#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SYT9	143425	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	7324616	7324616	+	Silent	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:7324616G>A	ENST00000318881.6	+	2	729	c.492G>A	c.(490-492)tcG>tcA	p.S164S	SYT9_ENST00000396716.2_Silent_p.S132S	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	164					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CAACCTCGTCGGCCCGGTCAG	0.587																																						.											0																																										SO:0001819	synonymous_variant	143425			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.492G>A	11.37:g.7324616G>A				Silent	SNP	ENST00000318881.6	37	CCDS7778.1																																																																																				0.587	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
HNF1A	6927	broad.mit.edu;hgsc.bcm.edu	37	12	121431369	121431370	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr12:121431369_121431370insG	ENST00000257555.6	+	3	799_800	c.573_574insG	c.(574-576)gatfs	p.D192fs	HNF1A_ENST00000402929.1_Frame_Shift_Ins_p.D192fs|HNF1A_ENST00000400024.2_Frame_Shift_Ins_p.D192fs|HNF1A_ENST00000541395.1_Frame_Shift_Ins_p.D192fs|HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.D75fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Frame_Shift_Ins_p.D192fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	192					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G191fs*26(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGCCCACAGGTGATGAGCTACC	0.589									Hepatic Adenoma, Familial Clustering of																													.											1	Deletion - Frameshift(1)	liver(1)																																								SO:0001589	frameshift_variant	6927	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.574dupG	12.37:g.121431370_121431370dupG	ENSP00000257555:p.Asp192fs		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	ENST00000257555.6	37	CCDS9209.1																																																																																				0.589	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
SQRDL	58472	broad.mit.edu;hgsc.bcm.edu	37	15	45951304	45951305	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr15:45951304_45951305insA	ENST00000260324.7	+	2	569_570	c.183_184insA	c.(184-186)atgfs	p.M62fs	SQRDL_ENST00000568606.1_Frame_Shift_Ins_p.M62fs|RP11-96O20.4_ENST00000564080.1_Frame_Shift_Ins_p.M62fs	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	62					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		TGGCTGCCCGCATGAAGAGGAA	0.609																																						.											0																																										SO:0001589	frameshift_variant	58472			AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.184dupA	15.37:g.45951305_45951305dupA	ENSP00000260324:p.Met62fs		Q9UQM8	Frame_Shift_Ins	INS	ENST00000260324.7	37	CCDS10127.1																																																																																				0.609	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254319.2		
DMXL2	23312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	51768854	51768854	+	Missense_Mutation	SNP	C	C	A	rs200609180	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr15:51768854C>A	ENST00000251076.5	-	27	7180	c.6893G>T	c.(6892-6894)cGt>cTt	p.R2298L	DMXL2_ENST00000543779.2_Missense_Mutation_p.R2299L|DMXL2_ENST00000449909.3_Missense_Mutation_p.R1662L|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2298						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TAGTCTTCTACGATCACTTAA	0.353																																						.											0													147.0	141.0	143.0					15																	51768854		2196	4293	6489	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.6893G>T	15.37:g.51768854C>A	ENSP00000251076:p.Arg2298Leu		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127413	0.94473	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.25414	1.94;1.94;1.8	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.51805	0.1696	M	0.65975	2.015	0.80722	D	1	D;D;D;P	0.89917	1.0;0.995;0.997;0.956	D;D;D;P	0.76071	0.985;0.968;0.987;0.688	T	0.52909	-0.8512	10	0.66056	D	0.02	.	19.0467	0.93022	0.0:1.0:0.0:0.0	.	2299;1662;2298;2299	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	L	2298;2299;1662	ENSP00000251076:R2298L;ENSP00000441858:R2299L;ENSP00000400855:R1662L	ENSP00000251076:R2298L	R	-	2	0	DMXL2	49556146	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.270000	0.78493	2.502000	0.84385	0.655000	0.94253	CGT		0.353	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DNAH9	1770	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	11833188	11833188	+	Silent	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:11833188T>C	ENST00000262442.4	+	63	11951	c.11883T>C	c.(11881-11883)atT>atC	p.I3961I	DNAH9_ENST00000608377.1_Silent_p.I273I|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Intron	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3961	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACTAGAACATTCACCTGGTGG	0.557																																						.											0													47.0	40.0	42.0					17																	11833188		2203	4299	6502	SO:0001819	synonymous_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11883T>C	17.37:g.11833188T>C			A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				0.557	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
NFATC1	4772	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	77208855	77208855	+	Missense_Mutation	SNP	G	G	A	rs139150912		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr18:77208855G>A	ENST00000427363.2	+	4	1460	c.1460G>A	c.(1459-1461)cGc>cAc	p.R487H	NFATC1_ENST00000586434.1_Missense_Mutation_p.R474H|NFATC1_ENST00000592223.1_Missense_Mutation_p.R474H|NFATC1_ENST00000397790.2_Missense_Mutation_p.R15H|NFATC1_ENST00000587635.1_Missense_Mutation_p.R487H|NFATC1_ENST00000542384.1_Missense_Mutation_p.R487H|NFATC1_ENST00000591814.1_Missense_Mutation_p.R487H|NFATC1_ENST00000318065.5_Missense_Mutation_p.R474H|NFATC1_ENST00000329101.4_Missense_Mutation_p.R474H|NFATC1_ENST00000545796.1_Missense_Mutation_p.R15H|NFATC1_ENST00000253506.5_Missense_Mutation_p.R487H			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	487	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	CGCCTGCTGCGCCCGCACGCC	0.602																																					GBM(151;1210 2593 28719 45011)	.											0								G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	81.0	72.0	75.0		1460,1421,44,1421,1460	4.3	1.0	18	dbSNP_134	75	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	NFATC1	NM_006162.3,NM_172387.1,NM_172388.1,NM_172389.1,NM_172390.1	29,29,29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	487/826,474/931,15/354,474/813,487/717	77208855	1,13005	2203	4300	6503	SO:0001583	missense	4772			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1460G>A	18.37:g.77208855G>A	ENSP00000389377:p.Arg487His		B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	ENST00000427363.2	37		.	.	.	.	.	.	.	.	.	.	G	22.1	4.244410	0.79912	2.27E-4	0.0	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000397790;ENST00000542384;ENST00000329101;ENST00000545796;ENST00000427363;ENST00000397794	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	4.31	4.31	0.51392	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.72479	2.2	0.48185	D	0.9996	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.79784	0.983;0.983;0.983;0.992;0.992;0.993;0.983	T	0.73458	-0.3976	10	0.87932	D	0	-25.1669	16.9798	0.86324	0.0:0.0:1.0:0.0	.	474;474;487;487;487;474;487	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M4;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.;.	H	487;487;15;487;474;15;474;451	ENSP00000253506:R487H;ENSP00000380892:R15H;ENSP00000442435:R487H;ENSP00000327850:R474H;ENSP00000439992:R15H	ENSP00000253506:R487H	R	+	2	0	NFATC1	75309843	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.991000	0.63883	2.230000	0.72887	0.561000	0.74099	CGC		0.602	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390	
LILRB5	10990	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	54756385	54756385	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:54756385G>A	ENST00000316219.5	-	10	1606	c.1499C>T	c.(1498-1500)gCg>gTg	p.A500V	LILRB5_ENST00000450632.1_Missense_Mutation_p.A492V|LILRB5_ENST00000345866.6_Missense_Mutation_p.A401V|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000449561.2_Missense_Mutation_p.A501V	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	500					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTCTGGCCCCGCAGCCCCTGC	0.617																																						.											0													91.0	88.0	89.0					19																	54756385		2203	4300	6503	SO:0001583	missense	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1499C>T	19.37:g.54756385G>A	ENSP00000320390:p.Ala500Val		Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	0.094	-1.161755	0.01673	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00485	7.12;7.07;7.11;7.13	1.91	-0.491	0.12045	.	.	.	.	.	T	0.00241	0.0007	N	0.25890	0.77	0.09310	N	1	B;B;B;B	0.32862	0.349;0.172;0.055;0.387	B;B;B;B	0.24541	0.022;0.054;0.027;0.037	T	0.22695	-1.0209	9	0.14656	T	0.56	.	4.6532	0.12605	0.3582:0.0:0.6418:0.0	.	492;401;501;500	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	V	500;492;501;401	ENSP00000320390:A500V;ENSP00000414225:A492V;ENSP00000406478:A501V;ENSP00000263430:A401V	ENSP00000320390:A500V	A	-	2	0	LILRB5	59448197	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.285000	0.08410	-0.045000	0.13468	-0.459000	0.05422	GCG		0.617	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ZNF837	116412	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	58879856	58879856	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:58879856G>A	ENST00000427624.2	-	3	1166	c.844C>T	c.(844-846)Cgc>Tgc	p.R282C	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Missense_Mutation_p.R282C			Q96EG3	ZN837_HUMAN	zinc finger protein 837	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						CTGGAGGTGCGCGTGAAGGCC	0.697																																						.											0													12.0	14.0	14.0					19																	58879856		690	1584	2274	SO:0001583	missense	116412			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.844C>T	19.37:g.58879856G>A	ENSP00000405699:p.Arg282Cys			Missense_Mutation	SNP	ENST00000427624.2	37	CCDS46216.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634690	0.29068	.	.	ENSG00000152475	ENST00000427624	T	0.07567	3.18	1.23	0.157	0.14915	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06188	0.0160	L	0.42744	1.35	0.09310	N	1	B	0.29508	0.246	B	0.12837	0.008	T	0.33624	-0.9861	9	0.45353	T	0.12	.	4.3935	0.11351	0.5931:0.0:0.4069:0.0	.	282	Q96EG3	ZN837_HUMAN	C	282	ENSP00000405699:R282C	ENSP00000405699:R282C	R	-	1	0	ZNF837	63571668	0.000000	0.05858	0.338000	0.25549	0.282000	0.26991	-1.573000	0.02134	0.089000	0.17243	0.563000	0.77884	CGC		0.697	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
XKR7	343702	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	20	30584474	30584474	+	Silent	SNP	G	G	A	rs375135448		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr20:30584474G>A	ENST00000562532.2	+	3	1128	c.954G>A	c.(952-954)gcG>gcA	p.A318A		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	318						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGGCCTTCGCGCTCTTCGCCA	0.632																																						.											0										1,4405	2.1+/-5.4	0,1,2202	72.0	70.0	70.0		954	-2.9	1.0	20		70	0,8600		0,0,4300	no	coding-synonymous	XKR7	NM_001011718.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		318/580	30584474	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	343702			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.954G>A	20.37:g.30584474G>A			Q9NUG5	Silent	SNP	ENST00000562532.2	37	CCDS33459.1																																																																																				0.632	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078597.3	NM_001011718	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179641009	179641009	+	Missense_Mutation	SNP	C	C	T	rs140914855		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:179641009C>T	ENST00000591111.1	-	28	5806	c.5582G>A	c.(5581-5583)cGc>cAc	p.R1861H	TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R1815H|TTN_ENST00000589042.1_Missense_Mutation_p.R1861H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R1815H|TTN_ENST00000460472.2_Missense_Mutation_p.R1815H|TTN_ENST00000342992.6_Missense_Mutation_p.R1861H|TTN_ENST00000360870.5_Missense_Mutation_p.R1861H|TTN-AS1_ENST00000610005.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin	12698	Ig-like 9.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCCTGCAGCGGAACCTTGC	0.478																																						.											0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	210.0	199.0	203.0		5444,5582,5582,5444,5444	5.2	1.0	2	dbSNP_134	203	1,8599	2.2+/-6.3	0,1,4299	yes	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1815/26927,1861/33424,1861/5605,1815/27052,1815/27119	179641009	1,13005	2203	4300	6503	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5582G>A	2.37:g.179641009C>T	ENSP00000465570:p.Arg1861His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	c	13.46	2.243341	0.39697	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	5.16	5.16	0.70880	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75598	0.3871	L	0.35414	1.06	0.44061	D	0.996808	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.78705	-0.2100	9	0.87932	D	0	.	18.6477	0.91416	0.0:1.0:0.0:0.0	.	1815;1815;1815;1861;1861	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	1861;1815;1815;1815;1815;1861	ENSP00000343764:R1861H;ENSP00000434586:R1815H;ENSP00000340554:R1815H;ENSP00000352154:R1815H;ENSP00000354117:R1861H	ENSP00000340554:R1815H	R	-	2	0	TTN	179349254	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	7.792000	0.85828	2.417000	0.82017	0.651000	0.88453	CGC		0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PMM1	5372	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	22	41973907	41973907	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr22:41973907C>T	ENST00000216259.7	-	7	655	c.571G>A	c.(571-573)Gtc>Atc	p.V191I		NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	191					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						TCGGGGAAGACGTCAAAGCTG	0.572																																						.											0													114.0	87.0	96.0					22																	41973907		2203	4300	6503	SO:0001583	missense	5372				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.571G>A	22.37:g.41973907C>T	ENSP00000216259:p.Val191Ile		A8K003|Q92586	Missense_Mutation	SNP	ENST00000216259.7	37	CCDS14020.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732968	0.30684	.	.	ENSG00000100417	ENST00000216259	D	0.99023	-5.34	5.24	4.22	0.49857	HAD-like domain (2);	0.196740	0.46145	N	0.000313	D	0.97558	0.9200	M	0.70108	2.13	0.48632	D	0.999684	B	0.10296	0.003	B	0.10450	0.005	D	0.96235	0.9171	10	0.27785	T	0.31	-27.3831	10.0097	0.41979	0.0:0.8453:0.0:0.1547	.	191	Q92871	PMM1_HUMAN	I	191	ENSP00000216259:V191I	ENSP00000216259:V191I	V	-	1	0	PMM1	40303853	0.852000	0.29690	0.787000	0.31911	0.045000	0.14185	1.391000	0.34475	1.205000	0.43262	0.555000	0.69702	GTC		0.572	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320711.3	NM_002676	
SETD2	29072	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	47084094	47084094	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:47084094G>A	ENST00000409792.3	-	17	7237	c.7195C>T	c.(7195-7197)Cga>Tga	p.R2399*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2399	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.R1896*(2)|p.R2399*(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTGGATCTCGAGCTGTCTTC	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	4	Substitution - Nonsense(4)	large_intestine(2)|breast(2)											113.0	112.0	112.0					3																	47084094		2203	4300	6503	SO:0001587	stop_gained	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7195C>T	3.37:g.47084094G>A	ENSP00000386759:p.Arg2399*		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	48	14.190842	0.99783	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.51	3.7	0.42460	.	0.000000	0.43110	D	0.000617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4304	0.44405	0.0695:0.0:0.796:0.1346	.	.	.	.	X	2399	.	ENSP00000386759:R2399X	R	-	1	2	SETD2	47059098	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	3.171000	0.50824	0.685000	0.31468	-0.182000	0.12963	CGA		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
ATP11B	23200	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	182631695	182631695	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:182631695G>T	ENST00000323116.5	+	29	3625	c.3365G>T	c.(3364-3366)tGt>tTt	p.C1122F		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	1122					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TCCATGTGCTGTTTCCCGGAA	0.453																																						.											0													251.0	244.0	247.0					3																	182631695		2203	4300	6503	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.3365G>T	3.37:g.182631695G>T	ENSP00000321195:p.Cys1122Phe		Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206191	0.79127	.	.	ENSG00000058063	ENST00000323116;ENST00000484691	T	0.38887	1.11	5.24	5.24	0.73138	.	0.431079	0.26567	N	0.023660	T	0.51432	0.1674	M	0.67953	2.075	0.80722	D	1	P;P	0.50710	0.938;0.664	P;B	0.47470	0.548;0.216	T	0.50398	-0.8833	10	0.35671	T	0.21	.	19.1816	0.93625	0.0:0.0:1.0:0.0	.	696;1122	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	F	1122;100	ENSP00000321195:C1122F	ENSP00000321195:C1122F	C	+	2	0	ATP11B	184114389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.374000	0.90133	2.601000	0.87937	0.655000	0.94253	TGT		0.453	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
DGKQ	1609	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	956357	956357	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr4:956357C>T	ENST00000273814.3	-	18	2153	c.2080G>A	c.(2080-2082)Ggc>Agc	p.G694S	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	694	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGGTCCTCGCCGCTGTAGCCC	0.662																																					Esophageal Squamous(17;537 645 4447 26373)	.											0													47.0	46.0	46.0					4																	956357		2200	4299	6499	SO:0001583	missense	1609			L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.2080G>A	4.37:g.956357C>T	ENSP00000273814:p.Gly694Ser		Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	37	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333433	0.81801	.	.	ENSG00000145214	ENST00000273814	T	0.21361	2.01	4.9	4.9	0.64082	Diacylglycerol kinase, catalytic domain (3);	0.100622	0.64402	D	0.000002	T	0.34687	0.0906	L	0.38692	1.165	0.58432	D	0.999996	D;D	0.76494	0.998;0.999	P;D	0.63703	0.806;0.917	T	0.05241	-1.0897	10	0.56958	D	0.05	.	15.9132	0.79488	0.0:1.0:0.0:0.0	.	694;694	E9KL49;P52824	.;DGKQ_HUMAN	S	694	ENSP00000273814:G694S	ENSP00000273814:G694S	G	-	1	0	DGKQ	946357	0.798000	0.28890	0.638000	0.29380	0.430000	0.31655	1.737000	0.38197	2.395000	0.81488	0.655000	0.94253	GGC		0.662	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		
ARSK	153642	broad.mit.edu;hgsc.bcm.edu	37	5	94936601	94936601	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr5:94936601delC	ENST00000380009.4	+	7	1352	c.1147delC	c.(1147-1149)ccgfs	p.P383fs		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	383					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CTCTTTGTTGCCGTTATCATC	0.358																																						.											0													140.0	137.0	138.0					5																	94936601		2203	4300	6503	SO:0001589	frameshift_variant	153642				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1147delC	5.37:g.94936601delC	ENSP00000369346:p.Pro383fs		A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Frame_Shift_Del	DEL	ENST00000380009.4	37	CCDS4073.1																																																																																				0.358	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150	
LMOD2	442721	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	123302156	123302156	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:123302156C>A	ENST00000458573.2	+	2	673	c.516C>A	c.(514-516)aaC>aaA	p.N172K	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	172						cytoskeleton (GO:0005856)											AAATAGAGAACATAAATTTGA	0.393																																						.											0													39.0	39.0	39.0					7																	123302156		1902	4103	6005	SO:0001583	missense	442721			AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.516C>A	7.37:g.123302156C>A	ENSP00000411932:p.Asn172Lys		A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	ENST00000458573.2	37	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	C	4.545	0.101182	0.08731	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074	D	0.89050	-2.46	5.22	3.37	0.38596	.	.	.	.	.	D	0.83538	0.5276	M	0.61703	1.905	0.58432	D	0.999996	B	0.27625	0.183	B	0.19666	0.026	T	0.75747	-0.3209	9	0.14252	T	0.57	-15.6113	8.691	0.34267	0.0:0.6316:0.0:0.3684	.	172	Q6P5Q4	LMOD2_HUMAN	K	172;132;143	ENSP00000411932:N172K	ENSP00000405123:N143K	N	+	3	2	LMOD2	123089392	0.097000	0.21791	0.975000	0.42487	0.913000	0.54294	-0.128000	0.10531	1.168000	0.42723	0.591000	0.81541	AAC		0.393	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
GCC1	79571	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	127224826	127224826	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:127224826C>A	ENST00000321407.2	-	1	835	c.411G>T	c.(409-411)gaG>gaT	p.E137D	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	137					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TAACGCCACTCTCGGACCAAC	0.577																																						.											0													135.0	124.0	128.0					7																	127224826		2203	4300	6503	SO:0001583	missense	79571			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.411G>T	7.37:g.127224826C>A	ENSP00000318821:p.Glu137Asp		Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269087	0.23221	.	.	ENSG00000179562	ENST00000321407	T	0.14022	2.54	5.89	5.01	0.66863	.	0.251271	0.42294	D	0.000738	T	0.15003	0.0362	L	0.39397	1.21	0.50467	D	0.999871	B	0.29936	0.262	B	0.34489	0.184	T	0.02471	-1.1154	10	0.23302	T	0.38	-31.1941	15.946	0.79792	0.0:0.9272:0.0:0.0728	.	137	Q96CN9	GCC1_HUMAN	D	137	ENSP00000318821:E137D	ENSP00000318821:E137D	E	-	3	2	GCC1	127012062	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	2.048000	0.41278	0.844000	0.35094	-0.797000	0.03246	GAG		0.577	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
SLC4A2	6522	broad.mit.edu;hgsc.bcm.edu	37	7	150772848	150772851	+	Frame_Shift_Del	DEL	ACTT	ACTT	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	ACTT	ACTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:150772848_150772851delACTT	ENST00000485713.1	+	21	4497_4500	c.3457_3460delACTT	c.(3457-3462)acttacfs	p.TY1153fs	SLC4A2_ENST00000413384.2_Frame_Shift_Del_p.TY1153fs|SLC4A2_ENST00000392826.2_Frame_Shift_Del_p.TY1144fs|SLC4A2_ENST00000461735.1_Frame_Shift_Del_p.TY1139fs|SLC4A2_ENST00000310317.5_Frame_Shift_Del_p.TY1071fs|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'Flank	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1153	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCCAGATGTCACTTACGTCAAGAA	0.588																																						.											0																																										SO:0001589	frameshift_variant	6522				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3457_3460delACTT	7.37:g.150772848_150772851delACTT	ENSP00000419412:p.Thr1153fs		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Frame_Shift_Del	DEL	ENST00000485713.1	37	CCDS5917.1																																																																																				0.588	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
CRHR2	1395	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	30739613	30739613	+	Missense_Mutation	SNP	C	C	T	rs548065920		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:30739613C>T	ENST00000348438.4	-	1	106	c.37G>A	c.(37-39)Gtc>Atc	p.V13I	INMT_ENST00000484180.1_Intron|CRHR2_ENST00000462882.1_5'UTR	NM_001202475.1|NM_001202481.1	NP_001189404.1|NP_001189410.1	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGGTGTGGGACGTAGAGGAGG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		14531	0.0		0.0	False		,,,				2504	0.001					.											0																																										SO:0001583	missense	1395				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000348438.4:c.37G>A	7.37:g.30739613C>T	ENSP00000340943:p.Val13Ile		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	ENST00000348438.4	37	CCDS56478.1	.	.	.	.	.	.	.	.	.	.	C	2.389	-0.340309	0.05243	.	.	ENSG00000106113	ENST00000348438;ENST00000445981	T	0.38077	1.16	2.31	-3.8	0.04307	.	2.960750	0.01652	N	0.024622	T	0.21145	0.0509	.	.	.	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.07635	-1.0762	9	0.28530	T	0.3	.	4.0182	0.09654	0.1663:0.4334:0.0:0.4003	.	13;13;13	F2Z2M6;C9JZM9;Q13324-2	.;.;.	I	13	ENSP00000340943:V13I	ENSP00000340943:V13I	V	-	1	0	CRHR2	30706138	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.467000	0.06664	-1.142000	0.02869	-2.087000	0.00375	GTC		0.682	CRHR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327785.1		
MICU3	286097	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	16935352	16935352	+	Nonsense_Mutation	SNP	C	C	T	rs150021056		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:16935352C>T	ENST00000318063.5	+	4	670	c.628C>T	c.(628-630)Cga>Tga	p.R210*		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	210						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.R210*(2)									GAAGCTATTTCGAAATCTTAA	0.303																																						.											2	Substitution - Nonsense(2)	large_intestine(1)|skin(1)						C	stop/ARG	2,4404	4.2+/-10.8	0,2,2201	66.0	62.0	63.0		628	3.0	1.0	8	dbSNP_134	63	0,8598		0,0,4299	yes	stop-gained	EFHA2	NM_181723.2		0,2,6500	TT,TC,CC		0.0,0.0454,0.0154		210/531	16935352	2,13002	2203	4299	6502	SO:0001587	stop_gained	286097			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.628C>T	8.37:g.16935352C>T	ENSP00000321455:p.Arg210*		Q8IYZ3	Nonsense_Mutation	SNP	ENST00000318063.5	37	CCDS5999.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.10|16.10	3.028534|3.028534	0.54790|0.54790	4.54E-4|4.54E-4	0.0|0.0	ENSG00000155970|ENSG00000155970	ENST00000318063|ENST00000517398	.|.	.|.	.|.	4.88|4.88	3.05|3.05	0.35203|0.35203	.|.	0.148150|.	0.46758|.	D|.	0.000269|.	.|T	.|0.51500	.|0.1678	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.59386	.|-0.7464	.|3	0.07644|.	T|.	0.81|.	-27.3167|-27.3167	9.9373|9.9373	0.41559|0.41559	0.1382:0.7888:0.0:0.073|0.1382:0.7888:0.0:0.073	.|.	.|.	.|.	.|.	X|L	210|49	.|.	ENSP00000321455:R210X|.	R|S	+|+	1|2	2|0	EFHA2|EFHA2	16979723|16979723	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.792000|0.792000	0.44763|0.44763	3.275000|3.275000	0.51639|0.51639	0.564000|0.564000	0.29238|0.29238	-0.535000|-0.535000	0.04281|0.04281	CGA|TCG		0.303	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	
RMDN1	51115	broad.mit.edu;hgsc.bcm.edu	37	8	87487151	87487154	+	Frame_Shift_Del	DEL	AAGT	AAGT	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:87487151_87487154delAAGT	ENST00000406452.3	-	9	948_951	c.789_792delACTT	c.(787-792)ttacttfs	p.LL265fs	RMDN1_ENST00000523911.1_Intron|RMDN1_ENST00000519966.1_Intron|RMDN1_ENST00000430676.2_Frame_Shift_Del_p.LL235fs	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	265						microtubule (GO:0005874)|mitochondrion (GO:0005739)											TTCCTAAAAGAAGTAAGTTTTTGC	0.368																																						.											0																																										SO:0001589	frameshift_variant	51115			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.789_792delACTT	8.37:g.87487155_87487158delAAGT	ENSP00000385927:p.Leu265fs		A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Frame_Shift_Del	DEL	ENST00000406452.3	37	CCDS34918.1																																																																																				0.368	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	
CCDC13	152206	hgsc.bcm.edu	37	3	42777231	42777231	+	Silent	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:42777231G>A	ENST00000310232.6	-	10	1422	c.1339C>T	c.(1339-1341)Ctg>Ttg	p.L447L	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	447										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TCCATCTCCAGCTGTCGCACT	0.602																																						.											0													128.0	115.0	119.0					3																	42777231		2203	4300	6503	SO:0001819	synonymous_variant	152206			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1339C>T	3.37:g.42777231G>A				Silent	SNP	ENST00000310232.6	37	CCDS2705.1																																																																																				0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
H6PD	9563	broad.mit.edu	37	1	9324408	9324408	+	Missense_Mutation	SNP	T	T	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:9324408T>G	ENST00000377403.2	+	5	2158	c.1856T>G	c.(1855-1857)gTt>gGt	p.V619G	H6PD_ENST00000602477.1_Missense_Mutation_p.V630G	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	619	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CTGTGGCTGGTTGACGAGCGC	0.677																																						.											0													19.0	21.0	20.0					1																	9324408		2190	4286	6476	SO:0001583	missense	9563			AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1856T>G	1.37:g.9324408T>G	ENSP00000366620:p.Val619Gly		Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	37	CCDS101.1	.	.	.	.	.	.	.	.	.	.	T	17.48	3.400189	0.62177	.	.	ENSG00000049239	ENST00000377403	T	0.39406	1.08	5.16	2.85	0.33270	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.058049	0.64402	D	0.000002	T	0.48892	0.1525	L	0.31926	0.97	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.43925	-0.9361	10	0.87932	D	0	-29.2922	8.7296	0.34491	0.0:0.1543:0.0:0.8457	.	619	O95479	G6PE_HUMAN	G	619	ENSP00000366620:V619G	ENSP00000366620:V619G	V	+	2	0	H6PD	9246995	1.000000	0.71417	0.738000	0.30950	0.966000	0.64601	3.810000	0.55613	0.321000	0.23259	0.459000	0.35465	GTT		0.677	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
OLFM3	118427	broad.mit.edu	37	1	102269842	102269842	+	Silent	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:102269842C>T	ENST00000338858.5	-	6	1388	c.1389G>A	c.(1387-1389)ctG>ctA	p.L463L	OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Silent_p.L443L|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	463	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TGACATTGAACAGCACCTGGT	0.408																																						.											0													150.0	142.0	145.0					1																	102269842		2203	4300	6503	SO:0001819	synonymous_variant	118427			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1389G>A	1.37:g.102269842C>T			Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	ENST00000338858.5	37																																																																																					0.408	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
CR1L	1379	broad.mit.edu	37	1	207896964	207896964	+	Splice_Site	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:207896964T>C	ENST00000508064.2	+	12	1704	c.1644T>C	c.(1642-1644)ggT>ggC	p.G548G		NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	548						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TCCTTTTAGGTTCACATGATG	0.353																																						.											0													216.0	187.0	196.0					1																	207896964		1859	4113	5972	SO:0001630	splice_region_variant	1379			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1643-1T>C	1.37:g.207896964T>C			Q32MC9|Q8NEU7	Silent	SNP	ENST00000508064.2	37	CCDS44310.1																																																																																				0.353	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	Silent
CALCB	797	broad.mit.edu;mdanderson.org	37	11	15096731	15096731	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:15096731A>G	ENST00000533448.1	+	3	322	c.211A>G	c.(211-213)Aca>Gca	p.T71A	CALCB_ENST00000523376.1_Missense_Mutation_p.T82A|CALCB_ENST00000324229.6_Missense_Mutation_p.T71A			P10092	CALCB_HUMAN	calcitonin-related polypeptide beta	71					cellular calcium ion homeostasis (GO:0006874)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			endometrium(1)|large_intestine(1)|lung(1)|skin(2)	5						GGAGCAGGAGACACAGGGCTC	0.617											OREG0020793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													66.0	69.0	68.0					11																	15096731		2200	4294	6494	SO:0001583	missense	797				CCDS7820.1	11p14.2-p12	2013-02-25	2008-02-20			ENSG00000175868		"""Endogenous ligands"""	1438	protein-coding gene	gene with protein product		114160	"""calcitonin 2"""	CALC2			Standard	NM_000728		Approved	FLJ30166, CGRP-II	uc001mlx.1	P10092		ENST00000533448.1:c.211A>G	11.37:g.15096731A>G	ENSP00000433490:p.Thr71Ala	700	A8K573|D3DQX4|Q569I0|Q9UCN9	Missense_Mutation	SNP	ENST00000533448.1	37	CCDS7820.1	.	.	.	.	.	.	.	.	.	.	A	3.803	-0.041286	0.07452	.	.	ENSG00000175868	ENST00000523376;ENST00000324229;ENST00000533448	T;T;T	0.22743	1.94;1.94;1.94	4.21	-4.08	0.03963	.	0.664761	0.14008	N	0.347681	T	0.10121	0.0248	L	0.39514	1.22	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40534	-0.9558	10	0.08837	T	0.75	-2.6446	1.9945	0.03453	0.4014:0.1338:0.3345:0.1303	.	71	P10092	CALCB_HUMAN	A	82;71;71	ENSP00000428882:T82A;ENSP00000346017:T71A;ENSP00000433490:T71A	ENSP00000346017:T71A	T	+	1	0	CALCB	15053307	0.013000	0.17824	0.000000	0.03702	0.187000	0.23431	0.309000	0.19332	-0.830000	0.04262	0.454000	0.30748	ACA		0.617	CALCB-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387433.1	NM_000728	
OR4D10	390197	broad.mit.edu	37	11	59245050	59245050	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:59245050A>G	ENST00000530162.1	+	1	205	c.148A>G	c.(148-150)Acc>Gcc	p.T50A		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGTCACTGTTACCTGTGAATC	0.448																																						.											0													188.0	194.0	192.0					11																	59245050		2142	4275	6417	SO:0001583	missense	390197			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.148A>G	11.37:g.59245050A>G	ENSP00000436424:p.Thr50Ala		B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	A	5.242	0.230125	0.09969	.	.	ENSG00000254466	ENST00000530162	T	0.01068	5.38	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01353	0.0044	L	0.33189	0.99	0.24281	N	0.995208	P	0.37663	0.604	B	0.38327	0.271	T	0.52631	-0.8550	9	0.40728	T	0.16	.	8.3873	0.32508	0.8249:0.0:0.0:0.1751	.	50	Q8NGI6	OR4DA_HUMAN	A	50	ENSP00000436424:T50A	ENSP00000436424:T50A	T	+	1	0	OR4D10	59001626	0.000000	0.05858	0.669000	0.29828	0.016000	0.09150	0.428000	0.21395	1.733000	0.51620	0.533000	0.62120	ACC		0.448	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705	
PRB1	5542	broad.mit.edu	37	12	11506383	11506383	+	Intron	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr12:11506383C>T	ENST00000500254.2	-	4	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTCCTTGTGGCTTTCCTGGAG	0.602																																						.											0													10.0	7.0	8.0					12																	11506383		1016	2010	3026	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-59G>A	12.37:g.11506383C>T			Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Silent	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.602	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
MARK3	4140	broad.mit.edu	37	14	103941508	103941508	+	Silent	SNP	G	G	A	rs549864859		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr14:103941508G>A	ENST00000429436.2	+	13	1953	c.1443G>A	c.(1441-1443)gcG>gcA	p.A481A	MARK3_ENST00000216288.7_Silent_p.A465A|MARK3_ENST00000561071.1_Intron|MARK3_ENST00000416682.2_Silent_p.A504A|MARK3_ENST00000440884.3_Silent_p.A402A|MARK3_ENST00000553942.1_Silent_p.A481A|MARK3_ENST00000303622.9_Silent_p.A481A|MARK3_ENST00000335102.5_Silent_p.A504A	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	481						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			CTAATAAGGCGGATATTCCTG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		20146	0.001		0.0	False		,,,				2504	0.0					.											0													103.0	100.0	101.0					14																	103941508		1941	4132	6073	SO:0001819	synonymous_variant	4140			M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.1443G>A	14.37:g.103941508G>A			O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Silent	SNP	ENST00000429436.2	37	CCDS45165.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381168	0.24944	.	.	ENSG00000075413	ENST00000554627	.	.	.	5.65	-10.3	0.00346	.	.	.	.	.	T	0.32224	0.0822	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41592	-0.9500	4	.	.	.	.	2.0884	0.03651	0.2373:0.08:0.2825:0.4002	.	.	.	.	Q	233	.	.	R	+	2	0	MARK3	103011261	0.000000	0.05858	0.826000	0.32828	0.989000	0.77384	-2.962000	0.00672	-1.547000	0.01715	-0.253000	0.11424	CGG		0.483	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
CHRNB4	1143	broad.mit.edu;mdanderson.org	37	15	78921471	78921471	+	Silent	SNP	G	G	A	rs142694602		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr15:78921471G>A	ENST00000261751.3	-	5	1287	c.1176C>T	c.(1174-1176)ccC>ccT	p.P392P	CHRNB4_ENST00000412074.2_Intron|RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000560511.1_5'Flank	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	392					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CTGCAGAGGCGGGGTTCACAA	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16160	0.0		0.0	False		,,,				2504	0.0					.											0								G		3,4389	6.2+/-15.9	0,3,2193	50.0	52.0	51.0		1176	-7.4	0.0	15	dbSNP_134	51	0,8586		0,0,4293	no	coding-synonymous	CHRNB4	NM_000750.3		0,3,6486	AA,AG,GG		0.0,0.0683,0.0231		392/499	78921471	3,12975	2196	4293	6489	SO:0001819	synonymous_variant	1143			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1176C>T	15.37:g.78921471G>A			A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Silent	SNP	ENST00000261751.3	37	CCDS10306.1																																																																																				0.627	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1		
ZP2	7783	broad.mit.edu	37	16	21218242	21218242	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr16:21218242A>G	ENST00000574002.1	-	6	882	c.400T>C	c.(400-402)Tat>Cat	p.Y134H	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.Y134H|ZP2_ENST00000219593.4_Missense_Mutation_p.Y134H			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	134					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		AAGAACTGATACATGACAGCT	0.488																																						.											0													237.0	199.0	212.0					16																	21218242		2199	4300	6499	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.400T>C	16.37:g.21218242A>G	ENSP00000460971:p.Tyr134His		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	A	4.571	0.106025	0.08780	.	.	ENSG00000103310	ENST00000219593	T	0.29142	1.58	4.21	3.11	0.35812	.	0.000000	0.64402	D	0.000005	T	0.29588	0.0738	M	0.66378	2.025	0.09310	N	0.999997	B;B;B	0.31752	0.099;0.338;0.338	B;B;B	0.33890	0.041;0.172;0.172	T	0.22347	-1.0219	10	0.49607	T	0.09	-13.0883	6.2931	0.21071	0.8859:0.0:0.1141:0.0	.	134;134;134	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	H	134	ENSP00000219593:Y134H	ENSP00000219593:Y134H	Y	-	1	0	ZP2	21125743	0.023000	0.18921	0.019000	0.16419	0.099000	0.18886	0.610000	0.24253	0.773000	0.33404	0.482000	0.46254	TAT		0.488	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2		
VMP1	81671	broad.mit.edu	37	17	57895131	57895131	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:57895131delT	ENST00000262291.4	+	10	1281	c.971delT	c.(970-972)attfs	p.I324fs	VMP1_ENST00000536180.1_Frame_Shift_Del_p.I227fs|VMP1_ENST00000539763.1_Frame_Shift_Del_p.I132fs|VMP1_ENST00000537567.1_Frame_Shift_Del_p.I190fs|VMP1_ENST00000545362.1_Frame_Shift_Del_p.I268fs	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	324					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						GTGGCTTTCATTGGGTAAGTA	0.274																																						.											0													40.0	41.0	41.0					17																	57895131		2201	4287	6488	SO:0001589	frameshift_variant	81671				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.971delT	17.37:g.57895131delT	ENSP00000262291:p.Ile324fs		B4DVV9|Q9H0P4|Q9P089	Frame_Shift_Del	DEL	ENST00000262291.4	37	CCDS11619.1																																																																																				0.274	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																						.											0																																												201283			AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G				RNA	SNP	ENST00000430983.1	37																																																																																					0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255102.1	NM_153032	
AATK	9625	broad.mit.edu	37	17	79102327	79102327	+	Silent	SNP	G	G	A	rs56384363	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:79102327G>A	ENST00000326724.4	-	4	381	c.357C>T	c.(355-357)gaC>gaT	p.D119D	AATK_ENST00000572339.1_5'UTR|AATK_ENST00000417379.1_Silent_p.D16D|MIR338_ENST00000390137.2_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	119					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCCGGCCCACGTCTGTGGACT	0.677													G|||	11	0.00219649	0.0	0.0029	5008	,	,		16832	0.0		0.0089	False		,,,				2504	0.0					.											0								G	,	4,3428		0,4,1712	31.0	39.0	36.0		357,48	3.1	1.0	17	dbSNP_129	36	50,6930		0,50,3440	no	coding-synonymous,coding-synonymous	AATK	NM_001080395.2,NM_004920.2	,	0,54,5152	AA,AG,GG		0.7163,0.1166,0.5186	,	119/1375,16/1272	79102327	54,10358	1716	3490	5206	SO:0001819	synonymous_variant	9625			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.357C>T	17.37:g.79102327G>A			O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	37	CCDS45807.1	7	0.003205128205128205	0	0.0	1	0.0027624309392265192	0	0.0	6	0.0079155672823219	G	9.994	1.231624	0.22626	0.001166	0.007163	ENSG00000181409	ENST00000417379	.	.	.	4.09	3.1	0.35709	.	.	.	.	.	T	0.46870	0.1415	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42531	-0.9446	4	.	.	.	.	6.4447	0.21869	0.0983:0.0:0.724:0.1777	rs56384363	.	.	.	M	72	.	.	T	-	2	0	AATK	76716922	0.997000	0.39634	0.999000	0.59377	0.905000	0.53344	0.360000	0.20250	0.696000	0.31696	0.467000	0.42956	ACG		0.677	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
WDPCP	51057	broad.mit.edu	37	2	63401909	63401909	+	Silent	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:63401909A>G	ENST00000272321.7	-	15	2501	c.1974T>C	c.(1972-1974)tcT>tcC	p.S658S	WDPCP_ENST00000398544.3_Silent_p.S499S|WDPCP_ENST00000409120.1_Silent_p.S466S|WDPCP_ENST00000409199.1_Silent_p.S466S	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	658					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GAGGTGCTAAAGACAGGCCAA	0.408																																						.											0													159.0	146.0	150.0					2																	63401909		1863	4095	5958	SO:0001819	synonymous_variant	51057				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1974T>C	2.37:g.63401909A>G			Q53RW4|Q7Z2Z3	Silent	SNP	ENST00000272321.7	37	CCDS42688.1																																																																																				0.408	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
CTNNA2	1496	broad.mit.edu	37	2	80816430	80816430	+	Splice_Site	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:80816430C>A	ENST00000402739.4	+	14	2014	c.2009C>A	c.(2008-2010)gCc>gAc	p.A670D	CTNNA2_ENST00000343114.3_Splice_Site_p.A349D|CTNNA2_ENST00000540488.1_Splice_Site_p.A670D|CTNNA2_ENST00000466387.1_Splice_Site_p.A670D|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000361291.4_Splice_Site_p.A704D|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000496558.1_Splice_Site_p.A670D|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000541047.1_Splice_Site_p.A670D|AC008067.2_ENST00000596887.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	670					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CCCACGCAGGCCATCATGGCG	0.517																																						.											0													57.0	62.0	60.0					2																	80816430		2171	4282	6453	SO:0001630	splice_region_variant	1496				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2008-1C>A	2.37:g.80816430C>A			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	C	13.82	2.351090	0.41599	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.76	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.31752	0.955	0.80722	D	1	B;B;B;B	0.24186	0.003;0.099;0.081;0.081	B;B;B;B	0.27796	0.007;0.058;0.056;0.083	T	0.04693	-1.0933	9	.	.	.	.	14.9476	0.71044	0.0:0.9314:0.0:0.0685	.	302;670;670;670	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	D	670;670;704;670;670;670;349	ENSP00000418191:A670D;ENSP00000419295:A670D;ENSP00000355398:A704D;ENSP00000384638:A670D;ENSP00000444675:A670D;ENSP00000441705:A670D;ENSP00000341500:A349D	.	A	+	2	0	CTNNA2	80669941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.915000	0.69973	1.443000	0.47586	0.655000	0.94253	GCC		0.517	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	Missense_Mutation
FAM138B	654412	broad.mit.edu	37	2	114336333	114336333	+	lincRNA	SNP	A	A	G	rs200381690		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:114336333A>G	ENST00000432583.2	+	0	1136									family with sequence similarity 138, member B																		tgatggcagaaccatagatgg	0.478																																						.											0																																												654412					2q13	2013-01-30			ENSG00000226516	ENSG00000226516		"""Long non-coding RNAs"""	33582	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026821		Approved	F379	uc002tjz.3		OTTHUMG00000047820		2.37:g.114336333A>G				RNA	SNP	ENST00000432583.2	37																																																																																					0.478	FAM138B-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000109027.3	NR_026821	
EEF1B2	1933	broad.mit.edu	37	2	207025365	207025365	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:207025365C>T	ENST00000392222.2	+	2	509	c.134C>T	c.(133-135)cCg>cTg	p.P45L	SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000233190.6_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.P45L|NDUFS1_ENST00000455934.2_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.P45L|NDUFS1_ENST00000457011.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TCCAGCCCACCGCCTGCCGAC	0.453																																						.											0													109.0	100.0	103.0					2																	207025365		2203	4300	6503	SO:0001583	missense	1933			X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.134C>T	2.37:g.207025365C>T	ENSP00000376056:p.Pro45Leu		A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106668	0.56291	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.47	5.47	0.80525	Glutathione S-transferase, C-terminal-like (2);	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	M	0.88979	2.995	0.80722	D	1	P	0.43431	0.807	B	0.35655	0.207	T	0.69837	-0.5037	10	0.72032	D	0.01	-5.866	19.3282	0.94273	0.0:1.0:0.0:0.0	.	45	P24534	EF1B_HUMAN	L	45	ENSP00000236957:P45L;ENSP00000376055:P45L;ENSP00000376056:P45L;ENSP00000407730:P45L	ENSP00000236957:P45L	P	+	2	0	EEF1B2	206733610	1.000000	0.71417	0.649000	0.29536	0.233000	0.25261	5.440000	0.66563	2.584000	0.87258	0.561000	0.74099	CCG		0.453	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
ALPP	250	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	233244614	233244614	+	Missense_Mutation	SNP	G	G	A	rs138033708		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:233244614G>A	ENST00000392027.2	+	5	894	c.625G>A	c.(625-627)Gct>Act	p.A209T	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	209					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CCAGGACATCGCTACGCAGCT	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		18710	0.0		0.0	False		,,,				2504	0.001					.											0													69.0	70.0	70.0					2																	233244614		2203	4299	6502	SO:0001583	missense	250			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.625G>A	2.37:g.233244614G>A	ENSP00000375881:p.Ala209Thr		P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	.	14.15	2.449547	0.43531	.	.	ENSG00000163283	ENST00000392027	D	0.96940	-4.18	2.31	1.36	0.22044	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97729	0.9255	M	0.88842	2.985	0.53005	D	0.999963	D	0.89917	1.0	D	0.70016	0.967	D	0.96819	0.9602	10	0.66056	D	0.02	.	9.4929	0.38971	0.0:0.0:0.6243:0.3757	.	209	P05187	PPB1_HUMAN	T	209	ENSP00000375881:A209T	ENSP00000375881:A209T	A	+	1	0	ALPP	232952858	0.743000	0.28239	0.326000	0.25389	0.024000	0.10985	0.952000	0.29149	0.266000	0.21894	0.298000	0.19748	GCT		0.682	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
NNAT	4826	broad.mit.edu	37	20	36149782	36149782	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr20:36149782T>C	ENST00000062104.2	+	1	166	c.49T>C	c.(49-51)Tac>Cac	p.Y17H	BLCAP_ENST00000397135.1_Intron|BLCAP_ENST00000414542.2_5'UTR|BLCAP_ENST00000397137.1_Intron|NNAT_ENST00000346199.2_Missense_Mutation_p.Y17H|BLCAP_ENST00000373537.2_Intron|BLCAP_ENST00000397134.1_5'Flank|BLCAP_ENST00000397131.1_Intron	NM_005386.2	NP_005377.1	Q16517	NNAT_HUMAN	neuronatin	17					brain development (GO:0007420)|neuron differentiation (GO:0030182)|positive regulation of insulin secretion (GO:0032024)|protein lipoylation (GO:0009249)|regulation of protein localization (GO:0032880)|response to glucose (GO:0009749)|transport (GO:0006810)	cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|lung(1)	3		Myeloproliferative disorder(115;0.00878)				CATCGGCTGGTACATCTTCCG	0.617																																						.											0													140.0	140.0	140.0					20																	36149782		2203	4300	6503	SO:0001583	missense	4826				CCDS13296.1, CCDS13297.1	20q11.2-q12	2007-12-07			ENSG00000053438	ENSG00000053438			7860	protein-coding gene	gene with protein product		603106				8660979	Standard	NM_005386		Approved	Peg5	uc002xhd.3	Q16517	OTTHUMG00000032420	ENST00000062104.2:c.49T>C	20.37:g.36149782T>C	ENSP00000062104:p.Tyr17His		B2R558|E1P5V6|Q16596|Q5U0N3	Missense_Mutation	SNP	ENST00000062104.2	37	CCDS13296.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.542446	0.65198	.	.	ENSG00000053438	ENST00000062104;ENST00000346199	.	.	.	4.35	4.35	0.52113	.	0.000000	0.41823	D	0.000817	T	0.66761	0.2822	.	.	.	0.31677	N	0.643627	D;P	0.62365	0.991;0.89	D;P	0.65323	0.934;0.607	T	0.73014	-0.4116	8	0.87932	D	0	-7.5239	10.2286	0.43241	0.0:0.0:0.0:1.0	.	17;17	Q16517-2;Q16517	.;NNAT_HUMAN	H	17	.	ENSP00000062104:Y17H	Y	+	1	0	NNAT	35583196	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.088000	0.50175	2.197000	0.70478	0.533000	0.62120	TAC		0.617	NNAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079116.2	NM_005386	
RALGAPB	57148	broad.mit.edu	37	20	37126161	37126161	+	Splice_Site	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr20:37126161T>C	ENST00000262879.6	+	4	837		c.e4+2		RALGAPB_ENST00000397042.3_Splice_Site|RALGAPB_ENST00000397040.1_Splice_Site|RALGAPB_ENST00000537204.1_Splice_Site|RALGAPB_ENST00000397038.1_Splice_Site			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)						activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGTTCAAGGTTTGTTTATTT	0.393																																						.											0													101.0	99.0	99.0					20																	37126161		2203	4300	6503	SO:0001630	splice_region_variant	57148			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.553+2T>C	20.37:g.37126161T>C			A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Splice_Site	SNP	ENST00000262879.6	37	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.843339	0.71488	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000537204;ENST00000397040;ENST00000438490	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.319	0.74105	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RALGAPB	36559575	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.472000	0.80996	2.004000	0.58718	0.528000	0.53228	.		0.393	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	Intron
ACR	49	broad.mit.edu	37	22	51183206	51183206	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr22:51183206G>T	ENST00000216139.5	+	5	877	c.837G>T	c.(835-837)tgG>tgT	p.W279C	AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	279	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CGGCCACCTGGCCCTATCTGA	0.597																																						.											0													14.0	16.0	15.0					22																	51183206		2194	4268	6462	SO:0001583	missense	49			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.837G>T	22.37:g.51183206G>T	ENSP00000216139:p.Trp279Cys		Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	37	CCDS14101.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302954	0.40795	.	.	ENSG00000100312	ENST00000216139	D	0.88431	-2.38	4.19	3.17	0.36434	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.382752	0.19487	N	0.113087	D	0.82875	0.5132	N	0.01874	-0.695	0.09310	N	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.72384	-0.4310	10	0.56958	D	0.05	-14.1835	6.3667	0.21459	0.2211:0.0:0.7789:0.0	.	279	P10323	ACRO_HUMAN	C	279	ENSP00000216139:W279C	ENSP00000216139:W279C	W	+	3	0	ACR	49530072	1.000000	0.71417	0.656000	0.29637	0.943000	0.58893	3.881000	0.56152	0.980000	0.38523	0.305000	0.20034	TGG		0.597	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	NM_001097	
ITGA9	3680	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	37785427	37785427	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:37785427C>A	ENST00000264741.5	+	22	2591	c.2335C>A	c.(2335-2337)Cca>Aca	p.P779T	AC093415.2_ENST00000449586.1_RNA	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	779					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AATCATGTCTCCAACCTCCTT	0.483																																						.											0													159.0	128.0	138.0					3																	37785427		2203	4300	6503	SO:0001583	missense	3680			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2335C>A	3.37:g.37785427C>A	ENSP00000264741:p.Pro779Thr		Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144022	0.77888	.	.	ENSG00000144668	ENST00000264741	T	0.74632	-0.86	5.41	5.41	0.78517	Integrin alpha-2 (1);	0.051257	0.85682	D	0.000000	D	0.86715	0.5999	M	0.77103	2.36	0.58432	D	0.999997	D	0.69078	0.997	D	0.77557	0.99	D	0.87897	0.2688	10	0.87932	D	0	.	18.3243	0.90248	0.0:1.0:0.0:0.0	.	779	Q13797	ITA9_HUMAN	T	779	ENSP00000264741:P779T	ENSP00000264741:P779T	P	+	1	0	ITGA9	37760431	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	5.900000	0.69853	2.686000	0.91538	0.655000	0.94253	CCA		0.483	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
COL12A1	1303	broad.mit.edu;bcgsc.ca	37	6	75875301	75875301	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr6:75875301T>C	ENST00000322507.8	-	14	3214	c.2905A>G	c.(2905-2907)Acc>Gcc	p.T969A	COL12A1_ENST00000416123.2_Missense_Mutation_p.T969A|COL12A1_ENST00000483888.2_Missense_Mutation_p.T969A|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	969	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTGTATTTGGTCTCTGGCTGC	0.413																																						.											0													133.0	129.0	130.0					6																	75875301		1890	4114	6004	SO:0001583	missense	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2905A>G	6.37:g.75875301T>C	ENSP00000325146:p.Thr969Ala		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370089	0.82573	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.61627	0.09;0.09;0.09	5.55	5.55	0.83447	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.74974	0.3787	M	0.87381	2.88	0.54753	D	0.99998	D	0.76494	0.999	D	0.85130	0.997	T	0.80158	-0.1499	10	0.62326	D	0.03	.	15.6872	0.77421	0.0:0.0:0.0:1.0	.	969	Q99715	COCA1_HUMAN	A	969	ENSP00000325146:T969A;ENSP00000412864:T969A;ENSP00000421216:T969A	ENSP00000325146:T969A	T	-	1	0	COL12A1	75932021	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.466000	0.80914	2.100000	0.63781	0.533000	0.62120	ACC		0.413	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CFTR	1080	broad.mit.edu	37	7	117188705	117188705	+	Missense_Mutation	SNP	A	A	T	rs397508180		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:117188705A>T	ENST00000003084.6	+	10	1352	c.1220A>T	c.(1219-1221)gAa>gTa	p.E407V	CFTR_ENST00000454343.1_Intron	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	407					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GGATTTGGGGAATTATTTGAG	0.328									Cystic Fibrosis																													.											0			GRCh37	CM993855	CFTR	M							18.0	18.0	18.0					7																	117188705		2198	4290	6488	SO:0001583	missense	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1220A>T	7.37:g.117188705A>T	ENSP00000003084:p.Glu407Val		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.781907	0.49891	.	.	ENSG00000001626	ENST00000003084;ENST00000426809	D;D	0.93189	-3.12;-3.18	4.85	3.7	0.42460	ABC transporter, transmembrane domain, type 1 (1);	0.149774	0.64402	D	0.000018	D	0.92698	0.7679	M	0.81802	2.56	0.80722	D	1	B	0.27882	0.192	B	0.32022	0.139	D	0.90227	0.4276	10	0.56958	D	0.05	-10.5798	10.1866	0.43002	0.9212:0.0:0.0788:0.0	.	407	P13569	CFTR_HUMAN	V	407;377	ENSP00000003084:E407V;ENSP00000389119:E377V	ENSP00000003084:E407V	E	+	2	0	CFTR	116975941	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.730000	0.74780	0.822000	0.34565	0.528000	0.53228	GAA		0.328	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
RNF122	79845	broad.mit.edu;bcgsc.ca	37	8	33408896	33408896	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:33408896T>C	ENST00000256257.1	-	3	595	c.194A>G	c.(193-195)aAc>aGc	p.N65S		NM_024787.2	NP_079063.2	Q9H9V4	RN122_HUMAN	ring finger protein 122	65						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		CTGTGCCTGGTTCCGCAGTTT	0.493																																						.											0													132.0	113.0	120.0					8																	33408896		2203	4300	6503	SO:0001583	missense	79845			AK022588	CCDS6091.1	8p12	2013-01-09			ENSG00000133874	ENSG00000133874		"""RING-type (C3HC4) zinc fingers"""	21147	protein-coding gene	gene with protein product							Standard	NM_024787		Approved	FLJ12526	uc003xjo.1	Q9H9V4	OTTHUMG00000163960	ENST00000256257.1:c.194A>G	8.37:g.33408896T>C	ENSP00000256257:p.Asn65Ser		Q52LK3	Missense_Mutation	SNP	ENST00000256257.1	37	CCDS6091.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444231	0.63067	.	.	ENSG00000133874	ENST00000256257	T	0.30448	1.53	5.88	5.88	0.94601	.	0.088003	0.85682	D	0.000000	T	0.19565	0.0470	N	0.14661	0.345	0.39976	D	0.974855	B	0.06786	0.001	B	0.04013	0.001	T	0.10291	-1.0636	10	0.21540	T	0.41	-33.6107	14.5307	0.67923	0.0:0.0:0.0:1.0	.	65	Q9H9V4	RN122_HUMAN	S	65	ENSP00000256257:N65S	ENSP00000256257:N65S	N	-	2	0	RNF122	33528438	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.110000	0.77069	2.246000	0.74042	0.533000	0.62120	AAC		0.493	RNF122-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376562.1	NM_024787	
TLR7	51284	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	12904430	12904430	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chrX:12904430T>C	ENST00000380659.3	+	3	942	c.803T>C	c.(802-804)tTt>tCt	p.F268S		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	268					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	AATGCCCCATTTCCTTGTGCG	0.368																																						.											0													109.0	102.0	104.0					X																	12904430		2203	4300	6503	SO:0001583	missense	51284			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.803T>C	X.37:g.12904430T>C	ENSP00000370034:p.Phe268Ser		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.726644	0.30593	.	.	ENSG00000196664	ENST00000380659	T	0.36699	1.24	5.63	-2.51	0.06365	.	0.270338	0.35708	N	0.003022	T	0.55832	0.1945	M	0.80746	2.51	0.39016	D	0.959651	P	0.42735	0.788	P	0.58928	0.848	T	0.61667	-0.7016	10	0.72032	D	0.01	.	15.153	0.72717	0.7566:0.0:0.0:0.2434	.	268	Q9NYK1	TLR7_HUMAN	S	268	ENSP00000370034:F268S	ENSP00000370034:F268S	F	+	2	0	TLR7	12814351	1.000000	0.71417	0.176000	0.23000	0.039000	0.13416	0.763000	0.26517	-0.939000	0.03709	-1.676000	0.00740	TTT		0.368	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
PRICKLE3	4007	broad.mit.edu	37	X	49034679	49034679	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chrX:49034679A>G	ENST00000376317.3	-	6	804	c.710T>C	c.(709-711)gTc>gCc	p.V237A	PRICKLE3_ENST00000538114.1_Missense_Mutation_p.V224A|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.V156A|PRICKLE3_ENST00000540849.1_Missense_Mutation_p.V169A	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	237	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						CCCGCAGTAGACCTTGCCAAC	0.627																																						.											0													66.0	44.0	51.0					X																	49034679		2202	4298	6500	SO:0001583	missense	4007			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.710T>C	X.37:g.49034679A>G	ENSP00000365494:p.Val237Ala		B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	ENST00000376317.3	37	CCDS14320.1	.	.	.	.	.	.	.	.	.	.	A	18.19	3.569778	0.65765	.	.	ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	5.14	5.14	0.70334	Zinc finger, LIM-type (4);	0.000000	0.34652	N	0.003797	D	0.88808	0.6537	L	0.42581	1.335	0.44652	D	0.997632	B;D;P;P	0.60160	0.417;0.987;0.594;0.803	B;P;B;P	0.60609	0.374;0.81;0.374;0.877	D	0.88252	0.2917	10	0.44086	T	0.13	-3.6123	11.8433	0.52368	1.0:0.0:0.0:0.0	.	237;199;156;237	B2RBS3;B7Z6S4;B7Z8F2;O43900	.;.;.;PRIC3_HUMAN	A	237;156;169;224	ENSP00000365494:V237A;ENSP00000441385:V156A;ENSP00000446051:V169A;ENSP00000441743:V224A	ENSP00000365494:V237A	V	-	2	0	PRICKLE3	48921623	1.000000	0.71417	0.999000	0.59377	0.859000	0.49053	9.154000	0.94694	1.699000	0.51192	0.416000	0.27883	GTC		0.627	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
WNK3	65267	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	54276507	54276507	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chrX:54276507G>A	ENST00000375159.2	-	15	2632	c.2633C>T	c.(2632-2634)aCg>aTg	p.T878M	WNK3_ENST00000354646.2_Missense_Mutation_p.T878M|WNK3_ENST00000375169.3_Missense_Mutation_p.T878M			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	878					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GTTTCTTATCGTCTGATTGAT	0.448																																						.											0													51.0	45.0	47.0					X																	54276507		2203	4300	6503	SO:0001583	missense	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.2633C>T	X.37:g.54276507G>A	ENSP00000364301:p.Thr878Met		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.462626	0.84425	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.28666	1.6;1.6;1.6	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000020	T	0.46776	0.1410	L	0.32530	0.975	0.43238	D	0.995146	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.46610	-0.9179	10	0.72032	D	0.01	-12.1503	17.1006	0.86648	0.0:0.0:1.0:0.0	.	878;878	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	M	878	ENSP00000364312:T878M;ENSP00000346667:T878M;ENSP00000364301:T878M	ENSP00000346667:T878M	T	-	2	0	WNK3	54293232	1.000000	0.71417	0.975000	0.42487	0.969000	0.65631	7.917000	0.87498	2.302000	0.77476	0.506000	0.49869	ACG		0.448	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
ARR3	407	broad.mit.edu	37	X	69498391	69498391	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chrX:69498391T>C	ENST00000307959.8	+	12	856	c.805T>C	c.(805-807)Ttt>Ctt	p.F269L	ARR3_ENST00000374495.3_Missense_Mutation_p.F269L	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	269					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						CTCCCAGAGCTTTGCAGTAAC	0.493																																						.											0													63.0	60.0	61.0					X																	69498391		2203	4300	6503	SO:0001583	missense	407				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.805T>C	X.37:g.69498391T>C	ENSP00000311538:p.Phe269Leu		B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	ENST00000307959.8	37	CCDS14399.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927921	0.34002	.	.	ENSG00000120500	ENST00000374495;ENST00000374480;ENST00000307959	T;T	0.15718	2.4;2.4	3.92	3.92	0.45320	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.294134	0.37906	N	0.001899	T	0.12561	0.0305	N	0.25825	0.765	0.38402	D	0.945681	B;B	0.27823	0.19;0.023	B;B	0.32762	0.152;0.04	T	0.15178	-1.0446	10	0.17369	T	0.5	.	11.4823	0.50333	0.0:0.0:0.0:1.0	.	269;269	P36575;P36575-2	ARRC_HUMAN;.	L	269	ENSP00000363619:F269L;ENSP00000311538:F269L	ENSP00000311538:F269L	F	+	1	0	ARR3	69415116	1.000000	0.71417	0.998000	0.56505	0.756000	0.42949	7.229000	0.78088	1.354000	0.45846	0.417000	0.27973	TTT		0.493	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312	
ABCA10	10349	ucsc.edu	37	17	67190540	67190540	+	Missense_Mutation	SNP	G	G	A	rs113082690|rs200155538	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:67190540G>A	ENST00000269081.4	-	13	2240	c.1331C>T	c.(1330-1332)tCt>tTt	p.S444F	ABCA10_ENST00000416101.2_Missense_Mutation_p.S444F	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	444	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TGTAGAAACAGACAATCCACT	0.328																																						.											0													116.0	111.0	113.0					17																	67190540		2192	4289	6481	SO:0001583	missense	10349			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1331C>T	17.37:g.67190540G>A	ENSP00000269081:p.Ser444Phe		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497627	0.44455	.	.	ENSG00000154263	ENST00000269081;ENST00000416101	T;D	0.93247	1.12;-3.19	3.8	-0.228	0.13098	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.30118	U	0.010364	D	0.84915	0.5578	N	0.11845	0.185	0.24712	N	0.993191	B;B	0.30146	0.27;0.116	B;B	0.31245	0.126;0.118	T	0.66536	-0.5899	10	0.09338	T	0.73	.	18.3875	0.90471	0.0:0.741:0.259:0.0	.	444;444	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	F	444	ENSP00000269081:S444F;ENSP00000407772:S444F	ENSP00000269081:S444F	S	-	2	0	ABCA10	64702135	0.000000	0.05858	0.000000	0.03702	0.611000	0.37282	0.017000	0.13399	-0.209000	0.10156	0.557000	0.71058	TCT		0.328	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
GAS1	2619	ucsc.edu	37	9	89561028	89561028	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr9:89561028C>T	ENST00000298743.7	-	1	1076	c.667G>A	c.(667-669)Gtg>Atg	p.V223M	RP11-276H19.1_ENST00000415801.1_lincRNA	NM_002048.2	NP_002039.2	P54826	GAS1_HUMAN	growth arrest-specific 1	223					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cerebellum morphogenesis (GO:0021587)|developmental growth (GO:0048589)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|eye morphogenesis (GO:0048592)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein processing (GO:0010955)|negative regulation of smoothened signaling pathway (GO:0045879)|odontogenesis (GO:0042476)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|programmed cell death (GO:0012501)|regulation of apoptotic process (GO:0042981)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|regulation of smoothened signaling pathway (GO:0008589)	anchored component of plasma membrane (GO:0046658)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|lung(2)|skin(1)	4						CCGTCGCACACGCAGTCGTTG	0.677																																						.											0													26.0	25.0	25.0					9																	89561028		2203	4300	6503	SO:0001583	missense	2619				CCDS6674.1	9q21.3-q22	2008-07-21			ENSG00000180447	ENSG00000180447			4165	protein-coding gene	gene with protein product	"""Growth arrest-specific gene-1"""	139185				8307588	Standard	NM_002048		Approved		uc004aox.4	P54826	OTTHUMG00000020141	ENST00000298743.7:c.667G>A	9.37:g.89561028C>T	ENSP00000298743:p.Val223Met		B9EGM4|Q6B086	Missense_Mutation	SNP	ENST00000298743.7	37	CCDS6674.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547253	0.45383	.	.	ENSG00000180447	ENST00000298743	T	0.63255	-0.03	4.49	3.51	0.40186	GDNF/GAS1 (2);	0.098848	0.40640	U	0.001049	T	0.70439	0.3224	L	0.48642	1.525	0.42504	D	0.992941	D	0.89917	1.0	D	0.74674	0.984	T	0.70149	-0.4951	10	0.38643	T	0.18	1.9743	13.1526	0.59498	0.1608:0.8392:0.0:0.0	.	223	P54826	GAS1_HUMAN	M	223	ENSP00000298743:V223M	ENSP00000298743:V223M	V	-	1	0	GAS1	88750848	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	4.172000	0.58243	2.046000	0.60703	0.549000	0.68633	GTG		0.677	GAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052928.1	NM_002048	
LMTK3	114783	ucsc.edu	37	19	48994716	48994716	+	Silent	SNP	T	T	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:48994716T>G	ENST00000600059.1	-	13	4400	c.4173A>C	c.(4171-4173)acA>acC	p.T1391T	LMTK3_ENST00000270238.3_Silent_p.T1420T			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1391	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GGTGGGGAGGTGTCGGGGGCG	0.711																																						.											0													3.0	4.0	3.0					19																	48994716		1503	3609	5112	SO:0001819	synonymous_variant	114783			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.4173A>C	19.37:g.48994716T>G			Q4G0U1	Silent	SNP	ENST00000600059.1	37																																																																																					0.711	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	
NCS1	23413	ucsc.edu	37	9	132934986	132934986	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr9:132934986A>G	ENST00000372398.3	+	1	130	c.44A>G	c.(43-45)gAg>gGg	p.E15G		NM_014286.3	NP_055101.2	P62166	NCS1_HUMAN	neuronal calcium sensor 1	15					calcium ion transmembrane transport (GO:0070588)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of exocytosis (GO:0045921)|regulation of neuron projection development (GO:0010975)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|voltage-gated calcium channel activity (GO:0005245)			large_intestine(1)|lung(4)|stomach(1)	6						GTTGTGGAGGAGCTGACCAGG	0.756																																					Melanoma(30;182 1162 22581 33240)	.											0													24.0	17.0	20.0					9																	132934986		2184	4280	6464	SO:0001583	missense	23413			AF186409	CCDS6932.1	9q34.11	2013-01-10	2010-01-27	2010-01-27	ENSG00000107130	ENSG00000107130		"""EF-hand domain containing"""	3953	protein-coding gene	gene with protein product		603315	"""frequenin (Drosophila) homolog"", ""frequenin homolog (Drosophila)"""	FREQ		11092894	Standard	NM_014286		Approved	NCS-1	uc004bzi.2	P62166	OTTHUMG00000020801	ENST00000372398.3:c.44A>G	9.37:g.132934986A>G	ENSP00000361475:p.Glu15Gly		E9PAY3|P36610|Q9UK26	Missense_Mutation	SNP	ENST00000372398.3	37	CCDS6932.1	.	.	.	.	.	.	.	.	.	.	a	13.10	2.136236	0.37728	.	.	ENSG00000107130	ENST00000372398	T	0.30981	1.51	2.38	2.38	0.29361	EF-hand-like domain (1);	0.071909	0.53938	U	0.000054	T	0.41604	0.1166	H	0.94964	3.605	0.80722	D	1	B	0.25719	0.132	B	0.18561	0.022	T	0.47699	-0.9097	10	0.62326	D	0.03	.	8.2937	0.31973	1.0:0.0:0.0:0.0	.	15	P62166	NCS1_HUMAN	G	15	ENSP00000361475:E15G	ENSP00000361475:E15G	E	+	2	0	NCS1	131974807	1.000000	0.71417	0.998000	0.56505	0.724000	0.41520	2.598000	0.46223	0.850000	0.35239	0.149000	0.16113	GAG		0.756	NCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054637.1	NM_014286	
NRXN1	9378	ucsc.edu;bcgsc.ca	37	2	51255194	51255194	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:51255194T>C	ENST00000406316.2	-	2	1694	c.218A>G	c.(217-219)gAg>gGg	p.E73G	NRXN1_ENST00000401669.2_Missense_Mutation_p.E73G|NRXN1_ENST00000405581.1_Missense_Mutation_p.E73G|NRXN1_ENST00000402717.3_Missense_Mutation_p.E73G|NRXN1_ENST00000406859.3_Missense_Mutation_p.E73G|NRXN1_ENST00000405472.3_Missense_Mutation_p.E73G|NRXN1_ENST00000404971.1_Missense_Mutation_p.E73G	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	73	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCAGAAGCCCTCGTCGTCGAA	0.657																																						.											0													15.0	20.0	18.0					2																	51255194		2008	4176	6184	SO:0001583	missense	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.218A>G	2.37:g.51255194T>C	ENSP00000384311:p.Glu73Gly		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	T	5.027	0.190678	0.09547	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.26654	U	0.023183	T	0.61961	0.2389	N	0.21282	0.65	0.37779	D	0.926933	B;B;B	0.13145	0.0;0.007;0.001	B;B;B	0.12837	0.003;0.008;0.007	T	0.58763	-0.7579	10	0.02654	T	1	.	14.6578	0.68847	0.0:0.0:0.0:1.0	.	73;73;73	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	G	73	ENSP00000385142:E73G;ENSP00000384311:E73G;ENSP00000434015:E73G;ENSP00000385017:E73G;ENSP00000385434:E73G;ENSP00000385681:E73G;ENSP00000385310:E73G	ENSP00000385017:E73G	E	-	2	0	NRXN1	51108698	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.036000	0.64164	1.860000	0.53959	0.460000	0.39030	GAG		0.657	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
OSGEPL1	64172	ucsc.edu	37	2	190618648	190618648	+	Silent	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr2:190618648T>C	ENST00000264151.5	-	5	1059	c.957A>G	c.(955-957)gcA>gcG	p.A319A	Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000519810.1_Silent_p.A319A|OSGEPL1_ENST00000522700.1_Silent_p.A319A	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			TTACCAGTACTGCATTATTTT	0.368																																						.											0													49.0	48.0	49.0					2																	190618648		1868	4099	5967	SO:0001819	synonymous_variant	64172			AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.957A>G	2.37:g.190618648T>C				Silent	SNP	ENST00000264151.5	37	CCDS46472.1																																																																																				0.368	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353	
RNF39	80352	ucsc.edu;bcgsc.ca	37	6	30043356	30043356	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr6:30043356C>T	ENST00000244360.6	-	1	308	c.211G>A	c.(211-213)Gcg>Acg	p.A71T	RNF39_ENST00000376751.3_Missense_Mutation_p.A71T	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	71						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										AGCTCGGGCGCATCCATGGAA	0.706																																					NSCLC(8;188 360 1520 20207 31481)	.											0													13.0	16.0	15.0					6																	30043356		2199	4296	6495	SO:0001583	missense	80352			AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.211G>A	6.37:g.30043356C>T	ENSP00000244360:p.Ala71Thr		A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	.	.	.	.	.	.	.	.	.	.	c	15.90	2.968922	0.53614	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.70516	-0.01;-0.49	3.81	1.81	0.25067	.	.	.	.	.	T	0.32823	0.0842	L	0.31157	0.91	0.23632	N	0.99724	B;P	0.36535	0.421;0.557	B;B	0.33750	0.081;0.169	T	0.05517	-1.0880	9	0.27785	T	0.31	.	6.7546	0.23505	0.0:0.713:0.1793:0.1077	.	71;71	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	T	71	ENSP00000365942:A71T;ENSP00000244360:A71T	ENSP00000244360:A71T	A	-	1	0	RNF39	30151335	0.018000	0.18449	0.962000	0.40283	0.892000	0.51952	0.642000	0.24735	0.732000	0.32470	0.436000	0.28706	GCG		0.706	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
RPL30	6156	ucsc.edu	37	8	99054067	99054067	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:99054067T>C	ENST00000521291.1	-	4	456	c.310A>G	c.(310-312)Atc>Gtc	p.I104V	KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Missense_Mutation_p.I40V|RPL30_ENST00000518164.1_Intron|RPL30_ENST00000287038.3_Missense_Mutation_p.I104V|RPL30_ENST00000396070.2_Missense_Mutation_p.I85V|SNORA72_ENST00000384339.1_RNA			P62888	RL30_HUMAN	ribosomal protein L30	104					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			CTTCTAATGATGTCAGAGTCA	0.303																																						.											0													51.0	52.0	51.0					8																	99054067		2203	4300	6503	SO:0001583	missense	6156				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.310A>G	8.37:g.99054067T>C	ENSP00000428085:p.Ile104Val		B2R591|P04645|Q502Z6	Missense_Mutation	SNP	ENST00000521291.1	37	CCDS34928.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.835143	0.50951	.	.	ENSG00000156482	ENST00000521291;ENST00000396070;ENST00000287038;ENST00000523172;ENST00000521726	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.1	3.92	0.45320	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.64494	0.2603	H	0.95437	3.67	0.58432	D	0.999999	B	0.15141	0.012	B	0.22152	0.038	T	0.65961	-0.6041	10	0.66056	D	0.02	-2.787	10.1382	0.42719	0.1491:0.0:0.0:0.8509	.	104	P62888	RL30_HUMAN	V	104;85;104;40;104	ENSP00000428085:I104V;ENSP00000287038:I104V;ENSP00000430506:I40V;ENSP00000429483:I104V	ENSP00000287038:I104V	I	-	1	0	RPL30	99123243	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.529000	0.81952	0.854000	0.35336	0.454000	0.30748	ATC		0.303	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380450.1		
TBC1D10C	374403	ucsc.edu	37	11	67176906	67176906	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:67176906A>G	ENST00000542590.1	+	9	1036	c.1022A>G	c.(1021-1023)gAc>gGc	p.D341G	TBC1D10C_ENST00000312390.5_Missense_Mutation_p.D341G|TBC1D10C_ENST00000526387.1_Silent_p.G276G			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	341					retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCAGAGCGGGACCTGCAGCGG	0.706																																						.											0													4.0	6.0	5.0					11																	67176906		1833	3735	5568	SO:0001583	missense	374403			BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.1022A>G	11.37:g.67176906A>G	ENSP00000443654:p.Asp341Gly		G3V1D6	Missense_Mutation	SNP	ENST00000542590.1	37	CCDS8162.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312459	0.40895	.	.	ENSG00000175463	ENST00000312390;ENST00000542590	T;T	0.07908	3.15;3.15	5.05	2.62	0.31277	.	0.122213	0.36854	N	0.002374	T	0.07188	0.0182	L	0.36672	1.1	0.53005	D	0.999966	B	0.27416	0.178	B	0.31442	0.13	T	0.32348	-0.9910	10	0.39692	T	0.17	.	6.5476	0.22414	0.6848:0.1611:0.0:0.1541	.	341	Q8IV04	TB10C_HUMAN	G	341	ENSP00000310193:D341G;ENSP00000443654:D341G	ENSP00000310193:D341G	D	+	2	0	TBC1D10C	66933482	0.987000	0.35691	0.962000	0.40283	0.631000	0.37964	2.832000	0.48152	0.357000	0.24183	0.459000	0.35465	GAC		0.706	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395492.2	NM_198517	
TESC	54997	ucsc.edu	37	12	117513078	117513078	+	Silent	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr12:117513078A>G	ENST00000335209.7	-	2	312	c.126T>C	c.(124-126)atT>atC	p.I42I	TESC_ENST00000541210.1_Silent_p.I42I|TESC_ENST00000392545.4_Silent_p.I95I			Q96BS2	CHP3_HUMAN	tescalcin	42					cell differentiation (GO:0030154)|cellular response to retinoic acid (GO:0071300)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell proliferation (GO:0008285)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of sodium:proton antiporter activity (GO:0032417)|positive regulation of transcription, DNA-templated (GO:0045893)|protein maturation (GO:0051604)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of cell adhesion mediated by integrin (GO:0033628)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphatase inhibitor activity (GO:0019212)|protein homodimerization activity (GO:0042803)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)		AATCTTACCGAATGGTAGGCT	0.512																																						.											0													87.0	84.0	85.0					12																	117513078		2203	4300	6503	SO:0001819	synonymous_variant	54997			AF443207	CCDS9183.2, CCDS9183.3, CCDS53835.1	12q24.22	2013-01-10			ENSG00000088992	ENSG00000088992		"""EF-hand domain containing"""	26065	protein-coding gene	gene with protein product	"""calcineurin-like EF hand protein 3"""	611585				11145610, 11696366, 12809501, 14661968	Standard	NM_017899		Approved	TSC, FLJ20607, CHP3	uc001twh.3	Q96BS2	OTTHUMG00000144168	ENST00000335209.7:c.126T>C	12.37:g.117513078A>G			F5H1Y5|Q9NWT9	Silent	SNP	ENST00000335209.7	37	CCDS9183.3																																																																																				0.512	TESC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291363.2	NM_017899	
AGGF1	55109	mdanderson.org	37	5	76332463	76332463	+	Missense_Mutation	SNP	C	C	A	rs78273685		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr5:76332463C>A	ENST00000312916.7	+	4	981	c.599C>A	c.(598-600)gCg>gAg	p.A200E		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	200					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)	p.A200E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GCAGCAGAAGCGGCTGTATCA	0.398																																						.											1	Substitution - Missense(1)	prostate(1)											80.0	80.0	80.0					5																	76332463		2203	4300	6503	SO:0001583	missense	55109			AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.599C>A	5.37:g.76332463C>A	ENSP00000316109:p.Ala200Glu		O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	37	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675227	0.47781	.	.	ENSG00000164252	ENST00000312916	D	0.85629	-2.01	5.09	5.09	0.68999	.	0.065026	0.64402	D	0.000007	D	0.84392	0.5462	L	0.41710	1.295	0.80722	D	1	D	0.52996	0.957	P	0.48921	0.595	D	0.83644	0.0152	9	.	.	.	-37.6142	18.4903	0.90844	0.0:1.0:0.0:0.0	.	200	Q8N302	AGGF1_HUMAN	E	200	ENSP00000316109:A200E	.	A	+	2	0	AGGF1	76368219	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	5.450000	0.66626	2.363000	0.80096	0.585000	0.79938	GCG		0.398	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
C1QTNF9	338872	mdanderson.org	37	13	24895797	24895797	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr13:24895797G>A	ENST00000382071.2	+	4	978	c.893G>A	c.(892-894)gGg>gAg	p.G298E	C1QTNF9_ENST00000332018.4_Missense_Mutation_p.G298E|C1QTNF9-AS1_ENST00000449656.1_RNA|AL359736.1_ENST00000422229.2_5'Flank			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	298	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		CTGAAGCTCGGGGATGAGGTG	0.507																																						.											0													102.0	106.0	105.0					13																	24895797		2203	4300	6503	SO:0001583	missense	338872			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.893G>A	13.37:g.24895797G>A	ENSP00000371503:p.Gly298Glu		A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	ENST00000382071.2	37	CCDS9306.1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.980211	0.74474	.	.	ENSG00000240654	ENST00000382071;ENST00000332018	D;D	0.82255	-1.59;-1.59	3.96	3.96	0.45880	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.100850	0.64402	D	0.000002	D	0.90154	0.6923	M	0.78285	2.405	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.90374	0.4383	10	0.44086	T	0.13	.	15.5078	0.75753	0.0:0.0:1.0:0.0	.	298	P0C862	C1T9A_HUMAN	E	298	ENSP00000371503:G298E;ENSP00000333737:G298E	ENSP00000333737:G298E	G	+	2	0	C1QTNF9	23793797	1.000000	0.71417	0.915000	0.36163	0.687000	0.40016	6.425000	0.73370	2.180000	0.69256	0.430000	0.28490	GGG		0.507	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044177.1	NM_178540	
CDC27	996	mdanderson.org	37	17	45219669	45219669	+	Missense_Mutation	SNP	G	G	A	rs11491191		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:45219669G>A	ENST00000066544.3	-	11	1397	c.1304C>T	c.(1303-1305)tCc>tTc	p.S435F	CDC27_ENST00000446365.2_Missense_Mutation_p.S374F|CDC27_ENST00000527547.1_Missense_Mutation_p.S435F|CDC27_ENST00000531206.1_Missense_Mutation_p.S441F	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	435					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAAATGATGGAAGAGTCCAA	0.333																																						.											0													25.0	24.0	25.0					17																	45219669		2202	4290	6492	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1304C>T	17.37:g.45219669G>A	ENSP00000066544:p.Ser435Phe		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418475	0.62622	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.69435	-0.4;-0.39;-0.12;-0.4	5.45	5.45	0.79879	.	0.229124	0.46442	D	0.000286	T	0.71693	0.3370	L	0.38175	1.15	0.51233	D	0.999911	D;D;D;D	0.63880	0.993;0.988;0.989;0.991	P;P;P;P	0.58172	0.79;0.774;0.834;0.687	T	0.74241	-0.3729	10	0.66056	D	0.02	-29.963	16.7931	0.85594	0.0:0.0:1.0:0.0	rs11491191	374;435;441;435	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	F	435;441;374;435	ENSP00000066544:S435F;ENSP00000434614:S441F;ENSP00000392802:S374F;ENSP00000437339:S435F	ENSP00000066544:S435F	S	-	2	0	CDC27	42574668	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.973000	0.63763	2.568000	0.86640	0.460000	0.39030	TCC		0.333	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDC27	996	mdanderson.org	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	G	T	rs199588670		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:45234300G>T	ENST00000066544.3	-	7	914	c.821C>A	c.(820-822)gCt>gAt	p.A274D	CDC27_ENST00000446365.2_Missense_Mutation_p.A213D|CDC27_ENST00000527547.1_Missense_Mutation_p.A274D|CDC27_ENST00000531206.1_Missense_Mutation_p.A274D|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.A274D(11)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGACTAAGAGCTGCTGGTCC	0.363																																						.											11	Substitution - Missense(11)	prostate(9)|skin(2)											61.0	65.0	63.0					17																	45234300		2201	4292	6493	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.821C>A	17.37:g.45234300G>T	ENSP00000066544:p.Ala274Asp		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604295	0.66445	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.38;-0.38;-0.13;-0.38;0.68	5.64	5.64	0.86602	.	0.058237	0.64402	D	0.000002	T	0.64735	0.2625	N	0.24115	0.695	0.58432	D	0.999999	P;P;P;B	0.51351	0.704;0.886;0.944;0.363	B;P;P;B	0.51615	0.216;0.495;0.675;0.143	T	0.64685	-0.6349	10	0.40728	T	0.16	-20.3108	17.2083	0.86924	0.0:0.0:1.0:0.0	.	213;274;274;274	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	274;274;213;274;274	ENSP00000066544:A274D;ENSP00000434614:A274D;ENSP00000392802:A213D;ENSP00000437339:A274D;ENSP00000432105:A274D	ENSP00000066544:A274D	A	-	2	0	CDC27	42589299	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.260000	0.95568	2.665000	0.90641	0.460000	0.39030	GCT		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDC27	996	mdanderson.org	37	17	45234430	45234430	+	Missense_Mutation	SNP	A	A	G	rs78072949		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:45234430A>G	ENST00000066544.3	-	7	784	c.691T>C	c.(691-693)Tca>Cca	p.S231P	CDC27_ENST00000446365.2_Missense_Mutation_p.S170P|CDC27_ENST00000527547.1_Missense_Mutation_p.S231P|CDC27_ENST00000531206.1_Missense_Mutation_p.S231P|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	231					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAGACACTGAGGAATCTGTA	0.323																																						.											0													36.0	40.0	39.0					17																	45234430		2179	4285	6464	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.691T>C	17.37:g.45234430A>G	ENSP00000066544:p.Ser231Pro		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.410050	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69561	-0.41;-0.35;-0.16;-0.4;0.68	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.15719	0.014;0.003;0.002;0.0	B;B;B;B	0.14023	0.004;0.01;0.003;0.001	T	0.47649	-0.9101	10	0.29301	T	0.29	-3.3768	13.444	0.61129	1.0:0.0:0.0:0.0	.	170;231;231;231	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	P	231;231;170;231;231	ENSP00000066544:S231P;ENSP00000434614:S231P;ENSP00000392802:S170P;ENSP00000437339:S231P;ENSP00000432105:S231P	ENSP00000066544:S231P	S	-	1	0	CDC27	42589429	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	4.586000	0.60984	2.066000	0.61787	0.377000	0.23210	TCA		0.323	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
FCGBP	8857	mdanderson.org	37	19	40368733	40368733	+	Silent	SNP	G	G	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:40368733G>C	ENST00000221347.6	-	28	12622	c.12615C>G	c.(12613-12615)ctC>ctG	p.L4205L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4205	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGCTGCTGGGGAGCGTCACGT	0.597																																						.											0													292.0	295.0	294.0					19																	40368733		2203	4300	6503	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12615C>G	19.37:g.40368733G>C			O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FLG	2312	mdanderson.org	37	1	152284424	152284424	+	Missense_Mutation	SNP	G	G	C	rs12756586	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:152284424G>C	ENST00000368799.1	-	3	2973	c.2938C>G	c.(2938-2940)Cat>Gat	p.H980D	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	980	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAGCCATGTCTTGACTGC	0.562									Ichthyosis				C|||	170	0.0339457	0.0325	0.0216	5008	,	,		21013	0.0238		0.0278	False		,,,				2504	0.0613					.											0													243.0	243.0	243.0					1																	152284424		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2938C>G	1.37:g.152284424G>C	ENSP00000357789:p.His980Asp		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	N	4.045	0.005945	0.07866	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.00695	5.83	3.45	-6.61	0.01818	.	.	.	.	.	T	0.00109	0.0003	N	0.01086	-1.025	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35895	-0.9770	9	0.07644	T	0.81	.	13.5956	0.61987	0.1:0.2109:0.6891:0.0	rs12756586	980	P20930	FILA_HUMAN	D	980;187	ENSP00000357789:H980D	ENSP00000357789:H980D	H	-	1	0	FLG	150551048	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.117000	0.03283	-1.136000	0.02892	-2.617000	0.00157	CAT		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FOLH1	2346	mdanderson.org	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																						.											1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
FOLH1	2346	mdanderson.org	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																						.											0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																				0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
GGT1	2678	mdanderson.org	37	22	25016442	25016442	+	Missense_Mutation	SNP	C	C	T	rs3895576		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr22:25016442C>T	ENST00000400382.1	+	8	1285	c.530C>T	c.(529-531)gCc>gTc	p.A177V	GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000400383.1_Missense_Mutation_p.A177V|GGT1_ENST00000248923.4_Missense_Mutation_p.A177V|GGT1_ENST00000406383.2_Missense_Mutation_p.A177V|GGT1_ENST00000400380.1_Missense_Mutation_p.A177V			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	177			A -> V (in dbSNP:rs3895576).		arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.A177V(1)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	TTGGCGGCAGCCCTGGAAAAC	0.687																																						.											1	Substitution - Missense(1)	prostate(1)											25.0	28.0	27.0					22																	25016442		1906	4095	6001	SO:0001583	missense	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.530C>T	22.37:g.25016442C>T	ENSP00000383232:p.Ala177Val		Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	14.08	2.430183	0.43122	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383	T;T;T;T;T;T	0.07021	3.23;3.23;3.23;3.23;3.23;3.23	3.35	3.35	0.38373	.	0.067565	0.64402	U	0.000018	T	0.09730	0.0239	L	0.56340	1.77	0.09310	N	1	B	0.12013	0.005	B	0.20577	0.03	T	0.15065	-1.0450	10	0.46703	T	0.11	-6.9103	10.3241	0.43783	0.0:0.7987:0.2013:0.0	rs3895576;rs4049845	177	P19440	GGT1_HUMAN	V	177	ENSP00000248923:A177V;ENSP00000393537:A177V;ENSP00000383232:A177V;ENSP00000383233:A177V;ENSP00000383231:A177V;ENSP00000385975:A177V	ENSP00000248923:A177V	A	+	2	0	GGT1	23346442	0.997000	0.39634	0.256000	0.24389	0.047000	0.14425	3.457000	0.53007	1.588000	0.49971	0.455000	0.32223	GCC		0.687	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
HLA-DRB1	3123	mdanderson.org	37	6	32557477	32557477	+	Silent	SNP	G	G	A	rs150644773	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr6:32557477G>A	ENST00000360004.5	-	1	148	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	15					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GTCACTGTCAGCGCTGTCATG	0.592										Multiple Myeloma(14;0.17)																												.											0													87.0	106.0	99.0					6																	32557477		1511	2709	4220	SO:0001819	synonymous_variant	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.43C>T	6.37:g.32557477G>A			P01914|Q9MYF5	Silent	SNP	ENST00000360004.5	37	CCDS47409.1																																																																																				0.592	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
KIF26A	26153	mdanderson.org	37	14	104643409	104643409	+	Silent	SNP	A	A	G	rs2487303	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr14:104643409A>G	ENST00000423312.2	+	12	4284	c.4284A>G	c.(4282-4284)gcA>gcG	p.A1428A	KIF26A_ENST00000315264.7_Silent_p.A1289A	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1428					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		AGGTAGAAGCAGCACACCGTC	0.706													G|||	3872	0.773163	0.826	0.7176	5008	,	,		14740	0.7827		0.7048	False		,,,				2504	0.8016					.											0								G		3386,734		1393,600,67	11.0	16.0	14.0		4284	-7.2	0.0	14	dbSNP_100	14	6044,2232		2231,1582,325	no	coding-synonymous	KIF26A	NM_015656.1		3624,2182,392	GG,GA,AA		26.9696,17.8155,23.9271		1428/1883	104643409	9430,2966	2060	4138	6198	SO:0001819	synonymous_variant	26153			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4284A>G	14.37:g.104643409A>G			Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																				0.706	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
KRTAP10-2	386679	mdanderson.org	37	21	45971109	45971109	+	Missense_Mutation	SNP	G	G	A	rs200984587	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr21:45971109G>A	ENST00000391621.1	-	1	279	c.233C>T	c.(232-234)tCg>tTg	p.S78L	TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	78	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CTGGCAGCACGAGGGCGTGCA	0.687																																						.											0																																										SO:0001583	missense	386679			AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.233C>T	21.37:g.45971109G>A	ENSP00000375479:p.Ser78Leu		Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	5.987	0.366047	0.11352	.	.	ENSG00000205445	ENST00000391621	T	0.01572	4.76	3.44	1.48	0.22813	.	.	.	.	.	T	0.03305	0.0096	M	0.87682	2.9	0.09310	N	1	B	0.22683	0.073	B	0.16289	0.015	T	0.40384	-0.9566	9	0.51188	T	0.08	.	2.1189	0.03721	0.1176:0.1948:0.4883:0.1993	.	78	P60368	KR102_HUMAN	L	78	ENSP00000375479:S78L	ENSP00000375479:S78L	S	-	2	0	KRTAP10-2	44795537	0.060000	0.20803	0.001000	0.08648	0.073000	0.16967	1.997000	0.40786	0.133000	0.18654	0.456000	0.33151	TCG		0.687	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
KRTAP4-11	653240	mdanderson.org	37	17	39274415	39274415	+	Silent	SNP	C	C	T	rs425487		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:39274415C>T	ENST00000391413.2	-	1	191	c.153G>A	c.(151-153)agG>agA	p.R51R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51R(6)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																																						.											6	Substitution - coding silent(6)	endometrium(3)|kidney(2)|lung(1)											9.0	15.0	13.0					17																	39274415		682	1579	2261	SO:0001819	synonymous_variant	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.153G>A	17.37:g.39274415C>T			A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																				0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
LAD1	3898	mdanderson.org	37	1	201358386	201358386	+	Silent	SNP	G	G	A	rs150992211	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:201358386G>A	ENST00000391967.2	-	2	385	c.84C>T	c.(82-84)cgC>cgT	p.R28R	LAD1_ENST00000367313.3_Silent_p.R42R	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	28	Poly-Arg.					basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						GCCTGCGCTCGCGCTCCTGTT	0.672													G|||	5	0.000998403	0.0	0.0	5008	,	,		18002	0.0		0.005	False		,,,				2504	0.0					.											0								G		0,4406		0,0,2203	46.0	44.0	45.0		84	-10.3	0.0	1	dbSNP_134	45	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	LAD1	NM_005558.3		0,5,6498	AA,AG,GG		0.0581,0.0,0.0384		28/518	201358386	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	3898			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.84C>T	1.37:g.201358386G>A			O95614|Q96GD8	Silent	SNP	ENST00000391967.2	37	CCDS1410.1																																																																																				0.672	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
CPSF1	29894	mdanderson.org	37	8	145625538	145625538	+	Intron	SNP	C	C	G	rs141140965		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:145625538C>G	ENST00000349769.3	-	9	1032				MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			cccccccccccccccAGCCAC	0.697																																					NSCLC(133;1088 1848 27708 34777 35269)	.											0													2.0	2.0	2.0					8																	145625538		1719	3320	5039	SO:0001627	intron_variant	100302196			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.937+21G>C	8.37:g.145625538C>G			Q96AF0	RNA	SNP	ENST00000349769.3	37	CCDS34966.1																																																																																				0.697	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
KMT2C	58508	mdanderson.org	37	7	151945349	151945349	+	Nonsense_Mutation	SNP	T	T	A	rs201039690		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:151945349T>A	ENST00000262189.6	-	14	2388	c.2170A>T	c.(2170-2172)Aag>Tag	p.K724*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.K724*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	724					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K724*(4)									TTCTGTTCCTTTTCTCCTTGT	0.398																																						.											4	Substitution - Nonsense(4)	kidney(2)|skin(2)											70.0	69.0	69.0					7																	151945349		2203	4300	6503	SO:0001587	stop_gained	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2170A>T	7.37:g.151945349T>A	ENSP00000262189:p.Lys724*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	37	6.120169	0.97300	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.13	-1.83	0.07833	.	0.648456	0.13994	N	0.348586	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	1.3853	0.02239	0.12:0.2536:0.2465:0.3799	.	.	.	.	X	724	.	ENSP00000262189:K724X	K	-	1	0	MLL3	151576282	0.000000	0.05858	0.029000	0.17559	0.083000	0.17756	-0.061000	0.11693	-0.613000	0.05694	-0.321000	0.08615	AAG		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC16	94025	mdanderson.org	37	19	8999443	8999443	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:8999443T>C	ENST00000397910.4	-	56	40935	c.40732A>G	c.(40732-40734)Atc>Gtc	p.I13578V	MUC16_ENST00000380951.5_Missense_Mutation_p.I219V	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13580	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCTCAGTGATGCTGTGGGTC	0.572																																						.											0													231.0	194.0	206.0					19																	8999443		2060	4204	6264	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40732A>G	19.37:g.8999443T>C	ENSP00000381008:p.Ile13578Val		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	0.060	-1.225501	0.01530	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.35236	1.32;1.32	2.95	-5.02	0.02982	SEA (2);	.	.	.	.	T	0.27900	0.0687	N	0.21508	0.67	.	.	.	B;B	0.28933	0.018;0.228	B;P	0.44561	0.008;0.453	T	0.52064	-0.8625	8	0.18276	T	0.48	.	8.2204	0.31539	0.0:0.3117:0.0:0.6883	.	21223;13578	Q8WXI7;B5ME49	MUC16_HUMAN;.	V	13578;219	ENSP00000381008:I13578V;ENSP00000370338:I219V	ENSP00000370338:I219V	I	-	1	0	MUC16	8860443	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-2.491000	0.00974	-0.945000	0.03681	0.454000	0.30748	ATC		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	mdanderson.org	37	3	195508380	195508380	+	Silent	SNP	G	G	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:195508380G>A	ENST00000463781.3	-	2	10530	c.10071C>T	c.(10069-10071)caC>caT	p.H3357H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.H3357H|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.602																																						.											0													38.0	30.0	32.0					3																	195508380		690	1583	2273	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10071C>T	3.37:g.195508380G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512520	195512520	+	Silent	SNP	C	C	T	rs531471633	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:195512520C>T	ENST00000463781.3	-	2	6390	c.5931G>A	c.(5929-5931)gtG>gtA	p.V1977V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.V1977V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCTGTGGACACTGAGGAAG	0.597													.|||	3	0.000599042	0.0015	0.0	5008	,	,		26532	0.001		0.0	False		,,,				2504	0.0					.											0																																										SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5931G>A	3.37:g.195512520C>T			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512531	195512531	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:195512531C>T	ENST00000463781.3	-	2	6379	c.5920G>A	c.(5920-5922)Gct>Act	p.A1974T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1974T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1974T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.607																																						.											1	Substitution - Missense(1)	endometrium(1)											52.0	43.0	46.0					3																	195512531		690	1590	2280	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5920G>A	3.37:g.195512531C>T	ENSP00000417498:p.Ala1974Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	6.041	0.375968	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.45;1.46	.	.	.	.	.	.	.	.	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	P	0.45986	0.87	B	0.26310	0.068	T	0.27468	-1.0073	7	.	.	.	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	.	1974	E7ESK3	.	T	1974	ENSP00000417498:A1974T;ENSP00000420243:A1974T	.	A	-	1	0	MUC4	196996926	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	-3.284000	0.00527	-0.833000	0.04245	0.064000	0.15345	GCT		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195513826	195513826	+	Missense_Mutation	SNP	G	G	A	rs202029925		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:195513826G>A	ENST00000463781.3	-	2	5084	c.4625C>T	c.(4624-4626)cCt>cTt	p.P1542L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1542L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.M1535_T1550delMPLPVTSPSSASTGDT(4)|p.P1542L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGGGCTAGTGAC	0.592																																						.											5	Deletion - In frame(4)|Substitution - Missense(1)	stomach(4)|kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4625C>T	3.37:g.195513826G>A	ENSP00000417498:p.Pro1542Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	9.599	1.128178	0.20959	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26067	1.77;1.76	0.844	0.844	0.18943	.	.	.	.	.	T	0.21307	0.0513	N	0.19112	0.55	0.31987	N	0.6051	P	0.48350	0.909	P	0.52909	0.713	T	0.25779	-1.0122	8	.	.	.	.	5.3481	0.16020	1.0E-4:0.0:0.9999:0.0	.	1542	E7ESK3	.	L	1542	ENSP00000417498:P1542L;ENSP00000420243:P1542L	.	P	-	2	0	MUC4	196998221	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-0.058000	0.11750	0.088000	0.17205	0.089000	0.15464	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515052	195515052	+	Missense_Mutation	SNP	G	G	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:195515052G>C	ENST00000463781.3	-	2	3858	c.3399C>G	c.(3397-3399)caC>caG	p.H1133Q	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1133Q|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	581					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H1133Q(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGAGGTGGCGTGACCTGTGG	0.567																																						.											2	Substitution - Missense(2)	endometrium(2)											5.0	6.0	6.0					3																	195515052		542	1260	1802	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3399C>G	3.37:g.195515052G>C	ENSP00000417498:p.His1133Gln		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.833	-0.469252	0.04445	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26957	1.72;1.7	0.814	-1.63	0.08345	.	.	.	.	.	T	0.20700	0.0498	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.61658	0.892	T	0.18618	-1.0331	8	.	.	.	.	6.1974	0.20557	0.0:0.0:0.5044:0.4955	.	1133	E7ESK3	.	Q	1133	ENSP00000417498:H1133Q;ENSP00000420243:H1133Q	.	H	-	3	2	MUC4	196999447	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.117000	0.10708	-1.056000	0.03205	0.064000	0.15345	CAC		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC5B	727897	mdanderson.org	37	11	1270383	1270383	+	Silent	SNP	G	G	A	rs61869661	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:1270383G>A	ENST00000529681.1	+	31	12331	c.12273G>A	c.(12271-12273)acG>acA	p.T4091T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T4094T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4091	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCACACCACGGCCACCTCCA	0.701													G|||	37	0.00738818	0.0	0.0173	5008	,	,		14467	0.002		0.0199	False		,,,				2504	0.0031					.											0								G		19,4175		1,17,2079	91.0	126.0	114.0		12273	-4.3	0.0	11	dbSNP_129	114	160,8248		5,150,4049	no	coding-synonymous	MUC5B	NM_002458.2		6,167,6128	AA,AG,GG		1.9029,0.453,1.4204		4091/5763	1270383	179,12423	2097	4204	6301	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12273G>A	11.37:g.1270383G>A			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.701	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC6	4588	mdanderson.org	37	11	1016871	1016871	+	Missense_Mutation	SNP	G	G	T	rs554068781		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:1016871G>T	ENST00000421673.2	-	31	5980	c.5930C>A	c.(5929-5931)cCc>cAc	p.P1977H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1977	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGAGAAGGGACTGCTCCC	0.587																																						.											0													1308.0	1300.0	1302.0					11																	1016871		2203	4299	6502	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5930C>A	11.37:g.1016871G>T	ENSP00000406861:p.Pro1977His		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923756	0.34002	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	2.69	1.71	0.24356	.	.	.	.	.	T	0.14614	0.0353	L	0.29908	0.895	0.09310	N	1	B	0.29212	0.237	B	0.28553	0.091	T	0.22382	-1.0218	9	0.56958	D	0.05	.	7.0992	0.25327	0.0:0.0:0.7301:0.2699	.	1977	Q6W4X9	MUC6_HUMAN	H	1977	ENSP00000406861:P1977H	ENSP00000406861:P1977H	P	-	2	0	MUC6	1006871	0.015000	0.18098	0.001000	0.08648	0.026000	0.11368	1.250000	0.32850	0.416000	0.25844	0.306000	0.20318	CCC		0.587	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017152	1017152	+	Missense_Mutation	SNP	G	G	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:1017152G>C	ENST00000421673.2	-	31	5699	c.5649C>G	c.(5647-5649)atC>atG	p.I1883M		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1883	Approximate repeats.|Thr-rich.			PTTIKA -> LTTLMN (in Ref. 5; AAA35866). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGTGGCCTTGATCGTGGTCG	0.562																																						.											0													568.0	561.0	564.0					11																	1017152		2202	4287	6489	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5649C>G	11.37:g.1017152G>C	ENSP00000406861:p.Ile1883Met		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.422707	0.25639	.	.	ENSG00000184956	ENST00000421673	T	0.22539	1.95	2.4	-2.53	0.06326	.	.	.	.	.	T	0.19127	0.0459	N	0.21448	0.665	0.09310	N	1	D	0.54207	0.965	P	0.59012	0.85	T	0.11470	-1.0586	9	0.33940	T	0.23	.	2.4101	0.04422	0.1196:0.3184:0.3879:0.174	.	1883	Q6W4X9	MUC6_HUMAN	M	1883	ENSP00000406861:I1883M	ENSP00000406861:I1883M	I	-	3	3	MUC6	1007152	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.412000	0.07132	-0.608000	0.05731	-0.657000	0.03884	ATC		0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	mdanderson.org	37	11	1270401	1270401	+	Silent	SNP	G	G	A	rs201512746	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:1270401G>A	ENST00000529681.1	+	31	12349	c.12291G>A	c.(12289-12291)acG>acA	p.T4097T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T4100T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4097	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A4055_T4056delAT(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAGGACCACGGCCACGGCCA	0.711																																						.											1	Deletion - In frame(1)	ovary(1)											68.0	100.0	89.0					11																	1270401		2087	4191	6278	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12291G>A	11.37:g.1270401G>A			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.711	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NIN	51199	mdanderson.org;bcgsc.ca	37	14	51237220	51237220	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr14:51237220C>A	ENST00000382041.3	-	12	1510	c.1320G>T	c.(1318-1320)gaG>gaT	p.E440D	NIN_ENST00000389868.3_Missense_Mutation_p.E440D|NIN_ENST00000324330.9_Missense_Mutation_p.E440D|NIN_ENST00000245441.5_Missense_Mutation_p.E440D|NIN_ENST00000530997.2_Missense_Mutation_p.E440D|NIN_ENST00000382043.4_Missense_Mutation_p.E440D|NIN_ENST00000453196.1_Missense_Mutation_p.E440D	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	440					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TCTGCTCTCTCTCTTTTCGGA	0.448			T	PDGFRB	MPD																																	.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													177.0	156.0	163.0					14																	51237220		2203	4300	6503	SO:0001583	missense	51199			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1320G>T	14.37:g.51237220C>A	ENSP00000371472:p.Glu440Asp		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891097	0.72524	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.50411	0.1614	M	0.78637	2.42	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.996	D;D;D;D;D	0.87578	0.998;0.998;0.993;0.991;0.987	T	0.50110	-0.8866	10	0.59425	D	0.04	-18.9462	18.6203	0.91318	0.0:1.0:0.0:0.0	.	446;440;440;440;440	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	D	440;440;440;440;446;440;440;440	ENSP00000245441:E440D;ENSP00000374518:E440D;ENSP00000371474:E440D;ENSP00000371472:E440D;ENSP00000324210:E440D;ENSP00000412391:E440D	ENSP00000245441:E440D	E	-	3	2	NIN	50306970	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	3.064000	0.49986	2.658000	0.90341	0.650000	0.86243	GAG		0.448	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
NOTCH3	4854	mdanderson.org	37	19	15285052	15285052	+	Silent	SNP	T	T	C	rs1044006	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:15285052T>C	ENST00000263388.2	-	25	4638	c.4563A>G	c.(4561-4563)ccA>ccG	p.P1521P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1521					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTAGCTCCTCTGGCGGCAGCA	0.706													C|||	4366	0.871805	0.9879	0.7637	5008	,	,		14411	0.8006		0.8817	False		,,,				2504	0.8548					.											0								C		4249,97		2076,97,0	11.0	14.0	13.0		4563	-9.2	0.8	19	dbSNP_86	13	7663,853		3451,761,46	no	coding-synonymous	NOTCH3	NM_000435.2		5527,858,46	CC,CT,TT		10.0164,2.2319,7.3861		1521/2322	15285052	11912,950	2173	4258	6431	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4563A>G	19.37:g.15285052T>C			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																				0.706	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
OR10H2	26538	mdanderson.org	37	19	15839311	15839311	+	Missense_Mutation	SNP	C	C	T	rs139469467		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:15839311C>T	ENST00000305899.3	+	1	478	c.458C>T	c.(457-459)tCg>tTg	p.S153L		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GCTGGTGGCTCGGTCATGGGG	0.592																																						.											0													91.0	75.0	81.0					19																	15839311		2203	4300	6503	SO:0001583	missense	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.458C>T	19.37:g.15839311C>T	ENSP00000306095:p.Ser153Leu		Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	0.360	-0.939686	0.02322	.	.	ENSG00000171942	ENST00000305899	T	0.00019	9.06	3.4	-2.39	0.06602	GPCR, rhodopsin-like superfamily (1);	1.096810	0.07137	N	0.846687	T	0.00039	0.0001	N	0.02973	-0.45	0.09310	N	1	B	0.12630	0.006	B	0.19946	0.027	T	0.00510	-1.1697	10	0.10902	T	0.67	.	6.8361	0.23937	0.0:0.2906:0.0:0.7094	.	153	O60403	O10H2_HUMAN	L	153	ENSP00000306095:S153L	ENSP00000306095:S153L	S	+	2	0	OR10H2	15700311	0.000000	0.05858	0.002000	0.10522	0.174000	0.22865	-0.238000	0.08977	-0.296000	0.08947	0.537000	0.68136	TCG		0.592	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
OR2T12	127064	mdanderson.org	37	1	248458419	248458419	+	Silent	SNP	G	G	C	rs142654576		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:248458419G>C	ENST00000317996.1	-	1	461	c.462C>G	c.(460-462)ggC>ggG	p.G154G		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCTGCAGGAGGCCGTCAGCTG	0.602																																						.											0													87.0	93.0	91.0					1																	248458419		2162	4286	6448	SO:0001819	synonymous_variant	127064			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.462C>G	1.37:g.248458419G>C				Silent	SNP	ENST00000317996.1	37	CCDS31110.1																																																																																				0.602	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
RBM11	54033	mdanderson.org	37	21	15599340	15599340	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr21:15599340A>G	ENST00000400577.3	+	5	581	c.572A>G	c.(571-573)cAc>cGc	p.H191R	RBM11_ENST00000468643.1_3'UTR	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11	191					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		AAATGGACTCACCAACAACCA	0.453																																						.											0													271.0	258.0	263.0					21																	15599340		1964	4154	6118	SO:0001583	missense	54033			AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.572A>G	21.37:g.15599340A>G	ENSP00000383421:p.His191Arg		Q6YNC2|Q8NBA1|Q8NFF6	Missense_Mutation	SNP	ENST00000400577.3	37	CCDS46635.1	.	.	.	.	.	.	.	.	.	.	A	1.477	-0.558202	0.03967	.	.	ENSG00000185272	ENST00000400577	T	0.07216	3.21	1.87	0.568	0.17333	.	1.040610	0.07512	N	0.908963	T	0.03305	0.0096	N	0.08118	0	0.20307	N	0.999915	B	0.16166	0.016	B	0.04013	0.001	T	0.46775	-0.9167	10	0.17832	T	0.49	.	0.217	0.00163	0.3713:0.2386:0.1563:0.2338	.	191	P57052	RBM11_HUMAN	R	191	ENSP00000383421:H191R	ENSP00000383421:H191R	H	+	2	0	RBM11	14521211	0.764000	0.28473	0.756000	0.31282	0.615000	0.37417	0.317000	0.19487	0.130000	0.18549	0.164000	0.16699	CAC		0.453	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157818.1	NM_144770	
RFX1	5989	mdanderson.org	37	19	14083761	14083761	+	Missense_Mutation	SNP	T	T	C	rs2305780	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:14083761T>C	ENST00000254325.4	-	9	1342	c.1108A>G	c.(1108-1110)Acc>Gcc	p.T370A		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	370			T -> A (in dbSNP:rs2305780). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2253877}.		immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CCAGTGCTGGTGGAGCTGGCG	0.741													T|||	2661	0.53135	0.7496	0.5	5008	,	,		10294	0.4454		0.4742	False		,,,				2504	0.4059					.											0								T	ALA/THR	3076,1206		1147,782,212	13.0	14.0	14.0		1108	-2.8	0.2	19	dbSNP_100	14	3917,4527		951,2015,1256	yes	missense	RFX1	NM_002918.4	58	2098,2797,1468	CC,CT,TT		46.388,28.1644,45.0495	benign	370/980	14083761	6993,5733	2141	4222	6363	SO:0001583	missense	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.1108A>G	19.37:g.14083761T>C	ENSP00000254325:p.Thr370Ala			Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	1139	0.5215201465201466	351	0.7134146341463414	190	0.5248618784530387	248	0.43356643356643354	350	0.46174142480211083	T	9.229	1.035327	0.19590	0.718356	0.46388	ENSG00000132005	ENST00000254325	T	0.39997	1.05	4.02	-2.85	0.05734	RFX1 transcription activation region (1);	0.529736	0.19468	N	0.113536	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.16396	0.017	B	0.22152	0.038	T	0.41538	-0.9503	9	0.08837	T	0.75	-17.3917	0.6272	0.00788	0.2668:0.1627:0.1302:0.4403	rs2305780;rs17854587;rs60197642	370	P22670	RFX1_HUMAN	A	370	ENSP00000254325:T370A	ENSP00000254325:T370A	T	-	1	0	RFX1	13944761	0.996000	0.38824	0.227000	0.23927	0.383000	0.30230	0.368000	0.20399	-0.867000	0.04063	-0.441000	0.05720	ACC		0.741	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
SERPINA7	6906	mdanderson.org;bcgsc.ca	37	X	105278361	105278361	+	Missense_Mutation	SNP	C	C	A	rs1804495	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chrX:105278361C>A	ENST00000327674.4	-	3	1244	c.909G>T	c.(907-909)ttG>ttT	p.L303F	SERPINA7_ENST00000487487.1_5'UTR|SERPINA7_ENST00000372563.1_Missense_Mutation_p.L303F			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	303			L -> F (common polymorphism; dbSNP:rs1804495).		aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TTGGAACAAACAAGTCAACCC	0.408													C|||	678	0.179603	0.084	0.0778	3775	,	,		15263	0.1964		0.0855	False		,,,				2504	0.2342					.											0			GRCh37	CD013484|CM920665	SERPINA7	D|M	rs1804495	C	PHE/LEU	472,3363		32,335,73,1265,498	91.0	75.0	80.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	909	2.5	0.8	X	dbSNP_89	80	751,5977		33,464,221,1931,1651	yes	missense	SERPINA7	NM_000354.5	22	65,799,294,3196,2149	AA,AC,A,CC,C		11.1623,12.3077,11.5782	probably-damaging	303/416	105278361	1223,9340	2203	4300	6503	SO:0001583	missense	6906			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.909G>T	X.37:g.105278361C>A	ENSP00000329374:p.Leu303Phe		D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	228	0.13743218806509946	32	0.06779661016949153	27	0.07894736842105263	62	0.11877394636015326	43	0.059722222222222225	C	14.90	2.672593	0.47781	0.123077	0.111623	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.91068	-2.78;-2.78	4.83	2.51	0.30379	Serpin domain (3);	0.628220	0.12570	N	0.457388	T	0.19565	0.0470	M	0.86028	2.79	0.58432	P	5.999999999950489E-6	D	0.58620	0.983	P	0.53809	0.735	T	0.68918	-0.5282	9	0.72032	D	0.01	.	1.9978	0.03460	0.2538:0.3548:0.0:0.3915	rs1804495;rs2071772;rs17347153;rs52796729;rs59668572;rs1804495	303	P05543	THBG_HUMAN	F	303	ENSP00000329374:L303F;ENSP00000361644:L303F	ENSP00000329374:L303F	L	-	3	2	SERPINA7	105165017	0.000000	0.05858	0.766000	0.31476	0.852000	0.48524	-0.651000	0.05372	0.352000	0.24053	0.594000	0.82650	TTG		0.408	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354	
SLC39A3	29985	mdanderson.org	37	19	2732986	2732986	+	Silent	SNP	T	T	C	rs759073	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:2732986T>C	ENST00000269740.4	-	3	1037	c.708A>G	c.(706-708)gtA>gtG	p.V236V	SLC39A3_ENST00000545664.1_Silent_p.V236V|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3	236					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATGGCGCTTACGGTGACCG	0.736													C|||	3132	0.625399	0.907	0.3905	5008	,	,		14002	0.6468		0.4414	False		,,,				2504	0.5787					.											0								C		3669,719		1542,585,67	19.0	22.0	21.0		708	2.4	1.0	19	dbSNP_86	21	3873,4701		921,2031,1335	no	coding-synonymous	SLC39A3	NM_144564.4		2463,2616,1402	CC,CT,TT		45.1714,16.3856,41.8145		236/315	2732986	7542,5420	2194	4287	6481	SO:0001819	synonymous_variant	29985			AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.708A>G	19.37:g.2732986T>C			B3KMJ3|Q8WUG1	Silent	SNP	ENST00000269740.4	37	CCDS12093.1																																																																																				0.736	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451354.2		
SPATA31D1	389763	mdanderson.org	37	9	84607651	84607651	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr9:84607651T>C	ENST00000344803.2	+	4	2313	c.2266T>C	c.(2266-2268)Ttc>Ctc	p.F756L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	756					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCCTAGAAGCTTCCACGAGAG	0.463																																						.											0													50.0	45.0	47.0					9																	84607651		1814	4071	5885	SO:0001583	missense	389763				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2266T>C	9.37:g.84607651T>C	ENSP00000341988:p.Phe756Leu			Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	T	8.889	0.953501	0.18431	.	.	ENSG00000214929	ENST00000344803	T	0.05258	3.47	2.81	-1.47	0.08772	.	1.033220	0.07726	N	0.944536	T	0.05044	0.0135	L	0.53249	1.67	0.09310	N	1	P	0.35456	0.502	B	0.34722	0.188	T	0.39057	-0.9632	10	0.10377	T	0.69	-6.7016	0.374	0.00384	0.2211:0.1411:0.2268:0.411	.	756	Q6ZQQ2	F75D1_HUMAN	L	756	ENSP00000341988:F756L	ENSP00000341988:F756L	F	+	1	0	FAM75D1	83797471	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	-1.518000	0.02246	-0.290000	0.09025	0.418000	0.28097	TTC		0.463	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
SUSD2	56241	mdanderson.org	37	22	24579219	24579219	+	Missense_Mutation	SNP	G	G	A	rs399140		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr22:24579219G>A	ENST00000358321.3	+	2	532	c.271G>A	c.(271-273)Gcc>Acc	p.A91T		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	91					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.A91T(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCCCACAGACGCCAGTGTGAT	0.627																																						.											1	Substitution - Missense(1)	skin(1)											38.0	38.0	38.0					22																	24579219		2202	4276	6478	SO:0001583	missense	56241			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.271G>A	22.37:g.24579219G>A	ENSP00000351075:p.Ala91Thr		Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	G	2.736	-0.263316	0.05754	.	.	ENSG00000099994	ENST00000358321	T	0.05649	3.41	3.33	-1.69	0.08186	.	1.453820	0.04535	N	0.386942	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.25772	0.134	B	0.09377	0.004	T	0.43327	-0.9398	10	0.12766	T	0.61	.	7.7082	0.28663	0.5771:0.0:0.4229:0.0	rs399140;rs4398360	91	Q9UGT4	SUSD2_HUMAN	T	91	ENSP00000351075:A91T	ENSP00000351075:A91T	A	+	1	0	SUSD2	22909219	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.783000	0.04638	-0.189000	0.10482	-0.418000	0.06021	GCC		0.627	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
TRPM5	29850	mdanderson.org	37	11	2435946	2435946	+	Splice_Site	SNP	A	A	G	rs4929981	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr11:2435946A>G	ENST00000155858.6	-	11	1751	c.1743T>C	c.(1741-1743)ctT>ctC	p.L581L	TRPM5_ENST00000452833.1_Splice_Site_p.L583L|TRPM5_ENST00000528453.1_Splice_Site_p.L581L|TRPM5_ENST00000533060.1_Splice_Site_p.L581L	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		gTCACTCACCAAGGGCCAGCC	0.711													A|||	3808	0.760383	0.6286	0.83	5008	,	,		13145	0.9048		0.7117	False		,,,				2504	0.7904				NSCLC(1;49 61 17205 18850 43201)	.											0								A		2544,1064		900,744,160	4.0	5.0	5.0		1743	-0.7	1.0	11	dbSNP_111	5	5370,1840		2019,1332,254	no	coding-synonymous-near-splice	TRPM5	NM_014555.3		2919,2076,414	GG,GA,AA		25.5201,29.49,26.8441		581/1166	2435946	7914,2904	1804	3605	5409	SO:0001630	splice_region_variant	29850			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1744+1T>C	11.37:g.2435946A>G				Silent	SNP	ENST00000155858.6	37	CCDS31340.1																																																																																				0.711	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	Silent
TUBB8	347688	mdanderson.org	37	10	93804	93804	+	Silent	SNP	C	C	T	rs9329304	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr10:93804C>T	ENST00000309812.4	-	4	590	c.528G>A	c.(526-528)tcG>tcA	p.S176S	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000447903.2_Silent_p.S104S	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	176					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CCACGGTGTCCGACACCTTGG	0.537																																					Pancreas(192;2041 3010 9013 18103)	.											0								T		308,4098	763.7+/-413.2	0,308,1895	102.0	92.0	95.0		528		0.2	10	dbSNP_119	95	11,8573	794.8+/-407.5	0,11,4281	no	coding-synonymous	TUBB8	NM_177987.2		0,319,6176	TT,TC,CC		0.1281,6.9905,2.4557		176/445	93804	319,12671	2203	4292	6495	SO:0001819	synonymous_variant	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.528G>A	10.37:g.93804C>T			Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	CCDS7051.1																																																																																				0.537	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
ZNF593	51042	mdanderson.org	37	1	26496651	26496651	+	Silent	SNP	T	T	C	rs7087	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:26496651T>C	ENST00000374266.5	+	1	290	c.177T>C	c.(175-177)ggT>ggC	p.G59G	RP11-96L14.7_ENST00000433939.1_RNA|ZNF593_ENST00000270812.5_Silent_p.G59G|RP11-96L14.7_ENST00000414762.1_RNA|RP11-96L14.7_ENST00000448923.1_RNA|RP11-96L14.7_ENST00000407889.2_RNA|RP11-96L14.7_ENST00000444682.1_RNA	NM_015871.4	NP_056955.2	O00488	ZN593_HUMAN	zinc finger protein 593	59					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			large_intestine(4)|prostate(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGGGGCGGTCTGCACCGCT	0.706											OREG0013262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2678	0.534744	0.6301	0.5504	5008	,	,		13465	0.6429		0.2992	False		,,,				2504	0.5256					.											0								C		2355,1869		730,895,487	6.0	8.0	7.0		177	3.7	1.0	1	dbSNP_52	7	2256,6012		382,1492,2260	no	coding-synonymous	ZNF593	NM_015871.4		1112,2387,2747	CC,CT,TT		27.2859,44.2472,36.9116		59/135	26496651	4611,7881	2112	4134	6246	SO:0001819	synonymous_variant	51042			D45213	CCDS275.2	1p35.3	2012-10-05			ENSG00000142684	ENSG00000142684			30943	protein-coding gene	gene with protein product						9115366	Standard	NM_015871		Approved	ZT86	uc001bll.4	O00488	OTTHUMG00000007538	ENST00000374266.5:c.177T>C	1.37:g.26496651T>C		787	B2R4S0|Q5T2H7	Silent	SNP	ENST00000374266.5	37	CCDS275.2																																																																																				0.706	ZNF593-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019842.2	NM_015871	
ZNRF4	148066	mdanderson.org	37	19	5455976	5455976	+	Silent	SNP	C	C	T	rs386806230|rs61740902	byFrequency	TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr19:5455976C>T	ENST00000222033.4	+	1	551	c.474C>T	c.(472-474)atC>atT	p.I158I		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	158	PA.			AIV -> SIA (in Ref. 4; AAH17592). {ECO:0000305}.		cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		TGGGCGCCATCGTGCTGATCC	0.682													C|||	596	0.11901	0.0477	0.1729	5008	,	,		15731	0.004		0.2296	False		,,,				2504	0.182					.											0								C		259,3999		8,243,1878	28.0	31.0	30.0		474	-9.3	0.0	19	dbSNP_129	30	1616,6844		228,1160,2842	no	coding-synonymous	ZNRF4	NM_181710.3		236,1403,4720	TT,TC,CC		19.1017,6.0827,14.7429		158/430	5455976	1875,10843	2129	4230	6359	SO:0001819	synonymous_variant	148066			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.474C>T	19.37:g.5455976C>T			A8K886|O75866	Silent	SNP	ENST00000222033.4	37	CCDS42475.1																																																																																				0.682	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
OR2T2	401992	bcgsc.ca	37	1	248616706	248616712	+	Frame_Shift_Del	DEL	TGCTGCG	TGCTGCG	-	rs199823862		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	TGCTGCG	TGCTGCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr1:248616706_248616712delTGCTGCG	ENST00000342927.3	+	1	630_636	c.608_614delTGCTGCG	c.(607-615)ttgctgcggfs	p.LLR203fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGTATGCCTGCTGCGTGCTGATGCTG	0.527																																						.											0																																										SO:0001589	frameshift_variant	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.608_614delTGCTGCG	1.37:g.248616706_248616712delTGCTGCG	ENSP00000343062:p.Leu203fs		B2RNM1|B9EH01	Frame_Shift_Del	DEL	ENST00000342927.3	37	CCDS31116.1																																																																																				0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
VMP1	81671	bcgsc.ca	37	17	57895132	57895132	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr17:57895132delT	ENST00000262291.4	+	10	1282	c.972delT	c.(970-972)attfs	p.I324fs	VMP1_ENST00000536180.1_Frame_Shift_Del_p.I227fs|VMP1_ENST00000539763.1_Frame_Shift_Del_p.I132fs|VMP1_ENST00000537567.1_Frame_Shift_Del_p.I190fs|VMP1_ENST00000545362.1_Frame_Shift_Del_p.I268fs	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	324					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TGGCTTTCATTGGGTAAGTAA	0.279																																						.											0													40.0	40.0	40.0					17																	57895132		2202	4286	6488	SO:0001589	frameshift_variant	81671				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.972delT	17.37:g.57895132delT	ENSP00000262291:p.Ile324fs		B4DVV9|Q9H0P4|Q9P089	Frame_Shift_Del	DEL	ENST00000262291.4	37	CCDS11619.1																																																																																				0.279	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
TGM6	343641	bcgsc.ca	37	20	2384095	2384095	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr20:2384095T>C	ENST00000202625.2	+	8	1103	c.1042T>C	c.(1042-1044)Tct>Cct	p.S348P	TGM6_ENST00000381423.1_Missense_Mutation_p.S348P	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	348					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CCTAGGCCCCTCTTACAATGG	0.567																																						.											0													56.0	53.0	54.0					20																	2384095		2203	4300	6503	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1042T>C	20.37:g.2384095T>C	ENSP00000202625:p.Ser348Pro		Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610753	0.66558	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.87412	-2.25;-2.25	4.9	-0.758	0.11049	Transglutaminase-like (2);	0.663319	0.16355	N	0.218045	D	0.84871	0.5568	M	0.66939	2.045	0.25024	N	0.991311	P;P	0.48911	0.797;0.917	P;P	0.45712	0.491;0.48	T	0.77308	-0.2636	10	0.59425	D	0.04	-1.3682	8.462	0.32934	0.1442:0.0:0.5177:0.3382	.	348;348	O95932-2;O95932	.;TGM3L_HUMAN	P	348	ENSP00000202625:S348P;ENSP00000370831:S348P	ENSP00000202625:S348P	S	+	1	0	TGM6	2332095	0.000000	0.05858	0.931000	0.37212	0.970000	0.65996	0.078000	0.14761	-0.220000	0.09988	0.449000	0.29647	TCT		0.567	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
LRRN1	57633	bcgsc.ca	37	3	3887089	3887089	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:3887089C>A	ENST00000319331.3	+	2	1525	c.764C>A	c.(763-765)cCt>cAt	p.P255H	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	255						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		GTTAAAGTCCCTCAACTTGCC	0.403																																						.											0													79.0	87.0	84.0					3																	3887089		2202	4300	6502	SO:0001583	missense	57633			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.764C>A	3.37:g.3887089C>A	ENSP00000314901:p.Pro255His		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296416	0.81025	.	.	ENSG00000175928	ENST00000319331	T	0.34472	1.36	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.63873	0.2548	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65598	-0.6129	10	0.54805	T	0.06	.	19.313	0.94199	0.0:1.0:0.0:0.0	.	255	Q6UXK5	LRRN1_HUMAN	H	255	ENSP00000314901:P255H	ENSP00000314901:P255H	P	+	2	0	LRRN1	3862089	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.755000	0.85180	2.557000	0.86248	0.585000	0.79938	CCT		0.403	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
TRANK1	9881	bcgsc.ca	37	3	36898643	36898643	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr3:36898643T>C	ENST00000429976.2	-	12	2685	c.2438A>G	c.(2437-2439)aAg>aGg	p.K813R	TRANK1_ENST00000428977.2_Missense_Mutation_p.K263R|TRANK1_ENST00000301807.6_Missense_Mutation_p.K263R	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	813							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GATGATTTTCTTCTTGATGAC	0.507																																						.											0													171.0	168.0	169.0					3																	36898643		2012	4168	6180	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2438A>G	3.37:g.36898643T>C	ENSP00000416168:p.Lys813Arg		Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	T	10.38	1.333210	0.24167	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.32988	1.43;1.83;1.43	5.64	3.29	0.37713	.	0.193295	0.37304	N	0.002150	T	0.15522	0.0374	N	0.14661	0.345	0.28734	N	0.902325	B	0.16166	0.016	B	0.10450	0.005	T	0.10965	-1.0607	10	0.30078	T	0.28	.	6.672	0.23074	0.0:0.1436:0.1404:0.716	.	813	O15050	TRNK1_HUMAN	R	263;813;263	ENSP00000416826:K263R;ENSP00000416168:K813R;ENSP00000301807:K263R	ENSP00000301807:K263R	K	-	2	0	TRANK1	36873647	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.181000	0.42547	1.093000	0.41377	0.533000	0.62120	AAG		0.507	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
ARSK	153642	bcgsc.ca	37	5	94936602	94936602	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr5:94936602delC	ENST00000380009.4	+	7	1353	c.1148delC	c.(1147-1149)ccgfs	p.P383fs		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	383					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		TCTTTGTTGCCGTTATCATCA	0.363																																						.											0													141.0	138.0	139.0					5																	94936602		2203	4300	6503	SO:0001589	frameshift_variant	153642				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1148delC	5.37:g.94936602delC	ENSP00000369346:p.Pro383fs		A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Frame_Shift_Del	DEL	ENST00000380009.4	37	CCDS4073.1																																																																																				0.363	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150	
ARPC1B	10095	bcgsc.ca	37	7	98988571	98988571	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:98988571G>T	ENST00000451682.1	+	8	865	c.556G>T	c.(556-558)Ggc>Tgc	p.G186C	ARPC1B_ENST00000252725.5_Missense_Mutation_p.G186C|PDAP1_ENST00000496335.1_5'Flank			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	186					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CACCCCGTGGGGCTCCAAGAT	0.597																																						.											0													49.0	48.0	48.0					7																	98988571		2203	4300	6503	SO:0001583	missense	10095			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.556G>T	7.37:g.98988571G>T	ENSP00000389631:p.Gly186Cys		Q9BU00	Missense_Mutation	SNP	ENST00000451682.1	37	CCDS5661.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767210	0.90020	.	.	ENSG00000130429	ENST00000252725;ENST00000451682	T;T	0.67171	-0.25;-0.25	5.81	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85478	0.5706	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.88995	0.3417	10	0.72032	D	0.01	-55.2488	14.663	0.68888	0.0705:0.0:0.9295:0.0	.	186;186	A4D275;O15143	.;ARC1B_HUMAN	C	186	ENSP00000252725:G186C;ENSP00000389631:G186C	ENSP00000252725:G186C	G	+	1	0	ARPC1B	98826507	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.764000	0.98949	1.469000	0.48083	0.561000	0.74099	GGC		0.597	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
SLC4A2	6522	bcgsc.ca	37	7	150772849	150772852	+	Frame_Shift_Del	DEL	ACTT	ACTT	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	ACTT	ACTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr7:150772849_150772852delACTT	ENST00000485713.1	+	21	4498_4501	c.3458_3461delACTT	c.(3457-3462)aacttcfs	p.NF1153fs	SLC4A2_ENST00000413384.2_Frame_Shift_Del_p.NF1153fs|SLC4A2_ENST00000392826.2_Frame_Shift_Del_p.NF1144fs|SLC4A2_ENST00000461735.1_Frame_Shift_Del_p.NF1139fs|SLC4A2_ENST00000310317.5_Frame_Shift_Del_p.NF1071fs|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'Flank	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1153	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCAGATGTCACTTACGTCAAGAAG	0.593																																						.											0																																										SO:0001589	frameshift_variant	6522				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3458_3461delACTT	7.37:g.150772849_150772852delACTT	ENSP00000419412:p.Asn1153fs		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Frame_Shift_Del	DEL	ENST00000485713.1	37	CCDS5917.1																																																																																				0.593	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
RP1	6101	bcgsc.ca	37	8	55538990	55538990	+	Missense_Mutation	SNP	A	A	G	rs112884043		TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:55538990A>G	ENST00000220676.1	+	4	2696	c.2548A>G	c.(2548-2550)Atg>Gtg	p.M850V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	850					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TTTGAGAGGAATGGCAAAGAA	0.343																																					Colon(91;1014 1389 7634 14542 40420)	.											0													44.0	47.0	46.0					8																	55538990		2203	4299	6502	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2548A>G	8.37:g.55538990A>G	ENSP00000220676:p.Met850Val			Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	6.248	0.413831	0.11812	.	.	ENSG00000104237	ENST00000220676	T	0.50277	0.75	5.63	0.138	0.14793	.	0.513050	0.19509	N	0.112549	T	0.29061	0.0722	L	0.43152	1.355	0.23416	N	0.997725	B	0.26318	0.146	B	0.15870	0.014	T	0.08953	-1.0697	10	0.25751	T	0.34	.	2.7202	0.05199	0.622:0.1239:0.1352:0.119	.	850	P56715	RP1_HUMAN	V	850	ENSP00000220676:M850V	ENSP00000220676:M850V	M	+	1	0	RP1	55701543	0.214000	0.23563	0.390000	0.26220	0.771000	0.43674	0.675000	0.25232	0.073000	0.16731	0.533000	0.62120	ATG		0.343	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RMDN1	51115	bcgsc.ca	37	8	87487152	87487155	+	Frame_Shift_Del	DEL	AAGT	AAGT	-			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr8:87487152_87487155delAAGT	ENST00000406452.3	-	9	947_950	c.788_791delACTT	c.(787-792)tactttfs	p.YF263fs	RMDN1_ENST00000523911.1_Intron|RMDN1_ENST00000519966.1_Intron|RMDN1_ENST00000430676.2_Frame_Shift_Del_p.YF233fs	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	263						microtubule (GO:0005874)|mitochondrion (GO:0005739)											TCCTAAAAGAAGTAAGTTTTTGCT	0.368																																						.											0																																										SO:0001589	frameshift_variant	51115			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.788_791delACTT	8.37:g.87487152_87487155delAAGT	ENSP00000385927:p.Tyr263fs		A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Frame_Shift_Del	DEL	ENST00000406452.3	37	CCDS34918.1																																																																																				0.368	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	
SQRDL	58472	bcgsc.ca	37	15	45951305	45951306	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KM-8438-01A-11D-2310-10	TCGA-KM-8438-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	148536ce-ee2a-4952-a19d-10d6f44146b9	503f8648-a261-4fad-9062-769d85f140df	g.chr15:45951305_45951306insA	ENST00000260324.7	+	2	570_571	c.184_185insA	c.(184-186)atgfs	p.M62fs	SQRDL_ENST00000568606.1_Frame_Shift_Ins_p.M62fs|RP11-96O20.4_ENST00000564080.1_Frame_Shift_Ins_p.M62fs	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	62					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		GGCTGCCCGCATGAAGAGGAAA	0.609																																						.											0																																										SO:0001589	frameshift_variant	58472			AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.184dupA	15.37:g.45951305_45951305dupA	ENSP00000260324:p.Met62fs		Q9UQM8	Frame_Shift_Ins	INS	ENST00000260324.7	37	CCDS10127.1																																																																																				0.609	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254319.2		
