#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DYNC2H1	79659	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	103153739	103153739	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:103153739C>A	ENST00000375735.2	+	73	10959	c.10815C>A	c.(10813-10815)gaC>gaA	p.D3605E	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.D3612E|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3605					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TATTAAAGGACTCTCAACAAA	0.313																																						.											0													59.0	58.0	59.0					11																	103153739		1809	4063	5872	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10815C>A	11.37:g.103153739C>A	ENSP00000364887:p.Asp3605Glu		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	7.276	0.608177	0.14002	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.27890	1.64;1.64	5.05	-0.757	0.11054	.	0.224065	0.40818	N	0.001016	T	0.15609	0.0376	L	0.29908	0.895	0.58432	D	0.999999	B;B	0.19445	0.021;0.036	B;B	0.23852	0.022;0.049	T	0.30001	-0.9993	10	0.02654	T	1	.	8.4751	0.33007	0.0:0.3211:0.0:0.6789	.	3605;3612	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	E	3605;3612	ENSP00000364887:D3605E;ENSP00000381167:D3612E	ENSP00000364887:D3605E	D	+	3	2	DYNC2H1	102658949	0.970000	0.33590	0.998000	0.56505	0.978000	0.69477	-0.088000	0.11198	0.014000	0.14944	0.460000	0.39030	GAC		0.313	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ZBTB16	7704	hgsc.bcm.edu;mdanderson.org	37	11	113934295	113934295	+	Silent	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:113934295G>T	ENST00000335953.4	+	2	653	c.273G>T	c.(271-273)acG>acT	p.T91T	ZBTB16_ENST00000392996.2_Silent_p.T91T	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	91	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		ATACAGCCACGCTGCAAGCCA	0.527																																						.											0													72.0	62.0	66.0					11																	113934295		2201	4296	6497	SO:0001819	synonymous_variant	7704			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.273G>T	11.37:g.113934295G>T			Q8TAL4	Silent	SNP	ENST00000335953.4	37	CCDS8367.1																																																																																				0.527	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
REV1	51455	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	100038086	100038086	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:100038086C>T	ENST00000258428.3	-	11	1934	c.1706G>A	c.(1705-1707)tGt>tAt	p.C569Y	REV1_ENST00000393445.3_Missense_Mutation_p.C568Y|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	569	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGCTTCATCACAACTGACAGC	0.438								Direct reversal of damage																														.											0													142.0	123.0	129.0					2																	100038086		2203	4300	6503	SO:0001583	missense	51455			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1706G>A	2.37:g.100038086C>T	ENSP00000258428:p.Cys569Tyr		O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283368	0.59867	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.75938	-0.98;-0.98	5.29	5.29	0.74685	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.000000	0.85682	D	0.000000	D	0.88224	0.6379	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89663	0.3878	10	0.87932	D	0	.	19.2796	0.94048	0.0:1.0:0.0:0.0	.	569;568	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	Y	568;569	ENSP00000377091:C568Y;ENSP00000258428:C569Y	ENSP00000258428:C569Y	C	-	2	0	REV1	99404518	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	7.206000	0.77891	2.646000	0.89796	0.655000	0.94253	TGT		0.438	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
OXTR	5021	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	8809619	8809619	+	Missense_Mutation	SNP	G	G	T	rs200886854		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr3:8809619G>T	ENST00000316793.3	-	3	879	c.255C>A	c.(253-255)gaC>gaA	p.D85E	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	85					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	CCACCACCAGGTCGGCGATGC	0.627																																						.											0													49.0	45.0	46.0					3																	8809619		2203	4300	6503	SO:0001583	missense	5021				CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.255C>A	3.37:g.8809619G>T	ENSP00000324270:p.Asp85Glu		Q15071	Missense_Mutation	SNP	ENST00000316793.3	37	CCDS2570.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852767	0.71719	.	.	ENSG00000180914	ENST00000316793;ENST00000449615	D;T	0.87966	-2.32;-0.21	4.73	2.9	0.33743	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93733	0.7997	M	0.91090	3.175	0.53688	D	0.999974	D	0.89917	1.0	D	0.97110	1.0	D	0.93640	0.6964	10	0.87932	D	0	-39.5606	10.1125	0.42572	0.1693:0.0:0.8307:0.0	.	85	P30559	OXYR_HUMAN	E	85	ENSP00000324270:D85E;ENSP00000389587:D85E	ENSP00000324270:D85E	D	-	3	2	OXTR	8784619	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	4.195000	0.58400	0.987000	0.38709	0.313000	0.20887	GAC		0.627	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2		
MEGF10	84466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	126776527	126776527	+	Missense_Mutation	SNP	G	G	A	rs565304206	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr5:126776527G>A	ENST00000274473.6	+	19	2597	c.2330G>A	c.(2329-2331)cGc>cAc	p.R777H	MEGF10_ENST00000503335.2_Missense_Mutation_p.R777H	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	777	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGTACTTGCCGCACTGGATTC	0.468													G|||	4	0.000798722	0.0008	0.0014	5008	,	,		21967	0.0		0.0	False		,,,				2504	0.002					.											0													146.0	131.0	136.0					5																	126776527		2203	4300	6503	SO:0001583	missense	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2330G>A	5.37:g.126776527G>A	ENSP00000274473:p.Arg777His		Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326208	0.95708	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.29397	1.57;1.57	6.03	6.03	0.97812	EGF-like, laminin (2);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.42378	-0.9455	10	0.42905	T	0.14	-41.3444	20.5752	0.99366	0.0:0.0:1.0:0.0	.	777	Q96KG7	MEG10_HUMAN	H	777	ENSP00000423354:R777H;ENSP00000274473:R777H	ENSP00000274473:R777H	R	+	2	0	MEGF10	126804426	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	9.869000	0.99810	2.868000	0.98415	0.557000	0.71058	CGC		0.468	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
MAPKAP1	79109	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	9	128246857	128246857	+	Silent	SNP	T	T	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr9:128246857T>G	ENST00000373498.1	-	8	1140	c.1072A>C	c.(1072-1074)Agg>Cgg	p.R358R	MAPKAP1_ENST00000373503.3_Silent_p.R166R|MAPKAP1_ENST00000350766.3_Silent_p.R322R|MAPKAP1_ENST00000373497.5_Silent_p.R71R|MAPKAP1_ENST00000394063.1_Silent_p.R166R|MAPKAP1_ENST00000265960.3_Silent_p.R358R|MAPKAP1_ENST00000373511.2_Intron			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	358					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						CCGTCTGCCCTTGAACCTGGG	0.413																																						.											0													129.0	112.0	118.0					9																	128246857		2203	4300	6503	SO:0001819	synonymous_variant	79109			M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.1072A>C	9.37:g.128246857T>G			A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Silent	SNP	ENST00000373498.1	37	CCDS35140.1																																																																																				0.413	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054092.1		
DUSP21	63904	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	44703528	44703528	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrX:44703528C>T	ENST00000339042.4	+	1	280	c.150C>T	c.(148-150)gcC>gcT	p.A50A		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	50	Sufficient for mitochondrial localization. {ECO:0000250}.|Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						GCATCACCGCCATTGTCAATG	0.512																																						.											0													169.0	131.0	144.0					X																	44703528		2203	4300	6503	SO:0001819	synonymous_variant	63904			AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.150C>T	X.37:g.44703528C>T			Q0VDA6|Q6IAJ6|Q6YDQ8	Silent	SNP	ENST00000339042.4	37	CCDS14264.1																																																																																				0.512	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056323.1	NM_022076	
PJA1	64219	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	68382228	68382228	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrX:68382228T>A	ENST00000361478.1	-	2	1231	c.854A>T	c.(853-855)cAc>cTc	p.H285L	PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374571.4_Missense_Mutation_p.H230L|PJA1_ENST00000374583.1_Missense_Mutation_p.H285L|PJA1_ENST00000374584.3_Intron	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	285					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GGAAGTACTGTGTGGCATATC	0.502																																						.											0													84.0	71.0	75.0					X																	68382228		2203	4300	6503	SO:0001583	missense	64219			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.854A>T	X.37:g.68382228T>A	ENSP00000355014:p.His285Leu		A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	t	8.610	0.888911	0.17540	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.05258	3.47;3.47;3.47	3.07	1.87	0.25490	.	0.649262	0.13314	U	0.397237	T	0.08403	0.0209	L	0.44542	1.39	0.09310	N	1	D	0.59357	0.985	P	0.49477	0.612	T	0.26018	-1.0115	10	0.66056	D	0.02	-2.1912	4.5018	0.11867	0.0:0.1598:0.0:0.8402	.	285	Q8NG27	PJA1_HUMAN	L	200;285;285;230	ENSP00000363711:H285L;ENSP00000355014:H285L;ENSP00000363699:H230L	ENSP00000355014:H285L	H	-	2	0	PJA1	68298953	0.984000	0.35163	0.168000	0.22838	0.721000	0.41392	1.590000	0.36654	0.433000	0.26313	0.299000	0.19835	CAC		0.502	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
CXorf66	347487	hgsc.bcm.edu;mdanderson.org	37	X	139038874	139038874	+	Silent	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrX:139038874G>A	ENST00000370540.1	-	3	290	c.267C>T	c.(265-267)gcC>gcT	p.A89A		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	89						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TAGATGACTTGGCTGCTATGC	0.378																																						.											0													142.0	124.0	130.0					X																	139038874		2203	4300	6503	SO:0001819	synonymous_variant	347487				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.267C>T	X.37:g.139038874G>A				Silent	SNP	ENST00000370540.1	37	CCDS35411.1																																																																																				0.378	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403	
CUBN	8029	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	10	16941101	16941101	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr10:16941101C>T	ENST00000377833.4	-	54	8557	c.8492G>A	c.(8491-8493)tGt>tAt	p.C2831Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2831	CUB 21. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CGTCCAGGAACATCTGCTGTT	0.428																																						.											0													159.0	145.0	150.0					10																	16941101		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8492G>A	10.37:g.16941101C>T	ENSP00000367064:p.Cys2831Tyr		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760183	0.69763	.	.	ENSG00000107611	ENST00000377833	T	0.66280	-0.2	5.63	5.63	0.86233	CUB (5);	0.000000	0.51477	D	0.000095	D	0.86029	0.5835	H	0.95917	3.74	0.80722	D	1	D	0.60160	0.987	D	0.66497	0.944	D	0.89731	0.3926	10	0.87932	D	0	.	20.0433	0.97601	0.0:1.0:0.0:0.0	.	2831	O60494	CUBN_HUMAN	Y	2831	ENSP00000367064:C2831Y	ENSP00000367064:C2831Y	C	-	2	0	CUBN	16981107	1.000000	0.71417	0.999000	0.59377	0.465000	0.32709	7.396000	0.79891	2.817000	0.96982	0.561000	0.74099	TGT		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
BLNK	29760	broad.mit.edu;hgsc.bcm.edu	37	10	98006782	98006782	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr10:98006782T>C	ENST00000224337.5	-	2	212	c.71A>G	c.(70-72)gAt>gGt	p.D24G	BLNK_ENST00000413476.2_Missense_Mutation_p.D24G|BLNK_ENST00000495266.1_Missense_Mutation_p.D24G|BLNK_ENST00000371176.2_Missense_Mutation_p.D24G|BLNK_ENST00000427367.2_Missense_Mutation_p.D24G	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	24					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		GTTTTTAATATCATGGACCAT	0.269																																						.											0													63.0	75.0	71.0					10																	98006782		2203	4296	6499	SO:0001583	missense	29760			AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.71A>G	10.37:g.98006782T>C	ENSP00000224337:p.Asp24Gly		O75498|O75499|Q2MD49	Missense_Mutation	SNP	ENST00000224337.5	37	CCDS7446.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503963	0.44558	.	.	ENSG00000095585	ENST00000224337;ENST00000371176;ENST00000427367;ENST00000413476;ENST00000537049;ENST00000393894;ENST00000393889;ENST00000428924;ENST00000393898	.	.	.	5.85	4.52	0.55395	.	0.089414	0.85682	D	0.000000	T	0.60599	0.2281	M	0.78801	2.425	0.45662	D	0.998581	B;B;B;B;B	0.27997	0.004;0.197;0.096;0.004;0.153	B;B;B;B;B	0.27796	0.011;0.083;0.038;0.011;0.052	T	0.65450	-0.6165	9	0.72032	D	0.01	-28.8439	8.3876	0.32510	0.0:0.0998:0.0:0.9002	.	24;24;24;24;24	Q2MD54;Q2MD49;Q8WV28-2;Q2MD59;Q8WV28	.;.;.;.;BLNK_HUMAN	G	24;24;24;24;24;24;24;24;37	.	ENSP00000224337:D24G	D	-	2	0	BLNK	97996772	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.966000	0.49208	2.235000	0.73313	0.482000	0.46254	GAT		0.269	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049593.1	NM_013314	
NR4A1	3164	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	12	52448851	52448851	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr12:52448851G>A	ENST00000243050.1	+	3	1053	c.739G>A	c.(739-741)Gat>Aat	p.D247N	NR4A1_ENST00000545748.1_Missense_Mutation_p.D301N|NR4A1_ENST00000394824.2_Missense_Mutation_p.D247N|NR4A1_ENST00000360284.3_Missense_Mutation_p.D260N|NR4A1_ENST00000550082.1_Missense_Mutation_p.D260N|NR4A1_ENST00000394825.1_Missense_Mutation_p.D247N|NR4A1_ENST00000548232.1_Missense_Mutation_p.D247N	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	247					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GGGGATACTGGATACACCCGT	0.627																																						.											0													74.0	82.0	79.0					12																	52448851		2203	4300	6503	SO:0001583	missense	3164			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.739G>A	12.37:g.52448851G>A	ENSP00000243050:p.Asp247Asn		B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	ENST00000243050.1	37	CCDS8818.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092444	0.55968	.	.	ENSG00000123358	ENST00000360284;ENST00000545748;ENST00000550082;ENST00000243050;ENST00000394825;ENST00000394824;ENST00000548232	D;D;D;D;D;D;D	0.92858	-3.09;-3.11;-3.09;-3.09;-3.09;-3.09;-3.12	4.93	4.04	0.47022	.	1.015660	0.07897	N	0.972056	D	0.83797	0.5332	N	0.08118	0	0.54753	D	0.999983	B;B;B	0.26876	0.115;0.093;0.162	B;B;B	0.23419	0.035;0.046;0.034	T	0.70684	-0.4804	10	0.24483	T	0.36	.	12.6278	0.56640	0.0818:0.0:0.9182:0.0	.	260;247;247	B4DML7;P22736;Q15627	.;NR4A1_HUMAN;.	N	260;301;260;247;247;247;247	ENSP00000353427:D260N;ENSP00000440864:D301N;ENSP00000449539:D260N;ENSP00000243050:D247N;ENSP00000378302:D247N;ENSP00000378301:D247N;ENSP00000449587:D247N	ENSP00000243050:D247N	D	+	1	0	NR4A1	50735118	1.000000	0.71417	0.964000	0.40570	0.521000	0.34408	3.150000	0.50662	1.451000	0.47736	0.561000	0.74099	GAT		0.627	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317922.2		
JAG1	182	hgsc.bcm.edu;mdanderson.org	37	20	10626014	10626014	+	Silent	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr20:10626014G>T	ENST00000254958.5	-	16	2618	c.2103C>A	c.(2101-2103)acC>acA	p.T701T	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Silent_p.T542T	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	701	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GTGAGTGGCAGGTCTTTCCTT	0.527									Alagille Syndrome																													.											0			GRCh37	CD994168	JAG1	D							153.0	147.0	149.0					20																	10626014		2203	4300	6503	SO:0001819	synonymous_variant	182	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2103C>A	20.37:g.10626014G>T			A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																				0.527	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
CREG2	200407	hgsc.bcm.edu	37	2	102000023	102000024	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:102000023_102000024GC>TA	ENST00000324768.5	-	2	719_720	c.582_583GC>TA	c.(580-585)atGCtg>atTAtg	p.194_195ML>IM	CREG2_ENST00000495455.1_5'UTR	NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	194						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GATTCTGGCAGCATCAGCGAGG	0.545																																						.											0																																										SO:0001583	missense	200407			AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.582_583delinsTA	2.37:g.102000023_102000024delinsTA	ENSP00000315203:p.M194_L195delinsIM		Q86X03|Q8N540|Q8N9E3	Missense_Mutation	DNP	ENST00000324768.5	37	CCDS2052.1																																																																																				0.545	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836	
FAT4	79633	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	126369744	126369744	+	Missense_Mutation	SNP	G	G	A	rs201007539		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr4:126369744G>A	ENST00000394329.3	+	9	7586	c.7573G>A	c.(7573-7575)Gcc>Acc	p.A2525T	FAT4_ENST00000335110.5_Missense_Mutation_p.A823T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2525	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CATTATGGCCGCCGGACCACT	0.418																																						.											0													65.0	67.0	66.0					4																	126369744		2203	4299	6502	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7573G>A	4.37:g.126369744G>A	ENSP00000377862:p.Ala2525Thr		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	14.78	2.639072	0.47153	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.48522	0.81;0.81	5.72	4.89	0.63831	Cadherin (4);Cadherin-like (1);	0.000000	0.34110	U	0.004241	T	0.40694	0.1127	L	0.37561	1.115	0.43338	D	0.995382	D;B;B	0.55605	0.972;0.004;0.003	P;B;B	0.45099	0.469;0.004;0.002	T	0.15521	-1.0434	10	0.15066	T	0.55	.	14.9437	0.71014	0.0685:0.0:0.9315:0.0	.	823;2525;2525	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	2525;823	ENSP00000377862:A2525T;ENSP00000335169:A823T	ENSP00000335169:A823T	A	+	1	0	FAT4	126589194	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.440000	0.52886	1.441000	0.47550	-0.143000	0.13931	GCC		0.418	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
SPEN	23013	broad.mit.edu	37	1	16260459	16260459	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:16260459C>T	ENST00000375759.3	+	11	7928	c.7724C>T	c.(7723-7725)cCa>cTa	p.P2575L		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2575	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCGCCCCCGCCAGTTGACTCT	0.522																																						.											0													73.0	84.0	81.0					1																	16260459		2203	4300	6503	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7724C>T	1.37:g.16260459C>T	ENSP00000364912:p.Pro2575Leu		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	6.140	0.394125	0.11638	.	.	ENSG00000065526	ENST00000375759	T	0.09350	2.99	5.38	3.46	0.39613	.	.	.	.	.	T	0.12561	0.0305	L	0.50333	1.59	0.20403	N	0.999907	B	0.24258	0.1	B	0.21708	0.036	T	0.16660	-1.0395	9	0.29301	T	0.29	-0.4291	14.2989	0.66334	0.2718:0.7282:0.0:0.0	.	2575	Q96T58	MINT_HUMAN	L	2575	ENSP00000364912:P2575L	ENSP00000364912:P2575L	P	+	2	0	SPEN	16133046	0.000000	0.05858	0.014000	0.15608	0.688000	0.40055	0.853000	0.27777	0.616000	0.30141	0.561000	0.74099	CCA		0.522	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SPATA21	374955	broad.mit.edu	37	1	16731518	16731518	+	Missense_Mutation	SNP	C	C	T	rs140528029		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:16731518C>T	ENST00000335496.1	-	8	1237	c.755G>A	c.(754-756)gGc>gAc	p.G252D	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Missense_Mutation_p.G229D	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	252							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		CACAGAGAAGCCCATTAGGAG	0.587																																						.											0													109.0	91.0	97.0					1																	16731518		2203	4300	6503	SO:0001583	missense	374955				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.755G>A	1.37:g.16731518C>T	ENSP00000335612:p.Gly252Asp		B9EK40|F5GXP5	Missense_Mutation	SNP	ENST00000335496.1	37	CCDS172.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962510	0.53400	.	.	ENSG00000187144	ENST00000335496;ENST00000540400	D;D	0.84298	-1.83;-1.83	4.53	4.53	0.55603	EF-hand-like domain (1);	0.000000	0.56097	D	0.000032	D	0.92799	0.7710	M	0.88979	2.995	0.40552	D	0.98112	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93990	0.7266	10	0.87932	D	0	-17.4912	12.9323	0.58294	0.0:1.0:0.0:0.0	.	229;252	F5GXP5;Q7Z572	.;SPT21_HUMAN	D	252;229	ENSP00000335612:G252D;ENSP00000440046:G229D	ENSP00000335612:G252D	G	-	2	0	SPATA21	16604105	1.000000	0.71417	0.998000	0.56505	0.294000	0.27393	2.231000	0.43009	2.505000	0.84491	0.313000	0.20887	GGC		0.587	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006677.2	NM_198546	
SYCP1	6847	broad.mit.edu	37	1	115418696	115418696	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:115418696A>G	ENST00000369522.3	+	10	904	c.664A>G	c.(664-666)Ata>Gta	p.I222V	SYCP1_ENST00000369518.1_Missense_Mutation_p.I222V	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	222					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAGAAAATGATAACAGCTTT	0.274																																						.											0													46.0	49.0	48.0					1																	115418696		2203	4294	6497	SO:0001583	missense	6847			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.664A>G	1.37:g.115418696A>G	ENSP00000358535:p.Ile222Val		O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	CCDS879.1	.	.	.	.	.	.	.	.	.	.	A	4.011	-0.000587	0.07819	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.52295	0.67;0.67;0.67	5.52	0.545	0.17190	.	0.270468	0.43260	N	0.000599	T	0.10594	0.0259	L	0.29908	0.895	0.26560	N	0.973751	B;B	0.19073	0.033;0.033	B;B	0.23574	0.047;0.047	T	0.40739	-0.9547	10	0.02654	T	1	-6.9164	10.4389	0.44452	0.6334:0.0:0.3666:0.0	.	222;222	B7ZLS9;Q15431	.;SYCP1_HUMAN	V	222	ENSP00000358535:I222V;ENSP00000410011:I222V;ENSP00000358531:I222V	ENSP00000358531:I222V	I	+	1	0	SYCP1	115220219	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	0.924000	0.28777	-0.093000	0.12396	-1.162000	0.01777	ATA		0.274	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
LCE3C	353144	broad.mit.edu	37	1	152573449	152573449	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:152573449G>A	ENST00000333881.3	+	1	312	c.242G>A	c.(241-243)gGc>gAc	p.G81D		NM_178434.2	NP_848521.1	Q5T5A8	LCE3C_HUMAN	late cornified envelope 3C	81					keratinization (GO:0031424)					lung(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0313)|Kidney(5;0.0367)		GGTCAGCAAGGCGGGGGCTCC	0.602																																						.											0													34.0	33.0	33.0					1																	152573449		1810	2679	4489	SO:0001583	missense	353144			BI670516	CCDS1015.1	1q21.3	2008-02-05		2004-10-15	ENSG00000244057	ENSG00000244057		"""Late cornified envelopes"""	16612	protein-coding gene	gene with protein product		612615	"""small proline rich-like (epidermal differentiation complex) 3A"""	SPRL3A		11698679	Standard	NM_178434		Approved	LEP15	uc001fac.2	Q5T5A8	OTTHUMG00000014403	ENST00000333881.3:c.242G>A	1.37:g.152573449G>A	ENSP00000334644:p.Gly81Asp		A1L420	Missense_Mutation	SNP	ENST00000333881.3	37	CCDS1015.1	.	.	.	.	.	.	.	.	.	.	G	1.076	-0.668510	0.03403	.	.	ENSG00000244057	ENST00000333881	T	0.03607	3.87	4.01	3.09	0.35607	.	.	.	.	.	T	0.00524	0.0017	.	.	.	0.09310	N	1	B	0.22146	0.065	B	0.17098	0.017	T	0.44019	-0.9355	8	0.02654	T	1	.	9.2689	0.37659	0.0:0.7629:0.2371:0.0	.	81	Q5T5A8	LCE3C_HUMAN	D	81	ENSP00000334644:G81D	ENSP00000334644:G81D	G	+	2	0	LCE3C	150840073	0.000000	0.05858	0.019000	0.16419	0.008000	0.06430	-0.101000	0.10973	0.876000	0.35872	0.313000	0.20887	GGC		0.602	LCE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040061.2	NM_178434	
ASPM	259266	broad.mit.edu	37	1	197073232	197073232	+	Frame_Shift_Del	DEL	T	T	-	rs199422167		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:197073232delT	ENST00000367409.4	-	18	5405	c.5149delA	c.(5149-5151)atafs	p.I1717fs	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1717					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.I1717fs*1(2)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGTGCAGCTATTTTTTTGGAA	0.373																																						.											2	Deletion - Frameshift(2)	ovary(1)|large_intestine(1)	GRCh37	CD077387	ASPM	D							107.0	107.0	107.0					1																	197073232		2203	4298	6501	SO:0001589	frameshift_variant	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5149delA	1.37:g.197073232delT	ENSP00000356379:p.Ile1717fs		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Nonsense_Mutation	DEL	ENST00000367409.4	37	CCDS1389.1																																																																																				0.373	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
SIRT1	23411	broad.mit.edu	37	10	69644881	69644883	+	In_Frame_Del	DEL	GGC	GGC	-	rs561432931|rs36062014	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr10:69644881_69644883delGGC	ENST00000212015.6	+	1	455_457	c.402_404delGGC	c.(400-405)gaggcg>gag	p.A139del	SIRT1_ENST00000432464.1_5'Flank	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	139	Interaction with CLOCK. {ECO:0000250|UniProtKB:Q923E4}.|Interaction with HIST1H1E.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						aggaggaagaggcggcggcggcg	0.7														4	0.000798722	0.0023	0.0	5008	,	,		11397	0.0		0.0	False		,,,				2504	0.001					.											0										22,2122		7,8,1057						2.8	1.0			3	14,4796		4,6,2395	no	coding	SIRT1	NM_012238.4		11,14,3452	A1A1,A1R,RR		0.2911,1.0261,0.5177				36,6918				SO:0001651	inframe_deletion	23411			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.402_404delGGC	10.37:g.69644890_69644892delGGC	ENSP00000212015:p.Ala139del		Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	In_Frame_Del	DEL	ENST00000212015.6	37	CCDS7273.1																																																																																				0.700	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048296.1		
TEX40	25858	broad.mit.edu	37	11	64068336	64068336	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:64068336T>G	ENST00000328404.6	+	2	249	c.229T>G	c.(229-231)Tac>Gac	p.Y77D	TEX40_ENST00000539943.1_Missense_Mutation_p.Y35D|RP11-783K16.10_ENST00000539086.1_RNA	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	77					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											GGACGAGGGGTACAAGGCCAG	0.667											OREG0021050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													7.0	10.0	9.0					11																	64068336		2013	4129	6142	SO:0001583	missense	25858					11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.229T>G	11.37:g.64068336T>G	ENSP00000330877:p.Tyr77Asp	1073		Missense_Mutation	SNP	ENST00000328404.6	37		.	.	.	.	.	.	.	.	.	.	T	9.160	1.018388	0.19355	.	.	ENSG00000219435	ENST00000328404;ENST00000539943	T;T	0.40756	1.02;1.08	4.02	-1.11	0.09840	.	.	.	.	.	T	0.14056	0.0340	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19192	-1.0313	9	0.31617	T	0.26	.	3.455	0.07512	0.2683:0.0:0.2858:0.4459	.	77	Q9NTU4	CK020_HUMAN	D	77;35	ENSP00000330877:Y77D;ENSP00000443917:Y35D	ENSP00000330877:Y77D	Y	+	1	0	C11orf20	63824912	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.006000	0.12833	-0.195000	0.10382	-0.249000	0.11873	TAC		0.667	TEX40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001039496	
NEAT1	283131	broad.mit.edu	37	11	65190292	65190292	+	IGR	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:65190292C>T								FRMD8 (9296 upstream) : NEAT1 (21636 downstream)																							GGGAGGGATGCGCGCCTGGGT	0.597																																						.											0																																										SO:0001628	intergenic_variant	283131																															11.37:g.65190292C>T				RNA	SNP		37																																																																																				0	0.597								
MTL5	9633	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	68514791	68514791	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:68514791G>A	ENST00000255087.5	-	3	698	c.515C>T	c.(514-516)cCg>cTg	p.P172L	MTL5_ENST00000544963.1_Missense_Mutation_p.P172L|MTL5_ENST00000443940.2_Missense_Mutation_p.P172L|MTL5_ENST00000540869.1_5'UTR	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	172					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P172Q(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			TGCTTCTTCCGGATTATTACT	0.423																																						.											1	Substitution - Missense(1)	lung(1)											134.0	128.0	130.0					11																	68514791		2200	4294	6494	SO:0001583	missense	9633			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.515C>T	11.37:g.68514791G>A	ENSP00000255087:p.Pro172Leu		A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	G	1.720	-0.496866	0.04291	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.42131	1.59;0.98;1.57	5.1	-2.27	0.06846	.	1.095660	0.06919	N	0.809035	T	0.20700	0.0498	N	0.12746	0.255	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.0	T	0.19943	-1.0290	10	0.26408	T	0.33	-1.9232	4.6009	0.12352	0.3337:0.0:0.385:0.2813	.	172;155;172	Q9Y4I5-3;Q6PHY4;Q9Y4I5	.;.;MTL5_HUMAN	L	172	ENSP00000255087:P172L;ENSP00000403086:P172L;ENSP00000440968:P172L	ENSP00000255087:P172L	P	-	2	0	MTL5	68271367	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.165000	0.09968	-0.189000	0.10482	-0.215000	0.12644	CCG		0.423	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	
OR6T1	219874	broad.mit.edu	37	11	123814285	123814285	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:123814285C>T	ENST00000321252.2	-	1	295	c.261G>A	c.(259-261)acG>acA	p.T87T		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T87T(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TGTGATCCCCCGTGAGGATGA	0.507																																						.											1	Substitution - coding silent(1)	lung(1)											122.0	99.0	107.0					11																	123814285		2202	4299	6501	SO:0001819	synonymous_variant	219874			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.261G>A	11.37:g.123814285C>T			Q6IFE7	Silent	SNP	ENST00000321252.2	37	CCDS31700.1																																																																																				0.507	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187	
LETMD1	25875	broad.mit.edu;bcgsc.ca	37	12	51449713	51449713	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr12:51449713C>G	ENST00000262055.4	+	5	608	c.569C>G	c.(568-570)tCc>tGc	p.S190C	LETMD1_ENST00000418425.2_Missense_Mutation_p.S203C|LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000552739.1_Missense_Mutation_p.S73C|LETMD1_ENST00000547008.1_Intron|LETMD1_ENST00000550929.1_Missense_Mutation_p.S134C|LETMD1_ENST00000548516.1_Intron	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	190	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CGGAAGCAGTCCCACCCAGAA	0.448																																						.											0													94.0	95.0	95.0					12																	51449713		2203	4300	6503	SO:0001583	missense	25875			AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.569C>G	12.37:g.51449713C>G	ENSP00000262055:p.Ser190Cys		A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.21|16.21	3.059884|3.059884	0.55325|0.55325	.|.	.|.	ENSG00000050426|ENSG00000050426	ENST00000551931|ENST00000551477;ENST00000550755;ENST00000550929;ENST00000262055;ENST00000549340;ENST00000418425;ENST00000448283;ENST00000552739	.|T;T;T;T;T;T	.|0.43294	.|0.95;0.95;0.95;0.95;0.95;0.95	5.08|5.08	5.08|5.08	0.68730|0.68730	.|LETM1-like (1);	.|0.296675	.|0.37437	.|N	.|0.002081	T|T	0.51398|0.51398	0.1672|0.1672	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|D;P;D;P	.|0.58268	.|0.982;0.936;0.975;0.794	.|P;P;P;P	.|0.56343	.|0.789;0.552;0.796;0.552	T|T	0.37549|0.37549	-0.9701|-0.9701	5|10	.|0.35671	.|T	.|0.21	-6.2246|-6.2246	17.7887|17.7887	0.88546|0.88546	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|140;203;73;190	.|F8VVQ3;B3KXK7;F8VP71;Q6P1Q0	.|.;.;.;LTMD1_HUMAN	A|C	8|157;96;134;190;140;203;140;73	.|ENSP00000446862:S157C;ENSP00000450163:S134C;ENSP00000262055:S190C;ENSP00000449896:S140C;ENSP00000389903:S203C;ENSP00000450333:S73C	.|ENSP00000262055:S190C	P|S	+|+	1|2	0|0	LETMD1|LETMD1	49735980|49735980	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	2.032000|2.032000	0.41127|0.41127	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	CCC|TCC		0.448	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
NBEA	26960	broad.mit.edu	37	13	36167554	36167554	+	Silent	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr13:36167554A>G	ENST00000400445.3	+	47	7800	c.7266A>G	c.(7264-7266)agA>agG	p.R2422R	NBEA_ENST00000537702.1_Silent_p.R215R|NBEA_ENST00000379939.2_Silent_p.R2419R|NBEA_ENST00000379922.3_5'UTR|NBEA_ENST00000310336.4_Silent_p.R2422R|NBEA_ENST00000540320.1_Silent_p.R2422R	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2422	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGTCTTGGAGAACTAGTCAGA	0.343																																						.											0													130.0	117.0	121.0					13																	36167554		1834	4082	5916	SO:0001819	synonymous_variant	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7266A>G	13.37:g.36167554A>G			B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																				0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
RALGAPA1	253959	broad.mit.edu	37	14	36190999	36190999	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr14:36190999T>C	ENST00000389698.3	-	16	2551	c.2161A>G	c.(2161-2163)Agt>Ggt	p.S721G	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.S721G|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.S721G|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.S721G	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	721					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGATCACGACTCCATCCTCTA	0.433																																						.											0													102.0	95.0	98.0					14																	36190999		2203	4297	6500	SO:0001583	missense	253959			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.2161A>G	14.37:g.36190999T>C	ENSP00000374348:p.Ser721Gly		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.724374	0.89298	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	D;D;D;D;D	0.94828	-3.53;-3.53;-3.52;-3.53;-3.52	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.96163	0.8749	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.76494	0.996;0.994;0.999;0.976;0.965	D;D;D;P;P	0.83275	0.99;0.977;0.996;0.882;0.549	D	0.95302	0.8404	10	0.33141	T	0.24	-16.8152	16.1864	0.81955	0.0:0.0:0.0:1.0	.	721;721;721;721;721	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	G	721	ENSP00000374348:S721G;ENSP00000302647:S721G;ENSP00000258840:S721G;ENSP00000371803:S721G;ENSP00000451877:S721G	ENSP00000258840:S721G	S	-	1	0	RALGAPA1	35260750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.803000	0.85983	2.281000	0.76405	0.528000	0.53228	AGT		0.433	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
YLPM1	56252	broad.mit.edu	37	14	75301975	75301975	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr14:75301975G>A	ENST00000552421.1	+	19	4308	c.4184G>A	c.(4183-4185)tGg>tAg	p.W1395*	YLPM1_ENST00000325680.7_Nonsense_Mutation_p.W2101*			P49750	YLPM1_HUMAN	YLP motif containing 1	1906					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TAGGTCAGATGGGCAGACCTG	0.458																																						.											0													90.0	89.0	89.0					14																	75301975		1885	4112	5997	SO:0001587	stop_gained	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.4184G>A	14.37:g.75301975G>A	ENSP00000447921:p.Trp1395*		P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	ENST00000552421.1	37		.	.	.	.	.	.	.	.	.	.	G	47	13.313461	0.99734	.	.	ENSG00000119596	ENST00000552421;ENST00000325680	.	.	.	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0283	18.8429	0.92192	0.0:0.0:1.0:0.0	.	.	.	.	X	1395;2101	.	ENSP00000324463:W2101X	W	+	2	0	YLPM1	74371728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.446000	0.82766	0.563000	0.77884	TGG		0.458	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
CEP152	22995	broad.mit.edu	37	15	49052452	49052452	+	Silent	SNP	A	A	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr15:49052452A>T	ENST00000380950.2	-	19	2761	c.2574T>A	c.(2572-2574)gcT>gcA	p.A858A	CEP152_ENST00000399334.3_Silent_p.A858A|CEP152_ENST00000325747.5_Silent_p.A765A	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	858					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CATTTTGCACAGCTATTTCTA	0.393																																						.											0													119.0	111.0	114.0					15																	49052452		1859	4106	5965	SO:0001819	synonymous_variant	22995			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2574T>A	15.37:g.49052452A>T			E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	37	CCDS58361.1																																																																																				0.393	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
NOX5	79400	broad.mit.edu	37	15	69320701	69320701	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr15:69320701C>T	ENST00000388866.3	+	3	362	c.321C>T	c.(319-321)atC>atT	p.I107I	NOX5_ENST00000455873.3_Silent_p.I100I|NOX5_ENST00000448182.3_Silent_p.I89I|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000530406.2_Silent_p.I107I|NOX5_ENST00000260364.5_Silent_p.I89I	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	107	EF-hand 3; atypical; contains an insert of 28 residues. {ECO:0000255|PROSITE- ProRule:PRU00448}.|N-terminal regulatory region; interacts with the C-terminal catalytic region in a calcium-dependent manner.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						TGTATGACATCGATGGTAAGG	0.592																																						.											0													110.0	105.0	106.0					15																	69320701		2200	4298	6498	SO:0001819	synonymous_variant	79400			AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.321C>T	15.37:g.69320701C>T			B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	ENST00000388866.3	37	CCDS32276.2																																																																																				0.592	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505	
MYH13	8735	broad.mit.edu	37	17	10263502	10263502	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr17:10263502C>G	ENST00000418404.3	-	5	672	c.509G>C	c.(508-510)cGa>cCa	p.R170P	MYH13_ENST00000252172.4_Missense_Mutation_p.R170P			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	170	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTGGTTGTCTCGATCTAGAAA	0.418																																						.											0													85.0	85.0	85.0					17																	10263502		2177	4294	6471	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.509G>C	17.37:g.10263502C>G	ENSP00000404570:p.Arg170Pro		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062811	0.76187	.	.	ENSG00000006788	ENST00000252172	T	0.72942	-0.7	3.94	2.96	0.34315	Myosin head, motor domain (2);	.	.	.	.	D	0.86100	0.5852	M	0.92507	3.315	0.41551	D	0.988576	D	0.59357	0.985	D	0.77557	0.99	D	0.89034	0.3444	9	0.87932	D	0	.	12.3249	0.55005	0.0:0.9118:0.0:0.0882	.	170	Q9UKX3	MYH13_HUMAN	P	170	ENSP00000252172:R170P	ENSP00000252172:R170P	R	-	2	0	MYH13	10204227	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	3.790000	0.55461	2.194000	0.70268	0.655000	0.94253	CGA		0.418	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
CARD14	79092	broad.mit.edu	37	17	78178060	78178060	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr17:78178060T>A	ENST00000573882.1	+	19	2854	c.2318T>A	c.(2317-2319)aTc>aAc	p.I773N	RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA|RP11-334C17.5_ENST00000572730.1_RNA|CARD14_ENST00000344227.2_Missense_Mutation_p.I773N|RP11-334C17.5_ENST00000573346.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	773					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGTCCGCATCGTCAGTATG	0.572																																						.											0													54.0	45.0	48.0					17																	78178060		2202	4299	6501	SO:0001583	missense	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2318T>A	17.37:g.78178060T>A	ENSP00000458715:p.Ile773Asn		B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.689183	0.68271	.	.	ENSG00000141527	ENST00000344227	T	0.05580	3.42	4.08	4.08	0.47627	.	0.520215	0.19019	N	0.124877	T	0.18467	0.0443	M	0.67953	2.075	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.02015	-1.1229	10	0.27082	T	0.32	-21.5192	12.0436	0.53466	0.0:0.0:0.0:1.0	.	773	Q9BXL6	CAR14_HUMAN	N	773	ENSP00000344549:I773N	ENSP00000344549:I773N	I	+	2	0	CARD14	75792655	0.968000	0.33430	0.999000	0.59377	0.978000	0.69477	4.578000	0.60929	1.490000	0.48466	0.383000	0.25322	ATC		0.572	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
LOC644669	644669	broad.mit.edu	37	18	15323273	15323273	+	RNA	SNP	G	G	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr18:15323273G>C	ENST00000455308.2	-	0	575				RNU6-721P_ENST00000410155.1_RNA	NR_027417.1																						CTTATCAACTGCAATTGCATT	0.313																																						.											0																																												0																															18.37:g.15323273G>C				RNA	SNP	ENST00000455308.2	37																																																																																					0.313	AP005901.1-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373635.1		
SMYD1	150572	broad.mit.edu	37	2	88383883	88383883	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:88383883C>T	ENST00000419482.2	+	2	271	c.186C>T	c.(184-186)ctC>ctT	p.L62L	MIR4780_ENST00000584268.1_RNA|SMYD1_ENST00000444564.2_Silent_p.L62L|SMYD1_ENST00000438570.1_Silent_p.L62L|SMYD1_ENST00000468008.1_3'UTR	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	62	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.L62L(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						AGGAGAAGCTCCATCGCTGTG	0.512																																						.											1	Substitution - coding silent(1)	ovary(1)											107.0	91.0	97.0					2																	88383883		2203	4300	6503	SO:0001819	synonymous_variant	150572			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.186C>T	2.37:g.88383883C>T			A0AV30|A6NE13	Silent	SNP	ENST00000419482.2	37	CCDS33240.1																																																																																				0.512	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
CREG2	200407	broad.mit.edu	37	2	102000023	102000023	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:102000023G>T	ENST00000324768.5	-	2	720	c.583C>A	c.(583-585)Ctg>Atg	p.L195M	CREG2_ENST00000495455.1_5'UTR	NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	195						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GATTCTGGCAGCATCAGCGAG	0.547																																						.											0													66.0	62.0	63.0					2																	102000023		2203	4300	6503	SO:0001583	missense	200407			AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.583C>A	2.37:g.102000023G>T	ENSP00000315203:p.Leu195Met		Q86X03|Q8N540|Q8N9E3	Missense_Mutation	SNP	ENST00000324768.5	37	CCDS2052.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.183187	0.57800	.	.	ENSG00000175874	ENST00000324768	T	0.49432	0.78	5.93	5.06	0.68205	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.070444	0.64402	D	0.000017	T	0.49012	0.1532	L	0.31371	0.925	0.36684	D	0.879203	D	0.69078	0.997	D	0.68621	0.959	T	0.54289	-0.8316	10	0.24483	T	0.36	.	6.2953	0.21083	0.0702:0.1324:0.6603:0.1371	.	195	Q8IUH2	CREG2_HUMAN	M	195	ENSP00000315203:L195M	ENSP00000315203:L195M	L	-	1	2	CREG2	101366455	0.996000	0.38824	1.000000	0.80357	0.994000	0.84299	2.284000	0.43478	1.505000	0.48720	0.655000	0.94253	CTG		0.547	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836	
ECEL1	9427	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	233347864	233347864	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:233347864C>T	ENST00000304546.1	-	9	1742	c.1532G>A	c.(1531-1533)gGc>gAc	p.G511D	ECEL1_ENST00000409941.1_Missense_Mutation_p.G511D	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	511					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GTCCGGGTAGCCGACCATCAC	0.657																																						.											0													50.0	33.0	39.0					2																	233347864		2203	4299	6502	SO:0001583	missense	9427			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1532G>A	2.37:g.233347864C>T	ENSP00000302051:p.Gly511Asp		Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	C	31	5.104234	0.94245	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	D;D	0.90563	-2.69;-2.69	5.39	5.39	0.77823	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96103	0.8730	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96550	0.9407	10	0.87932	D	0	-10.712	19.1545	0.93504	0.0:1.0:0.0:0.0	.	511;511	O95672-2;O95672	.;ECEL1_HUMAN	D	511	ENSP00000302051:G511D;ENSP00000386333:G511D	ENSP00000302051:G511D	G	-	2	0	ECEL1	233056108	0.997000	0.39634	0.999000	0.59377	0.932000	0.56968	4.726000	0.61986	2.528000	0.85240	0.563000	0.77884	GGC		0.657	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
ILKAP	80895	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	239090747	239090747	+	Nonsense_Mutation	SNP	A	A	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:239090747A>C	ENST00000254654.3	-	9	970	c.795T>G	c.(793-795)taT>taG	p.Y265*		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	265	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TCCGCTCTTCATACTGAGTTG	0.483																																						.											0													322.0	282.0	295.0					2																	239090747		2203	4300	6503	SO:0001587	stop_gained	80895			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.795T>G	2.37:g.239090747A>C	ENSP00000254654:p.Tyr265*		B3KM39	Nonsense_Mutation	SNP	ENST00000254654.3	37	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	A	38	6.662059	0.97743	.	.	ENSG00000132323	ENST00000254654;ENST00000450411	.	.	.	5.37	-3.19	0.05171	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	5.6221	11.459	0.50199	0.5229:0.0:0.4771:0.0	.	.	.	.	X	265;82	.	ENSP00000254654:Y265X	Y	-	3	2	ILKAP	238755486	0.991000	0.36638	0.835000	0.33067	0.997000	0.91878	0.307000	0.19296	-0.906000	0.03866	0.533000	0.62120	TAT		0.483	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
KIAA1755	85449	broad.mit.edu;bcgsc.ca	37	20	36869241	36869241	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr20:36869241G>T	ENST00000279024.4	-	3	1563	c.1292C>A	c.(1291-1293)gCa>gAa	p.A431E		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	431										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGCTGCAGCTGCAGGAGAAGC	0.562																																						.											0													64.0	65.0	65.0					20																	36869241		2203	4300	6503	SO:0001583	missense	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1292C>A	20.37:g.36869241G>T	ENSP00000279024:p.Ala431Glu		Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	0.336	-0.953363	0.02285	.	.	ENSG00000149633	ENST00000279024	T	0.05382	3.45	4.18	-5.42	0.02640	.	1.213520	0.06010	N	0.649274	T	0.03095	0.0091	N	0.22421	0.69	0.09310	N	1	B	0.27498	0.18	B	0.23716	0.048	T	0.44097	-0.9350	10	0.02654	T	1	.	6.1358	0.20233	0.4644:0.3157:0.2199:0.0	.	431	Q5JYT7	K1755_HUMAN	E	431	ENSP00000279024:A431E	ENSP00000279024:A431E	A	-	2	0	KIAA1755	36302655	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.332000	0.07904	-0.796000	0.04456	-0.768000	0.03414	GCA		0.562	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
SLC35C2	51006	broad.mit.edu	37	20	44984494	44984494	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr20:44984494A>G	ENST00000372227.1	-	5	895	c.355T>C	c.(355-357)Tca>Cca	p.S119P	SLC35C2_ENST00000317734.8_Missense_Mutation_p.S119P|SLC35C2_ENST00000543605.1_Missense_Mutation_p.S148P|SLC35C2_ENST00000372230.5_Missense_Mutation_p.S119P|SLC35C2_ENST00000243896.2_Missense_Mutation_p.S119P|SLC35C2_ENST00000493599.1_5'Flank|SLC35C2_ENST00000372229.1_Intron	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2	119					negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				AGGACAGCTGAGGATTTGGTC	0.527																																						.											0													151.0	141.0	145.0					20																	44984494		2203	4300	6503	SO:0001583	missense	51006				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.355T>C	20.37:g.44984494A>G	ENSP00000361301:p.Ser119Pro		B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	Missense_Mutation	SNP	ENST00000372227.1	37	CCDS13396.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109718	0.77096	.	.	ENSG00000080189	ENST00000317734;ENST00000243896;ENST00000372227;ENST00000372230;ENST00000543605	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.94198	0.8138	M	0.89840	3.065	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;0.999;1.0	D;P;D;D	0.79108	0.992;0.763;0.991;0.963	D	0.94860	0.8021	10	0.56958	D	0.05	.	14.3057	0.66384	1.0:0.0:0.0:0.0	.	148;5;119;119	F5H4T9;B7Z6R4;Q9NQQ7-2;Q9NQQ7	.;.;.;S35C2_HUMAN	P	119;119;119;119;148	ENSP00000318960:S119P;ENSP00000243896:S119P;ENSP00000361301:S119P;ENSP00000361304:S119P;ENSP00000439974:S148P	ENSP00000243896:S119P	S	-	1	0	SLC35C2	44417901	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.269000	0.72558	2.217000	0.71921	0.533000	0.62120	TCA		0.527	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080363.1	NM_015945	
TYMP	1890	broad.mit.edu	37	22	50965605	50965605	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr22:50965605C>T	ENST00000252029.3	-	6	916	c.754G>A	c.(754-756)Gca>Aca	p.A252T	TYMP_ENST00000395678.3_Missense_Mutation_p.A252T|SCO2_ENST00000395693.3_5'Flank|CTA-384D8.36_ENST00000608319.1_RNA|TYMP_ENST00000395680.1_Missense_Mutation_p.A252T|SCO2_ENST00000535425.1_5'Flank|SCO2_ENST00000543927.1_5'Flank|SCO2_ENST00000252785.3_5'Flank|TYMP_ENST00000395681.1_Missense_Mutation_p.A252T	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	252					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	AGCGTCTTTGCCAGCTCCCGG	0.652																																						.											0													34.0	35.0	34.0					22																	50965605		2201	4300	6501	SO:0001583	missense	1890			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.754G>A	22.37:g.50965605C>T	ENSP00000252029:p.Ala252Thr		A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	ENST00000252029.3	37	CCDS14096.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503085	0.85176	.	.	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678;ENST00000425169	D;D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03;-5.03	4.6	3.56	0.40772	Glycosyl transferase, family 3 (3);	0.126268	0.51477	D	0.000099	D	0.99396	0.9787	H	0.98218	4.175	0.46222	D	0.998934	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68943	0.961;0.961;0.961	D	0.98541	1.0632	10	0.87932	D	0	-1.5027	12.6632	0.56826	0.0:0.8318:0.1682:0.0	.	252;252;252	B2RBL3;E5KRG5;P19971	.;.;TYPH_HUMAN	T	252;252;252;252;219	ENSP00000379037:A252T;ENSP00000379038:A252T;ENSP00000252029:A252T;ENSP00000379036:A252T;ENSP00000395875:A219T	ENSP00000252029:A252T	A	-	1	0	TYMP	49312471	1.000000	0.71417	0.972000	0.41901	0.695000	0.40330	6.059000	0.71133	1.047000	0.40274	0.561000	0.74099	GCA		0.652	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317081.1	NM_001953	
SIDT1	54847	broad.mit.edu	37	3	113342326	113342326	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr3:113342326G>T	ENST00000264852.4	+	22	2869	c.2143G>T	c.(2143-2145)Ggc>Tgc	p.G715C	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Missense_Mutation_p.G720C	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	715					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						CTACATGCTGGGCATCTTCAT	0.567																																						.											0													136.0	138.0	138.0					3																	113342326		2203	4300	6503	SO:0001583	missense	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2143G>T	3.37:g.113342326G>T	ENSP00000264852:p.Gly715Cys		Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	G	33	5.276712	0.95459	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.23552	1.9;1.9	5.62	5.62	0.85841	.	0.085246	0.51477	D	0.000099	T	0.47192	0.1432	L	0.61218	1.895	0.80722	D	1	D;D	0.64830	0.99;0.994	P;P	0.62014	0.831;0.897	T	0.21211	-1.0252	10	0.39692	T	0.17	-10.785	18.4243	0.90604	0.0:0.0:1.0:0.0	.	720;715	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	C	715;720	ENSP00000264852:G715C;ENSP00000377416:G720C	ENSP00000264852:G715C	G	+	1	0	SIDT1	114825016	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.646000	0.89796	0.655000	0.94253	GGC		0.567	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
BOD1L1	259282	broad.mit.edu	37	4	13615200	13615200	+	Silent	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr4:13615200T>C	ENST00000040738.5	-	5	1395	c.1260A>G	c.(1258-1260)gaA>gaG	p.E420E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	420	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										CAGTATCTTCTTCAAAAGATG	0.388																																						.											0													134.0	128.0	130.0					4																	13615200		2203	4300	6503	SO:0001819	synonymous_variant	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1260A>G	4.37:g.13615200T>C			Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																				0.388	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
TRIM15	89870	broad.mit.edu	37	6	30139748	30139748	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr6:30139748C>T	ENST00000376694.4	+	7	1489	c.1020C>T	c.(1018-1020)ggC>ggT	p.G340G	TRIM15_ENST00000376688.1_Intron	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	340	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						CGGTTCTGGGCTTCCCGGGCT	0.701																																						.											0													6.0	7.0	7.0					6																	30139748		1498	2677	4175	SO:0001819	synonymous_variant	89870			AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.1020C>T	6.37:g.30139748C>T			A2BEC9|O95604|Q8IUX9|Q9C018	Silent	SNP	ENST00000376694.4	37	CCDS4677.1																																																																																				0.701	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076026.2	NM_033229	
STXBP5	134957	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	147646106	147646106	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr6:147646106C>A	ENST00000321680.6	+	17	1814	c.1814C>A	c.(1813-1815)tCa>tAa	p.S605*	STXBP5_ENST00000367481.3_Nonsense_Mutation_p.S605*|STXBP5_ENST00000179882.6_Nonsense_Mutation_p.S276*|STXBP5_ENST00000367480.3_Nonsense_Mutation_p.S605*	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	605					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GTTAAAAACTCACCACTTAAA	0.333																																						.											0													56.0	60.0	59.0					6																	147646106		2203	4300	6503	SO:0001587	stop_gained	134957			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1814C>A	6.37:g.147646106C>A	ENSP00000321826:p.Ser605*		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Nonsense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	C	38	6.790862	0.97841	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	.	.	.	4.94	4.94	0.65067	.	0.279933	0.35320	N	0.003284	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	18.5225	0.90959	0.0:1.0:0.0:0.0	.	.	.	.	X	605;605;605;276	.	ENSP00000179882:S276X	S	+	2	0	STXBP5	147687799	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	5.657000	0.67996	2.438000	0.82558	0.655000	0.94253	TCA		0.333	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
ST7	7982	broad.mit.edu	37	7	116759716	116759716	+	Silent	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:116759716T>C	ENST00000393446.2	+	3	639	c.336T>C	c.(334-336)tcT>tcC	p.S112S	ST7_ENST00000393449.1_Silent_p.S112S|ST7_ENST00000393443.1_Silent_p.S62S|ST7-AS2_ENST00000432541.1_RNA|ST7_ENST00000393447.4_Silent_p.S69S|ST7_ENST00000422922.1_Silent_p.S66S|ST7-AS2_ENST00000434993.1_RNA|ST7_ENST00000393451.3_Silent_p.S112S|ST7-AS2_ENST00000442719.1_RNA|ST7_ENST00000432298.1_Silent_p.S66S|ST7_ENST00000323984.3_Silent_p.S112S|ST7_ENST00000265437.5_Silent_p.S112S|ST7_ENST00000465133.1_Silent_p.S69S|ST7_ENST00000487459.1_3'UTR|ST7_ENST00000393444.3_Silent_p.S69S			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ACAACAACTCTTCCAACAATT	0.413																																						.											0													103.0	105.0	104.0					7																	116759716		2203	4300	6503	SO:0001819	synonymous_variant	7982			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.336T>C	7.37:g.116759716T>C			A8K137|B4DRQ2	Silent	SNP	ENST00000393446.2	37																																																																																					0.413	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1	NM_021908	
FLNC	2318	broad.mit.edu	37	7	128483327	128483327	+	Silent	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:128483327C>T	ENST00000325888.8	+	17	2856	c.2595C>T	c.(2593-2595)caC>caT	p.H865H	FLNC_ENST00000346177.6_Silent_p.H865H	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	865					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						ACCCATCCCACGATGCCAGCA	0.642																																						.											0													33.0	38.0	36.0					7																	128483327		2075	4233	6308	SO:0001819	synonymous_variant	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2595C>T	7.37:g.128483327C>T			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																				0.642	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
KMT2C	58508	broad.mit.edu;mdanderson.org;bcgsc.ca	37	7	151855973	151855973	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:151855973G>A	ENST00000262189.6	-	44	11863	c.11645C>T	c.(11644-11646)aCt>aTt	p.T3882I	KMT2C_ENST00000355193.2_Missense_Mutation_p.T3882I	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3882					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAACGTGTCAGTGCTAGAGTA	0.488																																						.											0													404.0	372.0	383.0					7																	151855973		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11645C>T	7.37:g.151855973G>A	ENSP00000262189:p.Thr3882Ile		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330519	0.24167	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.88354	-1.73;-1.79;-2.37	5.56	1.33	0.21861	.	1.403890	0.05210	U	0.506622	D	0.86439	0.5933	L	0.38175	1.15	0.19300	N	0.999975	B;B;B	0.32526	0.201;0.374;0.374	B;B;B	0.36186	0.092;0.219;0.143	T	0.75274	-0.3375	10	0.62326	D	0.03	.	12.502	0.55960	0.0:0.3803:0.5009:0.1188	.	3882;2943;3882	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	I	3882;3882;468	ENSP00000262189:T3882I;ENSP00000347325:T3882I;ENSP00000410411:T468I	ENSP00000262189:T3882I	T	-	2	0	MLL3	151486906	0.028000	0.19301	0.000000	0.03702	0.023000	0.10783	1.857000	0.39399	0.347000	0.23924	0.591000	0.81541	ACT		0.488	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SWI5	375757	broad.mit.edu	37	9	131046910	131046910	+	Splice_Site	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr9:131046910A>G	ENST00000320188.5	+	3	548	c.548A>G	c.(547-549)gAa>gGa	p.E183G	SWI5_ENST00000418976.1_Splice_Site_p.E78G|SWI5_ENST00000495313.1_Splice_Site_p.E87G|SWI5_ENST00000419867.2_Splice_Site_p.E118G|SWI5_ENST00000608796.1_Splice_Site_p.E118G	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	183					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											TTCGTATCTGAGTAAGTTTCA	0.512																																						.											0													102.0	108.0	106.0					9																	131046910		1979	4158	6137	SO:0001630	splice_region_variant	375757			BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.548+1A>G	9.37:g.131046910A>G			Q5SYX7|Q5SYX8|Q8N2W6	Missense_Mutation	SNP	ENST00000320188.5	37	CCDS43883.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	19.42|19.42|19.42	3.823333|3.823333|3.823333	0.71143|0.71143|0.71143	.|.|.	.|.|.	ENSG00000175854|ENSG00000175854|ENSG00000175854	ENST00000320188|ENST00000495313;ENST00000372898|ENST00000418976	.|.|.	.|.|.	.|.|.	5.32|5.32|5.32	4.18|4.18|4.18	0.49190|0.49190|0.49190	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.73079|0.73079|.	0.3541|0.3541|.	M|M|M	0.83603|0.83603|0.83603	2.65|2.65|2.65	0.45342|0.45342|0.45342	D|D|D	0.998339|0.998339|0.998339	D|.|.	0.89917|.|.	1.0|.|.	D|.|.	0.91635|.|.	0.999|.|.	T|T|.	0.73235|0.73235|.	-0.4047|-0.4047|.	9|5|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	8.945|8.945|8.945	0.35753|0.35753|0.35753	0.9143:0.0:0.0857:0.0|0.9143:0.0:0.0857:0.0|0.9143:0.0:0.0857:0.0	.|.|.	183|.|.	Q1ZZU3|.|.	SWI5_HUMAN|.|.	G|E|W	183|97;93|110	.|.|.	ENSP00000316609:E183G|.|.	E|K|X	+|+|+	2|1|3	0|0|0	SWI5|SWI5|SWI5	130086731|130086731|130086731	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.776000|0.776000|0.776000	0.43924|0.43924|0.43924	3.514000|3.514000|3.514000	0.53422|0.53422|0.53422	0.964000|0.964000|0.964000	0.38108|0.38108|0.38108	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAA|AAG|TGA		0.512	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001040011	Missense_Mutation
TSC1	7248	broad.mit.edu	37	9	135797337	135797349	+	Frame_Shift_Del	DEL	CGAGATAGACTTC	CGAGATAGACTTC	-	rs118203393|rs118203392|rs118203395|rs397514794|rs118203394		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	CGAGATAGACTTC	CGAGATAGACTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr9:135797337_135797349delCGAGATAGACTTC	ENST00000298552.3	-	7	741_753	c.520_532delGAAGTCTATCTCG	c.(520-534)gaagtctatctcgtcfs	p.EVYLV174fs	TSC1_ENST00000403810.1_Frame_Shift_Del_p.EVYLV174fs|TSC1_ENST00000545250.1_Frame_Shift_Del_p.EVYLV123fs|TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000440111.2_Frame_Shift_Del_p.EVYLV174fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	174					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.E174*(1)|p.V178L(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TGGAGATGGACGAGATAGACTTCCGCCACGTGG	0.474			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	3	Substitution - Missense(1)|Unknown(1)|Substitution - Nonsense(1)	lung(2)|bone(1)	GRCh37	CD972479|CM090913	TSC1	D|M	rs118203392																																			SO:0001589	frameshift_variant	7248	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.520_532delGAAGTCTATCTCG	9.37:g.135797337_135797349delCGAGATAGACTTC	ENSP00000298552:p.Glu174fs		B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	37	CCDS6956.1																																																																																				0.474	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
MT-CO1	4512	broad.mit.edu	37	M	7059	7059	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrM:7059G>A	ENST00000361624.2	+	1	1156	c.1156G>A	c.(1156-1158)Gta>Ata	p.V386I	MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	386					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CAATAGGAGCTGTATTTGCCA	0.433																																						.											0																																										SO:0001583	missense	5742					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1156G>A	M.37:g.7059G>A	ENSP00000354499:p.Val386Ile		Q34770	Missense_Mutation	SNP	ENST00000361624.2	37																																																																																					0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
PCDH11X	27328	broad.mit.edu	37	X	91090725	91090725	+	Silent	SNP	G	G	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrX:91090725G>T	ENST00000373094.1	+	1	1067	c.222G>T	c.(220-222)ctG>ctT	p.L74L	PCDH11X_ENST00000373088.1_Silent_p.L74L|PCDH11X_ENST00000298274.8_Silent_p.L74L|PCDH11X_ENST00000406881.1_Silent_p.L74L|PCDH11X_ENST00000395337.2_Silent_p.L74L|PCDH11X_ENST00000373097.1_Silent_p.L74L|PCDH11X_ENST00000361655.2_Silent_p.L74L|PCDH11X_ENST00000361724.1_Silent_p.L74L|PCDH11X_ENST00000504220.2_Silent_p.L74L	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	74	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ATGTGCCACTGATTCGAATTG	0.453																																					NSCLC(38;925 1092 2571 38200 45895)	.											0													190.0	159.0	169.0					X																	91090725		2203	4300	6503	SO:0001819	synonymous_variant	27328			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.222G>T	X.37:g.91090725G>T			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																				0.453	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
FCGBP	8857	broad.mit.edu	37	19	40396331	40396332	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr19:40396331_40396332insC	ENST00000221347.6	-	15	7072_7073	c.7065_7066insG	c.(7063-7068)ccgagcfs	p.S2356fs		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2356	Cys-rich.|TIL 5.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCGACAGGCTCGGGCAGCTCC	0.649																																						.											0																																										SO:0001589	frameshift_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7066dupG	19.37:g.40396332_40396332dupC	ENSP00000221347:p.Ser2356fs		O95784	Frame_Shift_Ins	INS	ENST00000221347.6	37	CCDS12546.1																																																																																				0.649	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CELSR3	1951	broad.mit.edu	37	3	48694660	48694661	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr3:48694660_48694661insG	ENST00000164024.4	-	2	4149_4150	c.3869_3870insC	c.(3868-3870)ccgfs	p.P1290fs	CELSR3_ENST00000544264.1_Frame_Shift_Ins_p.P1290fs	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1290					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGCCCAGCAGCGGTGACAGGAA	0.634																																						.											0																																										SO:0001589	frameshift_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3870dupC	3.37:g.48694662_48694662dupG	ENSP00000164024:p.Pro1290fs		O75092	Frame_Shift_Ins	INS	ENST00000164024.4	37	CCDS2775.1																																																																																				0.634	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
HLA-DPB1	3115	broad.mit.edu	37	6	33048688	33048689	+	Frame_Shift_Ins	INS	-	-	A	rs141530233|rs534577141	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr6:33048688_33048689insA	ENST00000418931.2	+	2	456_457	c.340_341insA	c.(340-342)gggfs	p.G114fs	HLA-DPB1_ENST00000471184.1_3'UTR|HLA-DPA1_ENST00000419277.1_5'Flank|HLA-DPB1_ENST00000535465.1_Frame_Shift_Ins_p.G114fs	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	114	Beta-1.		G -> E (in allele DPB1*01:01, allele DPB1*03:01, allele DPB1*03:02, allele DPB1*04:03, allele DPB1*05:01, allele DPB1*05:02, allele DPB1*06:01, allele DPB1*08:01, allele DPB1*08:02, allele DPB1*09:01, allele DPB1*09:02, allele DPB1*10:01, allele DPB1*11:01, allele DPB1*13:01, allele DPB1*13:02, allele DPB1*14:01, allele DPB1*14:02, allele DPB1*16:01, allele DPB1*17:01, allele DPB1*17:02, allele DPB1*19:01, allele DPB1*21:01, allele DPB1*21:02, allele DPB1*20:01, allele DPB1*22:01, allele DPB1*22:02, allele DPB1*25:01, allele DPB1*25:02, allele DPB1*26:01, allele DPB1*27:01, allele DPB1*29:01, allele DPB1*30:01, allele DPB1*31:01, allele DPB1*35:01, allele DPB1*36:01, allele DPB1*37:01, allele DPB1*38:01, allele DPB1*44:01, allele DPB1*45:01, allele DPB1*50:01, allele DPB1*52:01, allele DPB1*54:01, allele DPB1*55:01, allele DPB1*56:01, allele DPB1*57:01, allele DPB1*58:01, allele DPB1*63:01, allele DPB1*65:01, allele DPB1*67:01, allele DPB1*68:01, allele DPB1*69:01, allele DPB1*70:01, allele DPB1*76:01, allele DPB1*78:01, allele DPB1*79:01, allele DPB1*84:01, allele DPB1*85:01, allele DPB1*87:01, allele DPB1*88:01, allele DPB1*89:01, allele DPB1*90:01, allele DPB1*91:01, allele DPB1*92:01, allele DPB1*93:01, allele DPB1*97:01 and allele DPB1*98:01; dbSNP:rs9277354). {ECO:0000269|PubMed:6330724}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						CGAGCTGGGCGGGCCCATGACC	0.708																																						.											0										2094,2108		551,992,558						-3.9	0.0		dbSNP_134	20	2192,6010		354,1484,2263	no	frameshift	HLA-DPB1	NM_002121.5		905,2476,2821	A1A1,A1R,RR		26.7252,49.8334,34.5534				4286,8118				SO:0001589	frameshift_variant	3115				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	Exception_encountered	6.37:g.33048688_33048689insA	ENSP00000408146:p.Gly114fs		A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Frame_Shift_Ins	INS	ENST00000418931.2	37	CCDS4765.1																																																																																				0.708	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	
AIFM2	84883	ucsc.edu	37	10	71877654	71877654	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr10:71877654A>C	ENST00000307864.1	-	6	743	c.530T>G	c.(529-531)gTg>gGg	p.V177G	AIFM2_ENST00000482166.1_5'UTR|AIFM2_ENST00000373248.1_Missense_Mutation_p.V177G	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	177					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						AGCCAGGGCCACTTGGGAGTG	0.592																																						.											0													74.0	69.0	71.0					10																	71877654		2203	4300	6503	SO:0001583	missense	84883			AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.530T>G	10.37:g.71877654A>C	ENSP00000312370:p.Val177Gly		B3KXI0|Q63Z39	Missense_Mutation	SNP	ENST00000307864.1	37	CCDS7297.1	.	.	.	.	.	.	.	.	.	.	A	8.823	0.937925	0.18206	.	.	ENSG00000042286	ENST00000373248;ENST00000307864;ENST00000395039	T;T	0.56444	0.46;0.46	5.58	4.44	0.53790	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.538267	0.21743	N	0.069795	T	0.28863	0.0716	N	0.03324	-0.35	0.21627	N	0.999619	B	0.27166	0.17	B	0.32289	0.143	T	0.18493	-1.0335	10	0.23302	T	0.38	-12.9655	10.0053	0.41953	0.8647:0.0:0.1353:0.0	.	177	Q9BRQ8	AIFM2_HUMAN	G	177;177;137	ENSP00000362345:V177G;ENSP00000312370:V177G	ENSP00000312370:V177G	V	-	2	0	AIFM2	71547660	0.000000	0.05858	0.026000	0.17262	0.898000	0.52572	1.364000	0.34171	2.133000	0.65898	0.402000	0.26972	GTG		0.592	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048487.1	NM_032797	
CYP26C1	340665	ucsc.edu	37	10	94825774	94825774	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr10:94825774T>C	ENST00000285949.5	+	5	923	c.923T>C	c.(922-924)cTc>cCc	p.L308P		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	308					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				AGCACCTCGCTCGTCCTGCTG	0.716																																						.											0													9.0	9.0	9.0					10																	94825774		2166	4233	6399	SO:0001583	missense	340665				CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.923T>C	10.37:g.94825774T>C	ENSP00000285949:p.Leu308Pro		Q5VXH6	Missense_Mutation	SNP	ENST00000285949.5	37	CCDS7425.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.612459	0.87258	.	.	ENSG00000187553	ENST00000285949	T	0.69561	-0.41	5.27	5.27	0.74061	.	0.139535	0.49305	D	0.000149	D	0.82342	0.5016	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85090	0.0951	10	0.72032	D	0.01	-31.2296	15.2251	0.73345	0.0:0.0:0.0:1.0	.	308	Q6V0L0	CP26C_HUMAN	P	308	ENSP00000285949:L308P	ENSP00000285949:L308P	L	+	2	0	CYP26C1	94815764	1.000000	0.71417	0.965000	0.40720	0.836000	0.47400	7.973000	0.88032	1.997000	0.58415	0.397000	0.26171	CTC		0.716	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374	
ELFN2	114794	ucsc.edu	37	22	37769129	37769129	+	Missense_Mutation	SNP	C	C	T	rs61737924		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr22:37769129C>T	ENST00000402918.2	-	3	3231	c.2446G>A	c.(2446-2448)Gcc>Acc	p.A816T	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.8_ENST00000609322.1_RNA|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	816					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TTCTGCTGGGCGGAGACCCCC	0.662																																						.											0													57.0	52.0	54.0					22																	37769129		2203	4300	6503	SO:0001583	missense	114794			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.2446G>A	22.37:g.37769129C>T	ENSP00000385277:p.Ala816Thr		Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	37	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913449	0.92178	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.67171	-0.25;-0.25	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.72542	0.3473	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.77422	-0.2594	10	0.87932	D	0	-33.9132	17.8461	0.88730	0.0:1.0:0.0:0.0	.	816	Q5R3F8	PPR29_HUMAN	T	816	ENSP00000300147:A816T;ENSP00000385277:A816T	ENSP00000300147:A816T	A	-	1	0	ELFN2	36099075	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.575000	0.82447	2.265000	0.75225	0.561000	0.74099	GCC		0.662	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906	
FOCAD	54914	ucsc.edu	37	9	20986432	20986432	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr9:20986432A>G	ENST00000380249.1	+	42	5238	c.4874A>G	c.(4873-4875)tAc>tGc	p.Y1625C	FOCAD_ENST00000338382.6_Missense_Mutation_p.Y1625C|FOCAD_ENST00000605086.1_Missense_Mutation_p.Y1061C	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1625						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CACAGCTTATACCAGGCACGG	0.522																																						.											0													120.0	89.0	99.0					9																	20986432		2203	4300	6503	SO:0001583	missense	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4874A>G	9.37:g.20986432A>G	ENSP00000369599:p.Tyr1625Cys		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.292997	0.80914	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.26660	1.72;1.72	5.72	5.72	0.89469	.	0.064498	0.64402	D	0.000005	T	0.50905	0.1643	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.50346	-0.8839	10	0.49607	T	0.09	-8.4471	15.998	0.80265	1.0:0.0:0.0:0.0	.	1625	Q5VW36	K1797_HUMAN	C	1625	ENSP00000369599:Y1625C;ENSP00000344307:Y1625C	ENSP00000344307:Y1625C	Y	+	2	0	KIAA1797	20976432	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.436000	0.66538	2.183000	0.69458	0.455000	0.32223	TAC		0.522	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
IZUMO2	126123	ucsc.edu	37	19	50666389	50666389	+	Silent	SNP	G	G	A	rs61742305	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr19:50666389G>A	ENST00000293405.3	-	1	63	c.63C>T	c.(61-63)tgC>tgT	p.C21C		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	21						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CGCACTGCAGGCAGCCCCAGC	0.706													G|||	587	0.117212	0.0159	0.1643	5008	,	,		12810	0.0625		0.2485	False		,,,				2504	0.1421					.											0								G		174,3710		4,166,1772	10.0	14.0	13.0		63	2.4	1.0	19	dbSNP_129	13	1851,6415		214,1423,2496	no	coding-synonymous	IZUMO2	NM_152358.2		218,1589,4268	AA,AG,GG		22.3929,4.4799,16.6667		21/222	50666389	2025,10125	1942	4133	6075	SO:0001819	synonymous_variant	126123			AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.63C>T	19.37:g.50666389G>A			Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Silent	SNP	ENST00000293405.3	37	CCDS12792.2																																																																																				0.706	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
JAG2	3714	ucsc.edu	37	14	105614515	105614515	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr14:105614515T>C	ENST00000331782.3	-	17	2589	c.2186A>G	c.(2185-2187)gAc>gGc	p.D729G	JAG2_ENST00000347004.2_Missense_Mutation_p.D691G	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	729	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GTCGCCGCTGTCGTAGCAGGT	0.716																																						.											0													16.0	11.0	13.0					14																	105614515		2102	4139	6241	SO:0001583	missense	3714			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.2186A>G	14.37:g.105614515T>C	ENSP00000328169:p.Asp729Gly		Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	t	16.98	3.270379	0.59540	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.95554	-3.74;-3.74	4.67	4.67	0.58626	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.054503	0.64402	D	0.000001	D	0.97096	0.9051	M	0.75447	2.3	0.58432	D	0.999994	D;D	0.71674	0.998;0.997	D;D	0.69824	0.966;0.925	D	0.97501	1.0060	10	0.72032	D	0.01	.	12.926	0.58260	0.0:0.0:0.0:1.0	.	691;729	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	G	729;691	ENSP00000328169:D729G;ENSP00000328566:D691G	ENSP00000328169:D729G	D	-	2	0	JAG2	104685560	1.000000	0.71417	0.974000	0.42286	0.013000	0.08279	4.099000	0.57755	1.745000	0.51790	0.254000	0.18369	GAC		0.716	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
KLRG2	346689	ucsc.edu;bcgsc.ca	37	7	139168253	139168253	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:139168253T>C	ENST00000340940.4	-	1	205	c.136A>G	c.(136-138)Agc>Ggc	p.S46G	KLRG2_ENST00000393039.2_Missense_Mutation_p.S46G	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	46	Pro-rich.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					CTTGGGCTGCTTTCGGGACCT	0.721																																						.											0													13.0	16.0	15.0					7																	139168253		1980	4042	6022	SO:0001583	missense	346689			AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.136A>G	7.37:g.139168253T>C	ENSP00000339356:p.Ser46Gly		Q2NL79|Q6ZTV6	Missense_Mutation	SNP	ENST00000340940.4	37	CCDS5854.1	.	.	.	.	.	.	.	.	.	.	T	13.25	2.180967	0.38511	.	.	ENSG00000188883	ENST00000340940;ENST00000393039	T;T	0.48836	3.78;0.8	3.55	0.944	0.19537	.	1.345140	0.05333	U	0.528670	T	0.28962	0.0719	N	0.24115	0.695	0.09310	N	1	P;P	0.37500	0.597;0.597	B;B	0.31614	0.133;0.098	T	0.17623	-1.0363	10	0.45353	T	0.12	-3.6868	3.0292	0.06101	0.0:0.2195:0.3131:0.4674	.	46;46	A4D1S0-2;A4D1S0	.;KLRG2_HUMAN	G	46	ENSP00000339356:S46G;ENSP00000376759:S46G	ENSP00000339356:S46G	S	-	1	0	KLRG2	138818793	0.130000	0.22417	0.004000	0.12327	0.163000	0.22366	0.056000	0.14256	-0.008000	0.14320	0.254000	0.18369	AGC		0.721	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508	
LYPD1	116372	ucsc.edu	37	2	133427465	133427465	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr2:133427465A>G	ENST00000397463.2	-	1	313	c.41T>C	c.(40-42)tTc>tCc	p.F14S	LYPD1_ENST00000345008.6_Intron|AC010974.3_ENST00000450509.1_RNA	NM_144586.5	NP_653187.3	Q8N2G4	LYPD1_HUMAN	LY6/PLAUR domain containing 1	14						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				lung(2)	2						TGGAAGCAAGAACAATCCGCA	0.642																																						.											0													49.0	57.0	54.0					2																	133427465		1998	4158	6156	SO:0001583	missense	116372			AK075487	CCDS42759.1, CCDS46416.1	2q21.2	2008-02-05		2005-08-30	ENSG00000150551	ENSG00000150551			28431	protein-coding gene	gene with protein product		610450		LYPDC1		12477932	Standard	NM_144586		Approved	MGC29643	uc002ttn.3	Q8N2G4	OTTHUMG00000153609	ENST00000397463.2:c.41T>C	2.37:g.133427465A>G	ENSP00000380605:p.Phe14Ser		H7BXW6|Q6ZP52|Q6ZWI4|Q96AC2	Missense_Mutation	SNP	ENST00000397463.2	37	CCDS42759.1	.	.	.	.	.	.	.	.	.	.	A	14.19	2.461515	0.43736	.	.	ENSG00000150551	ENST00000409034;ENST00000397463	D	0.82167	-1.58	5.52	3.12	0.35913	.	0.117881	0.38381	N	0.001702	T	0.65312	0.2679	N	0.14661	0.345	0.80722	D	1	B;B	0.27732	0.187;0.018	B;B	0.21360	0.024;0.034	T	0.62329	-0.6877	10	0.87932	D	0	4.0E-4	5.4946	0.16795	0.5665:0.3455:0.088:0.0	.	14;30	Q8N2G4;Q8N2G4-3	LYPD1_HUMAN;.	S	37;14	ENSP00000380605:F14S	ENSP00000380605:F14S	F	-	2	0	LYPD1	133143935	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	1.260000	0.32968	0.896000	0.36366	0.260000	0.18958	TTC		0.642	LYPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331821.1	NM_144586	
RFX7	64864	ucsc.edu	37	15	56388045	56388045	+	Silent	SNP	A	A	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr15:56388045A>T	ENST00000559447.2	-	9	1861	c.1590T>A	c.(1588-1590)gcT>gcA	p.A530A	RFX7_ENST00000423270.1_Silent_p.A627A|RFX7_ENST00000422057.1_Silent_p.A530A|RFX7_ENST00000317318.6_Silent_p.A627A			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	530					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGTTCTGAGAAGCAACTGATA	0.428																																						.											0													83.0	80.0	81.0					15																	56388045		1997	4171	6168	SO:0001819	synonymous_variant	64864					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1590T>A	15.37:g.56388045A>T			Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Silent	SNP	ENST00000559447.2	37																																																																																					0.428	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
SOGA3	387104	ucsc.edu	37	6	127796985	127796985	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr6:127796985A>G	ENST00000525778.1	-	6	2931	c.2186T>C	c.(2185-2187)cTt>cCt	p.L729P	SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000481848.2_Missense_Mutation_p.L729P|SOGA3_ENST00000368268.2_Missense_Mutation_p.L729P|SOGA3_ENST00000556132.1_Missense_Mutation_p.L729P|SOGA3_ENST00000465909.2_Missense_Mutation_p.L729P			Q5TF21	SOGA3_HUMAN	SOGA family member 3	729					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GTTGGACATAAGCACGCGGTT	0.672																																						.											0													67.0	74.0	72.0					6																	127796985		2194	4296	6490	SO:0001583	missense	387104			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2186T>C	6.37:g.127796985A>G	ENSP00000434570:p.Leu729Pro			Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983571	0.74474	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79645	-0.1717	10	0.87932	D	0	-13.174	14.9909	0.71387	1.0:0.0:0.0:0.0	.	729	Q5TF21	CF174_HUMAN	P	729	ENSP00000451768:L729P;ENSP00000357251:L729P;ENSP00000434570:L729P;ENSP00000435559:L729P	ENSP00000435559:L729P	L	-	2	0	C6orf174	127838678	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.051000	0.93849	1.952000	0.56665	0.379000	0.24179	CTT		0.672	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
WBSCR17	64409	ucsc.edu	37	7	70800582	70800582	+	Silent	SNP	T	T	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:70800582T>G	ENST00000333538.5	+	2	919	c.285T>G	c.(283-285)ggT>ggG	p.G95G	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	95					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GTGGGCGGGGTAAAGGGGGCC	0.448																																						.											0																																										SO:0001819	synonymous_variant	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.285T>G	7.37:g.70800582T>G			Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	37	CCDS5540.1																																																																																				0.448	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
AKR7L	246181	mdanderson.org	37	1	19600376	19600377	+	RNA	DNP	TT	TT	GC	rs565823852|rs539454439	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr1:19600376_19600377TT>GC	ENST00000429712.1	-	0	311_312				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						CTGCTGCCCATTCGGAGCCCCA	0.673																																						.											0																																												246181					1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520	ENST00000429712.1:c.192_193delinsGC	1.37:g.19600376_19600377delinsGC			Q5U614	RNA	DNP	ENST00000429712.1	37																																																																																					0.673	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3	NM_201252	
ATP6V0A1	535	mdanderson.org	37	17	40666439	40666439	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr17:40666439A>G	ENST00000343619.4	+	21	2504	c.2381A>G	c.(2380-2382)gAg>gGg	p.E794G	ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.E794G|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.E788G|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.E795G|MIR5010_ENST00000582846.1_RNA|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.E745G|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.E751G|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.E440G|RP11-400F19.18_ENST00000591237.1_RNA	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	794					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CTGATCATGGAGGGCCTCTCG	0.622																																						.											0													163.0	138.0	147.0					17																	40666439		2203	4300	6503	SO:0001583	missense	535			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.2381A>G	17.37:g.40666439A>G	ENSP00000342951:p.Glu794Gly		B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.977615	0.92982	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35;-2.35	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.96513	0.8862	H	0.97874	4.095	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.97859	1.0279	10	0.87932	D	0	-20.7555	14.0846	0.64947	1.0:0.0:0.0:0.0	.	745;751;795;794;788	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	G	794;794;788;795;745;440	ENSP00000342951:E794G;ENSP00000444676:E794G;ENSP00000377415:E788G;ENSP00000264649:E795G;ENSP00000443991:E745G;ENSP00000446377:E440G	ENSP00000264649:E795G	E	+	2	0	ATP6V0A1	37919965	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	1.936000	0.56123	0.459000	0.35465	GAG		0.622	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
HLA-DRB5	3127	mdanderson.org	37	6	32497900	32497900	+	Splice_Site	SNP	A	A	G	rs78612727	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr6:32497900A>G	ENST00000374975.3	-	1	163		c.e1+1			NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						ATGTGCACTTACGTCGGGTGT	0.522																																						.											0													99.0	102.0	101.0					6																	32497900		2203	4300	6503	SO:0001630	splice_region_variant	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.100+1T>C	6.37:g.32497900A>G				Splice_Site	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	8.839	0.941693	0.18281	.	.	ENSG00000198502	ENST00000374975	.	.	.	4.54	3.3	0.37823	.	.	.	.	.	.	.	.	.	.	.	0.35921	D	0.831832	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4495	0.27229	0.8084:0.0:0.0:0.1916	.	.	.	.	.	-1	.	.	.	-	.	.	HLA-DRB5	32605878	0.985000	0.35326	0.199000	0.23439	0.019000	0.09904	2.123000	0.41996	1.909000	0.55274	0.397000	0.26171	.		0.522	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	Intron
IGLL3P	91353	mdanderson.org	37	22	25715886	25715886	+	IGR	SNP	G	G	A	rs138922401	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr22:25715886G>A								RP3-462D8.2 (37628 upstream) : LRP5L (31501 downstream)																							CATCACCCAGGGCGTGGAGAT	0.577													G|||	15	0.00299521	0.0008	0.0072	5008	,	,		18092	0.002		0.0	False		,,,				2504	0.0072					.											0													132.0	120.0	124.0					22																	25715886		2201	4300	6501	SO:0001628	intergenic_variant	91353																															22.37:g.25715886G>A				RNA	SNP		37																																																																																				0	0.577								
OR10G8	219869	mdanderson.org	37	11	123900382	123900382	+	Missense_Mutation	SNP	C	C	T	rs73028928	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr11:123900382C>T	ENST00000431524.1	+	1	86	c.53C>T	c.(52-54)gCc>gTc	p.A18V		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTTCCCCATGCCCCAGCGCTG	0.572																																						.											0													180.0	171.0	174.0					11																	123900382		2201	4299	6500	SO:0001583	missense	219869			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.53C>T	11.37:g.123900382C>T	ENSP00000389072:p.Ala18Val		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326961	0.24080	.	.	ENSG00000234560	ENST00000431524	T	0.01099	5.34	2.95	2.95	0.34219	.	0.922077	0.09000	N	0.863091	T	0.00784	0.0026	N	0.04994	-0.135	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.46555	-0.9183	10	0.39692	T	0.17	.	4.9369	0.13944	0.0:0.7325:0.0:0.2675	.	18	Q8NGN5	O10G8_HUMAN	V	18	ENSP00000389072:A18V	ENSP00000389072:A18V	A	+	2	0	OR10G8	123405592	0.000000	0.05858	0.047000	0.18901	0.004000	0.04260	-1.793000	0.01755	1.634000	0.50500	0.585000	0.79938	GCC		0.572	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
SLC9B1	150159	mdanderson.org	37	4	103822298	103822298	+	Silent	SNP	C	C	T	rs3175325	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr4:103822298C>T	ENST00000296422.7	-	12	1665	c.1524G>A	c.(1522-1524)caG>caA	p.Q508Q	SLC9B1_ENST00000394789.3_Intron|SLC9B1_ENST00000512651.2_5'UTR	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	508					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ATGTTGACAACTGCAGTTTTA	0.358																																						.											0													66.0	70.0	68.0					4																	103822298		1818	3378	5196	SO:0001819	synonymous_variant	150159			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1524G>A	4.37:g.103822298C>T			A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	ENST00000296422.7	37	CCDS34041.1																																																																																				0.358	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
SPZ1	84654	mdanderson.org	37	5	79616400	79616400	+	Missense_Mutation	SNP	G	G	A	rs200562315	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr5:79616400G>A	ENST00000296739.4	+	1	611	c.366G>A	c.(364-366)atG>atA	p.M122I		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	122					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M122I(1)		endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		TCAATGAAATGTTATCAACAA	0.368																																						.											1	Substitution - Missense(1)	skin(1)											49.0	44.0	45.0					5																	79616400		1799	4058	5857	SO:0001583	missense	84654				CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.366G>A	5.37:g.79616400G>A	ENSP00000369611:p.Met122Ile		B2RA21|Q8N4P1|Q8N7E9	Missense_Mutation	SNP	ENST00000296739.4	37	CCDS43336.1	.	.	.	.	.	.	.	.	.	.	G	8.567	0.879064	0.17395	.	.	ENSG00000164299	ENST00000511881;ENST00000296739	T;T	0.39787	1.06;1.62	2.92	-2.42	0.06542	.	.	.	.	.	T	0.17238	0.0414	N	0.05078	-0.115	0.09310	N	1	B	0.20988	0.05	B	0.10450	0.005	T	0.15178	-1.0446	9	0.33940	T	0.23	.	4.398	0.11372	0.5786:0.0:0.2498:0.1716	.	122	Q9BXG8	SPZ1_HUMAN	I	122	ENSP00000426530:M122I;ENSP00000369611:M122I	ENSP00000369611:M122I	M	+	3	0	SPZ1	79652156	0.000000	0.05858	0.000000	0.03702	0.514000	0.34195	-1.754000	0.01816	-0.613000	0.05694	0.313000	0.20887	ATG		0.368	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369322.1	NM_032567	
STEAP1	26872	mdanderson.org	37	7	89791240	89791240	+	Missense_Mutation	SNP	A	A	G	rs199817828		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:89791240A>G	ENST00000297205.2	+	4	810	c.610A>G	c.(610-612)Aaa>Gaa	p.K204E	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	204	Ferric oxidoreductase.				ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					CCAACAAAATAAAGAAGATGC	0.408																																						.											0													43.0	44.0	44.0					7																	89791240		2203	4296	6499	SO:0001583	missense	26872			AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.610A>G	7.37:g.89791240A>G	ENSP00000297205:p.Lys204Glu		A4D1E0|O95034	Missense_Mutation	SNP	ENST00000297205.2	37	CCDS5614.1	38	0.0173992673992674	23	0.046747967479674794	1	0.0027624309392265192	0	0.0	14	0.018469656992084433	A	15.81	2.941792	0.53079	.	.	ENSG00000164647	ENST00000297205	T	0.07444	3.19	5.61	5.61	0.85477	Flavoprotein transmembrane component (1);	0.250346	0.33005	N	0.005400	T	0.01940	0.0061	L	0.51914	1.62	0.36302	D	0.857104	P;P	0.36683	0.565;0.477	B;B	0.41946	0.282;0.371	T	0.07558	-1.0766	10	0.48119	T	0.1	-6.2003	15.8022	0.78463	1.0:0.0:0.0:0.0	.	204;204	B4E221;Q9UHE8	.;STEA1_HUMAN	E	204	ENSP00000297205:K204E	ENSP00000297205:K204E	K	+	1	0	STEAP1	89629176	0.941000	0.31946	0.991000	0.47740	0.976000	0.68499	3.801000	0.55545	2.133000	0.65898	0.533000	0.62120	AAA		0.408	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059327.3	NM_012449	
ZNF676	163223	mdanderson.org	37	19	22363589	22363589	+	Silent	SNP	C	C	T	rs80146743	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr19:22363589C>T	ENST00000397121.2	-	3	1247	c.930G>A	c.(928-930)aaG>aaA	p.K310K		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATTCTTCACACTTGTAGGGTT	0.443																																						.											0													66.0	69.0	68.0					19																	22363589		2091	4235	6326	SO:0001819	synonymous_variant	163223			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.930G>A	19.37:g.22363589C>T			A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																				0.443	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
TMEM255B	348013	bcgsc.ca	37	13	114514867	114514867	+	Nonsense_Mutation	SNP	C	C	A	rs9604467	byFrequency	TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr13:114514867C>A	ENST00000375353.3	+	9	999	c.972C>A	c.(970-972)taC>taA	p.Y324*	TMEM255B_ENST00000467169.1_3'UTR	NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B	324	Pro-rich.					integral component of membrane (GO:0016021)											CACCCCCCTACGCACCCTGAT	0.552																																						.											0													56.0	75.0	69.0					13																	114514867		2187	4287	6474	SO:0001587	stop_gained	348013			BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.972C>A	13.37:g.114514867C>A	ENSP00000364502:p.Tyr324*			Nonsense_Mutation	SNP	ENST00000375353.3	37	CCDS45071.1	.	.	.	.	.	.	.	.	.	.	c	7.542	0.660962	0.14645	.	.	ENSG00000184497	ENST00000375353	.	.	.	4.72	-2.34	0.06704	.	.	.	.	.	.	.	.	.	.	.	0.25112	N	0.99071	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.5381	12.3595	0.55194	0.0:0.5423:0.0:0.4577	rs9604467	.	.	.	X	324	.	ENSP00000364502:Y324X	Y	+	3	2	FAM70B	113599076	0.000000	0.05858	0.026000	0.17262	0.031000	0.12232	-0.914000	0.04038	-0.444000	0.07170	-1.279000	0.01387	TAC		0.552	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045953.4	NM_182614	
DOCK4	9732	bcgsc.ca	37	7	111512561	111512561	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr7:111512561A>G	ENST00000437633.1	-	18	2060	c.1804T>C	c.(1804-1806)Tct>Cct	p.S602P	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.S602P	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	602					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TTTAATTTAGAGAGACAGCCA	0.333																																						.											0													69.0	61.0	64.0					7																	111512561		1812	4078	5890	SO:0001583	missense	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1804T>C	7.37:g.111512561A>G	ENSP00000404179:p.Ser602Pro		O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568056	0.65651	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.19669	2.13;2.13	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.34395	0.0896	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.60575	0.979;0.979;0.979;0.988	P;P;P;P	0.54706	0.756;0.756;0.756;0.759	T	0.06445	-1.0826	10	0.44086	T	0.13	.	14.3959	0.67010	1.0:0.0:0.0:0.0	.	602;602;602;602	Q149N2;Q149N5;Q8N1I0;Q8N1I0-2	.;.;DOCK4_HUMAN;.	P	590;602;602;590;601	ENSP00000410746:S602P;ENSP00000404179:S602P	ENSP00000345432:S590P	S	-	1	0	DOCK4	111299797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.484000	0.60271	2.048000	0.60808	0.528000	0.53228	TCT		0.333	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
HSF1	3297	bcgsc.ca	37	8	145535243	145535243	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr8:145535243C>T	ENST00000528838.1	+	7	839	c.679C>T	c.(679-681)Cgg>Tgg	p.R227W	HSF1_ENST00000400780.4_Missense_Mutation_p.R162W	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	227	Regulatory domain.				cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			CAAGTATAGCCGGCAGTTCTC	0.672																																						.											0													68.0	65.0	66.0					8																	145535243		2203	4296	6499	SO:0001583	missense	3297			M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.679C>T	8.37:g.145535243C>T	ENSP00000431512:p.Arg227Trp		A8K4L0|A8MW26|Q53XT4	Missense_Mutation	SNP	ENST00000528838.1	37	CCDS6419.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155959	0.78114	.	.	ENSG00000185122	ENST00000528838;ENST00000400780	.	.	.	5.14	4.26	0.50523	.	0.110120	0.56097	D	0.000040	T	0.77698	0.4169	M	0.77103	2.36	0.58432	D	0.999996	D	0.89917	1.0	D	0.72338	0.977	T	0.80643	-0.1291	9	0.72032	D	0.01	-17.3041	12.8206	0.57690	0.1646:0.8353:0.0:0.0	.	227	Q00613	HSF1_HUMAN	W	227;162	.	ENSP00000383590:R162W	R	+	1	2	HSF1	145506051	1.000000	0.71417	0.927000	0.36925	0.369000	0.29798	3.469000	0.53093	1.380000	0.46344	0.563000	0.77884	CGG		0.672	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
TSC1	7248	bcgsc.ca	37	9	135797338	135797350	+	Frame_Shift_Del	DEL	CGAGATAGACTTC	CGAGATAGACTTC	-	rs118203393|rs118203392|rs397514794|rs118203394		TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	CGAGATAGACTTC	CGAGATAGACTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chr9:135797338_135797350delCGAGATAGACTTC	ENST00000298552.3	-	7	740_752	c.519_531delGAAGTCTATCTCG	c.(517-531)gcgaagtctatctcgfs	p.AKSIS173fs	TSC1_ENST00000403810.1_Frame_Shift_Del_p.AKSIS173fs|TSC1_ENST00000545250.1_Frame_Shift_Del_p.AKSIS122fs|TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000440111.2_Frame_Shift_Del_p.AKSIS173fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	173					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.E174*(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGAGATGGACGAGATAGACTTCCGCCACGTGGC	0.479			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	2	Substitution - Nonsense(1)|Unknown(1)	lung(1)|bone(1)	GRCh37	CD972479|CM090913	TSC1	D|M	rs118203392																																			SO:0001589	frameshift_variant	7248	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.519_531delGAAGTCTATCTCG	9.37:g.135797338_135797350delCGAGATAGACTTC	ENSP00000298552:p.Ala173fs		B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	37	CCDS6956.1																																																																																				0.479	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
MT-ND4	4538	bcgsc.ca	37	M	11867	11868	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrM:11867_11868insC	ENST00000361381.2	+	1	1108_1109	c.1108_1109insC	c.(1108-1110)cccfs	p.P370fs	MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	370					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACCTCGCCTTACCCCCCACTAT	0.455																																						.											0																																										SO:0001589	frameshift_variant	0					mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1113dupC	M.37:g.11873_11873dupC	ENSP00000354961:p.Pro370fs		Q6RL39|Q6RQN9|Q8HNR8	Frame_Shift_Ins	INS	ENST00000361381.2	37																																																																																					0.455	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-CYB	4519	bcgsc.ca	37	M	14895	14895	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8326-01A-11D-2310-10	TCGA-KL-8326-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4729fe4b-c1ac-489b-a67e-91e5c5e3ff8c	5d6a5ba0-8213-4f89-85e0-021e4b4cc894	g.chrM:14895T>C	ENST00000361789.2	+	1	149	c.149T>C	c.(148-150)tTc>tCc	p.F50S	MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	50					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CACAGGACTATTCCTAGCCAT	0.517																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.149T>C	M.37:g.14895T>C	ENSP00000354554:p.Phe50Ser		Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																					0.517	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
