome.wustl.edu	37	9	116298982	116298982	+	Intron	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:116298982A>G	ENST00000374140.2	+	20	2123				RGS3_ENST00000350696.5_Intron|RGS3_ENST00000462143.1_5'UTR|RGS3_ENST00000374136.1_Intron|RGS3_ENST00000317613.6_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000343817.5_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CTGCAGCCTCACCCTCTGGAG	0.617																																																	0																																										SO:0001627	intron_variant	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.1915-94A>G	9.37:g.116298982A>G			A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	RNA	SNP	-	NULL	ENST00000374140.2	37	NULL	CCDS43869.1	9																																																																																			RGS3	-	-	ENSG00000138835		0.617	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	-	0.00	35	0	A	NM_017790		116298982	+1	tier1	-	no_errors	ENST00000492676	ensembl	human	known	74_37	rna	26.92	19	7	SNP	0.029	G
RHPN1	114822	genome.wustl.edu	37	8	144462882	144462882	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:144462882C>G	ENST00000289013.6	+	11	1441	c.1340C>G	c.(1339-1341)tCa>tGa	p.S447*		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	472	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTGCAGCGCTCACTGGCCAAG	0.682																																																	0													21.0	26.0	24.0					8																	144462882		2131	4241	6372	SO:0001587	stop_gained	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1340C>G	8.37:g.144462882C>G	ENSP00000289013:p.Ser447*		Q8TAV1|Q96PV9	Nonsense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.S447*	ENST00000289013.6	37	c.1340	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.423466	0.96111	.	.	ENSG00000158106	ENST00000289013	.	.	.	4.34	4.34	0.51931	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.5526	15.8385	0.78818	0.0:1.0:0.0:0.0	.	.	.	.	X	447	.	ENSP00000289013:S447X	S	+	2	0	RHPN1	144534025	1.000000	0.71417	0.854000	0.33618	0.039000	0.13416	7.289000	0.78701	1.965000	0.57142	0.313000	0.20887	TCA	RHPN1	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000158106		0.682	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	-	0.00	64	0	C			144462882	+1	tier1	-	no_errors	ENST00000289013	ensembl	human	known	74_37	nonsense	21.43	33	9	SNP	0.999	G
RICTOR	253260	genome.wustl.edu	37	5	38950435	38950435	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:38950435G>A	ENST00000357387.3	-	31	3545	c.3515C>T	c.(3514-3516)aCt>aTt	p.T1172I	RICTOR_ENST00000296782.5_Missense_Mutation_p.T1172I	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TGTACTACCAGTGTCTTCAAT	0.348																																																	0													160.0	169.0	166.0					5																	38950435		2203	4299	6502	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.3515C>T	5.37:g.38950435G>A	ENSP00000349959:p.Thr1172Ile			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T1172I	ENST00000357387.3	37	c.3515	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503954	0.44558	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.46063	0.88;0.88	5.75	5.75	0.90469	.	0.410597	0.31177	N	0.008109	T	0.40719	0.1128	L	0.40543	1.245	0.43471	D	0.995687	B;B	0.30281	0.13;0.275	B;B	0.29524	0.075;0.103	T	0.30621	-0.9972	10	0.87932	D	0	-4.2338	20.3046	0.98621	0.0:0.0:1.0:0.0	.	1172;1172	Q6R327;Q6R327-3	RICTR_HUMAN;.	I	1172	ENSP00000349959:T1172I;ENSP00000296782:T1172I	ENSP00000296782:T1172I	T	-	2	0	RICTOR	38986192	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.378000	0.44309	2.878000	0.98634	0.650000	0.86243	ACT	RICTOR	-	NULL	ENSG00000164327		0.348	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	-	0.00	37	0	G	NM_152756		38950435	-1	tier1	-	no_errors	ENST00000296782	ensembl	human	known	74_37	missense	7.69	96	8	SNP	1.000	A
ROCK2	9475	genome.wustl.edu	37	2	11332613	11332613	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:11332613T>C	ENST00000315872.6	-	31	4361	c.3913A>G	c.(3913-3915)Atg>Gtg	p.M1305V	ROCK2_ENST00000401753.1_Missense_Mutation_p.M1062V	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1305	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTTTTGTCCATATGATCTTTA	0.403																																																	0													99.0	93.0	95.0					2																	11332613		1868	4091	5959	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3913A>G	2.37:g.11332613T>C	ENSP00000317985:p.Met1305Val		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Rho-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.M1305V	ENST00000315872.6	37	c.3913	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	T	5.879	0.346346	0.11126	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.27256	1.68;1.68	5.52	3.05	0.35203	Protein kinase C-like, phorbol ester/diacylglycerol binding (2);Pleckstrin homology domain (3);	0.036926	0.85682	D	0.000000	T	0.10723	0.0262	N	0.08118	0	0.41553	D	0.988586	B	0.02656	0.0	B	0.06405	0.002	T	0.16012	-1.0417	10	0.09338	T	0.73	.	8.7562	0.34648	0.1273:0.0:0.1336:0.739	.	1305	O75116	ROCK2_HUMAN	V	1305;1062;663	ENSP00000317985:M1305V;ENSP00000385509:M1062V	ENSP00000317985:M1305V	M	-	1	0	ROCK2	11250064	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.180000	0.42537	0.351000	0.24027	0.482000	0.46254	ATG	ROCK2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000134318		0.403	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	-	0.00	53	0	T			11332613	-1	tier1	-	no_errors	ENST00000315872	ensembl	human	known	74_37	missense	19.44	58	14	SNP	1.000	C
RP1L1	94137	genome.wustl.edu	37	8	10464935	10464935	+	Missense_Mutation	SNP	G	G	A	rs575814754		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:10464935G>A	ENST00000382483.3	-	4	6896	c.6673C>T	c.(6673-6675)Cca>Tca	p.P2225S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2305	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ACGCCTTCTGGCTCTGGCTGG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		17396	0.001		0.0	False		,,,				2504	0.0																0													107.0	115.0	112.0					8																	10464935		1900	4106	6006	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6673C>T	8.37:g.10464935G>A	ENSP00000371923:p.Pro2225Ser		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.P2225S	ENST00000382483.3	37	c.6673	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.762636	0.00651	.	.	ENSG00000183638	ENST00000382483	T	0.06768	3.26	0.458	-0.916	0.10489	.	.	.	.	.	T	0.02929	0.0087	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45614	-0.9249	8	0.23302	T	0.38	.	.	.	.	.	2225	A6NKC6	.	S	2225	ENSP00000371923:P2225S	ENSP00000371923:P2225S	P	-	1	0	RP1L1	10502345	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.990000	0.03732	-0.455000	0.07054	-0.475000	0.04921	CCA	RP1L1	-	NULL	ENSG00000183638		0.602	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	72	0	G			10464935	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.001	A
RP1L1	94137	genome.wustl.edu	37	8	10464952	10464952	+	Missense_Mutation	SNP	T	T	C	rs544346924	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:10464952T>C	ENST00000382483.3	-	4	6879	c.6656A>G	c.(6655-6657)gAg>gGg	p.E2219G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2299	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGGGCCTCCTCTTCAGCCTC	0.617													T|||	2	0.000399361	0.0	0.0	5008	,	,		17118	0.001		0.001	False		,,,				2504	0.0																0													114.0	122.0	120.0					8																	10464952		1897	4102	5999	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6656A>G	8.37:g.10464952T>C	ENSP00000371923:p.Glu2219Gly		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.E2219G	ENST00000382483.3	37	c.6656	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	T	0.076	-1.191890	0.01607	.	.	ENSG00000183638	ENST00000382483	T	0.07688	3.17	2.42	-4.85	0.03142	.	.	.	.	.	T	0.02533	0.0077	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26326	-1.0106	9	0.24483	T	0.36	.	3.2653	0.06863	0.0982:0.4026:0.2533:0.2459	.	2219	A6NKC6	.	G	2219	ENSP00000371923:E2219G	ENSP00000371923:E2219G	E	-	2	0	RP1L1	10502362	0.019000	0.18553	0.000000	0.03702	0.020000	0.10135	1.073000	0.30691	-4.264000	0.00060	-1.831000	0.00592	GAG	RP1L1	-	NULL	ENSG00000183638		0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	80	0	T			10464952	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.000	C
RP1L1	94137	genome.wustl.edu	37	8	10464968	10464968	+	Missense_Mutation	SNP	C	C	T	rs532233178		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:10464968C>T	ENST00000382483.3	-	4	6863	c.6640G>A	c.(6640-6642)Gcc>Acc	p.A2214T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2294	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCCTCCGGGGCCTCTACACCT	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		16741	0.001		0.0	False		,,,				2504	0.0																0													124.0	136.0	132.0					8																	10464968		1895	4102	5997	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6640G>A	8.37:g.10464968C>T	ENSP00000371923:p.Ala2214Thr		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A2214T	ENST00000382483.3	37	c.6640	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	8.918	0.960434	0.18583	.	.	ENSG00000183638	ENST00000382483	T	0.08008	3.14	2.48	0.373	0.16178	.	.	.	.	.	T	0.03651	0.0104	N	0.17082	0.46	0.09310	N	1	B	0.26081	0.141	B	0.18263	0.021	T	0.45833	-0.9234	9	0.14656	T	0.56	-2.2868	2.1959	0.03911	0.1966:0.4899:0.1924:0.121	.	2214	A6NKC6	.	T	2214	ENSP00000371923:A2214T	ENSP00000371923:A2214T	A	-	1	0	RP1L1	10502378	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.162000	0.03141	-0.089000	0.12484	0.430000	0.28490	GCC	RP1L1	-	NULL	ENSG00000183638		0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	89	0	C			10464968	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.000	T
RP1L1	94137	genome.wustl.edu	37	8	10464975	10464975	+	Silent	SNP	A	A	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:10464975A>G	ENST00000382483.3	-	4	6856	c.6633T>C	c.(6631-6633)ggT>ggC	p.G2211G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2291	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGGCCTCTACACCTTCTAACT	0.627																																																	0													131.0	142.0	139.0					8																	10464975		1892	4101	5993	SO:0001819	synonymous_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6633T>C	8.37:g.10464975A>G			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.G2211	ENST00000382483.3	37	c.6633	CCDS43708.1	8																																																																																			RP1L1	-	NULL	ENSG00000183638		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	84	0	A			10464975	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	silent	18.97	46	11	SNP	0.000	G
RPS24	6229	genome.wustl.edu	37	10	79793751	79793751	+	Intron	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:79793751G>T	ENST00000372360.3	+	1	40				RPS24_ENST00000435275.1_Intron|RPS24_ENST00000440692.1_Intron|RPS24_ENST00000476545.1_Intron|RPS24_ENST00000360830.4_Intron	NM_001026.4	NP_001017.1	P62847	RS24_HUMAN	ribosomal protein S24						cellular protein metabolic process (GO:0044267)|erythrocyte homeostasis (GO:0034101)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|translation initiation factor binding (GO:0031369)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(2)|skin(1)	5	all_cancers(46;0.0343)|all_epithelial(25;0.000959)|Breast(12;0.00113)|Prostate(51;0.0095)		Epithelial(14;0.00128)|OV - Ovarian serous cystadenocarcinoma(4;0.00248)|all cancers(16;0.00428)			ATAGGCACGCGAAGCCCGGTT	0.642																																																	0													49.0	39.0	42.0					10																	79793751		692	1591	2283	SO:0001627	intron_variant	0			AB007159	CCDS7355.1, CCDS7356.1, CCDS44443.1	10q22	2011-04-06			ENSG00000138326	ENSG00000138326		"""S ribosomal proteins"""	10411	protein-coding gene	gene with protein product		602412				9027498, 9582194	Standard	NM_001142283		Approved	S24	uc001jzs.3	P62847	OTTHUMG00000018549	ENST00000372360.3:c.3+89G>T	10.37:g.79793751G>T			E7EPK6|P16632|Q5T0P7|Q5T0P8|Q7Z3D1	RNA	SNP	-	NULL	ENST00000372360.3	37	NULL	CCDS7355.1	10																																																																																			RPS24	-	-	ENSG00000138326		0.642	RPS24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS24	HGNC	protein_coding	OTTHUMT00000048910.1	-	0.00	37	0	G	NM_001026		79793751	+1	tier1	-	no_errors	ENST00000475468	ensembl	human	known	74_37	rna	87.50	2	14	SNP	0.000	T
RPS6KC1	26750	genome.wustl.edu	37	1	213414048	213414048	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:213414048G>A	ENST00000366960.3	+	11	1379	c.1229G>A	c.(1228-1230)gGc>gAc	p.G410D	RPS6KC1_ENST00000543354.1_Missense_Mutation_p.G113D|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.G398D|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Missense_Mutation_p.G198D	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	410	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TTCACAGGTGGCAAACTGTGG	0.313																																																	0													79.0	91.0	87.0					1																	213414048		2203	4300	6503	SO:0001583	missense	0			AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.1229G>A	1.37:g.213414048G>A	ENSP00000355927:p.Gly410Asp		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_MIT,pfam_Phox,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Phox,pfscan_Prot_kinase_dom	p.G410D	ENST00000366960.3	37	c.1229	CCDS1513.1	1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397548	0.62177	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.69655	0.3135	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75230	-0.3391	10	0.87932	D	0	-1.6401	20.0585	0.97663	0.0:0.0:1.0:0.0	.	198;410;398	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	D	198;410;398;113	ENSP00000442306:G198D;ENSP00000355927:G410D;ENSP00000355926:G398D;ENSP00000439282:G113D	ENSP00000355926:G398D	G	+	2	0	RPS6KC1	211480671	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	9.040000	0.93783	2.812000	0.96745	0.557000	0.71058	GGC	RPS6KC1	-	superfamily_Kinase-like_dom	ENSG00000136643		0.313	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	RPS6KC1	HGNC	protein_coding	OTTHUMT00000089690.3	-	0.00	30	0	G	NM_012424		213414048	+1	tier1	-	no_errors	ENST00000366960	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
SAFB	6294	genome.wustl.edu	37	19	5664432	5664432	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:5664432G>T	ENST00000292123.5	+	17	2423	c.2316G>T	c.(2314-2316)atG>atT	p.M772I	SAFB_ENST00000538656.1_Missense_Mutation_p.M614I|SAFB_ENST00000454510.1_Missense_Mutation_p.M703I|SAFB_ENST00000433404.1_Missense_Mutation_p.M602I|SAFB_ENST00000592224.1_Missense_Mutation_p.M771I|SAFB_ENST00000588852.1_Missense_Mutation_p.M772I	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	772	Arg-rich.|Interaction with POLR2A.|Interaction with SAFB2.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GGTCAATGATGGGAGAACGAG	0.478																																					Colon(88;338 1345 6184 8214 20897)												0													96.0	93.0	94.0					19																	5664432		2203	4300	6503	SO:0001583	missense	0			L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.2316G>T	19.37:g.5664432G>T	ENSP00000292123:p.Met772Ile		A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.M772I	ENST00000292123.5	37	c.2316	CCDS12142.1	19	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038637	0.55003	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.10382	2.9;3.06;2.9;2.88	5.04	5.04	0.67666	.	0.233245	0.30510	N	0.009467	T	0.32010	0.0815	M	0.70275	2.135	0.41978	D	0.990785	P;P;P;P;P;P;P	0.52577	0.915;0.924;0.954;0.924;0.924;0.924;0.924	P;P;D;P;P;P;P	0.66351	0.608;0.878;0.943;0.878;0.878;0.878;0.878	T	0.01874	-1.1256	10	0.56958	D	0.05	-22.8134	16.5634	0.84572	0.0:0.0:1.0:0.0	.	571;614;703;771;772;772;771	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	I	703;667;602;772;614	ENSP00000415895:M703I;ENSP00000404545:M602I;ENSP00000292123:M772I;ENSP00000438880:M614I	ENSP00000292123:M772I	M	+	3	0	SAFB	5615432	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.867000	0.63013	2.492000	0.84095	0.655000	0.94253	ATG	SAFB	-	NULL	ENSG00000160633		0.478	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SAFB	HGNC	protein_coding	OTTHUMT00000451641.2	-	0.00	83	0	G			5664432	+1	tier1	-	no_errors	ENST00000588852	ensembl	human	known	74_37	missense	13.04	40	6	SNP	1.000	T
SARS	6301	genome.wustl.edu	37	1	109779357	109779357	+	Intron	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:109779357C>G	ENST00000234677.2	+	9	1332				SARS_ENST00000369923.4_Intron|SARS_ENST00000468588.1_3'UTR	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase						gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	AGCTAGAAACCTGAATCTAGC	0.378																																																	0																																										SO:0001627	intron_variant	0			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.1257+187C>G	1.37:g.109779357C>G			B2R6Y9|Q5T5C8|Q9NSE3	RNA	SNP	-	NULL	ENST00000234677.2	37	NULL	CCDS795.1	1																																																																																			SARS	-	-	ENSG00000031698		0.378	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	-	0.00	81	0	C	NM_006513		109779357	+1	tier1	-	no_errors	ENST00000468588	ensembl	human	known	74_37	rna	14.89	80	14	SNP	0.002	G
SCN7A	6332	genome.wustl.edu	37	2	167262557	167262557	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:167262557C>A	ENST00000409855.1	-	25	4708	c.4582G>T	c.(4582-4584)Gat>Tat	p.D1528Y		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1528					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TGGGTCCTATCAGGATCAAAC	0.393																																																	0													54.0	55.0	54.0					2																	167262557		1873	4133	6006	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4582G>T	2.37:g.167262557C>A	ENSP00000386796:p.Asp1528Tyr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.D1528Y	ENST00000409855.1	37	c.4582	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180751	0.57800	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	T	0.15603	2.41	4.69	4.69	0.59074	.	0.310930	0.27072	N	0.021064	T	0.38931	0.1059	M	0.70595	2.14	0.37958	D	0.932876	D	0.71674	0.998	P	0.62740	0.906	T	0.41484	-0.9506	10	0.87932	D	0	.	15.4902	0.75600	0.0:1.0:0.0:0.0	.	1528	Q01118	SCN7A_HUMAN	Y	1528	ENSP00000386796:D1528Y	ENSP00000259060:D1528Y	D	-	1	0	SCN7A	166970803	0.577000	0.26708	0.997000	0.53966	0.995000	0.86356	2.079000	0.41577	2.612000	0.88384	0.650000	0.86243	GAT	SCN7A	-	NULL	ENSG00000136546		0.393	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	42	0	C			167262557	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	missense	47.06	27	24	SNP	0.997	A
SDCCAG8	10806	genome.wustl.edu	37	1	243652362	243652362	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:243652362G>T	ENST00000366541.3	+	17	2150	c.2032G>T	c.(2032-2034)Gtg>Ttg	p.V678L	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.V533L|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.V635L|AKT3_ENST00000336199.5_Intron	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	678	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CCAGCAGCTGGTGCAGCTCCT	0.587																																																	0													31.0	33.0	32.0					1																	243652362		2203	4300	6503	SO:0001583	missense	0			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.2032G>T	1.37:g.243652362G>T	ENSP00000355499:p.Val678Leu		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.V678L	ENST00000366541.3	37	c.2032	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265151	0.40095	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.44083	0.96;0.96;0.96;0.93	5.63	4.71	0.59529	.	0.564073	0.17325	N	0.178344	T	0.23133	0.0559	N	0.04508	-0.205	0.80722	D	1	B;B	0.13594	0.008;0.008	B;B	0.12156	0.007;0.007	T	0.04386	-1.0955	10	0.27082	T	0.32	-1.7893	13.7772	0.63062	0.0:0.1541:0.8459:0.0	.	635;678	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	L	635;678;533;379	ENSP00000348137:V635L;ENSP00000355499:V678L;ENSP00000341260:V533L;ENSP00000410200:V379L	ENSP00000341260:V533L	V	+	1	0	SDCCAG8	241718985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.157000	0.50716	1.340000	0.45581	0.650000	0.86243	GTG	SDCCAG8	-	NULL	ENSG00000054282		0.587	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1		0.00	69	0	G	NM_006642		243652362	+1			no_errors	ENST00000366541	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
SF3B3	23450	genome.wustl.edu	37	16	70604024	70604024	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:70604024G>A	ENST00000302516.5	+	24	3591	c.3380G>A	c.(3379-3381)gGc>gAc	p.G1127D		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1127					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GGAGGAATTGGCATCCTTGTG	0.517																																																	0													187.0	130.0	149.0					16																	70604024		2198	4300	6498	SO:0001583	missense	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3380G>A	16.37:g.70604024G>A	ENSP00000305790:p.Gly1127Asp		Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.G1127D	ENST00000302516.5	37	c.3380	CCDS10894.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.377678	0.95945	.	.	ENSG00000189091	ENST00000302516	T	0.57907	0.37	5.66	5.66	0.87406	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81621	0.4861	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86306	0.1683	10	0.87932	D	0	.	19.7566	0.96296	0.0:0.0:1.0:0.0	.	1127	Q15393	SF3B3_HUMAN	D	1127	ENSP00000305790:G1127D	ENSP00000305790:G1127D	G	+	2	0	SF3B3	69161525	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.768000	0.98965	2.671000	0.90904	0.563000	0.77884	GGC	SF3B3	-	pfam_Cleavage/polyA-sp_fac_asu_C	ENSG00000189091		0.517	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1		0.00	31	0	G	NM_012426		70604024	+1			no_errors	ENST00000302516	ensembl	human	known	74_37	missense	5.26	53	3	SNP	1.000	A
SGMS1	259230	genome.wustl.edu	37	10	52103376	52103376	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:52103376G>T	ENST00000361781.2	-	7	1458	c.499C>A	c.(499-501)Cct>Act	p.P167T	SGMS1_ENST00000429490.1_Intron|SGMS1_ENST00000361543.2_Missense_Mutation_p.P167T|SGMS1_ENST00000492601.2_5'Flank	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	173					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GGTAGTGGAGGCTGCACCTCC	0.458																																																	0													48.0	44.0	45.0					10																	52103376		2203	4300	6503	SO:0001583	missense	0			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.499C>A	10.37:g.52103376G>T	ENSP00000354829:p.Pro167Thr		Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.P167T	ENST00000361781.2	37	c.499	CCDS7240.1	10	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344174	0.61073	.	.	ENSG00000198964	ENST00000361781;ENST00000361543	T;T	0.58652	0.69;0.32	5.62	4.67	0.58626	.	0.100972	0.64402	D	0.000001	T	0.64757	0.2627	M	0.72894	2.215	0.51482	D	0.999923	D	0.56287	0.975	P	0.49597	0.616	T	0.70479	-0.4860	10	0.87932	D	0	-14.8506	13.8271	0.63357	0.0:0.2344:0.7655:0.0	.	173	Q86VZ5	SMS1_HUMAN	T	167	ENSP00000354829:P167T;ENSP00000355235:P167T	ENSP00000355235:P167T	P	-	1	0	SGMS1	51773382	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.117000	0.71577	2.648000	0.89879	0.650000	0.86243	CCT	SGMS1	-	NULL	ENSG00000198964		0.458	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2		0.00	42	0	G	NM_147156		52103376	-1			no_errors	ENST00000361781	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
SH3TC1	54436	genome.wustl.edu	37	4	8226903	8226903	+	Splice_Site	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:8226903C>G	ENST00000245105.3	+	11	1312	c.1245C>G	c.(1243-1245)gaC>gaG	p.D415E	SH3TC1_ENST00000514274.1_3'UTR|SH3TC1_ENST00000539824.1_Splice_Site_p.D339E	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	415										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						CCTTGCCAGACTCAGTAGAGG	0.562																																					NSCLC(145;2298 2623 35616 37297)												0													72.0	70.0	71.0					4																	8226903		2203	4300	6503	SO:0001630	splice_region_variant	0			AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.1244-1C>G	4.37:g.8226903C>G			Q4W5G5	Missense_Mutation	SNP	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.D415E	ENST00000245105.3	37	c.1245	CCDS3399.1	4	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729556	0.30684	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.47528	0.84;0.84	2.33	0.537	0.17144	.	0.336486	0.27720	N	0.018125	T	0.46964	0.1420	L	0.54323	1.7	0.09310	N	1	P	0.48640	0.913	P	0.52758	0.708	T	0.32508	-0.9904	10	0.49607	T	0.09	.	4.3599	0.11197	0.0:0.652:0.0:0.348	.	415	Q8TE82	S3TC1_HUMAN	E	153;415;339;244	ENSP00000245105:D415E;ENSP00000441045:D339E	ENSP00000245105:D415E	D	+	3	2	SH3TC1	8277803	0.255000	0.24002	0.031000	0.17742	0.014000	0.08584	0.192000	0.17096	0.116000	0.18110	0.462000	0.41574	GAC	SH3TC1	-	NULL	ENSG00000125089		0.562	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2	-	0.00	48	0	C	NM_018986	Missense_Mutation	8226903	+1	tier1	-	no_errors	ENST00000245105	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.031	G
SLC13A5	284111	genome.wustl.edu	37	17	6606342	6606342	+	Silent	SNP	G	G	A	rs373831482		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:6606342G>A	ENST00000433363.2	-	5	896	c.663C>T	c.(661-663)acC>acT	p.T221T	SLC13A5_ENST00000573648.1_Silent_p.T221T|SLC13A5_ENST00000381074.4_Silent_p.T178T|SLC13A5_ENST00000293800.6_Silent_p.T204T	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	221					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						TCAGGGTGGCGGTGCCCCCGA	0.637																																																	0								G	,	2,4404	4.2+/-10.8	0,2,2201	125.0	103.0	111.0		663,663	-10.9	0.0	17		111	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SLC13A5	NM_001143838.1,NM_177550.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	221/523,221/569	6606342	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.663C>T	17.37:g.6606342G>A			B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.T221	ENST00000433363.2	37	c.663	CCDS11079.1	17																																																																																			SLC13A5	-	pfam_Na/sul_symport	ENSG00000141485		0.637	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A5	HGNC	protein_coding	OTTHUMT00000219853.2	-	0.00	49	0	G	NM_177550		6606342	-1	tier1	-	no_errors	ENST00000433363	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.001	A
SLC2A7	155184	genome.wustl.edu	37	1	9064926	9064926	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:9064926G>T	ENST00000400906.1	-	11	1204	c.1205C>A	c.(1204-1206)tCg>tAg	p.S402*		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	402					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCTCACCACCGAGGGGACAGG	0.662																																																	0													43.0	36.0	38.0					1																	9064926		2203	4300	6503	SO:0001587	stop_gained	0			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1205C>A	1.37:g.9064926G>T	ENSP00000383698:p.Ser402*		A2A333	Nonsense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.S402*	ENST00000400906.1	37	c.1205	CCDS98.2	1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611133	0.66558	.	.	ENSG00000197241	ENST00000400906	.	.	.	4.45	4.45	0.53987	.	0.331224	0.29473	N	0.012053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	7.1008	0.25336	0.0907:0.0:0.7379:0.1714	.	.	.	.	X	402	.	ENSP00000383698:S402X	S	-	2	0	SLC2A7	8987513	0.329000	0.24696	0.829000	0.32907	0.443000	0.32047	1.453000	0.35167	2.307000	0.77673	0.561000	0.74099	TCG	SLC2A7	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000197241		0.662	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	HGNC	protein_coding	OTTHUMT00000127768.3		0.00	69	0	G	NM_207420		9064926	-1			no_errors	ENST00000400906	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.344	T
SLC38A10	124565	genome.wustl.edu	37	17	79226049	79226049	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:79226049G>T	ENST00000374759.3	-	13	2274	c.1891C>A	c.(1891-1893)Ccg>Acg	p.P631T	SLC38A10_ENST00000288439.5_Missense_Mutation_p.P631T	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	631					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TTGCCTGGCGGCGGTCCCCCC	0.706																																																	0													29.0	36.0	34.0					17																	79226049		2193	4277	6470	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1891C>A	17.37:g.79226049G>T	ENSP00000363891:p.Pro631Thr		Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.P631T	ENST00000374759.3	37	c.1891	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	G	3.606	-0.080500	0.07141	.	.	ENSG00000157637	ENST00000374759;ENST00000540966;ENST00000288439	T;T;T	0.44083	3.14;0.93;2.98	2.39	0.00687	0.14068	.	2580.400000	0.00166	N	0.000000	T	0.26085	0.0636	N	0.22421	0.69	0.09310	N	1	P;B	0.35982	0.531;0.41	B;B	0.32864	0.154;0.071	T	0.11867	-1.0570	10	0.12430	T	0.62	.	5.8407	0.18633	0.453:0.0:0.547:0.0	.	631;631	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	T	631;9;631	ENSP00000363891:P631T;ENSP00000437601:P9T;ENSP00000288439:P631T	ENSP00000288439:P631T	P	-	1	0	SLC38A10	76840644	0.001000	0.12720	0.002000	0.10522	0.029000	0.11900	0.946000	0.29069	0.214000	0.20742	0.282000	0.19409	CCG	SLC38A10	-	NULL	ENSG00000157637		0.706	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	-	0.00	77	0	G	NM_138570		79226049	-1	tier1	-	no_errors	ENST00000374759	ensembl	human	known	74_37	missense	5.88	80	5	SNP	0.001	T
SLC38A8	146167	genome.wustl.edu	37	16	84075670	84075670	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:84075670G>T	ENST00000299709.3	-	1	92	c.93C>A	c.(91-93)ttC>ttA	p.F31L	RNA5SP432_ENST00000362480.1_RNA	NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	31					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TCATGAGGATGAAGACAGCGC	0.632																																																	0													92.0	102.0	99.0					16																	84075670		2200	4300	6500	SO:0001583	missense	0				CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.93C>A	16.37:g.84075670G>T	ENSP00000299709:p.Phe31Leu			Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.F31L	ENST00000299709.3	37	c.93	CCDS32495.1	16	.	.	.	.	.	.	.	.	.	.	G	16.20	3.054633	0.55218	.	.	ENSG00000166558	ENST00000299709	T	0.02085	4.46	5.01	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.12433	0.0302	M	0.85542	2.76	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.00673	-1.1616	10	0.59425	D	0.04	-2.1982	11.2546	0.49045	0.1504:0.0:0.8496:0.0	.	31	A6NNN8	S38A8_HUMAN	L	31	ENSP00000299709:F31L	ENSP00000299709:F31L	F	-	3	2	SLC38A8	82633171	1.000000	0.71417	0.921000	0.36526	0.041000	0.13682	2.951000	0.49089	1.110000	0.41699	0.650000	0.86243	TTC	SLC38A8	-	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	ENSG00000166558		0.632	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	HGNC	protein_coding	OTTHUMT00000432623.1	-	0.00	54	0	G	NM_001080442		84075670	-1	tier1	-	no_errors	ENST00000299709	ensembl	human	known	74_37	missense	79.25	22	84	SNP	1.000	T
SLC44A3	126969	genome.wustl.edu	37	1	95293099	95293099	+	Silent	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:95293099C>G	ENST00000271227.6	+	4	417	c.315C>G	c.(313-315)gtC>gtG	p.V105V	SLC44A3_ENST00000527077.1_Silent_p.V69V|SLC44A3_ENST00000529450.1_Silent_p.V105V|SLC44A3_ENST00000467909.1_Silent_p.V57V|SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000532427.1_Silent_p.V57V|SLC44A3_ENST00000446120.2_Silent_p.V69V	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	105					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	ACCTGGAAGTCAAAGGTACGC	0.473																																																	0													155.0	145.0	148.0					1																	95293099		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.315C>G	1.37:g.95293099C>G			B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	pfam_Choline_transptr-like	p.V105	ENST00000271227.6	37	c.315	CCDS44176.1	1																																																																																			SLC44A3	-	NULL	ENSG00000143036		0.473	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A3	HGNC	protein_coding	OTTHUMT00000029544.3	-	0.00	37	0	C	NM_152369		95293099	+1	tier1	-	no_errors	ENST00000271227	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.107	G
SLC7A11	23657	genome.wustl.edu	37	4	139100537	139100537	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:139100537G>A	ENST00000280612.5	-	11	1557	c.1278C>T	c.(1276-1278)ttC>ttT	p.F426F	SLC7A11-AS1_ENST00000510767.1_RNA	NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	426					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	AAGCTGGGATGAACAGTGGCA	0.458																																																	0													92.0	85.0	88.0					4																	139100537		2203	4300	6503	SO:0001819	synonymous_variant	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.1278C>T	4.37:g.139100537G>A			A8K2U4	Silent	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_transpt_TM,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.F426	ENST00000280612.5	37	c.1278	CCDS3742.1	4																																																																																			SLC7A11	-	pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000151012		0.458	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11	HGNC	protein_coding	OTTHUMT00000257251.2		0.00	17	0	G			139100537	-1			no_errors	ENST00000280612	ensembl	human	known	74_37	silent	40.00	6	4	SNP	1.000	A
SLITRK6	84189	genome.wustl.edu	37	13	86369470	86369470	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:86369470G>C	ENST00000400286.2	-	2	1772	c.1174C>G	c.(1174-1176)Ctt>Gtt	p.L392V		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	392					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CCCAAGTGAAGCATTTCCAAA	0.373																																																	0													72.0	67.0	68.0					13																	86369470		1846	4090	5936	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1174C>G	13.37:g.86369470G>C	ENSP00000383143:p.Leu392Val		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L392V	ENST00000400286.2	37	c.1174	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010166	0.54361	.	.	ENSG00000184564	ENST00000400286	T	0.79033	-1.23	5.76	5.76	0.90799	.	0.000000	0.64402	U	0.000011	D	0.88662	0.6497	M	0.79614	2.46	0.53688	D	0.999972	D	0.89917	1.0	D	0.87578	0.998	D	0.89063	0.3464	10	0.66056	D	0.02	-11.36	18.5388	0.91020	0.0:0.0:1.0:0.0	.	392	Q9H5Y7	SLIK6_HUMAN	V	392	ENSP00000383143:L392V	ENSP00000383143:L392V	L	-	1	0	SLITRK6	85267471	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.869000	0.99810	2.724000	0.93272	0.585000	0.79938	CTT	SLITRK6	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000184564		0.373	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	-	0.00	64	0	G	NM_032229		86369470	-1	tier1	-	no_errors	ENST00000400286	ensembl	human	known	74_37	missense	26.58	58	21	SNP	1.000	C
SMC5	23137	genome.wustl.edu	37	9	72929739	72929739	+	Missense_Mutation	SNP	T	T	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:72929739T>G	ENST00000361138.5	+	12	1718	c.1660T>G	c.(1660-1662)Ttg>Gtg	p.L554V		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	554	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TTCAAGATCTTTGAATGAACT	0.274																																																	0													45.0	47.0	46.0					9																	72929739		2199	4292	6491	SO:0001583	missense	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1660T>G	9.37:g.72929739T>G	ENSP00000354957:p.Leu554Val		A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	p.L554V	ENST00000361138.5	37	c.1660	CCDS6632.1	9	.	.	.	.	.	.	.	.	.	.	T	13.53	2.264168	0.39995	.	.	ENSG00000198887	ENST00000361138	T	0.17054	2.3	5.0	2.78	0.32641	RecF/RecN/SMC (1);	0.082188	0.49305	D	0.000159	T	0.11537	0.0281	L	0.40543	1.245	0.31532	N	0.661054	P	0.45531	0.86	B	0.43052	0.406	T	0.13019	-1.0525	10	0.12430	T	0.62	-7.8787	3.5319	0.07779	0.2795:0.4782:0.0:0.2422	.	554	Q8IY18	SMC5_HUMAN	V	554	ENSP00000354957:L554V	ENSP00000354957:L554V	L	+	1	2	SMC5	72119559	1.000000	0.71417	0.985000	0.45067	0.758000	0.43043	1.432000	0.34936	0.284000	0.22305	-0.334000	0.08254	TTG	SMC5	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000198887		0.274	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	-	0.00	90	0	T	NM_015110		72929739	+1	tier1	-	no_errors	ENST00000361138	ensembl	human	known	74_37	missense	32.98	63	31	SNP	0.996	G
SMCR8	140775	genome.wustl.edu	37	17	18219700	18219701	+	Nonsense_Mutation	DNP	GA	GA	AT			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:18219700_18219701GA>AT	ENST00000406438.3	+	1	1077_1078	c.597_598GA>AT	c.(595-600)ctGAaa>ctATaa	p.K200*	TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	200						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						AAAAAAAGCTGAAAGACTTGGA	0.465																																																	0																																										SO:0001587	stop_gained	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	Exception_encountered	17.37:g.18219700_18219701delinsAT	ENSP00000385025:p.Lys200*		A5PKZ5|Q3ZCN0|Q6PJL3	Silent|Nonsense_Mutation	SNP	pfam_Folliculin	p.L199|p.K200*	ENST00000406438.3	37	c.597|c.598	CCDS11195.2	17																																																																																			SMCR8	-	pfam_Folliculin	ENSG00000176994		0.465	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2		0.00	29	0	G|A	NM_144775		18219700|18219701	+1			no_errors	ENST00000406438	ensembl	human	known	74_37	silent|nonsense	10.00|9.68	27|28	3	SNP	0.983|0.998	A|T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965435	18965435	+	lincRNA	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:18965435G>A	ENST00000363359.1	+	0	211				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		aacgcggtctgagtggtTTTT	0.547																																																	0													46.0	21.0	30.0					17																	18965435		864	1705	2569			0			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965435G>A				RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			SNORD3B-1	-	-	ENSG00000265185		0.547	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	HGNC	lincRNA		-	0.00	30	0	G	NR_003271		18965435	+1	tier1	-	no_errors	ENST00000363359	ensembl	human	known	74_37	rna	34.62	17	9	SNP	0.092	A
SOX1	6656	genome.wustl.edu	37	13	112722275	112722275	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:112722275C>G	ENST00000330949.1	+	1	363	c.303C>G	c.(301-303)atC>atG	p.I101M		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	101					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		GGCCGTTCATCGACGAGGCCA	0.627																																																	0													41.0	45.0	44.0					13																	112722275		2203	4300	6503	SO:0001583	missense	0				CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.303C>G	13.37:g.112722275C>G	ENSP00000330218:p.Ile101Met		Q5W0Q1	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I101M	ENST00000330949.1	37	c.303	CCDS9523.1	13	.	.	.	.	.	.	.	.	.	.	c	16.31	3.087744	0.55968	.	.	ENSG00000182968	ENST00000330949	D	0.98075	-4.7	3.47	2.62	0.31277	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.98232	0.9415	M	0.84219	2.685	0.50467	D	0.99987	D	0.89917	1.0	D	0.87578	0.998	D	0.97628	1.0140	10	0.87932	D	0	.	6.8474	0.23996	0.0:0.7737:0.0:0.2263	.	101	O00570	SOX1_HUMAN	M	101	ENSP00000330218:I101M	ENSP00000330218:I101M	I	+	3	3	SOX1	111770276	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.799000	0.38824	0.675000	0.31264	0.450000	0.29827	ATC	SOX1	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000182968		0.627	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	HGNC	protein_coding	OTTHUMT00000045817.3	-	0.00	93	0	C	NM_005986		112722275	+1	tier1	-	no_errors	ENST00000330949	ensembl	human	known	74_37	missense	75.00	12	36	SNP	1.000	G
SPATA31D5P	347127	genome.wustl.edu	37	9	84531499	84531499	+	RNA	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr9:84531499G>C	ENST00000527857.1	+	0	1521					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		TAAGTGTTTTGAGGACCATTT	0.473																																																	0																																												0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84531499G>C				RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			SPATA31D5P	-	-	ENSG00000240632		0.473	SPATA31D5P-002	KNOWN	basic	processed_transcript	SPATA31D5P	HGNC	pseudogene	OTTHUMT00000052810.2	-	0.00	100	0	G	NR_026851		84531499	+1	tier1	-	no_errors	ENST00000527857	ensembl	human	known	74_37	rna	12.82	68	10	SNP	0.000	C
SPEF2	79925	genome.wustl.edu	37	5	35628627	35628627	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:35628627G>A	ENST00000356031.3	+	2	278	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	SPEF2_ENST00000282469.6_Missense_Mutation_p.E42K|SPEF2_ENST00000440995.2_Missense_Mutation_p.E42K|SPEF2_ENST00000509059.1_Missense_Mutation_p.E42K	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	42	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACACAAGTTTGAACTTCAGGA	0.348																																																	0													142.0	140.0	141.0					5																	35628627		2203	4300	6503	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.124G>A	5.37:g.35628627G>A	ENSP00000348314:p.Glu42Lys		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.E42K	ENST00000356031.3	37	c.124	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270816	0.80469	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	5.64	5.64	0.86602	Calponin homology domain (1);	0.292353	0.32068	N	0.006628	T	0.37293	0.0998	L	0.54323	1.7	0.80722	D	1	D;P;P	0.56746	0.977;0.939;0.617	P;P;B	0.51453	0.67;0.67;0.124	T	0.03684	-1.1013	10	0.46703	T	0.11	.	16.4177	0.83748	0.0:0.0:1.0:0.0	.	42;42;42	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	K	42	ENSP00000282469:E42K;ENSP00000348314:E42K;ENSP00000421593:E42K;ENSP00000426259:E42K;ENSP00000412125:E42K	ENSP00000282469:E42K	E	+	1	0	SPEF2	35664384	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.900000	0.48687	2.658000	0.90341	0.655000	0.94253	GAA	SPEF2	-	pfam_DUF1042,superfamily_CH-domain,pfscan_CH-domain	ENSG00000152582		0.348	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	69	0	G	NM_144722		35628627	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	61.98	46	75	SNP	1.000	A
SPIDR	23514	genome.wustl.edu	37	8	48566668	48566668	+	Intron	SNP	G	G	T	rs534013819		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:48566668G>T	ENST00000297423.4	+	11	1928				SPIDR_ENST00000518074.1_Intron|SPIDR_ENST00000521214.1_Intron|SPIDR_ENST00000541342.1_Intron	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair						cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TGTACCAAGAGGCATGCAGGA	0.512																																																	0																																										SO:0001627	intron_variant	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1545-19695G>T	8.37:g.48566668G>T			B4DFV2|B4E0Y6|Q96BI5	RNA	SNP	-	NULL	ENST00000297423.4	37	NULL	CCDS43737.1	8	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645559	0.29246	.	.	ENSG00000164808	ENST00000519141	.	.	.	2.75	-0.123	0.13527	.	.	.	.	.	T	0.29817	0.0745	.	.	.	0.09310	N	1	D	0.57257	0.979	B	0.43950	0.437	T	0.18178	-1.0345	7	0.72032	D	0.01	.	5.4719	0.16674	0.4116:0.0:0.5884:0.0	.	6	B4DWT8	.	C	6	.	ENSP00000429303:G6C	G	+	1	0	KIAA0146	48729221	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.340000	0.19892	-0.051000	0.13334	-0.444000	0.05651	GGC	SPIDR	-	-	ENSG00000164808		0.512	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIDR	HGNC	protein_coding	OTTHUMT00000377611.1	-	0.00	27	0	G	NM_001080394		48566668	+1	tier1	-	no_errors	ENST00000519141	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.000	T
SRGAP3	9901	genome.wustl.edu	37	3	9097938	9097938	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:9097938G>T	ENST00000383836.3	-	8	1531	c.1104C>A	c.(1102-1104)acC>acA	p.T368T	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Silent_p.T368T	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	368	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CTATCTTGAGGGTGGCCAGTC	0.567			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													92.0	90.0	91.0					3																	9097938		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1104C>A	3.37:g.9097938G>T			Q8IX13|Q8IZV8	Silent	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.T368	ENST00000383836.3	37	c.1104	CCDS2572.1	3																																																																																			SRGAP3	-	NULL	ENSG00000196220		0.567	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3		0.00	41	0	G			9097938	-1			no_errors	ENST00000383836	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.767	T
STARD13	90627	genome.wustl.edu	37	13	33700299	33700299	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:33700299G>T	ENST00000336934.5	-	7	2117	c.2001C>A	c.(1999-2001)gtC>gtA	p.V667V	STARD13_ENST00000399365.3_Silent_p.V549V|STARD13_ENST00000255486.4_Silent_p.V659V	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	667	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TTTGGACGTGGACTATGAGAG	0.498																																																	0													191.0	167.0	175.0					13																	33700299		2203	4300	6503	SO:0001819	synonymous_variant	0			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2001C>A	13.37:g.33700299G>T			A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.V667	ENST00000336934.5	37	c.2001	CCDS9348.1	13																																																																																			STARD13	-	pfscan_RhoGAP_dom	ENSG00000133121		0.498	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	-	0.00	48	0	G	NM_001243466		33700299	-1	tier1	-	no_errors	ENST00000336934	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
STIM2	57620	genome.wustl.edu	37	4	27004677	27004677	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:27004677C>T	ENST00000467011.1	+	7	1357	c.932C>T	c.(931-933)gCt>gTt	p.A311V	STIM2_ENST00000237364.5_Missense_Mutation_p.A398V|STIM2_ENST00000382009.3_Missense_Mutation_p.A398V|STIM2_ENST00000465503.1_Missense_Mutation_p.A311V|STIM2_ENST00000412829.2_Missense_Mutation_p.A398V|STIM2_ENST00000467087.1_Missense_Mutation_p.A311V	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	311					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AGGGAGGGAGCTGAATGTGAA	0.383																																																	0													115.0	115.0	115.0					4																	27004677		2203	4300	6503	SO:0001583	missense	0			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.932C>T	4.37:g.27004677C>T	ENSP00000419383:p.Ala311Val		A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.A398V	ENST00000467011.1	37	c.1193	CCDS54752.1	4	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775716	0.90195	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503;ENST00000473519	T;T;T;T;T;T;T	0.80393	-1.23;-1.24;-1.25;-1.23;-1.24;-1.22;-1.37	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.87822	0.6274	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.997;0.998	D;D;D;D	0.80764	0.994;0.985;0.985;0.994	T	0.83210	-0.0074	10	0.21540	T	0.41	.	20.1467	0.98079	0.0:1.0:0.0:0.0	.	311;398;398;398	Q9P246;A6H8L7;E9PGD0;F5GXJ4	STIM2_HUMAN;.;.;.	V	311;398;398;311;398;311;19	ENSP00000419073:A311V;ENSP00000371439:A398V;ENSP00000237364:A398V;ENSP00000419383:A311V;ENSP00000404812:A398V;ENSP00000417569:A311V;ENSP00000420113:A19V	ENSP00000237364:A398V	A	+	2	0	STIM2	26613775	1.000000	0.71417	0.895000	0.35142	0.992000	0.81027	7.445000	0.80570	2.838000	0.97847	0.655000	0.94253	GCT	STIM2	-	NULL	ENSG00000109689		0.383	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	HGNC	protein_coding	OTTHUMT00000356861.1	-	0.00	32	0	C	NM_020860		27004677	+1	tier1	-	no_errors	ENST00000382009	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
STMND1	401236	genome.wustl.edu	37	6	17102499	17102499	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:17102499G>A	ENST00000536551.1	+	1	11	c.11G>A	c.(10-12)gGa>gAa	p.G4E		NM_001190766.1	NP_001177695.1	H3BQB6	STMD1_HUMAN	stathmin domain containing 1	4					regulation of microtubule polymerization or depolymerization (GO:0031110)												ATGGGCTGTGGACCTTCCCAA	0.642																																																	0																																										SO:0001583	missense	0			AK026805	CCDS58997.1	6p22.3	2012-12-11			ENSG00000230873	ENSG00000230873			44668	protein-coding gene	gene with protein product							Standard	NM_001190766		Approved	FLJ23152	uc021ymc.1	H3BQB6	OTTHUMG00000014304	ENST00000536551.1:c.11G>A	6.37:g.17102499G>A	ENSP00000455698:p.Gly4Glu			Missense_Mutation	SNP	pfam_Stathmin_fam,superfamily_Stathmin_fam	p.G4E	ENST00000536551.1	37	c.11	CCDS58997.1	6																																																																																			STMND1	-	NULL	ENSG00000230873		0.642	STMND1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STMND1	HGNC	protein_coding		-	0.00	61	0	G	NM_001190766		17102499	+1	tier1	-	no_errors	ENST00000536551	ensembl	human	known	74_37	missense	8.99	81	8	SNP	0.982	A
STPG1	90529	genome.wustl.edu	37	1	24710455	24710455	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:24710455G>T	ENST00000374409.1	-	4	482	c.228C>A	c.(226-228)caC>caA	p.H76Q	STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000003583.8_Missense_Mutation_p.H29Q|STPG1_ENST00000440416.1_Missense_Mutation_p.H29Q|STPG1_ENST00000337248.4_Missense_Mutation_p.H76Q	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	76					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCGGTGACTGGTGAATAACAT	0.443																																																	0													185.0	172.0	176.0					1																	24710455		2203	4300	6503	SO:0001583	missense	0			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.228C>A	1.37:g.24710455G>T	ENSP00000363530:p.His76Gln		Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	NULL	p.H76Q	ENST00000374409.1	37	c.228	CCDS55581.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.97|18.97	3.735066|3.735066	0.69189|0.69189	.|.	.|.	ENSG00000001460|ENSG00000001460	ENST00000374409;ENST00000440416;ENST00000003583;ENST00000337248;ENST00000437986|ENST00000435187	.|.	.|.	.|.	6.03|6.03	2.76|2.76	0.32466|0.32466	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59266|0.59266	0.2181|0.2181	L|L	0.56769|0.56769	1.78|1.78	0.38755|0.38755	D|D	0.95419|0.95419	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.87578|.	0.998;0.997|.	T|T	0.58317|0.58317	-0.7657|-0.7657	9|5	0.38643|.	T|.	0.18|.	-4.9828|-4.9828	8.4297|8.4297	0.32750|0.32750	0.2743:0.0:0.7257:0.0|0.2743:0.0:0.7257:0.0	.|.	76;29|.	Q5TH74;Q5TH74-3|.	CA201_HUMAN;.|.	Q|N	76;29;29;76;76|53	.|.	ENSP00000003583:H29Q|.	H|T	-|-	3|2	2|0	C1orf201|C1orf201	24583042|24583042	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	1.302000|1.302000	0.33459|0.33459	0.896000|0.896000	0.36366|0.36366	0.655000|0.655000	0.94253|0.94253	CAC|ACC	STPG1	-	NULL	ENSG00000001460		0.443	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STPG1	HGNC	protein_coding	OTTHUMT00000009172.1	-	0.00	58	0	G	NM_178122		24710455	-1	tier1	-	no_errors	ENST00000337248	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27002024	27002024	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:27002024G>A	ENST00000314616.6	+	5	665	c.382G>A	c.(382-384)Gag>Aag	p.E128K	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_Missense_Mutation_p.E128K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	128	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GTCAGATGACGAGGACGATGA	0.498																																																	0													84.0	78.0	80.0					17																	27002024		2203	4300	6503	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.382G>A	17.37:g.27002024G>A	ENSP00000319104:p.Glu128Lys		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.E128K	ENST00000314616.6	37	c.382	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718906	0.68844	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.41	5.41	0.78517	.	0.098602	0.64402	D	0.000002	T	0.54870	0.1885	M	0.75615	2.305	0.58432	D	0.999993	P	0.43352	0.804	B	0.26770	0.073	T	0.64935	-0.6290	9	0.49607	T	0.09	-16.8028	19.558	0.95361	0.0:0.0:1.0:0.0	.	128	Q7KZ85	SPT6H_HUMAN	K	128	.	ENSP00000319104:E128K	E	+	1	0	SUPT6H	24026151	1.000000	0.71417	0.994000	0.49952	0.573000	0.36030	8.702000	0.91338	2.697000	0.92050	0.655000	0.94253	GAG	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	48	0	G	NM_003170		27002024	+1	tier1	-	no_errors	ENST00000314616	ensembl	human	known	74_37	missense	21.21	51	14	SNP	1.000	A
TAF4	6874	genome.wustl.edu	37	20	60639546	60639546	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:60639546G>C	ENST00000252996.4	-	1	1320	c.1321C>G	c.(1321-1323)Cag>Gag	p.Q441E	hsa-mir-3195_ENST00000585001.1_RNA	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	441					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GTCGGGTTCTGAGGCGGCTGC	0.721																																																	0													6.0	8.0	7.0					20																	60639546		2105	4195	6300	SO:0001583	missense	0			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1321C>G	20.37:g.60639546G>C	ENSP00000252996:p.Gln441Glu		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.Q441E	ENST00000252996.4	37	c.1321	CCDS33500.1	20	.	.	.	.	.	.	.	.	.	.	g	15.18	2.757680	0.49468	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.34667	1.35;1.35	2.75	2.75	0.32379	.	0.651994	0.13882	U	0.356250	T	0.30885	0.0779	L	0.46157	1.445	0.38666	D	0.952181	P	0.48764	0.915	B	0.44108	0.441	T	0.19582	-1.0301	10	0.05833	T	0.94	.	13.4609	0.61227	0.0:0.0:1.0:0.0	.	441	O00268	TAF4_HUMAN	E	441;305	ENSP00000252996:Q441E;ENSP00000399091:Q305E	ENSP00000252996:Q441E	Q	-	1	0	TAF4	60072941	1.000000	0.71417	0.996000	0.52242	0.735000	0.41995	7.906000	0.87423	1.104000	0.41587	0.177000	0.17058	CAG	TAF4	-	NULL	ENSG00000130699		0.721	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	-	0.00	22	0	G	NM_003185		60639546	-1	tier1	-	no_errors	ENST00000252996	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	C
PSMB8	5696	genome.wustl.edu	37	6	32812357	32812357	+	5'Flank	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:32812357G>T	ENST00000374882.3	-	0	0				PSMB8_ENST00000395339.3_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374881.2_De_novo_Start_OutOfFrame|PSMB9_ENST00000395330.1_Intron	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	GGCCCCTCCAGGTTCAACGGT	0.612																																					NSCLC(48;53 1172 10859 13624 22883)												0																																										SO:0001631	upstream_gene_variant	0				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285		6.37:g.32812357G>T	Exception_encountered		B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	RNA	SNP	-	NULL	ENST00000374882.3	37	NULL	CCDS4757.1	6																																																																																			TAPSAR1	-	-	ENSG00000204261		0.612	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPSAR1	HGNC	protein_coding	OTTHUMT00000076617.3	-	0.00	24	0	G	NM_148919		32812357	+1	tier1	-	no_errors	ENST00000412095	ensembl	human	known	74_37	rna	50.00	11	11	SNP	0.000	T
TARS	6897	genome.wustl.edu	37	5	33467748	33467748	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:33467748G>A	ENST00000265112.3	+	19	2418	c.2107G>A	c.(2107-2109)Gaa>Aaa	p.E703K	TARS_ENST00000414361.2_Missense_Mutation_p.E582K|TARS_ENST00000455217.2_Missense_Mutation_p.E736K|TARS_ENST00000541634.1_Missense_Mutation_p.E599K|TARS_ENST00000502553.1_Missense_Mutation_p.E703K	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	703					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CACCATTTCTGAAACTATCGA	0.423																																																	0													59.0	60.0	60.0					5																	33467748		2203	4300	6503	SO:0001583	missense	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.2107G>A	5.37:g.33467748G>A	ENSP00000265112:p.Glu703Lys		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.E703K	ENST00000265112.3	37	c.2107	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	g	17.68	3.449687	0.63290	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.2	5.2	0.72013	Anticodon-binding (3);	0.099164	0.64402	D	0.000002	D	0.84334	0.5449	L	0.56124	1.755	0.80722	D	1	B;B;B;B	0.15719	0.014;0.009;0.0;0.005	B;B;B;B	0.27715	0.082;0.023;0.003;0.023	T	0.79916	-0.1601	10	0.36615	T	0.2	-30.3193	18.7427	0.91780	0.0:0.0:1.0:0.0	.	582;736;599;703	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	K	703;703;599;736;582	ENSP00000424387:E703K;ENSP00000265112:E703K;ENSP00000438469:E599K;ENSP00000387710:E736K;ENSP00000394291:E582K	ENSP00000265112:E703K	E	+	1	0	TARS	33503505	1.000000	0.71417	0.795000	0.32087	0.433000	0.31745	6.561000	0.73955	2.418000	0.82041	0.557000	0.71058	GAA	TARS	-	pfam_Anticodon-bd,superfamily_Anticodon-bd,tigrfam_Thr-tRNA-ligase_IIa	ENSG00000113407		0.423	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	-	0.00	54	0	G	NM_152295		33467748	+1	tier1	-	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	12.75	89	13	SNP	1.000	A
TCEA2	6919	genome.wustl.edu	37	20	62697888	62697888	+	Silent	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr20:62697888C>G	ENST00000343484.5	+	2	301	c.132C>G	c.(130-132)ctC>ctG	p.L44L	TCEA2_ENST00000395053.3_Silent_p.L44L|TCEA2_ENST00000361317.2_Silent_p.L17L|TCEA2_ENST00000465111.1_3'UTR	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	44	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					TGCACCTGCTCCAGGTAGGTC	0.622																																																	0													72.0	69.0	70.0					20																	62697888		2203	4300	6503	SO:0001819	synonymous_variant	0			U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.132C>G	20.37:g.62697888C>G			B3KNM1|Q8TD37|Q8TD38	Silent	SNP	pfam_TFIIS_cen_dom,pfam_TFIIS_N,pfam_Znf_TFIIS,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.L44	ENST00000343484.5	37	c.132	CCDS13553.1	20																																																																																			TCEA2	-	pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000171703		0.622	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	HGNC	protein_coding	OTTHUMT00000080277.2	-	0.00	36	0	C	NM_198723		62697888	+1	tier1	-	no_errors	ENST00000343484	ensembl	human	known	74_37	silent	55.81	19	24	SNP	0.056	G
TDG	6996	genome.wustl.edu	37	12	104373677	104373677	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:104373677C>A	ENST00000392872.3	+	3	469	c.235C>A	c.(235-237)Cct>Act	p.P79T	TDG_ENST00000544861.1_De_novo_Start_OutOfFrame|TDG_ENST00000542036.1_5'Flank|TDG_ENST00000266775.9_Missense_Mutation_p.P75T	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	79					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		ACCCAAAAAACCTGTTGAGTC	0.323								Base excision repair (BER), DNA glycosylases																																									0													66.0	68.0	67.0					12																	104373677		2203	4300	6503	SO:0001583	missense	0			U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.235C>A	12.37:g.104373677C>A	ENSP00000376611:p.Pro79Thr		Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like,tigrfam_Thymine-DNA_glycosylase	p.P79T	ENST00000392872.3	37	c.235	CCDS9095.1	12	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091429	0.36952	.	.	ENSG00000139372	ENST00000392872;ENST00000436021;ENST00000266775;ENST00000537100	T;T;T	0.46063	2.21;2.2;0.88	5.19	2.27	0.28462	.	0.226724	0.46758	D	0.000280	T	0.42698	0.1214	L	0.57536	1.79	0.47476	D	0.999435	P;B;B	0.49358	0.923;0.004;0.004	P;B;B	0.47891	0.56;0.002;0.002	T	0.30357	-0.9981	10	0.52906	T	0.07	-2.918	8.4486	0.32858	0.0:0.7321:0.1267:0.1411	.	79;79;79	B4DSN7;B2R848;Q13569	.;.;TDG_HUMAN	T	79;54;75;79	ENSP00000376611:P79T;ENSP00000266775:P75T;ENSP00000439825:P79T	ENSP00000266775:P75T	P	+	1	0	TDG	102897807	0.924000	0.31332	0.018000	0.16275	0.924000	0.55760	2.609000	0.46317	0.581000	0.29539	0.650000	0.86243	CCT	TDG	-	tigrfam_Thymine-DNA_glycosylase	ENSG00000139372		0.323	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDG	HGNC	protein_coding	OTTHUMT00000399673.2	-	0.00	29	0	C			104373677	+1	tier1	rs147763309	no_errors	ENST00000392872	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.901	A
TECTA	7007	genome.wustl.edu	37	11	120973431	120973431	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:120973431G>T	ENST00000392793.1	+	2	328	c.57G>T	c.(55-57)caG>caT	p.Q19H	TECTA_ENST00000264037.2_Missense_Mutation_p.Q19H			O75443	TECTA_HUMAN	tectorin alpha	19			Q -> R (in dbSNP:rs35507522).		cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CACTTGTACAGCACCAAGGTG	0.368																																																	0													142.0	149.0	146.0					11																	120973431		2203	4299	6502	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.57G>T	11.37:g.120973431G>T	ENSP00000376543:p.Gln19His			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.Q19H	ENST00000392793.1	37	c.57	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075348	0.36662	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.36878	1.23;1.23	5.22	5.22	0.72569	.	0.986647	0.08299	N	0.967271	T	0.27594	0.0678	N	0.14661	0.345	0.21020	N	0.999802	B	0.22480	0.07	B	0.25140	0.058	T	0.12915	-1.0529	10	0.38643	T	0.18	.	13.461	0.61227	0.0755:0.0:0.9245:0.0	.	19	O75443	TECTA_HUMAN	H	19	ENSP00000376543:Q19H;ENSP00000264037:Q19H	ENSP00000264037:Q19H	Q	+	3	2	TECTA	120478641	0.991000	0.36638	1.000000	0.80357	0.972000	0.66771	2.168000	0.42424	2.584000	0.87258	0.655000	0.94253	CAG	TECTA	-	NULL	ENSG00000109927		0.368	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	-	0.00	48	0	G	NM_005422		120973431	+1	tier1	-	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	T
TG	7038	genome.wustl.edu	37	8	133899614	133899614	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:133899614G>C	ENST00000220616.4	+	9	2037	c.1997G>C	c.(1996-1998)aGg>aCg	p.R666T	TG_ENST00000377869.1_Missense_Mutation_p.R666T	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	666	Thyroglobulin type-1 6. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GAAAAGCAAAGGGCTCGCATG	0.567																																																	0													61.0	56.0	58.0					8																	133899614		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1997G>C	8.37:g.133899614G>C	ENSP00000220616:p.Arg666Thr		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.R666T	ENST00000220616.4	37	c.1997	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603227	0.66445	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.64260	-0.09;-0.09	5.74	5.74	0.90152	Thyroglobulin type-1 (3);	0.000000	0.64402	D	0.000003	D	0.83751	0.5322	M	0.94063	3.49	0.33501	D	0.589933	D	0.89917	1.0	D	0.80764	0.994	D	0.90614	0.4554	10	0.87932	D	0	.	14.5158	0.67818	0.0:0.1462:0.8538:0.0	.	666	P01266	THYG_HUMAN	T	666	ENSP00000367100:R666T;ENSP00000220616:R666T	ENSP00000220616:R666T	R	+	2	0	TG	133968796	1.000000	0.71417	0.990000	0.47175	0.847000	0.48162	5.932000	0.70121	2.715000	0.92844	0.655000	0.94253	AGG	TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.567	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	27	0	G	NM_003235		133899614	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.998	C
TG	7038	genome.wustl.edu	37	8	134030045	134030045	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:134030045G>C	ENST00000220616.4	+	38	6625	c.6585G>C	c.(6583-6585)gaG>gaC	p.E2195D	TG_ENST00000377869.1_Missense_Mutation_p.E2138D|TG_ENST00000522523.1_3'UTR|TG_ENST00000519543.1_Missense_Mutation_p.E328D|TG_ENST00000542445.1_Missense_Mutation_p.E565D	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2195					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCAGCTATGAGGCATCTGTAC	0.572																																																	0													93.0	86.0	88.0					8																	134030045		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6585G>C	8.37:g.134030045G>C	ENSP00000220616:p.Glu2195Asp		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.E2195D	ENST00000220616.4	37	c.6585	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.05|10.05	1.244257|1.244257	0.22796|0.22796	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543;ENST00000518108|ENST00000519178	T;T;T;T|.	0.67698|.	-0.06;-0.06;-0.28;-0.28|.	5.53|5.53	-1.41|-1.41	0.08941|0.08941	.|.	0.903793|.	0.09471|.	N|.	0.797621|.	T|T	0.19366|0.19366	0.0465|0.0465	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	1|1	B;B;B|.	0.13145|.	0.002;0.0;0.007|.	B;B;B|.	0.11329|.	0.006;0.002;0.006|.	T|T	0.27262|0.27262	-1.0079|-1.0079	10|5	0.14656|.	T|.	0.56|.	.|.	4.048|4.048	0.09781|0.09781	0.2571:0.0:0.2662:0.4767|0.2571:0.0:0.2662:0.4767	.|.	328;565;2195|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	D|R	2138;1001;2195;565;328;34|651	ENSP00000367100:E2138D;ENSP00000220616:E2195D;ENSP00000441693:E565D;ENSP00000430430:E328D|.	ENSP00000220616:E2195D|.	E|G	+|+	3|1	2|0	TG|TG	134099227|134099227	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.657000|0.657000	0.38888|0.38888	-0.000000|-0.000000	0.12993|0.12993	-0.092000|-0.092000	0.12417|0.12417	-0.136000|-0.136000	0.14681|0.14681	GAG|GGC	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.572	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	35	0	G	NM_003235		134030045	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	37.25	32	19	SNP	0.000	C
TIMELESS	8914	genome.wustl.edu	37	12	56814440	56814440	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:56814440G>A	ENST00000553532.1	-	26	3291	c.3141C>T	c.(3139-3141)ctC>ctT	p.L1047L	TIMELESS_ENST00000554616.1_Silent_p.L544L|TIMELESS_ENST00000229201.4_Silent_p.L1046L					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						TTTCCTCTGTGAGTGGCACCA	0.522																																																	0													112.0	94.0	100.0					12																	56814440		2203	4300	6503	SO:0001819	synonymous_variant	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3141C>T	12.37:g.56814440G>A				Silent	SNP	pfam_TIMELESS_C,pfam_Timeless	p.L1047	ENST00000553532.1	37	c.3141	CCDS8918.1	12																																																																																			TIMELESS	-	pfam_TIMELESS_C	ENSG00000111602		0.522	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	-	0.00	66	0	G	NM_003920		56814440	-1	tier1	-	no_errors	ENST00000553532	ensembl	human	known	74_37	silent	19.15	76	18	SNP	1.000	A
TIMM10B	26515	genome.wustl.edu	37	11	6502989	6502989	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:6502989G>T	ENST00000254616.6	+	2	112	c.42G>T	c.(40-42)ctG>ctT	p.L14L	ARFIP2_ENST00000254584.2_5'Flank|ARFIP2_ENST00000423813.2_5'Flank|ARFIP2_ENST00000445086.2_5'Flank|TIMM10B_ENST00000530751.1_Intron|TIMM10B_ENST00000472836.1_Silent_p.L14L|ARFIP2_ENST00000525235.1_5'Flank|ARFIP2_ENST00000396777.3_5'Flank	NM_012192.3	NP_036324.1	Q9Y5J6	T10B_HUMAN	translocase of inner mitochondrial membrane 10 homolog B (yeast)	14					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial intermembrane space protein transporter complex (GO:0042719)	metal ion binding (GO:0046872)										TCTCTCAGCTGCGTGACTTCC	0.602																																																	0													76.0	70.0	72.0					11																	6502989		2201	4296	6497	SO:0001819	synonymous_variant	0			AF150105	CCDS7766.1	11p15.4	2012-12-07	2012-12-07	2012-12-07	ENSG00000132286	ENSG00000132286			4022	protein-coding gene	gene with protein product		607388	"""fracture callus 1 (rat) homolog"", ""fracture callus 1 homolog (rat)"""	FXC1		10552927	Standard	NM_012192		Approved	Tim9b, TIM10B	uc001mdn.4	Q9Y5J6	OTTHUMG00000133400	ENST00000254616.6:c.42G>T	11.37:g.6502989G>T			Q96FF3	Silent	SNP	pfam_Tim10/DDP_fam_Znf,superfamily_Tim10/DDP_fam_Znf	p.L14	ENST00000254616.6	37	c.42	CCDS7766.1	11																																																																																			TIMM10B	-	pfam_Tim10/DDP_fam_Znf,superfamily_Tim10/DDP_fam_Znf	ENSG00000132286		0.602	TIMM10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM10B	HGNC	protein_coding	OTTHUMT00000257257.2	-	0.00	42	0	G	NM_012192		6502989	+1	tier1	-	no_errors	ENST00000254616	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.999	T
TLR2	7097	genome.wustl.edu	37	4	154626358	154626358	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:154626358G>T	ENST00000260010.6	+	1	3707	c.2299G>T	c.(2299-2301)Gac>Tac	p.D767Y		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	767	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	GTGGCCCATGGACGAGGCTCA	0.478																																																	0													67.0	71.0	69.0					4																	154626358		2201	4299	6500	SO:0001583	missense	0			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2299G>T	4.37:g.154626358G>T	ENSP00000260010:p.Asp767Tyr		B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.D767Y	ENST00000260010.6	37	c.2299	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735456	0.69189	.	.	ENSG00000137462	ENST00000260010	T	0.10005	2.92	5.63	5.63	0.86233	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.417922	0.25419	N	0.030813	T	0.37625	0.1010	M	0.79123	2.44	0.40019	D	0.975389	D	0.89917	1.0	D	0.75020	0.985	T	0.10917	-1.0609	10	0.87932	D	0	.	20.0442	0.97604	0.0:0.0:1.0:0.0	.	767	O60603	TLR2_HUMAN	Y	767	ENSP00000260010:D767Y	ENSP00000260010:D767Y	D	+	1	0	TLR2	154845808	1.000000	0.71417	0.035000	0.18076	0.002000	0.02628	4.583000	0.60964	2.814000	0.96858	0.655000	0.94253	GAC	TLR2	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000137462		0.478	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1		0.00	35	0	G			154626358	+1			no_errors	ENST00000260010	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.536	T
TMC5	79838	genome.wustl.edu	37	16	19483510	19483510	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:19483510G>T	ENST00000396229.2	+	11	2632	c.1883G>T	c.(1882-1884)gGa>gTa	p.G628V	TMC5_ENST00000219821.5_Missense_Mutation_p.G382V|TMC5_ENST00000381414.4_Missense_Mutation_p.G628V|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Missense_Mutation_p.G628V|TMC5_ENST00000564959.1_Missense_Mutation_p.G311V|TMC5_ENST00000561503.1_Missense_Mutation_p.G269V	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	628					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GTCTCTACAGGAGTGGCCATA	0.537																																																	0													105.0	85.0	92.0					16																	19483510		2197	4300	6497	SO:0001583	missense	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1883G>T	16.37:g.19483510G>T	ENSP00000379531:p.Gly628Val		Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.G628V	ENST00000396229.2	37	c.1883	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094805	0.36952	.	.	ENSG00000103534	ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.78	4.82	0.62117	.	0.486689	0.22077	N	0.064944	T	0.64091	0.2567	M	0.80183	2.485	0.45634	D	0.998567	P;D;D;D;D	0.89917	0.63;0.999;0.998;1.0;1.0	P;D;D;D;D	0.81914	0.459;0.984;0.965;0.99;0.995	T	0.63633	-0.6593	10	0.15066	T	0.55	-9.6834	15.8699	0.79108	0.0:0.1362:0.8638:0.0	.	311;382;382;628;628	E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;TMC5_HUMAN;.	V	628;628;628;382;311	ENSP00000370822:G628V;ENSP00000379531:G628V;ENSP00000446274:G628V;ENSP00000219821:G382V	ENSP00000219821:G382V	G	+	2	0	TMC5	19391011	0.996000	0.38824	0.019000	0.16419	0.043000	0.13939	3.296000	0.51802	1.436000	0.47453	0.650000	0.86243	GGA	TMC5	-	NULL	ENSG00000103534		0.537	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	-	0.00	39	0	G	NM_024780		19483510	+1	tier1	-	no_errors	ENST00000396229	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.448	T
TMCO6	55374	genome.wustl.edu	37	5	140021959	140021959	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:140021959G>T	ENST00000394671.3	+	5	659	c.558G>T	c.(556-558)caG>caT	p.Q186H	TMCO6_ENST00000537378.1_Intron|TMCO6_ENST00000511410.1_3'UTR|NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000252100.6_Missense_Mutation_p.Q186H	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	186					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAAGGCAGCTCCTGCCAC	0.562																																																	0													63.0	73.0	70.0					5																	140021959		2139	4237	6376	SO:0001583	missense	0			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.558G>T	5.37:g.140021959G>T	ENSP00000378166:p.Gln186His		Q9BUU0|Q9P198	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.Q186H	ENST00000394671.3	37	c.558	CCDS4233.2	5	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988757	0.35131	.	.	ENSG00000113119	ENST00000394671;ENST00000252100	T;T	0.30448	1.53;1.53	5.8	4.92	0.64577	Armadillo-like helical (1);Armadillo-type fold (1);	0.098436	0.39909	U	0.001224	T	0.38321	0.1036	N	0.21373	0.66	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.65443	0.935;0.935	T	0.27839	-1.0062	10	0.62326	D	0.03	-11.7535	11.8921	0.52635	0.1429:0.0:0.8571:0.0	.	186;186	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	H	186	ENSP00000378166:Q186H;ENSP00000252100:Q186H	ENSP00000252100:Q186H	Q	+	3	2	TMCO6	140002143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.495000	0.22483	1.445000	0.47624	0.561000	0.74099	CAG	TMCO6	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000113119		0.562	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	-	0.00	24	0	G	NM_018502		140021959	+1	tier1	-	no_errors	ENST00000252100	ensembl	human	known	74_37	missense	76.47	4	13	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	129569203	129569203	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:129569203C>G	ENST00000422113.2	-	6	1814	c.1488G>C	c.(1486-1488)atG>atC	p.M496I	TMEM132D_ENST00000389441.4_Missense_Mutation_p.M34I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	496					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTTGCCTTTCATTTCTTTCC	0.542																																																	0													124.0	95.0	105.0					12																	129569203		2203	4300	6503	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1488G>C	12.37:g.129569203C>G	ENSP00000408581:p.Met496Ile		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.M496I	ENST00000422113.2	37	c.1488	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	c	11.93	1.784440	0.31593	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.47528	0.84;0.84	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.50429	0.1615	L	0.41710	1.295	0.45747	D	0.998648	D;P	0.56035	0.974;0.594	P;B	0.50659	0.647;0.39	T	0.47484	-0.9114	9	.	.	.	-70.0423	17.8083	0.88608	0.0:1.0:0.0:0.0	.	496;34	Q14C87;Q14C87-2	T132D_HUMAN;.	I	34;496	ENSP00000374092:M34I;ENSP00000408581:M496I	.	M	-	3	0	TMEM132D	128135156	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	2.559000	0.45888	2.181000	0.69327	0.556000	0.70494	ATG	TMEM132D	-	NULL	ENSG00000151952		0.542	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1		0.00	65	0	C	NM_133448		129569203	-1			no_errors	ENST00000422113	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	G
TMEM200C	645369	genome.wustl.edu	37	18	5890406	5890406	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr18:5890406C>A	ENST00000581347.2	-	3	2302	c.1657G>T	c.(1657-1659)Gca>Tca	p.A553S	TMEM200C_ENST00000383490.2_Missense_Mutation_p.A553S|RP11-945C19.4_ENST00000577694.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	553						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						CCAGCTACTGCGTCCAAGACC	0.687																																																	0													24.0	28.0	26.0					18																	5890406		1937	4110	6047	SO:0001583	missense	0				CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1657G>T	18.37:g.5890406C>A	ENSP00000463375:p.Ala553Ser			Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.A553S	ENST00000581347.2	37	c.1657	CCDS45825.1	18	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264926	0.40095	.	.	ENSG00000206432	ENST00000383490	.	.	.	4.62	-0.986	0.10252	.	.	.	.	.	T	0.14700	0.0355	N	0.08118	0	0.21933	N	0.99947	B	0.15141	0.012	B	0.16722	0.016	T	0.22836	-1.0205	8	0.49607	T	0.09	.	0.0364	0.00007	0.3271:0.1916:0.1852:0.2962	.	553	A6NKL6	T200C_HUMAN	S	553	.	ENSP00000372982:A553S	A	-	1	0	TMEM200C	5880406	0.114000	0.22134	0.000000	0.03702	0.182000	0.23217	0.310000	0.19356	-0.087000	0.12528	-0.258000	0.10820	GCA	TMEM200C	-	NULL	ENSG00000206432		0.687	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200C	HGNC	protein_coding	OTTHUMT00000441917.4	-	0.00	41	0	C	NM_001080209		5890406	-1	tier1	-	no_errors	ENST00000383490	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.718	A
TMEM258	746	genome.wustl.edu	37	11	61557382	61557382	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:61557382G>T	ENST00000537328.1	-	3	176	c.125C>A	c.(124-126)aCc>aAc	p.T42N	FEN1_ENST00000305885.2_5'Flank|MIR611_ENST00000384869.1_RNA|TMEM258_ENST00000543510.1_Missense_Mutation_p.T37N|TMEM258_ENST00000535042.1_5'UTR	NM_014206.3	NP_055021.1	P61165	TM258_HUMAN	transmembrane protein 258	42						integral component of membrane (GO:0016021)		p.T42I(1)									CTTGGTAGAGGTGACCTCGTA	0.532																																																	1	Substitution - Missense(1)	breast(1)											101.0	77.0	86.0					11																	61557382		2202	4299	6501	SO:0001583	missense	0				CCDS8009.1	11q12.2	2012-12-03	2012-12-03	2012-12-03	ENSG00000134825	ENSG00000134825			1164	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 10"""	C11orf10		12427278	Standard	NM_014206		Approved		uc001nsf.3	P61165	OTTHUMG00000168172	ENST00000537328.1:c.125C>A	11.37:g.61557382G>T	ENSP00000443216:p.Thr42Asn		A8K6L8|Q9D953|Q9Y2Q7	Missense_Mutation	SNP	pfam_UPF0197	p.T42N	ENST00000537328.1	37	c.125	CCDS8009.1	11	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884359	0.91814	.	.	ENSG00000134825	ENST00000537328;ENST00000543510	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	D	0.85173	0.0999	8	0.72032	D	0.01	.	19.1766	0.93604	0.0:0.0:1.0:0.0	.	42	P61165	CK010_HUMAN	N	42;37	.	ENSP00000257262:T42N	T	-	2	0	C11orf10	61313958	1.000000	0.71417	0.997000	0.53966	0.913000	0.54294	9.605000	0.98321	2.594000	0.87642	0.655000	0.94253	ACC	TMEM258	-	pfam_UPF0197	ENSG00000134825		0.532	TMEM258-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM258	HGNC	protein_coding	OTTHUMT00000398577.1		0.00	56	0	G	NM_014206		61557382	-1			no_errors	ENST00000257262	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
TMPO	7112	genome.wustl.edu	37	12	98938017	98938017	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:98938017C>G	ENST00000556029.1	+	5	1029	c.673C>G	c.(673-675)Caa>Gaa	p.Q225E	TMPO_ENST00000343315.5_Intron|TMPO_ENST00000548223.1_3'UTR|TMPO_ENST00000393053.2_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	225	NAKAP95-binding N.|Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GAGCTATTCTCAAGCTGGAAT	0.403																																																	0													71.0	72.0	72.0					12																	98938017		2203	4300	6503	SO:0001583	missense	0				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.673C>G	12.37:g.98938017C>G	ENSP00000450627:p.Gln225Glu		A2T926|Q14861	Missense_Mutation	SNP	pfam_LEM-like_dom,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom,pfscan_LEM-like_dom	p.Q225E	ENST00000556029.1	37	c.673	CCDS31879.1	12	.	.	.	.	.	.	.	.	.	.	C	4.296	0.054123	0.08291	.	.	ENSG00000120802	ENST00000556029	T	0.58060	0.36	5.75	4.86	0.63082	.	.	.	.	.	T	0.33411	0.0862	N	0.16368	0.405	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21724	-1.0237	9	0.02654	T	1	.	15.3477	0.74355	0.0:0.7369:0.2631:0.0	.	225	P42167	LAP2B_HUMAN	E	225	ENSP00000450627:Q225E	ENSP00000340251:Q225E	Q	+	1	0	TMPO	97462148	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.572000	0.45999	1.406000	0.46857	0.591000	0.81541	CAA	TMPO	-	NULL	ENSG00000120802		0.403	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPO	HGNC	protein_coding	OTTHUMT00000407973.2		0.00	41	0	C	NM_003276		98938017	+1			no_errors	ENST00000556029	ensembl	human	known	74_37	missense	30.43	16	7	SNP	1.000	G
TNFSF13B	10673	genome.wustl.edu	37	13	108922373	108922373	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr13:108922373G>C	ENST00000375887.4	+	1	308	c.130G>C	c.(130-132)Gac>Cac	p.D44H	TNFSF13B_ENST00000542136.1_Missense_Mutation_p.D44H|TNFSF13B_ENST00000430559.1_Missense_Mutation_p.D44H	NM_006573.4	NP_006564.1	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily, member 13b	44					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|cell proliferation (GO:0008283)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			large_intestine(1)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)		Belimumab(DB08879)	ATCCTCCAAAGACGGAAAGCT	0.552																																																	0													136.0	140.0	139.0					13																	108922373		2203	4300	6503	SO:0001583	missense	0			AF136293	CCDS9509.1, CCDS45067.1	13q32-q34	2008-05-14			ENSG00000102524	ENSG00000102524		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11929	protein-coding gene	gene with protein product		603969		TNFSF20		10331498, 10359578	Standard	NM_006573		Approved	BAFF, THANK, BLYS, TALL-1, TALL1, CD257	uc001vqr.3	Q9Y275	OTTHUMG00000017329	ENST00000375887.4:c.130G>C	13.37:g.108922373G>C	ENSP00000365048:p.Asp44His		E0ADT7|Q6FHD6|Q7Z5J2	Missense_Mutation	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,pfscan_TNF_dom	p.D44H	ENST00000375887.4	37	c.130	CCDS9509.1	13	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247601	0.22880	.	.	ENSG00000102524	ENST00000430559;ENST00000375887;ENST00000542136	T;T;T	0.69561	-0.41;-0.41;-0.41	4.32	3.46	0.39613	.	0.520908	0.19248	N	0.119014	T	0.74183	0.3683	M	0.67953	2.075	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.70016	0.967;0.921	T	0.61903	-0.6967	10	0.40728	T	0.16	-15.4657	5.6153	0.17428	0.1093:0.2247:0.6661:0.0	.	44;44	Q9Y275-2;Q9Y275	.;TN13B_HUMAN	H	44	ENSP00000389540:D44H;ENSP00000365048:D44H;ENSP00000445334:D44H	ENSP00000365048:D44H	D	+	1	0	TNFSF13B	107720374	0.021000	0.18746	0.066000	0.19879	0.003000	0.03518	1.586000	0.36611	2.344000	0.79699	0.650000	0.86243	GAC	TNFSF13B	-	NULL	ENSG00000102524		0.552	TNFSF13B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFSF13B	HGNC	protein_coding	OTTHUMT00000045739.3	-	0.00	17	0	G			108922373	+1	tier1	-	no_errors	ENST00000375887	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.009	C
TNKS	8658	genome.wustl.edu	37	8	9472945	9472946	+	Intron	INS	-	-	T	rs550131258	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr8:9472945_9472946insT	ENST00000310430.6	+	3	924				TNKS_ENST00000518027.1_3'UTR|TNKS_ENST00000518281.1_Intron|TNKS_ENST00000520408.1_Intron	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase						mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TGCTGCAGTGCTTTTTTGCTTT	0.332													TTTTTT|TTTTTT|TTTTTTT|insertion	13	0.00259585	0.0008	0.0	5008	,	,		20763	0.0		0.003	False		,,,				2504	0.0092																0																																										SO:0001627	intron_variant	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.899-146->T	8.37:g.9472951_9472951dupT			O95272|Q4G0F2	RNA	INS	-	NULL	ENST00000310430.6	37	NULL	CCDS5974.1	8																																																																																			TNKS	-	-	ENSG00000173273		0.332	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS	HGNC	protein_coding	OTTHUMT00000206935.1		0.00	10	0	-	NM_003747		9472946	+1	tier1		no_errors	ENST00000518027	ensembl	human	known	74_37	rna	56.25	7	9	INS	0.998:0.938	T
TNPO3	23534	genome.wustl.edu	37	7	128615974	128615974	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:128615974G>A	ENST00000265388.5	-	17	2220	c.2077C>T	c.(2077-2079)Cac>Tac	p.H693Y	TNPO3_ENST00000393245.1_Missense_Mutation_p.H727Y|TNPO3_ENST00000482320.1_Missense_Mutation_p.H627Y|TNPO3_ENST00000471166.1_Missense_Mutation_p.H727Y|TNPO3_ENST00000471234.1_Missense_Mutation_p.H629Y			Q9Y5L0	TNPO3_HUMAN	transportin 3	693					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						TGATGTACGTGGTACACATTC	0.453																																					Pancreas(147;583 2585 39696 52331)												0													150.0	122.0	132.0					7																	128615974		2203	4300	6503	SO:0001583	missense	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.2077C>T	7.37:g.128615974G>A	ENSP00000265388:p.His693Tyr		A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.H727Y	ENST00000265388.5	37	c.2179	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445286	0.63178	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	.	.	.	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.265315	0.44483	D	0.000448	T	0.45816	0.1361	N	0.14661	0.345	0.58432	D	0.999996	B;B;B;B	0.21688	0.019;0.059;0.057;0.01	B;B;B;B	0.24701	0.011;0.055;0.013;0.006	T	0.40156	-0.9578	9	0.62326	D	0.03	-9.0745	17.7253	0.88363	0.0:0.0:1.0:0.0	.	629;727;693;693	C9IZM0;C9J7E5;Q9Y5L0-3;Q9Y5L0	.;.;.;TNPO3_HUMAN	Y	727;693;627;629;727	.	ENSP00000265388:H693Y	H	-	1	0	TNPO3	128403210	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	7.825000	0.86693	2.789000	0.95967	0.591000	0.81541	CAC	TNPO3	-	superfamily_ARM-type_fold	ENSG00000064419		0.453	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	-	0.00	29	0	G	NM_012470		128615974	-1	tier1	-	no_errors	ENST00000393245	ensembl	human	known	74_37	missense	70.27	10	26	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	66	0	T	NM_000546		7578271	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	69.66	27	62	SNP	0.998	C
TRANK1	9881	genome.wustl.edu	37	3	36873775	36873775	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:36873775G>A	ENST00000429976.2	-	21	7414	c.7167C>T	c.(7165-7167)ttC>ttT	p.F2389F	TRANK1_ENST00000428977.2_Silent_p.F1839F|TRANK1_ENST00000301807.6_Silent_p.F1839F	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2389							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GGACATTCATGAAACGGAAAA	0.493																																																	0													98.0	103.0	101.0					3																	36873775		1896	4128	6024	SO:0001819	synonymous_variant	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7167C>T	3.37:g.36873775G>A			Q8N8K0	Silent	SNP	pfam_UvrD-like_ATP-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.F2389	ENST00000429976.2	37	c.7167	CCDS46789.2	3																																																																																			TRANK1	-	NULL	ENSG00000168016		0.493	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		-	0.00	76	0	G	NM_014831		36873775	-1	tier1	-	no_errors	ENST00000429976	ensembl	human	known	74_37	silent	24.59	46	15	SNP	1.000	A
TRAIP	10293	genome.wustl.edu	37	3	49866540	49866540	+	Missense_Mutation	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:49866540G>A	ENST00000331456.2	-	15	1519	c.1406C>T	c.(1405-1407)tCg>tTg	p.S469L		NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	469	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGTTCTCACGACCACAGGAA	0.557																																																	0													231.0	176.0	195.0					3																	49866540		2203	4300	6503	SO:0001583	missense	0			BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.1406C>T	3.37:g.49866540G>A	ENSP00000328203:p.Ser469Leu		B5BU84|B5BUL3|O00467	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Prefoldin,smart_Znf_RING,pfscan_Znf_RING	p.S469L	ENST00000331456.2	37	c.1406	CCDS2806.1	3	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665060	0.47677	.	.	ENSG00000183763	ENST00000331456	.	.	.	4.31	0.629	0.17687	.	1.830430	0.02943	N	0.140739	T	0.35098	0.0920	N	0.14661	0.345	0.53688	D	0.99997	B;B	0.25235	0.121;0.071	B;B	0.06405	0.002;0.002	T	0.21861	-1.0233	9	0.87932	D	0	-17.6902	5.1303	0.14907	0.0:0.1004:0.3895:0.5101	.	469;469	A8K807;Q9BWF2	.;TRAIP_HUMAN	L	469	.	ENSP00000328203:S469L	S	-	2	0	TRAIP	49841544	0.329000	0.24696	0.807000	0.32361	0.094000	0.18550	0.614000	0.24314	0.106000	0.17784	-0.271000	0.10264	TCG	TRAIP	-	NULL	ENSG00000183763		0.557	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAIP	HGNC	protein_coding	OTTHUMT00000350518.1	-	0.00	40	0	G	NM_005879		49866540	-1	tier1	-	no_errors	ENST00000331456	ensembl	human	known	74_37	missense	55.56	8	10	SNP	0.896	A
TRIM23	373	genome.wustl.edu	37	5	64890374	64890374	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr5:64890374G>T	ENST00000231524.9	-	10	1890	c.1519C>A	c.(1519-1521)Ctg>Atg	p.L507M	TRIM23_ENST00000274327.7_Missense_Mutation_p.L507M|TRIM23_ENST00000381018.3_Missense_Mutation_p.L507M	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	507	ARF-like.				GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L507V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		ATCAGGAGCAGAGCATCTCGG	0.358																																																	1	Substitution - Missense(1)	lung(1)											133.0	132.0	132.0					5																	64890374		2202	4300	6502	SO:0001583	missense	0			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.1519C>A	5.37:g.64890374G>T	ENSP00000231524:p.Leu507Met		Q9BZY4|Q9BZY5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_Znf_B-box,superfamily_P-loop_NTPase,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_Znf_C2H2,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L507M	ENST00000231524.9	37	c.1519	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904931	0.52333	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	D;D;D	0.82526	-1.62;-1.62;-1.62	5.64	3.27	0.37495	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.86644	0.5982	L	0.53671	1.685	0.52099	D	0.999943	D;D;B	0.71674	0.998;0.996;0.226	D;D;B	0.72338	0.977;0.931;0.262	D	0.84732	0.0746	10	0.66056	D	0.02	.	8.113	0.30926	0.6939:0.0:0.3061:0.0	.	507;507;507	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	M	507	ENSP00000231524:L507M;ENSP00000370406:L507M;ENSP00000274327:L507M	ENSP00000231524:L507M	L	-	1	2	TRIM23	64926130	0.952000	0.32445	1.000000	0.80357	0.993000	0.82548	1.042000	0.30303	0.419000	0.25927	-0.469000	0.05056	CTG	TRIM23	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000113595		0.358	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	HGNC	protein_coding	OTTHUMT00000215058.2		0.00	49	0	G	NM_001656		64890374	-1			no_errors	ENST00000231524	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.999	T
TRIM28	10155	genome.wustl.edu	37	19	59056833	59056833	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:59056833G>T	ENST00000253024.5	+	2	671	c.382G>T	c.(382-384)Gac>Tac	p.D128Y	RN7SL525P_ENST00000579267.1_RNA|TRIM28_ENST00000341753.6_Intron	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	128	RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		CTTCTCCAAAGACATCGTGGA	0.552																																																	0													116.0	122.0	120.0					19																	59056833		2203	4300	6503	SO:0001583	missense	0				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.382G>T	19.37:g.59056833G>T	ENSP00000253024:p.Asp128Tyr		O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D128Y	ENST00000253024.5	37	c.382	CCDS12985.1	19	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923839	0.73213	.	.	ENSG00000130726	ENST00000253024	T	0.68765	-0.35	4.36	3.29	0.37713	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.49916	D	0.000128	T	0.61540	0.2355	M	0.65320	2	0.80722	D	1	B	0.21309	0.054	B	0.15870	0.014	T	0.60337	-0.7283	10	0.48119	T	0.1	-32.8226	11.4583	0.50195	0.0:0.0:0.818:0.182	.	128	Q13263	TIF1B_HUMAN	Y	128	ENSP00000253024:D128Y	ENSP00000253024:D128Y	D	+	1	0	TRIM28	63748645	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.913000	0.75759	0.926000	0.37118	0.457000	0.33378	GAC	TRIM28	-	NULL	ENSG00000130726		0.552	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM28	HGNC	protein_coding	OTTHUMT00000467074.1	-	0.00	60	0	G	NM_005762		59056833	+1	tier1	-	no_errors	ENST00000253024	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
TRIM34	53840	genome.wustl.edu	37	11	5664977	5664977	+	3'UTR	DEL	C	C	-			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr11:5664977delC	ENST00000514226.1	+	0	1842				TRIM6-TRIM34_ENST00000457787.2_3'UTR|TRIM34_ENST00000495668.1_3'UTR|TRIM34_ENST00000429814.2_3'UTR|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_3'UTR	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34						positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTTGTCTTGACTTATCTCCTG	0.413																																																	0													87.0	89.0	89.0					11																	5664977		2200	4291	6491	SO:0001624	3_prime_UTR_variant	0			AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.*38C>-	11.37:g.5664977delC			D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	RNA	DEL	-	NULL	ENST00000514226.1	37	NULL	CCDS31391.1	11																																																																																			TRIM34	-	-	ENSG00000258659		0.413	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM34	HGNC	protein_coding	OTTHUMT00000143357.2		0.00	44	0	C	NM_001003827		5664977	+1	tier1		no_errors	ENST00000495668	ensembl	human	known	74_37	rna	17.24	24	5	DEL	0.000	-
TSGA10	80705	genome.wustl.edu	37	2	99634675	99634675	+	Missense_Mutation	SNP	C	C	A	rs148460657		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:99634675C>A	ENST00000393483.3	-	20	2904	c.2060G>T	c.(2059-2061)cGa>cTa	p.R687L	TSGA10_ENST00000410001.1_Missense_Mutation_p.R687L|TSGA10_ENST00000539964.1_Missense_Mutation_p.R687L|TSGA10_ENST00000355053.4_Missense_Mutation_p.R687L	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	687	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TTCTAATGATCGATCTAGGCC	0.378																																																	0								C	LEU/ARG,LEU/ARG	0,4406		0,0,2203	100.0	94.0	96.0		2060,2060	5.0	1.0	2	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TSGA10	NM_025244.2,NM_182911.3	102,102	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	687/699,687/699	99634675	1,13005	2203	4300	6503	SO:0001583	missense	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.2060G>T	2.37:g.99634675C>A	ENSP00000377123:p.Arg687Leu		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.R687L	ENST00000393483.3	37	c.2060	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399649	0.83120	0.0	1.16E-4	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.51574	0.86;0.86;0.86;0.86;0.7;0.75	5.04	5.04	0.67666	.	0.345645	0.24361	N	0.039184	T	0.49558	0.1564	L	0.29908	0.895	0.80722	D	1	D	0.62365	0.991	P	0.52031	0.688	T	0.52335	-0.8589	10	0.66056	D	0.02	-5.96	17.4589	0.87615	0.0:1.0:0.0:0.0	.	687	Q9BZW7	TSG10_HUMAN	L	687;687;687;687;617;687	ENSP00000377123:R687L;ENSP00000386956:R687L;ENSP00000347161:R687L;ENSP00000444419:R687L;ENSP00000386508:R617L;ENSP00000377122:R687L	ENSP00000347161:R687L	R	-	2	0	TSGA10	99001107	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.958000	0.29227	2.774000	0.95407	0.655000	0.94253	CGA	TSGA10	-	NULL	ENSG00000135951		0.378	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	39	0	C	NM_182911		99634675	-1	tier1	rs148460657	no_errors	ENST00000355053	ensembl	human	known	74_37	missense	39.33	54	35	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179398175	179398175	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:179398175G>C	ENST00000591111.1	-	308	98468	c.98244C>G	c.(98242-98244)atC>atG	p.I32748M	TTN_ENST00000589042.1_Missense_Mutation_p.I34389M|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I31821M|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I25324M|TTN_ENST00000359218.5_Missense_Mutation_p.I25449M|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I25516M|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32748	Ig-like 145.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGTGGGGGGATGCCAGACA	0.453																																																	0													63.0	62.0	62.0					2																	179398175		1956	4148	6104	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98244C>G	2.37:g.179398175G>C	ENSP00000465570:p.Ile32748Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I31821M	ENST00000591111.1	37	c.95463		2	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935610	0.34189	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.74	0.608	0.17569	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67183	0.2866	L	0.55834	1.745	0.29969	N	0.818756	D;D;D;D	0.54397	0.966;0.966;0.966;0.966	P;P;P;P	0.55161	0.77;0.77;0.77;0.77	T	0.62595	-0.6821	9	0.87932	D	0	.	3.9959	0.09558	0.3667:0.0:0.3827:0.2506	.	25324;25449;25516;32748	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	31821;25324;25516;25449;25321	ENSP00000343764:I31821M;ENSP00000434586:I25324M;ENSP00000340554:I25516M;ENSP00000352154:I25449M	ENSP00000340554:I25516M	I	-	3	3	TTN	179106421	0.445000	0.25657	0.995000	0.50966	0.967000	0.64934	-0.408000	0.07169	0.037000	0.15575	-0.367000	0.07326	ATC	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	41	0	G	NM_133378		179398175	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.982	C
TTN	7273	genome.wustl.edu	37	2	179402298	179402298	+	Silent	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:179402298G>T	ENST00000591111.1	-	305	94937	c.94713C>A	c.(94711-94713)tcC>tcA	p.S31571S	TTN_ENST00000589042.1_Silent_p.S33212S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.S30644S|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Silent_p.S24147S|TTN_ENST00000359218.5_Silent_p.S24272S|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000342175.6_Silent_p.S24339S|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31571					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCGAAGTGTGGAACCCACAG	0.438																																																	0													85.0	84.0	84.0					2																	179402298		1888	4108	5996	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.94713C>A	2.37:g.179402298G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S30644	ENST00000591111.1	37	c.91932		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	52	0	G	NM_133378		179402298	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.025	T
TTN	7273	genome.wustl.edu	37	2	179592389	179592389	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr2:179592389G>C	ENST00000591111.1	-	66	19189	c.18965C>G	c.(18964-18966)tCt>tGt	p.S6322C	TTN_ENST00000589042.1_Missense_Mutation_p.S6639C|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S5395C|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13098	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAGTCTTAGAAGCATCCAC	0.408																																																	0													200.0	204.0	203.0					2																	179592389		2030	4198	6228	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18965C>G	2.37:g.179592389G>C	ENSP00000465570:p.Ser6322Cys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S5395C	ENST00000591111.1	37	c.16184		2	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456528	0.26161	.	.	ENSG00000155657	ENST00000342992	T	0.48836	0.8	5.99	5.99	0.97316	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75133	0.3808	H	0.94423	3.535	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	T	0.81705	-0.0811	9	0.87932	D	0	.	14.6024	0.68450	0.069:0.0:0.931:0.0	.	6322	Q8WZ42	TITIN_HUMAN	C	5395	ENSP00000343764:S5395C	ENSP00000343764:S5395C	S	-	2	0	TTN	179300634	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.709000	0.74665	2.840000	0.97914	0.655000	0.94253	TCT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	55	0	G	NM_133378		179592389	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	28.89	32	13	SNP	0.999	C
TUBA1A	7846	genome.wustl.edu	37	12	49578864	49578864	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:49578864C>G	ENST00000295766.5	-	4	1764	c.1285G>C	c.(1285-1287)Gag>Cag	p.E429Q	TUBA1A_ENST00000550767.1_Missense_Mutation_p.E394Q|TUBA1A_ENST00000301071.7_Missense_Mutation_p.E429Q	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	429					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	TAATCCTTCTCAAGGGCAGCC	0.493																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)												0													153.0	152.0	152.0					12																	49578864		2203	4300	6503	SO:0001583	missense	0			AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.1285G>C	12.37:g.49578864C>G	ENSP00000439020:p.Glu429Gln		A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.E429Q	ENST00000295766.5	37	c.1285	CCDS58227.1	12	.	.	.	.	.	.	.	.	.	.	c	14.56	2.573199	0.45902	.	.	ENSG00000167552	ENST00000301071;ENST00000552597;ENST00000548405;ENST00000295766;ENST00000550767	D;D;D	0.84223	-1.82;-1.82;-1.82	5.51	4.62	0.57501	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.067420	0.56097	D	0.000030	D	0.91862	0.7424	M	0.85462	2.755	0.80722	D	1	D	0.59357	0.985	D	0.63283	0.913	D	0.92864	0.6308	10	0.87932	D	0	.	13.3715	0.60715	0.0:0.923:0.0:0.077	.	429	Q71U36	TBA1A_HUMAN	Q	429;160;276;429;394	ENSP00000301071:E429Q;ENSP00000439020:E429Q;ENSP00000446637:E394Q	ENSP00000439020:E429Q	E	-	1	0	TUBA1A	47865131	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	7.442000	0.80503	1.324000	0.45282	0.655000	0.94253	GAG	TUBA1A	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin	ENSG00000167552		0.493	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	TUBA1A	HGNC	protein_coding	OTTHUMT00000404547.2	-	0.00	148	0	C	NM_006009		49578864	-1	tier1	-	no_errors	ENST00000301071	ensembl	human	known	74_37	missense	14.21	155	26	SNP	1.000	G
TUBA1A	7846	genome.wustl.edu	37	12	49578975	49578975	+	Missense_Mutation	SNP	C	C	G			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr12:49578975C>G	ENST00000295766.5	-	4	1653	c.1174G>C	c.(1174-1176)Gac>Cac	p.D392H	TUBA1A_ENST00000550767.1_Missense_Mutation_p.D357H|TUBA1A_ENST00000301071.7_Missense_Mutation_p.D392H	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	392					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	AACTTGTGGTCCAGGCGAGCC	0.577																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)												0													109.0	95.0	99.0					12																	49578975		2203	4298	6501	SO:0001583	missense	0			AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.1174G>C	12.37:g.49578975C>G	ENSP00000439020:p.Asp392His		A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.D392H	ENST00000295766.5	37	c.1174	CCDS58227.1	12	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905494	0.52333	.	.	ENSG00000167552	ENST00000301071;ENST00000552597;ENST00000548405;ENST00000295766;ENST00000550767	D;D;D	0.84146	-1.81;-1.81;-1.81	5.51	5.51	0.81932	Tubulin/FtsZ, 2-layer sandwich domain (2);Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	M	0.92784	3.345	0.80722	D	1	D	0.63880	0.993	D	0.76071	0.987	D	0.95339	0.8436	10	0.87932	D	0	.	18.2109	0.89869	0.0:1.0:0.0:0.0	.	392	Q71U36	TBA1A_HUMAN	H	392;123;239;392;357	ENSP00000301071:D392H;ENSP00000439020:D392H;ENSP00000446637:D357H	ENSP00000439020:D392H	D	-	1	0	TUBA1A	47865242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.380000	0.79704	2.581000	0.87130	0.655000	0.94253	GAC	TUBA1A	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000167552		0.577	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	TUBA1A	HGNC	protein_coding	OTTHUMT00000404547.2	-	0.00	121	0	C	NM_006009		49578975	-1	tier1	-	no_errors	ENST00000301071	ensembl	human	known	74_37	missense	20.61	104	27	SNP	1.000	G
UOX	391051	genome.wustl.edu	37	1	84833375	84833375	+	RNA	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr1:84833375C>T	ENST00000483236.1	-	0	598									urate oxidase, pseudogene																		TTGGACATGTCTATGTTGAAG	0.433																																																	0																																												0			AB074093		1p31.1	2011-09-02	2010-03-12		ENSG00000240520	ENSG00000240520			12575	pseudogene	pseudogene		191540	"""urate oxidase"""			1395718, 1556746	Standard	NR_003927		Approved	UOXP	uc009wcg.3		OTTHUMG00000009861		1.37:g.84833375C>T				RNA	SNP	-	NULL	ENST00000483236.1	37	NULL		1																																																																																			UOX	-	-	ENSG00000240520		0.433	UOX-002	KNOWN	basic	processed_transcript	UOX	HGNC	pseudogene	OTTHUMT00000331132.1	-	0.00	35	0	C	NR_003927		84833375	-1	tier1	-	no_errors	ENST00000483236	ensembl	human	known	74_37	rna	35.19	35	19	SNP	1.000	T
UQCRFS1	7386	genome.wustl.edu	37	19	29699033	29699033	+	Missense_Mutation	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:29699033T>C	ENST00000304863.4	-	2	669	c.247A>G	c.(247-249)Atc>Gtc	p.I83V		NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	83					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.I83V(4)		endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			GGCACCTTGATGTCTGTGTGG	0.423																																																	4	Substitution - Missense(4)	endometrium(2)|kidney(2)											53.0	59.0	57.0					19																	29699033		2203	4299	6502	SO:0001583	missense	0			BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.247A>G	19.37:g.29699033T>C	ENSP00000306397:p.Ile83Val		A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	pfam_Ubiqinol_cyt_c_Rdtase_N,pfam_Ubiquinol_cyt_Rdtase_TM,pfam_Rieske_2Fe-2S,superfamily_Rieske_2Fe-2S,superfamily_Globular_prot_asu/bsu,prints_Rieske_Fe-S_prot_C,tigrfam_Ubiquinol_cyt_c_Rdtase_Fe-S-su	p.I83V	ENST00000304863.4	37	c.247	CCDS12415.1	19	.	.	.	.	.	.	.	.	.	.	t	0.014	-1.596233	0.00857	.	.	ENSG00000169021	ENST00000304863	T	0.42131	0.98	5.42	-4.98	0.03019	Ubiquinol cytochrome reductase, transmembrane domain (3);	0.618499	0.17385	N	0.176150	T	0.22360	0.0539	N	0.16862	0.45	0.20764	N	0.999851	B	0.02656	0.0	B	0.14578	0.011	T	0.23976	-1.0173	10	0.08837	T	0.75	.	17.2071	0.86921	0.0:0.6778:0.0:0.3222	.	83	P47985	UCRI_HUMAN	V	83	ENSP00000306397:I83V	ENSP00000306397:I83V	I	-	1	0	UQCRFS1	34390873	0.987000	0.35691	0.084000	0.20598	0.009000	0.06853	0.184000	0.16939	-1.243000	0.02519	-3.117000	0.00062	ATC	UQCRFS1	-	pfam_Ubiquinol_cyt_Rdtase_TM	ENSG00000169021		0.423	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRFS1	HGNC	protein_coding	OTTHUMT00000458563.1		0.00	49	0	T	NM_006003		29699033	-1			no_errors	ENST00000304863	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.746	C
USP43	124739	genome.wustl.edu	37	17	9549132	9549132	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:9549132C>T	ENST00000285199.7	+	1	279	c.183C>T	c.(181-183)ttC>ttT	p.F61F	RP11-55L4.1_ENST00000572923.1_RNA|USP43_ENST00000570475.1_Silent_p.F61F|RP11-55L4.2_ENST00000584676.1_RNA|USP43_ENST00000570827.2_Intron	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	61					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						AGGGGGGCTTCGCCTGCGCCC	0.791																																																	0													1.0	1.0	1.0					17																	9549132		759	1844	2603	SO:0001819	synonymous_variant	0			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.183C>T	17.37:g.9549132C>T			A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.F61	ENST00000285199.7	37	c.183	CCDS45610.1	17																																																																																			USP43	-	NULL	ENSG00000154914		0.791	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	HGNC	protein_coding	OTTHUMT00000439855.3	-	0.00	17	0	C	NM_153210		9549132	+1	tier1	-	no_errors	ENST00000285199	ensembl	human	known	74_37	silent	40.00	12	8	SNP	0.038	T
USP54	159195	genome.wustl.edu	37	10	75286503	75286503	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:75286503G>C	ENST00000339859.4	-	15	2196	c.2096C>G	c.(2095-2097)cCt>cGt	p.P699R	USP54_ENST00000428547.1_Missense_Mutation_p.P549R|USP54_ENST00000408019.1_Missense_Mutation_p.P699R|RNU6-883P_ENST00000384597.1_RNA|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000497106.1_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	699					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					ACGCCAGGAAGGAACCAACCC	0.493																																					Colon(195;880 2046 8854 25025 38456)												0													81.0	80.0	80.0					10																	75286503		1993	4174	6167	SO:0001583	missense	0			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2096C>G	10.37:g.75286503G>C	ENSP00000345216:p.Pro699Arg		A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P699R	ENST00000339859.4	37	c.2096	CCDS7329.2	10	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627379	0.87560	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547	T;T;T	0.69685	-0.23;-0.23;-0.42	5.95	5.95	0.96441	.	0.083518	0.47852	U	0.000209	T	0.81531	0.4842	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.82099	-0.0625	10	0.87932	D	0	-8.8888	18.5553	0.91081	0.0:0.0:1.0:0.0	.	699;699	Q70EL1-6;Q70EL1	.;UBP54_HUMAN	R	699;699;549	ENSP00000345216:P699R;ENSP00000386080:P699R;ENSP00000408714:P549R	ENSP00000345216:P699R	P	-	2	0	USP54	74956509	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.218000	0.77991	2.817000	0.96982	0.563000	0.77884	CCT	USP54	-	NULL	ENSG00000166348		0.493	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2	-	0.00	40	0	G	NM_152586		75286503	-1	tier1	-	no_errors	ENST00000339859	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	C
USP9Y	8287	genome.wustl.edu	37	Y	14898609	14898609	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chrY:14898609G>T	ENST00000338981.3	+	24	4382	c.3437G>T	c.(3436-3438)aGg>aTg	p.R1146M	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1146					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GAAACTCGAAGGGGTGCTTAT	0.398																																																	0													74.0	74.0	74.0					Y																	14898609		597	1951	2548	SO:0001583	missense	0			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.3437G>T	Y.37:g.14898609G>T	ENSP00000342812:p.Arg1146Met		O14601	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,superfamily_Glycoside_hydrolase_SF,pfscan_Peptidase_C19/C67	p.R1146M	ENST00000338981.3	37	c.3437	CCDS14781.1	Y																																																																																			USP9Y	-	superfamily_ARM-type_fold	ENSG00000114374		0.398	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP9Y	HGNC	protein_coding	OTTHUMT00000088703.2	-	0.00	38	0	G	NM_004654		14898609	+1	tier1	-	no_errors	ENST00000338981	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144814581	144814581	+	Silent	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:144814581C>T	ENST00000367545.3	+	32	4582	c.4582C>T	c.(4582-4584)Ctg>Ttg	p.L1528L		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1528	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTACAATGACCTGGGCGCACA	0.478																																																	0																																										SO:0001819	synonymous_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.4582C>T	6.37:g.144814581C>T			Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.L1528	ENST00000367545.3	37	c.4582	CCDS34547.1	6																																																																																			UTRN	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.478	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	-	0.00	19	0	C			144814581	+1	tier1	-	no_errors	ENST00000367545	ensembl	human	known	74_37	silent	18.52	22	5	SNP	1.000	T
UVSSA	57654	genome.wustl.edu	37	4	1341932	1341932	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:1341932C>A	ENST00000389851.4	+	2	500	c.53C>A	c.(52-54)cCc>cAc	p.P18H	UVSSA_ENST00000511216.1_Missense_Mutation_p.P18H|UVSSA_ENST00000507531.1_Missense_Mutation_p.P18H	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	18	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										TCAGGAGAACCCCGACTAAAT	0.408																																																	0													121.0	135.0	130.0					4																	1341932		2203	4300	6503	SO:0001583	missense	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.53C>A	4.37:g.1341932C>A	ENSP00000374501:p.Pro18His		A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.P18H	ENST00000389851.4	37	c.53	CCDS33938.1	4	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725309	0.48833	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.23348	1.91;1.91;1.91	4.92	4.92	0.64577	.	0.324290	0.32488	N	0.006028	T	0.43656	0.1257	L	0.55834	1.745	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	T	0.21143	-1.0254	10	0.41790	T	0.15	-19.7798	18.074	0.89422	0.0:1.0:0.0:0.0	.	18	Q2YD98	K1530_HUMAN	H	18	ENSP00000425130:P18H;ENSP00000374501:P18H;ENSP00000421741:P18H	ENSP00000374501:P18H	P	+	2	0	KIAA1530	1331932	1.000000	0.71417	0.783000	0.31826	0.044000	0.14063	4.865000	0.62998	2.431000	0.82371	0.561000	0.74099	CCC	UVSSA	-	superfamily_ENTH_VHS	ENSG00000163945		0.408	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	-	0.00	43	0	C	NM_020894		1341932	+1	tier1	-	no_errors	ENST00000389851	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	A
VNN3	55350	genome.wustl.edu	37	6	133044189	133044189	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr6:133044189G>T	ENST00000207771.3	-	8	1451	c.1379C>A	c.(1378-1380)tCa>tAa	p.S460*	VNN3_ENST00000275223.3_3'UTR|VNN3_ENST00000509351.1_3'UTR|VNN3_ENST00000423615.2_3'UTR|VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000417437.2_3'UTR|VNN3_ENST00000427187.2_3'UTR|VNN3_ENST00000414302.2_3'UTR|VNN3_ENST00000392393.3_3'UTR|VNN3_ENST00000519686.2_3'UTR|VNN3_ENST00000367927.5_3'UTR			Q9NY84	VNN3_HUMAN	vanin 3	461					nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		TCCATCTCTTGAAATCTGGTC	0.493																																																	0													73.0	61.0	65.0					6																	133044189		876	1991	2867	SO:0001587	stop_gained	0			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000207771.3:c.1379C>A	6.37:g.133044189G>T	ENSP00000440594:p.Ser460*		B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Nonsense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.S460*	ENST00000207771.3	37	c.1379		6	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853999	0.91355	.	.	ENSG00000093134	ENST00000207771	.	.	.	5.18	3.4	0.38934	.	0.745300	0.11421	U	0.565769	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-4.0964	7.4892	0.27452	0.268:0.0:0.732:0.0	.	.	.	.	X	460	.	ENSP00000440594:S460X	S	-	2	0	VNN3	133085882	0.117000	0.22190	0.989000	0.46669	0.795000	0.44927	1.583000	0.36579	0.681000	0.31386	0.563000	0.77884	TCA	VNN3	-	pirsf_Biotinidase_euk	ENSG00000093134		0.493	VNN3-201	KNOWN	basic|appris_principal	protein_coding	VNN3	HGNC	protein_coding		-	0.00	58	0	G	NR_028290		133044189	-1	tier1	-	no_errors	ENST00000207771	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	0.935	T
WBP2	23558	genome.wustl.edu	37	17	73843668	73843669	+	Frame_Shift_Ins	INS	-	-	A	rs573593933		TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:73843668_73843669insA	ENST00000591399.1	-	7	978_979	c.554_555insT	c.(553-555)atgfs	p.M185fs	WBP2_ENST00000344296.4_Frame_Shift_Ins_p.M163fs|UNC13D_ENST00000207549.4_5'Flank|WBP2_ENST00000254806.3_Frame_Shift_Ins_p.M185fs|WBP2_ENST00000590450.1_5'Flank|WBP2_ENST00000590221.1_Frame_Shift_Ins_p.M181fs|WBP2_ENST00000585462.1_Frame_Shift_Ins_p.M163fs|WBP2_ENST00000433525.2_Frame_Shift_Ins_p.M140fs			Q969T9	WBP2_HUMAN	WW domain binding protein 2	185	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCCCGTCCATCATGGGGGGTCC	0.678																																																	0																																										SO:0001589	frameshift_variant	0			U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.555dupT	17.37:g.73843669_73843669dupA	ENSP00000467579:p.Met185fs		O95638	Frame_Shift_Ins	INS	pfam_WW-domain-binding,pfam_GRAM	p.M185fs	ENST00000591399.1	37	c.555_554	CCDS11731.1	17																																																																																			WBP2	-	pfam_WW-domain-binding	ENSG00000132471		0.678	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2	HGNC	protein_coding	OTTHUMT00000448862.1		0.00	106	0	-	NM_012478		73843669	-1	tier1		no_errors	ENST00000254806	ensembl	human	known	74_37	frame_shift_ins	40.68	70	48	INS	1.000:1.000	A
CFAP43	80217	genome.wustl.edu	37	10	105900686	105900686	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:105900686G>C	ENST00000357060.3	-	34	4460	c.4345C>G	c.(4345-4347)Ctg>Gtg	p.L1449V	WDR96_ENST00000479392.1_5'UTR|WDR96_ENST00000428666.1_Missense_Mutation_p.L1421V	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AAATTTTCCAGTTCTACTTGT	0.333																																																	0													83.0	81.0	82.0					10																	105900686		2203	4299	6502	SO:0001583	missense	0																														ENST00000357060.3:c.4345C>G	10.37:g.105900686G>C	ENSP00000349568:p.Leu1449Val			Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.L1449V	ENST00000357060.3	37	c.4345	CCDS31281.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.266|1.266	-0.614467|-0.614467	0.03663|0.03663	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000357060;ENST00000428666|ENST00000457071;ENST00000434629	T;T|.	0.11063|.	2.81;2.87|.	5.44|5.44	1.24|1.24	0.21308|0.21308	.|.	0.276754|.	0.30538|.	N|.	0.009409|.	T|T	0.20820|0.20820	0.0501|0.0501	N|N	0.11255|0.11255	0.115|0.115	0.26688|0.26688	N|N	0.971407|0.971407	B;B|.	0.24483|.	0.024;0.104|.	B;B|.	0.30495|.	0.076;0.116|.	T|T	0.26985|0.26985	-1.0087|-1.0087	10|5	0.07482|.	T|.	0.82|.	.|.	11.2671|11.2671	0.49116|0.49116	0.0716:0.4862:0.4422:0.0|0.0716:0.4862:0.4422:0.0	.|.	1421;1449|.	G5E9L1;Q8NDM7|.	.;WDR96_HUMAN|.	V|K	1449;1421|297;780	ENSP00000349568:L1449V;ENSP00000400289:L1421V|.	ENSP00000349568:L1449V|.	L|N	-|-	1|3	2|2	WDR96|WDR96	105890676|105890676	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.791000|0.791000	0.44710|0.44710	0.322000|0.322000	0.19576|0.19576	0.255000|0.255000	0.21593|0.21593	0.655000|0.655000	0.94253|0.94253	CTG|AAC	WDR96	-	NULL	ENSG00000197748		0.333	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR96	HGNC	protein_coding		-	0.00	38	0	G			105900686	-1	tier1	-	no_errors	ENST00000357060	ensembl	human	known	74_37	missense	23.64	42	13	SNP	0.998	C
NDUFA13	51079	genome.wustl.edu	37	19	19627082	19627082	+	Missense_Mutation	SNP	C	C	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:19627082C>T	ENST00000507754.4	+	1	519	c.35C>T	c.(34-36)cCg>cTg	p.P12L	NDUFA13_ENST00000503283.1_Missense_Mutation_p.P12L|YJEFN3_ENST00000608404.1_Missense_Mutation_p.P12L|NDUFA13_ENST00000252576.5_Missense_Mutation_p.P95L|CTC-260F20.3_ENST00000586674.1_3'UTR|NDUFA13_ENST00000428459.2_Missense_Mutation_p.P12L|TSSK6_ENST00000360913.3_5'Flank|TSSK6_ENST00000585580.3_5'Flank|CTC-260F20.3_ENST00000555938.1_Missense_Mutation_p.P12L|NDUFA13_ENST00000512771.3_Missense_Mutation_p.P12L			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	12					apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						GACATGCCTCCGCCGGGGGGC	0.617																																																	0													39.0	44.0	43.0					19																	19627082		2203	4300	6503	SO:0001583	missense	0			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.35C>T	19.37:g.19627082C>T	ENSP00000423673:p.Pro12Leu		B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	pfam_GRIM-19,pfam_YjeF_N_dom,superfamily_YjeF_N_dom	p.P12L	ENST00000507754.4	37	c.35	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	C	35	5.558020	0.96514	.	.	ENSG00000186010;ENSG00000186010;ENSG00000250067;ENSG00000258674	ENST00000507754;ENST00000252576;ENST00000553705;ENST00000555938	D;D;D	0.89810	-2.57;-2.57;-2.57	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.96225	0.8769	H	0.95043	3.615	0.47441	D	0.999429	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97349	0.9962	10	0.87932	D	0	.	16.5154	0.84299	0.0:1.0:0.0:0.0	.	12;12;12	E7ENQ6;B4DF76;Q9P0J0	.;.;NDUAD_HUMAN	L	12;95;12;12	ENSP00000423673:P12L;ENSP00000252576:P95L;ENSP00000452549:P12L	ENSP00000252576:P95L	P	+	2	0	YJEFN3;NDUFA13;CTC-260F20.3	19488082	1.000000	0.71417	0.985000	0.45067	0.952000	0.60782	6.163000	0.71880	2.504000	0.84457	0.650000	0.86243	CCG	YJEFN3	-	pfam_GRIM-19	ENSG00000250067		0.617	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	YJEFN3	HGNC	protein_coding	OTTHUMT00000367916.6	-	0.00	66	0	C	NM_015965		19627082	+1	tier1	-	no_errors	ENST00000608404	ensembl	human	known	74_37	missense	41.86	25	18	SNP	1.000	T
ZCWPW1	55063	genome.wustl.edu	37	7	100004374	100004374	+	Missense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:100004374C>A	ENST00000398027.2	-	12	1360	c.1113G>T	c.(1111-1113)tgG>tgT	p.W371C	ZCWPW1_ENST00000360951.4_Missense_Mutation_p.W372C|ZCWPW1_ENST00000490721.1_Missense_Mutation_p.W251C|ZCWPW1_ENST00000324725.6_Missense_Mutation_p.W251C	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	371	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGACTGGGATCCATGCACGAG	0.448																																																	0													125.0	129.0	128.0					7																	100004374		1913	4137	6050	SO:0001583	missense	0			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.1113G>T	7.37:g.100004374C>A	ENSP00000381109:p.Trp371Cys		A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_CW	p.W371C	ENST00000398027.2	37	c.1113	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801948	0.70682	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000471336;ENST00000379559	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.6	5.6	0.85130	PWWP (2);	0.279059	0.26380	N	0.024713	D	0.89594	0.6760	M	0.89095	3.005	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.999;0.999	D	0.90797	0.4691	9	.	.	.	-6.191	15.107	0.72329	0.0:1.0:0.0:0.0	.	372;332;374;371;251	B4DUQ2;B4DXS7;C9J435;Q9H0M4;Q9H0M4-4	.;.;.;ZCPW1_HUMAN;.	C	371;251;372;251;121;374	ENSP00000381109:W371C;ENSP00000419187:W251C;ENSP00000354210:W372C;ENSP00000314880:W251C;ENSP00000418351:W121C	.	W	-	3	0	ZCWPW1	99842310	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.333000	0.59285	2.615000	0.88500	0.655000	0.94253	TGG	ZCWPW1	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000078487		0.448	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1	-	0.00	39	0	C	NM_017984		100004374	-1	tier1	-	no_errors	ENST00000398027	ensembl	human	known	74_37	missense	72.00	7	18	SNP	1.000	A
ZEB1	6935	genome.wustl.edu	37	10	31809541	31809541	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr10:31809541G>T	ENST00000320985.10	+	7	1388	c.1278G>T	c.(1276-1278)agG>agT	p.R426S	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.R359S|ZEB1_ENST00000361642.5_Missense_Mutation_p.R427S|ZEB1_ENST00000560721.2_Missense_Mutation_p.R406S|ZEB1_ENST00000446923.2_Missense_Mutation_p.R410S			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	426					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ATGTAATAAGGCAAGTGTTGG	0.388																																					Ovarian(40;423 959 14296 36701 49589)												0													74.0	71.0	72.0					10																	31809541		2203	4300	6503	SO:0001583	missense	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1278G>T	10.37:g.31809541G>T	ENSP00000319248:p.Arg426Ser		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.R427S	ENST00000320985.10	37	c.1281	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357839	0.41801	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.87	4.0	0.46444	.	0.000000	0.64402	D	0.000004	D	0.87997	0.6319	M	0.72894	2.215	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.85130	0.991;0.997;0.991;0.994;0.994;0.979;0.994;0.994	D	0.87524	0.2448	10	0.87932	D	0	-17.1906	12.2364	0.54518	0.2002:0.0:0.7998:0.0	.	359;426;410;426;426;406;427;426	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	S	208;426;427;426;359;426;406;285;317;410	ENSP00000444282:R208S;ENSP00000354487:R427S;ENSP00000444891:R359S;ENSP00000319248:R426S;ENSP00000391612:R410S	ENSP00000319248:R426S	R	+	3	2	ZEB1	31849547	0.998000	0.40836	0.999000	0.59377	0.917000	0.54804	0.409000	0.21082	0.481000	0.27557	-0.797000	0.03246	AGG	ZEB1	-	NULL	ENSG00000148516		0.388	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2	-	0.00	23	0	G	NM_030751		31809541	+1	tier1	-	no_errors	ENST00000361642	ensembl	human	known	74_37	missense	26.32	56	20	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72828297	72828297	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr16:72828297C>A	ENST00000268489.5	-	9	8956	c.8284G>T	c.(8284-8286)Gga>Tga	p.G2762*	ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.G1848*|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2762					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AAAATATCTCCTTTCATCTGG	0.507																																																	0													65.0	65.0	65.0					16																	72828297		2198	4300	6498	SO:0001587	stop_gained	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8284G>T	16.37:g.72828297C>A	ENSP00000268489:p.Gly2762*		D3DWS8|O15101|Q13719	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.G2762*	ENST00000268489.5	37	c.8284	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	C	51	18.394785	0.99904	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	.	.	.	5.97	5.97	0.96955	.	0.000000	0.48767	D	0.000167	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	20.4239	0.99064	0.0:1.0:0.0:0.0	.	.	.	.	X	2762;1848	.	ENSP00000268489:G2762X	G	-	1	0	ZFHX3	71385798	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.805000	0.62561	2.828000	0.97474	0.655000	0.94253	GGA	ZFHX3	-	NULL	ENSG00000140836		0.507	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	35	0	C	NM_006885		72828297	-1	tier1	-	no_errors	ENST00000268489	ensembl	human	known	74_37	nonsense	80.00	10	40	SNP	1.000	A
ZFP42	132625	genome.wustl.edu	37	4	188924576	188924576	+	Silent	SNP	G	G	A			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr4:188924576G>A	ENST00000326866.4	+	4	1023	c.615G>A	c.(613-615)ctG>ctA	p.L205L	ZFP42_ENST00000509524.1_Silent_p.L205L	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	205					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GAGCTGCCCTGAGAAAGCATC	0.483																																																	0													122.0	126.0	124.0					4																	188924576		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.615G>A	4.37:g.188924576G>A			D3DP65|Q8WXE2	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L205	ENST00000326866.4	37	c.615	CCDS3849.1	4																																																																																			ZFP42	-	smart_Znf_C2H2-like	ENSG00000179059		0.483	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	HGNC	protein_coding	OTTHUMT00000359794.1		0.00	17	0	G	NM_174900		188924576	+1			no_errors	ENST00000326866	ensembl	human	known	74_37	silent	17.65	14	3	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22155346	22155346	+	Silent	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:22155346T>C	ENST00000397126.4	-	4	2638	c.2490A>G	c.(2488-2490)gaA>gaG	p.E830E	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	830					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGGCTTTTCTCCAGCAT	0.373																																																	0													66.0	72.0	70.0					19																	22155346		2117	4255	6372	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2490A>G	19.37:g.22155346T>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E830	ENST00000397126.4	37	c.2490	CCDS54240.1	19																																																																																			ZNF208	-	pfscan_Znf_C2H2	ENSG00000160321		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1		0.00	79	0	T	NM_007153		22155346	-1			no_errors	ENST00000397126	ensembl	human	novel	74_37	silent	9.68	56	6	SNP	1.000	C
ZNF112	7771	genome.wustl.edu	37	19	44833162	44833162	+	Missense_Mutation	SNP	T	T	C	rs76661956	byFrequency	TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr19:44833162T>C	ENST00000337401.4	-	5	1254	c.1166A>G	c.(1165-1167)tAt>tGt	p.Y389C	ZNF112_ENST00000536500.1_Missense_Mutation_p.Y406C|ZNF112_ENST00000354340.4_Missense_Mutation_p.Y383C	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATTTTCCTCATATTCATGGGG	0.363																																																	0													84.0	78.0	80.0					19																	44833162		2203	4300	6503	SO:0001583	missense	0			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1166A>G	19.37:g.44833162T>C	ENSP00000337081:p.Tyr389Cys		A4FU53|Q9HCA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y406C	ENST00000337401.4	37	c.1217	CCDS54276.1	19	.	.	.	.	.	.	.	.	.	.	T	0.141	-1.102077	0.01828	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.06371	3.31;3.32;3.33	4.65	-2.63	0.06133	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31188	N	0.008099	T	0.00524	0.0017	N	0.00006	-3.21	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.45041	-0.9288	10	0.02654	T	1	-5.1538	1.1294	0.01742	0.2868:0.3492:0.1463:0.2177	.	388;406;389	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	C	389;389;383;406;388	ENSP00000337081:Y389C;ENSP00000346305:Y383C;ENSP00000441990:Y406C	ENSP00000253426:Y388C	Y	-	2	0	ZNF285	49525002	0.000000	0.05858	0.001000	0.08648	0.796000	0.44982	0.085000	0.14912	-0.503000	0.06586	-0.378000	0.06908	TAT	ZNF112	-	NULL	ENSG00000062370		0.363	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF112	HGNC	protein_coding	OTTHUMT00000460744.1	-	0.00	18	0	T	NM_013380		44833162	-1	tier1	-	no_errors	ENST00000536500	ensembl	human	known	74_37	missense	44.19	24	19	SNP	0.000	C
ZNF212	7988	genome.wustl.edu	37	7	148936991	148936991	+	Intron	SNP	T	T	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:148936991T>C	ENST00000335870.2	+	1	152					NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			GCCGGGGTCTTGGTTTCCCGG	0.716																																																	0																																										SO:0001627	intron_variant	0			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.24+98T>C	7.37:g.148936991T>C			B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	NULL	p.L41S	ENST00000335870.2	37	c.122	CCDS5896.1	7																																																																																			ZNF212	-	NULL	ENSG00000170260		0.716	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF212	HGNC	protein_coding	OTTHUMT00000352710.1	-	0.00	28	0	T	NM_012256		148936991	+1	tier1	-	no_errors	ENST00000462724	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.000	C
ZNF287	57336	genome.wustl.edu	37	17	16469934	16469934	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:16469934G>T	ENST00000395824.1	-	3	1023	c.406C>A	c.(406-408)Cct>Act	p.P136T	ZNF287_ENST00000461555.1_5'Flank|ZNF287_ENST00000395825.3_Missense_Mutation_p.P136T			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	129					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		GAGTTTTGAGGAGCTAGAGAA	0.453																																																	0													128.0	134.0	132.0					17																	16469934		2203	4300	6503	SO:0001583	missense	0			AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.406C>A	17.37:g.16469934G>T	ENSP00000379168:p.Pro136Thr		Q6IAG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P136T	ENST00000395824.1	37	c.406	CCDS11179.2	17	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342878	0.41498	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.05382	3.45;3.45	4.28	4.28	0.50868	Transcription regulator SCAN (1);	0.000000	0.44097	D	0.000492	T	0.11580	0.0282	L	0.46157	1.445	0.32541	N	0.533682	P	0.45634	0.863	P	0.50405	0.64	T	0.01294	-1.1393	10	0.48119	T	0.1	.	12.5419	0.56174	0.0:0.0:1.0:0.0	.	129	Q9HBT7	ZN287_HUMAN	T	136	ENSP00000379169:P136T;ENSP00000379168:P136T	ENSP00000379168:P136T	P	-	1	0	ZNF287	16410659	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	1.953000	0.40352	2.677000	0.91161	0.655000	0.94253	CCT	ZNF287	-	smart_Tscrpt_reg_SCAN	ENSG00000141040		0.453	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF287	HGNC	protein_coding	OTTHUMT00000130504.1	-	0.00	33	0	G			16469934	-1	tier1	-	no_errors	ENST00000395824	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.996	T
ZNF621	285268	genome.wustl.edu	37	3	40573853	40573853	+	Missense_Mutation	SNP	G	G	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr3:40573853G>C	ENST00000339296.5	+	5	1044	c.592G>C	c.(592-594)Gag>Cag	p.E198Q	ZNF621_ENST00000310898.1_Intron|ZNF621_ENST00000490457.1_Intron|ZNF621_ENST00000403205.2_Missense_Mutation_p.E198Q|ZNF621_ENST00000431278.1_Missense_Mutation_p.E87Q	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		TATTGTACATGAGAAAAACCA	0.443																																																	0													93.0	91.0	91.0					3																	40573853		2203	4300	6503	SO:0001583	missense	0			AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.592G>C	3.37:g.40573853G>C	ENSP00000340841:p.Glu198Gln		Q14DC7|Q8TE91	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E198Q	ENST00000339296.5	37	c.592	CCDS2693.1	3	.	.	.	.	.	.	.	.	.	.	g	0.007	-2.006728	0.00426	.	.	ENSG00000172888	ENST00000403205;ENST00000339296;ENST00000431278	T;T;T	0.17691	2.26;2.26;2.26	3.76	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41605	D	0.000853	T	0.06554	0.0168	N	0.02286	-0.61	0.80722	D	1	P;B	0.39094	0.659;0.391	B;B	0.42882	0.401;0.264	T	0.31613	-0.9937	10	0.02654	T	1	.	9.5825	0.39497	0.0:0.2142:0.7858:0.0	.	87;198	C9JZC2;Q6ZSS3	.;ZN621_HUMAN	Q	198;198;87	ENSP00000386051:E198Q;ENSP00000340841:E198Q;ENSP00000413236:E87Q	ENSP00000340841:E198Q	E	+	1	0	ZNF621	40548857	0.000000	0.05858	0.801000	0.32222	0.044000	0.14063	0.663000	0.25053	2.401000	0.81631	0.655000	0.94253	GAG	ZNF621	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172888		0.443	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF621	HGNC	protein_coding	OTTHUMT00000254178.2		0.00	35	0	G	NM_198484		40573853	+1			no_errors	ENST00000339296	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.982	C
ZNF750	79755	genome.wustl.edu	37	17	80790258	80790258	+	Missense_Mutation	SNP	A	A	C			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr17:80790258A>C	ENST00000269394.3	-	2	906	c.73T>G	c.(73-75)Tat>Gat	p.Y25D	TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	25					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AAACATTTATACTTGAAGGGC	0.408																																																	0													93.0	102.0	99.0					17																	80790258		2203	4300	6503	SO:0001583	missense	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.73T>G	17.37:g.80790258A>C	ENSP00000269394:p.Tyr25Asp		Q9H899	Missense_Mutation	SNP	NULL	p.Y25D	ENST00000269394.3	37	c.73	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614778	0.87359	.	.	ENSG00000141579	ENST00000269394	T	0.58358	0.34	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000011	T	0.72203	0.3431	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73363	-0.4006	9	.	.	.	-29.1617	15.3545	0.74418	1.0:0.0:0.0:0.0	.	25	Q32MQ0	ZN750_HUMAN	D	25	ENSP00000269394:Y25D	.	Y	-	1	0	ZNF750	78383547	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.160000	0.94734	2.214000	0.71695	0.533000	0.62120	TAT	ZNF750	-	NULL	ENSG00000141579		0.408	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	59	0	A	NM_024702		80790258	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	missense	73.68	25	70	SNP	1.000	C
ZNF804B	219578	genome.wustl.edu	37	7	88962859	88962859	+	Missense_Mutation	SNP	G	G	T			TCGA-Z6-A8JE-01A-11D-A37C-09	TCGA-Z6-A8JE-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a84c38da-9bf2-4a1b-be80-a58f22b44cff	7a2929d0-a1b6-4fde-86af-c153b1b66835	g.chr7:88962859G>T	ENST00000333190.4	+	4	1172	c.563G>T	c.(562-564)cGa>cTa	p.R188L		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	188							metal ion binding (GO:0046872)	p.R188L(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATGCCAAATCGACACCAATTA	0.413										HNSCC(36;0.09)																																							1	Substitution - Missense(1)	large_intestine(1)											113.0	109.0	111.0					7																	88962859		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.563G>T	7.37:g.88962859G>T	ENSP00000329638:p.Arg188Leu		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.R188L	ENST00000333190.4	37	c.563	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289724	0.40494	.	.	ENSG00000182348	ENST00000333190	T	0.05786	3.39	5.3	3.52	0.40303	.	0.129990	0.33938	N	0.004408	T	0.07458	0.0188	N	0.20401	0.57	0.27292	N	0.957828	D	0.64830	0.994	P	0.52672	0.706	T	0.22906	-1.0203	10	0.30078	T	0.28	-4.2873	10.2287	0.43243	0.2125:0.0:0.7875:0.0	.	188	A4D1E1	Z804B_HUMAN	L	188	ENSP00000329638:R188L	ENSP00000329638:R188L	R	+	2	0	ZNF804B	88800795	0.069000	0.21087	0.946000	0.38457	0.970000	0.65996	0.823000	0.27366	0.837000	0.34925	0.650000	0.86243	CGA	ZNF804B	-	NULL	ENSG00000182348		0.413	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2		0.00	30	0	G	NM_181646		88962859	+1			no_errors	ENST00000333190	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.640	T
