#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SVIL	6840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	10	29759270	29759270	+	Silent	SNP	G	G	A	rs201300228		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr10:29759270G>A	ENST00000355867.4	-	32	6530	c.5778C>T	c.(5776-5778)caC>caT	p.H1926H	PTCHD3P1_ENST00000446807.1_RNA|SVIL_ENST00000375398.2_Silent_p.H1926H|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000535393.1_Silent_p.H840H|SVIL_ENST00000375400.3_Silent_p.H1500H	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1926					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CTTTGCATCCGTGCCACAGGT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		19719	0.0		0.001	False		,,,				2504	0.0					.											0													198.0	163.0	175.0					10																	29759270		2203	4300	6503	SO:0001819	synonymous_variant	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5778C>T	10.37:g.29759270G>A			D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																				0.567	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ITGB1	3688	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	33218830	33218830	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr10:33218830C>T	ENST00000396033.2	-	4	431	c.296G>A	c.(295-297)aGc>aAc	p.S99N	ITGB1_ENST00000302278.3_Missense_Mutation_p.S99N|ITGB1_ENST00000484088.1_5'UTR|ITGB1_ENST00000374956.4_Missense_Mutation_p.S99N|ITGB1_ENST00000423113.1_Missense_Mutation_p.S99N	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	99					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	TGTTCCTTTGCTACGGTTGGT	0.413																																						.											0													338.0	326.0	330.0					10																	33218830		2203	4300	6503	SO:0001583	missense	3688			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.296G>A	10.37:g.33218830C>T	ENSP00000379350:p.Ser99Asn		A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	ENST00000396033.2	37	CCDS7174.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643371	0.29246	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956;ENST00000480226;ENST00000474568;ENST00000488494;ENST00000534049;ENST00000437302;ENST00000475184;ENST00000528877	D;D;D;D;D;D;D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05;-3.05	5.49	4.59	0.56863	Integrin beta subunit, N-terminal (2);	0.150804	0.64402	D	0.000008	T	0.80105	0.4562	N	0.11364	0.135	0.23506	N	0.997538	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.64888	-0.6301	10	0.27082	T	0.32	.	4.0811	0.09927	0.1704:0.5843:0.0:0.2452	.	99;99;99;99;99	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	N	99;99;99;99;99;42;102;99;99;99;99	ENSP00000379350:S99N;ENSP00000388694:S99N;ENSP00000303351:S99N;ENSP00000364094:S99N;ENSP00000417537:S99N;ENSP00000420282:S42N;ENSP00000418725:S102N;ENSP00000431326:S99N;ENSP00000398029:S99N;ENSP00000417243:S99N;ENSP00000436214:S99N	ENSP00000303351:S99N	S	-	2	0	ITGB1	33258836	0.475000	0.25894	0.981000	0.43875	0.993000	0.82548	0.396000	0.20867	1.318000	0.45170	0.591000	0.81541	AGC		0.413	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
SHC1	6464	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	154938971	154938971	+	Missense_Mutation	SNP	C	C	A	rs150380146		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:154938971C>A	ENST00000368445.5	-	8	1220	c.1006G>T	c.(1006-1008)Gca>Tca	p.A336S	SHC1_ENST00000368450.1_Missense_Mutation_p.A226S|SHC1_ENST00000368449.4_Missense_Mutation_p.A107S|SHC1_ENST00000368453.4_Missense_Mutation_p.A226S|SHC1_ENST00000490667.1_5'Flank|SHC1_ENST00000448116.2_Missense_Mutation_p.A336S|PYGO2_ENST00000483463.1_5'Flank|SHC1_ENST00000606391.1_Missense_Mutation_p.A137S	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	336	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCATCCCATGCTGAGCCATCA	0.567																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)	.											0													19.0	18.0	18.0					1																	154938971		2201	4300	6501	SO:0001583	missense	6464			U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.1006G>T	1.37:g.154938971C>A	ENSP00000357430:p.Ala336Ser		B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285670	0.59867	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000368441;ENST00000414115;ENST00000444179	T;T;T;T;T;T	0.47177	1.93;2.1;1.69;1.87;1.86;0.85	4.71	4.71	0.59529	Phosphotyrosine interaction domain (1);	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	N	0.12961	0.28	0.80722	D	1	B;P;B	0.36110	0.402;0.537;0.125	B;B;B	0.32928	0.109;0.155;0.119	T	0.10177	-1.0641	10	0.44086	T	0.13	.	17.4551	0.87605	0.0:1.0:0.0:0.0	.	115;336;336	Q59HB0;P29353-6;P29353	.;.;SHC1_HUMAN	S	336;336;137;226;226;272;8;89;107	ENSP00000357430:A336S;ENSP00000401303:A336S;ENSP00000357434:A137S;ENSP00000357438:A226S;ENSP00000357435:A226S;ENSP00000404908:A89S	ENSP00000357426:A8S	A	-	1	0	SHC1	153205595	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.198000	0.77823	2.442000	0.82660	0.557000	0.71058	GCA		0.567	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	
CLEC6A	93978	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	8618083	8618083	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr12:8618083G>A	ENST00000382073.3	+	4	413	c.227G>A	c.(226-228)tGg>tAg	p.W76*		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	76					defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					AAAATAGCCTGGGGATGTTGC	0.383																																						.											0													118.0	113.0	115.0					12																	8618083		2203	4300	6503	SO:0001587	stop_gained	93978			AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.227G>A	12.37:g.8618083G>A	ENSP00000371505:p.Trp76*		A2RUK3	Nonsense_Mutation	SNP	ENST00000382073.3	37	CCDS31739.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706150	0.89018	.	.	ENSG00000205846	ENST00000382073	.	.	.	4.09	3.19	0.36642	.	0.000000	0.35235	N	0.003345	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6456	0.28318	0.1143:0.0:0.8857:0.0	.	.	.	.	X	76	.	ENSP00000371505:W76X	W	+	2	0	CLEC6A	8509350	1.000000	0.71417	0.925000	0.36789	0.631000	0.37964	3.314000	0.51943	1.292000	0.44672	0.650000	0.86243	TGG		0.383	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033	
DNAH3	55567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	21049160	21049160	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:21049160C>A	ENST00000261383.3	-	34	4872	c.4873G>T	c.(4873-4875)Gaa>Taa	p.E1625*	DNAH3_ENST00000415178.1_Nonsense_Mutation_p.E1625*	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1625					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGGACACTTTCATTCTCCTCT	0.507																																						.											0													136.0	110.0	119.0					16																	21049160		2201	4300	6501	SO:0001587	stop_gained	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4873G>T	16.37:g.21049160C>A	ENSP00000261383:p.Glu1625*		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	45	11.822684	0.99607	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9616	0.97254	0.0:1.0:0.0:0.0	.	.	.	.	X	1625	.	ENSP00000261383:E1625X	E	-	1	0	DNAH3	20956661	1.000000	0.71417	0.992000	0.48379	0.676000	0.39594	7.764000	0.85297	2.724000	0.93272	0.561000	0.74099	GAA		0.507	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
ZFHX3	463	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	72992269	72992269	+	Missense_Mutation	SNP	G	G	T	rs11075951	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:72992269G>T	ENST00000268489.5	-	2	2448	c.1776C>A	c.(1774-1776)gaC>gaA	p.D592E	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	592					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGGCACTTTCGTCAGCGAAGT	0.552																																						.											0													108.0	104.0	105.0					16																	72992269		2198	4300	6498	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1776C>A	16.37:g.72992269G>T	ENSP00000268489:p.Asp592Glu		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	4.385	0.071015	0.08436	.	.	ENSG00000140836	ENST00000268489	T	0.75260	-0.92	5.04	-1.87	0.07737	.	0.000000	0.52532	D	0.000080	T	0.53578	0.1805	N	0.17474	0.49	0.80722	D	1	P	0.37573	0.6	B	0.38985	0.287	T	0.40683	-0.9550	10	0.17369	T	0.5	.	11.3231	0.49435	0.6672:0.0:0.3328:0.0	.	592	Q15911	ZFHX3_HUMAN	E	592	ENSP00000268489:D592E	ENSP00000268489:D592E	D	-	3	2	ZFHX3	71549770	0.935000	0.31712	0.992000	0.48379	0.925000	0.55904	0.137000	0.15995	-0.231000	0.09825	-0.827000	0.03088	GAC		0.552	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
SLC35D1	23169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	67486077	67486077	+	Missense_Mutation	SNP	G	G	A	rs143745141		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:67486077G>A	ENST00000235345.5	-	10	936	c.851C>T	c.(850-852)aCa>aTa	p.T284I	SLC35D1_ENST00000506472.2_Missense_Mutation_p.T205I	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	284					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TATTGTAGTTGTAAGAGCAGA	0.333																																						.											0													107.0	106.0	106.0					1																	67486077		2203	4300	6503	SO:0001583	missense	23169			AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.851C>T	1.37:g.67486077G>A	ENSP00000235345:p.Thr284Ile		A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	ENST00000235345.5	37	CCDS636.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618557	0.87460	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.71579	-0.58;-0.58	6.16	6.16	0.99307	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	D	0.87341	0.6153	M	0.93808	3.46	0.80722	D	1	D;D	0.59357	0.985;0.983	D;P	0.66716	0.946;0.873	D	0.88851	0.3319	10	0.72032	D	0.01	-12.8739	19.6313	0.95704	0.0:0.0:1.0:0.0	.	205;284	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	I	284;205	ENSP00000235345:T284I;ENSP00000445189:T205I	ENSP00000235345:T284I	T	-	2	0	SLC35D1	67258665	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.014000	0.88676	2.937000	0.99478	0.650000	0.86243	ACA		0.333	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
GALNS	2588	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	88889069	88889069	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:88889069T>C	ENST00000268695.5	-	12	1380	c.1292A>G	c.(1291-1293)aAt>aGt	p.N431S	GALNS_ENST00000542788.1_Missense_Mutation_p.N356S	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	431					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		GTCTTCCAGATTGTGAGTTGT	0.617																																					GBM(129;1929 2344 25209 33204)	.											0													106.0	90.0	96.0					16																	88889069		2198	4299	6497	SO:0001583	missense	2588			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.1292A>G	16.37:g.88889069T>C	ENSP00000268695:p.Asn431Ser		Q86VK3	Missense_Mutation	SNP	ENST00000268695.5	37	CCDS10970.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.956637	0.00465	.	.	ENSG00000141012	ENST00000268695;ENST00000542788	D;D	0.89415	-2.51;-2.51	4.89	1.67	0.24075	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.751136	0.13268	N	0.400708	T	0.67711	0.2922	N	0.03608	-0.345	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.55952	-0.8059	10	0.08381	T	0.77	.	2.9126	0.05742	0.0864:0.2963:0.3381:0.2792	.	431;431	B2R6P1;P34059	.;GALNS_HUMAN	S	431;356	ENSP00000268695:N431S;ENSP00000438197:N356S	ENSP00000268695:N431S	N	-	2	0	GALNS	87416570	0.010000	0.17322	0.999000	0.59377	0.015000	0.08874	0.718000	0.25866	0.668000	0.31126	-0.795000	0.03280	AAT		0.617	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
GJC1	10052	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	42882018	42882018	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr17:42882018C>A	ENST00000426548.1	-	3	1437	c.1168G>T	c.(1168-1170)Ggg>Tgg	p.G390W	GJC1_ENST00000590758.1_Missense_Mutation_p.G390W|GJC1_ENST00000592524.1_Missense_Mutation_p.G390W|GJC1_ENST00000330514.4_Missense_Mutation_p.G390W	NM_001080383.1|NM_005497.3	NP_001073852.1|NP_005488.2	P36383	CXG1_HUMAN	gap junction protein, gamma 1, 45kDa	390					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle tissue development (GO:0048738)|cell development (GO:0048468)|cell-cell junction assembly (GO:0007043)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vasculogenesis (GO:0001570)|visual perception (GO:0007601)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion channel activity (GO:0005216)			NS(1)|kidney(1)|large_intestine(5)|liver(1)|lung(10)|prostate(1)	19		Prostate(33;0.0959)				GAGGTCTTCCCATCCCCTGAT	0.493																																						.											0													134.0	126.0	129.0					17																	42882018		2203	4300	6503	SO:0001583	missense	10052			U03493	CCDS11487.1	17q21.31	2008-02-04	2007-11-06	2007-11-06		ENSG00000182963		"""Ion channels / Gap junction proteins (connexins)"""	4280	protein-coding gene	gene with protein product	"""connexin 45"""	608655	"""gap junction protein, alpha 7, 45kDa"""	GJA7		7966354	Standard	NM_005497		Approved	CX45	uc002ihl.3	P36383		ENST00000426548.1:c.1168G>T	17.37:g.42882018C>A	ENSP00000411528:p.Gly390Trp		B3KW68|Q4VAY0	Missense_Mutation	SNP	ENST00000426548.1	37	CCDS11487.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728356	0.69074	.	.	ENSG00000182963	ENST00000426548;ENST00000330514	D;D	0.98455	-4.94;-4.94	5.48	5.48	0.80851	.	0.764469	0.12267	N	0.484156	D	0.98679	0.9557	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98871	1.0766	10	0.87932	D	0	.	18.3265	0.90256	0.0:1.0:0.0:0.0	.	390	P36383	CXG1_HUMAN	W	390	ENSP00000411528:G390W;ENSP00000333193:G390W	ENSP00000333193:G390W	G	-	1	0	GJC1	40237544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.569000	0.86673	0.655000	0.94253	GGG		0.493	GJC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448661.1	NM_005497	
SPTBN4	57731	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	41003434	41003434	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:41003434A>G	ENST00000352632.3	+	7	793	c.707A>G	c.(706-708)aAt>aGt	p.N236S	SPTBN4_ENST00000598249.1_Missense_Mutation_p.N236S|SPTBN4_ENST00000344104.3_Missense_Mutation_p.N236S|SPTBN4_ENST00000595535.1_Missense_Mutation_p.N236S|SPTBN4_ENST00000338932.3_Missense_Mutation_p.N236S			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	236	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACCAAGTCCAATGCCAACTAC	0.662																																						.											0													109.0	90.0	96.0					19																	41003434		2203	4300	6503	SO:0001583	missense	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.707A>G	19.37:g.41003434A>G	ENSP00000263373:p.Asn236Ser		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.033515	0.54896	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.58358	0.34;0.34;0.34	3.92	3.92	0.45320	Calponin homology domain (5);	0.437819	0.18796	N	0.130913	T	0.60894	0.2304	L	0.43646	1.37	0.80722	D	1	B;P	0.51791	0.003;0.948	B;P	0.61940	0.007;0.896	T	0.60642	-0.7223	10	0.49607	T	0.09	.	11.9119	0.52743	1.0:0.0:0.0:0.0	.	236;236	Q9H254;Q71S06	SPTN4_HUMAN;.	S	236	ENSP00000263373:N236S;ENSP00000340345:N236S;ENSP00000340741:N236S	ENSP00000340345:N236S	N	+	2	0	SPTBN4	45695274	1.000000	0.71417	0.972000	0.41901	0.968000	0.65278	8.992000	0.93519	1.646000	0.50622	0.378000	0.23410	AAT		0.662	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
CEACAM5	1048	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	19	42225041	42225041	+	Silent	SNP	C	C	G	rs149056934		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:42225041C>G	ENST00000221992.6	+	8	2085	c.1971C>G	c.(1969-1971)gtC>gtG	p.V657V	CEACAM5_ENST00000398599.4_Silent_p.V656V|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Silent_p.V657V	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	657	Ig-like 7.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCTGTTTTGTCTCTAACTTGG	0.463																																						.											0													155.0	128.0	137.0					19																	42225041		2203	4300	6503	SO:0001819	synonymous_variant	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1971C>G	19.37:g.42225041C>G			H9KVA7	Silent	SNP	ENST00000221992.6	37	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	C	1.104	-0.660214	0.03454	.	.	ENSG00000105388	ENST00000398599	.	.	.	2.3	1.17	0.20885	.	.	.	.	.	T	0.31513	0.0799	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23833	-1.0177	4	.	.	.	.	6.6464	0.22936	0.0:0.6999:0.3001:0.0	.	.	.	.	V	653	.	.	L	+	1	0	CEACAM5	46916881	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.276000	0.18716	0.466000	0.27193	0.467000	0.42956	CTC		0.463	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
ZNF155	7711	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	44500350	44500350	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:44500350C>T	ENST00000270014.2	+	5	469	c.341C>T	c.(340-342)tCt>tTt	p.S114F	ZNF155_ENST00000407951.2_Missense_Mutation_p.S125F|RP11-15A1.7_ENST00000589021.1_RNA|RP11-15A1.7_ENST00000586860.1_RNA|ZNF155_ENST00000590615.1_Missense_Mutation_p.S114F	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	114					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TTAACCAGGTCTCAGGACTCT	0.448																																					NSCLC(61;554 1277 20909 42067 42312)	.											0													77.0	78.0	77.0					19																	44500350		2203	4300	6503	SO:0001583	missense	7711			U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.341C>T	19.37:g.44500350C>T	ENSP00000270014:p.Ser114Phe		A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	SNP	ENST00000270014.2	37	CCDS12634.1	.	.	.	.	.	.	.	.	.	.	C	0.352	-0.944372	0.02322	.	.	ENSG00000204920	ENST00000407951;ENST00000270014	T;T	0.06218	3.36;3.33	2.23	-4.46	0.03536	.	.	.	.	.	T	0.02304	0.0071	N	0.11255	0.115	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.45948	-0.9226	9	0.14252	T	0.57	.	1.8656	0.03198	0.1271:0.3627:0.2911:0.219	.	125;114	B4DM95;Q12901	.;ZN155_HUMAN	F	125;114	ENSP00000385163:S125F;ENSP00000270014:S114F	ENSP00000270014:S114F	S	+	2	0	ZNF155	49192190	0.000000	0.05858	0.000000	0.03702	0.178000	0.23041	-1.034000	0.03567	-1.407000	0.02043	0.462000	0.41574	TCT		0.448	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	8966765	8966765	+	Silent	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:8966765C>T	ENST00000397910.4	-	81	43391	c.43188G>A	c.(43186-43188)tcG>tcA	p.S14396S	MUC16_ENST00000380951.5_Silent_p.S1037S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14494				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCCAGTGGCGAGAAGTTAC	0.527																																						.											0													27.0	31.0	29.0					19																	8966765		1958	4136	6094	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.43188G>A	19.37:g.8966765C>T			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	1.585	-0.530574	0.04112	.	.	ENSG00000181143	ENST00000542240	.	.	.	4.22	-0.708	0.11241	.	1.029670	0.07728	N	0.944810	T	0.27663	0.0680	.	.	.	.	.	.	.	.	.	.	.	.	T	0.33929	-0.9849	4	.	.	.	.	4.1107	0.10057	0.0:0.3062:0.1787:0.5151	.	.	.	.	H	1219	.	.	R	-	2	0	MUC16	8827765	0.000000	0.05858	0.017000	0.16124	0.013000	0.08279	-3.159000	0.00578	-0.283000	0.09115	-1.295000	0.01343	CGC		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LAIR1	3903	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	19	54875936	54875936	+	Splice_Site	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:54875936C>T	ENST00000391742.2	-	2	188	c.36G>A	c.(34-36)gtG>gtA	p.V12V	LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000391743.3_Intron|LAIR1_ENST00000313038.6_Splice_Site_p.V6V|LAIR1_ENST00000434277.2_Splice_Site_p.V12V|LAIR1_ENST00000348231.4_Splice_Site_p.V12V|LAIR1_ENST00000474878.1_Splice_Site_p.V12V			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	12					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CCAGGCAGAGCACTGGAAGAG	0.612																																						.											0													76.0	70.0	72.0					19																	54875936		2203	4300	6503	SO:0001630	splice_region_variant	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.35-1G>A	19.37:g.54875936C>T				Silent	SNP	ENST00000391742.2	37	CCDS12891.1																																																																																				0.612	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1		Silent
MYH9	4627	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	36697638	36697638	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr22:36697638C>T	ENST00000216181.5	-	21	2803	c.2573G>A	c.(2572-2574)aGa>aAa	p.R858K		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	858					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTGCTTCTCTCTGACCTTCAC	0.617			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated		OREG0026520	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													162.0	113.0	130.0					22																	36697638		2202	4300	6502	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2573G>A	22.37:g.36697638C>T	ENSP00000216181:p.Arg858Lys	864	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347139	0.24426	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.81499	-1.5	5.78	4.56	0.56223	.	0.176467	0.46442	D	0.000300	T	0.46210	0.1381	N	0.01624	-0.795	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.55140	-0.8187	10	0.02654	T	1	.	4.3193	0.11009	0.0:0.701:0.0:0.299	.	858	P35579	MYH9_HUMAN	K	722;858	ENSP00000216181:R858K	ENSP00000216181:R858K	R	-	2	0	MYH9	35027584	0.984000	0.35163	0.958000	0.39756	0.962000	0.63368	2.570000	0.45981	2.894000	0.99253	0.655000	0.94253	AGA		0.617	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
IGSF10	285313	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	151162874	151162874	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:151162874G>T	ENST00000282466.3	-	4	4894	c.4895C>A	c.(4894-4896)tCc>tAc	p.S1632Y		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1632					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AAGGAGTTTGGAAGTTGTTGC	0.423																																						.											0													263.0	233.0	243.0					3																	151162874		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4895C>A	3.37:g.151162874G>T	ENSP00000282466:p.Ser1632Tyr		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659181	0.67586	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.71341	-0.56	5.86	4.09	0.47781	.	0.299519	0.23924	N	0.043206	T	0.69522	0.3120	L	0.39898	1.24	0.09310	N	1	D	0.61080	0.989	P	0.55667	0.781	T	0.61362	-0.7078	10	0.72032	D	0.01	.	6.5333	0.22339	0.2142:0.1308:0.6549:0.0	.	1632	Q6WRI0	IGS10_HUMAN	Y	1632;259	ENSP00000282466:S1632Y	ENSP00000282466:S1632Y	S	-	2	0	IGSF10	152645564	0.216000	0.23585	0.008000	0.14137	0.637000	0.38172	3.111000	0.50360	0.842000	0.35045	-0.142000	0.14014	TCC		0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
GFM1	85476	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	158363431	158363431	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:158363431C>T	ENST00000486715.1	+	2	452	c.95C>T	c.(94-96)gCc>gTc	p.A32V	GFM1_ENST00000264263.5_Missense_Mutation_p.A32V|GFM1_ENST00000478576.1_Missense_Mutation_p.A32V	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AATTGGAAGGCCTGCCGATGG	0.373																																						.											0													79.0	80.0	79.0					3																	158363431		2203	4300	6503	SO:0001583	missense	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.95C>T	3.37:g.158363431C>T	ENSP00000419038:p.Ala32Val			Missense_Mutation	SNP	ENST00000486715.1	37	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	C	9.663	1.144578	0.21288	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.72394	-0.07;-0.65;-0.07	5.43	-2.17	0.07059	.	1.214710	0.05439	N	0.547337	T	0.48205	0.1487	N	0.08118	0	0.36592	D	0.874181	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.22487	-1.0215	10	0.30854	T	0.27	18.8337	8.1196	0.30963	0.0:0.4113:0.2638:0.3248	.	32;32	Q96RP9;C9IZ01	EFGM_HUMAN;.	V	32	ENSP00000419038:A32V;ENSP00000418755:A32V;ENSP00000264263:A32V	ENSP00000264263:A32V	A	+	2	0	GFM1	159846125	.	.	0.008000	0.14137	0.654000	0.38779	.	.	-0.366000	0.08064	0.655000	0.94253	GCC		0.373	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
DTWD2	285605	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	118324112	118324112	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:118324112C>A	ENST00000510708.1	-	1	128	c.95G>T	c.(94-96)cGg>cTg	p.R32L	DTWD2_ENST00000304058.4_5'Flank|DTWD2_ENST00000515439.3_Missense_Mutation_p.R32L	NM_173666.2	NP_775937.1	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2	32										breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)	13		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		GCCGCCCTCCCGCCGCTCCTT	0.726											OREG0016736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													9.0	12.0	11.0					5																	118324112		2120	4225	6345	SO:0001583	missense	285605				CCDS34216.1	5q23.1	2008-02-05			ENSG00000169570	ENSG00000169570			19334	protein-coding gene	gene with protein product							Standard	NM_173666		Approved	FLJ33977	uc003ksa.3	Q8NBA8	OTTHUMG00000162956	ENST00000510708.1:c.95G>T	5.37:g.118324112C>A	ENSP00000425048:p.Arg32Leu	1487		Missense_Mutation	SNP	ENST00000510708.1	37	CCDS34216.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266785	0.40095	.	.	ENSG00000169570	ENST00000510708;ENST00000515439	.	.	.	5.56	-2.1	0.07210	.	1.581510	0.03198	N	0.174314	T	0.28333	0.0700	N	0.24115	0.695	0.09310	N	1	B	0.28636	0.218	B	0.23275	0.045	T	0.16748	-1.0392	9	0.54805	T	0.06	-9.157	6.7753	0.23617	0.0:0.4438:0.2112:0.345	.	32	Q8NBA8	DTWD2_HUMAN	L	32	.	ENSP00000425016:R32L	R	-	2	0	DTWD2	118352011	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.879000	0.01629	-1.251000	0.02494	-1.814000	0.00607	CGG		0.726	DTWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371167.2	NM_173666	
PCDHA11	56138	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	140250883	140250883	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:140250883C>T	ENST00000398640.2	+	1	2195	c.2195C>T	c.(2194-2196)gCg>gTg	p.A732V	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	732					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGCGTGCGCGCCGGGGAAG	0.677																																						.											0													30.0	32.0	31.0					5																	140250883		2202	4298	6500	SO:0001583	missense	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.2195C>T	5.37:g.140250883C>T	ENSP00000381636:p.Ala732Val		B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	T	6.697	0.497309	0.12762	.	.	ENSG00000249158	ENST00000398640	T	0.12672	2.66	4.6	-1.85	0.07784	.	.	.	.	.	T	0.09423	0.0232	L	0.43152	1.355	0.09310	N	1	B;B	0.12013	0.005;0.002	B;B	0.06405	0.002;0.002	T	0.34229	-0.9837	9	0.37606	T	0.19	.	2.5779	0.04811	0.1352:0.3466:0.2825:0.2358	.	732;732	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	V	732	ENSP00000381636:A732V	ENSP00000381636:A732V	A	+	2	0	PCDHA11	140231067	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.005000	0.13129	-0.915000	0.03823	-1.968000	0.00466	GCG		0.677	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
ADAMTS6	11174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	64468715	64468715	+	5'UTR	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:64468715G>A	ENST00000314351.5	-	0	690							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1011C(1)|p.R182C(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		AAACTGCAGCGGATGCGGACA	0.552																																						.											2	Substitution - Missense(2)	breast(2)											135.0	119.0	124.0					5																	64468715		2203	4300	6503	SO:0001623	5_prime_UTR_variant	11174			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-632C>T	5.37:g.64468715G>A			Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	ENST00000314351.5	37		.	.	.	.	.	.	.	.	.	.	G	27.4	4.828316	0.90955	.	.	ENSG00000049192	ENST00000381055	T	0.61158	0.13	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.80518	0.4638	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.82018	-0.0665	10	0.54805	T	0.06	.	19.838	0.96666	0.0:0.0:1.0:0.0	.	1011	Q9UKP5	ATS6_HUMAN	C	1011	ENSP00000370443:R1011C	ENSP00000370443:R1011C	R	-	1	0	ADAMTS6	64504471	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.692000	0.91855	0.650000	0.86243	CGC		0.552	ADAMTS6-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000157334.2	NM_197941	
AGGF1	55109	hgsc.bcm.edu;ucsc.edu	37	5	76326664	76326664	+	Silent	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:76326664C>T	ENST00000312916.7	+	1	455	c.73C>T	c.(73-75)Cta>Tta	p.L25L	AGGF1_ENST00000506806.1_Silent_p.L25L|AGGF1_ENST00000503538.1_Intron	NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	25					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GCTGGCCCAGCTAAGGCGGAA	0.692																																						.											0													34.0	33.0	33.0					5																	76326664		2202	4298	6500	SO:0001819	synonymous_variant	55109			AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.73C>T	5.37:g.76326664C>T			O00581|Q53YS3|Q9BU84|Q9NW66	Silent	SNP	ENST00000312916.7	37	CCDS4035.1																																																																																				0.692	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
TCOF1	6949	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	149773014	149773014	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:149773014C>G	ENST00000504761.2	+	23	3680	c.3680C>G	c.(3679-3681)tCc>tGc	p.S1227C	TCOF1_ENST00000323668.7_Missense_Mutation_p.S1150C|TCOF1_ENST00000377797.3_Missense_Mutation_p.S1228C|TCOF1_ENST00000451292.1_Missense_Mutation_p.S1264C|TCOF1_ENST00000513346.1_Missense_Mutation_p.S1227C|TCOF1_ENST00000439160.2_Missense_Mutation_p.S1190C|TCOF1_ENST00000445265.2_Missense_Mutation_p.S1151C			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1227					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGCTAGACTCCAGCCCCTCA	0.542																																						.											0													85.0	81.0	83.0					5																	149773014		2203	4300	6503	SO:0001583	missense	6949				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3680C>G	5.37:g.149773014C>G	ENSP00000421655:p.Ser1227Cys		A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414686	0.42817	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32	4.08	2.22	0.28083	.	1.237860	0.05884	N	0.627080	T	0.52289	0.1725	N	0.19112	0.55	0.09310	N	1	P;P;P;D;P	0.56521	0.924;0.924;0.924;0.976;0.924	P;P;P;P;P	0.52856	0.634;0.634;0.634;0.711;0.634	T	0.43032	-0.9416	10	0.48119	T	0.1	0.3147	6.0194	0.19620	0.0:0.7543:0.0:0.2457	.	1190;1150;1189;1227;1151	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	C	1264;1228;1151;1150;1190;1189;1227;1227	ENSP00000400939:S1264C;ENSP00000367028:S1228C;ENSP00000409944:S1151C;ENSP00000325223:S1150C;ENSP00000406888:S1190C;ENSP00000390717:S1189C;ENSP00000421655:S1227C;ENSP00000427484:S1227C	ENSP00000325223:S1150C	S	+	2	0	TCOF1	149753207	0.000000	0.05858	0.003000	0.11579	0.181000	0.23173	0.195000	0.17155	0.631000	0.30412	0.561000	0.74099	TCC		0.542	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
PNRC1	10957	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	89793802	89793802	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr6:89793802A>G	ENST00000336032.3	+	2	988	c.871A>G	c.(871-873)Agt>Ggt	p.S291G	PNRC1_ENST00000354922.3_Missense_Mutation_p.S106G|PNRC1_ENST00000369472.1_Missense_Mutation_p.S106G	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		ACCTTCTCCTAGTGTTCTTCC	0.413										Multiple Myeloma(7;0.094)																												.											0													81.0	84.0	83.0					6																	89793802		2203	4300	6503	SO:0001583	missense	10957			U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.871A>G	6.37:g.89793802A>G	ENSP00000336931:p.Ser291Gly		B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Missense_Mutation	SNP	ENST00000336032.3	37	CCDS5018.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.952621	0.73787	.	.	ENSG00000146278	ENST00000369472;ENST00000336032;ENST00000354922	T;T;T	0.58358	0.52;0.34;0.52	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.66684	0.2814	M	0.75777	2.31	0.54753	D	0.999985	D	0.89917	1.0	D	0.85130	0.997	T	0.72616	-0.4239	10	0.87932	D	0	-8.9899	15.3712	0.74568	1.0:0.0:0.0:0.0	.	291	Q12796	PNRC1_HUMAN	G	106;291;106	ENSP00000358484:S106G;ENSP00000336931:S291G;ENSP00000347000:S106G	ENSP00000336931:S291G	S	+	1	0	PNRC1	89850521	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.473000	0.73572	2.008000	0.58898	0.533000	0.62120	AGT		0.413	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041471.1	NM_006813	
RGAG1	57529	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	109696984	109696984	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:109696984G>T	ENST00000465301.2	+	3	3385	c.3139G>T	c.(3139-3141)Gcc>Tcc	p.A1047S	RGAG1_ENST00000540313.1_Missense_Mutation_p.A1047S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1047										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ACTACCAAGAGCCACAGCCTC	0.547																																						.											0													84.0	80.0	82.0					X																	109696984		2203	4300	6503	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3139G>T	X.37:g.109696984G>T	ENSP00000419786:p.Ala1047Ser		Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	7.001	0.554883	0.13436	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.55052	0.54;0.54	4.41	-0.846	0.10734	.	.	.	.	.	T	0.37100	0.0991	L	0.47716	1.5	0.09310	N	1	B	0.33171	0.4	B	0.33960	0.173	T	0.25537	-1.0129	8	.	.	.	-0.5503	0.8352	0.01138	0.3054:0.2935:0.2499:0.1512	.	1047	Q8NET4	RGAG1_HUMAN	S	1047;1047;608	ENSP00000419786:A1047S;ENSP00000441452:A1047S	.	A	+	1	0	RGAG1	109583640	0.000000	0.05858	0.017000	0.16124	0.821000	0.46438	0.204000	0.17335	-0.325000	0.08577	0.600000	0.82982	GCC		0.547	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
FLNA	2316	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	153588714	153588714	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:153588714A>T	ENST00000369850.3	-	22	3685	c.3449T>A	c.(3448-3450)tTc>tAc	p.F1150Y	FLNA_ENST00000422373.1_Missense_Mutation_p.F1150Y|FLNA_ENST00000360319.4_Missense_Mutation_p.F1150Y|FLNA_ENST00000344736.4_Missense_Mutation_p.F1150Y|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1150					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGGGCCTTGAATGGGGAGCC	0.617											OREG0003593	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										.											0													62.0	73.0	69.0					X																	153588714		2145	4213	6358	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3449T>A	X.37:g.153588714A>T	ENSP00000358866:p.Phe1150Tyr	1756	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.958476	0.74016	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	4.92	4.92	0.64577	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	D	0.93135	0.7814	M	0.80422	2.495	0.80722	D	1	P;D	0.89917	0.7;1.0	D;D	0.87578	0.91;0.998	D	0.93663	0.6983	10	0.59425	D	0.04	.	13.8267	0.63354	1.0:0.0:0.0:0.0	.	1150;1150	P21333-2;P21333	.;FLNA_HUMAN	Y	1150;1123;1150;1150;1150	ENSP00000353467:F1150Y;ENSP00000416926:F1150Y;ENSP00000358866:F1150Y;ENSP00000358863:F1150Y	ENSP00000358863:F1150Y	F	-	2	0	FLNA	153241908	1.000000	0.71417	0.998000	0.56505	0.818000	0.46254	7.383000	0.79741	1.640000	0.50565	0.427000	0.28365	TTC		0.617	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
CCDC59	29080	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	82747061	82747061	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr12:82747061C>A	ENST00000256151.7	-	4	1006	c.595G>T	c.(595-597)Gaa>Taa	p.E199*	CCDC59_ENST00000548126.1_5'UTR	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						CTTTGGGCTTCTTCTCTCTCC	0.328																																						.											0													124.0	115.0	118.0					12																	82747061		2203	4299	6502	SO:0001587	stop_gained	29080			AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.595G>T	12.37:g.82747061C>A	ENSP00000256151:p.Glu199*		Q9H2V5|Q9NW62	Nonsense_Mutation	SNP	ENST00000256151.7	37	CCDS9023.1	.	.	.	.	.	.	.	.	.	.	C	40	8.294946	0.98747	.	.	ENSG00000133773	ENST00000256151	.	.	.	5.87	5.87	0.94306	.	0.093803	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-30.2799	18.7629	0.91860	0.0:1.0:0.0:0.0	.	.	.	.	X	199	.	ENSP00000256151:E199X	E	-	1	0	CCDC59	81271192	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.974000	0.63771	2.775000	0.95449	0.650000	0.86243	GAA		0.328	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408186.1	NM_014167	
SYT16	83851	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	14	62462902	62462902	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr14:62462902G>T	ENST00000430451.2	+	1	362	c.165G>T	c.(163-165)caG>caT	p.Q55H	SYT16_ENST00000446982.2_Missense_Mutation_p.Q55H	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	55					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		AACTAGATCAGGACTTAGATA	0.388																																						.											0													138.0	134.0	135.0					14																	62462902		1867	4116	5983	SO:0001583	missense	83851			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.165G>T	14.37:g.62462902G>T	ENSP00000394700:p.Gln55His		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140061	0.37728	.	.	ENSG00000139973	ENST00000446982;ENST00000430451	T;T	0.36520	1.25;3.57	5.34	4.37	0.52481	.	0.000000	0.46442	D	0.000297	T	0.49525	0.1562	L	0.51422	1.61	0.23287	N	0.997971	D;D	0.89917	1.0;0.99	D;P	0.70935	0.971;0.707	T	0.33007	-0.9885	10	0.72032	D	0.01	-14.5578	9.808	0.40805	0.1467:0.0:0.8533:0.0	.	55;55	B4DZH2;Q17RD7	.;SYT16_HUMAN	H	55	ENSP00000388023:Q55H;ENSP00000394700:Q55H	ENSP00000394700:Q55H	Q	+	3	2	SYT16	61532655	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	2.327000	0.43858	2.776000	0.95493	0.650000	0.86243	CAG		0.388	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
QPRT	23475	hgsc.bcm.edu	37	16	29706448	29706448	+	Silent	SNP	G	G	T	rs569256152	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:29706448G>T	ENST00000395384.4	+	2	638	c.477G>T	c.(475-477)tcG>tcT	p.S159S	QPRT_ENST00000562473.1_Intron|QPRT_ENST00000219771.7_Intron	NM_014298.3	NP_055113.2	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase	159					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|protein oligomerization (GO:0051259)|quinolinate catabolic process (GO:0034213)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9					Niacin(DB00627)	GGGCCGCCTCGCACCGCTACG	0.687													g|||	3	0.000599042	0.0	0.0	5008	,	,		11932	0.0		0.0	False		,,,				2504	0.0031					.											0													25.0	38.0	34.0					16																	29706448		2150	4242	6392	SO:0001819	synonymous_variant	23475			D78177	CCDS10651.1	16p11.2	2008-07-31	2008-07-31		ENSG00000103485	ENSG00000103485	2.4.2.19		9755	protein-coding gene	gene with protein product	"""nicotinate-nucleotide pyrophosphorylase (carboxylating)"""	606248				9473669	Standard	NM_014298		Approved	QPRTase	uc002dto.3	Q15274	OTTHUMG00000097770	ENST00000395384.4:c.477G>T	16.37:g.29706448G>T			Q53XW7|Q96G22|Q9BSG6	Silent	SNP	ENST00000395384.4	37	CCDS10651.1																																																																																				0.687	QPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215011.2	NM_014298	
MUC17	140453	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	100677675	100677675	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:100677675C>T	ENST00000306151.4	+	3	3042	c.2978C>T	c.(2977-2979)aCg>aTg	p.T993M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	993	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCCACACGCTGGTGGCC	0.512																																						.											0													355.0	318.0	331.0					7																	100677675		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2978C>T	7.37:g.100677675C>T	ENSP00000302716:p.Thr993Met		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.825581	0.00071	.	.	ENSG00000169876	ENST00000306151	T	0.02525	4.26	0.373	-0.746	0.11095	.	.	.	.	.	T	0.01489	0.0048	L	0.29908	0.895	0.09310	N	1	D	0.54772	0.968	B	0.31812	0.136	T	0.40496	-0.9560	8	0.39692	T	0.17	.	.	.	.	.	993	Q685J3	MUC17_HUMAN	M	993	ENSP00000302716:T993M	ENSP00000302716:T993M	T	+	2	0	MUC17	100464395	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.033000	0.13754	-3.214000	0.00213	-3.604000	0.00028	ACG		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
Unknown	0	broad.mit.edu	37	1	13183837	13183837	+	IGR	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:13183837G>A								RP13-221M14.3 (19369 upstream) : PRAMEF26 (32518 downstream)																							AGTTCACGGAGTGAGGATCCA	0.463																																						.											0													64.0	48.0	53.0					1																	13183837		692	1591	2283	SO:0001628	intergenic_variant	0																															1.37:g.13183837G>A				Silent	SNP		37																																																																																				0	0.463								
MED8	112950	broad.mit.edu	37	1	43850194	43850194	+	3'UTR	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:43850194A>G	ENST00000372457.4	-	0	1369				MED8_ENST00000290663.6_Missense_Mutation_p.I278T|RP1-92O14.6_ENST00000436713.1_RNA	NM_001001653.2|NM_201542.3	NP_001001653.1|NP_963836.2	Q96G25	MED8_HUMAN	mediator complex subunit 8						gene expression (GO:0010467)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	9	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTTAGAGGGATAGCCAGAAT	0.517																																						.											0													52.0	51.0	51.0					1																	43850194		2203	4300	6503	SO:0001624	3_prime_UTR_variant	112950			AF521562, BC010543	CCDS486.2, CCDS487.2, CCDS60108.1	1p34.1	2008-02-05	2007-07-30		ENSG00000159479	ENSG00000159479			19971	protein-coding gene	gene with protein product		607956	"""mediator of RNA polymerase II transcription, subunit 8 homolog (S. cerevisiae)"""			12149480, 9671713	Standard	NM_052877		Approved	MGC17544, MGC19641, ARC32	uc001cje.2	Q96G25	OTTHUMG00000007421	ENST00000372457.4:c.*519T>C	1.37:g.43850194A>G			A9IZ91|A9IZ92|Q5JUY8|Q96FQ4	Missense_Mutation	SNP	ENST00000372457.4	37	CCDS487.2	.	.	.	.	.	.	.	.	.	.	A	9.522	1.108487	0.20714	.	.	ENSG00000159479	ENST00000290663	.	.	.	3.85	-0.45	0.12223	.	4.155170	0.00866	N	0.001964	T	0.32645	0.0836	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.31943	-0.9925	8	0.87932	D	0	-12.3911	5.4248	0.16419	0.346:0.4871:0.0:0.1668	.	278	Q96G25-2	.	T	278	.	ENSP00000290663:I278T	I	-	2	0	MED8	43622781	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.012000	0.13287	-0.078000	0.12730	0.450000	0.29827	ATC		0.517	MED8-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318959.1	NM_052877	
FMO3	2328	broad.mit.edu	37	1	171073025	171073025	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:171073025T>C	ENST00000367755.4	+	3	343	c.232T>C	c.(232-234)Ttc>Ctc	p.F78L	MIR1295A_ENST00000408463.1_RNA|FMO3_ENST00000392085.2_Missense_Mutation_p.F78L|FMO3_ENST00000538429.1_Intron|FMO3_ENST00000542847.1_Missense_Mutation_p.F58L	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	78					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TCCCGATGACTTCCCCAACTT	0.418																																						.											0													143.0	131.0	135.0					1																	171073025		2203	4300	6503	SO:0001583	missense	2328			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.232T>C	1.37:g.171073025T>C	ENSP00000356729:p.Phe78Leu		B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	T	18.70	3.680637	0.68042	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847	T;T;T	0.57436	0.4;0.4;0.4	4.53	4.53	0.55603	.	0.226085	0.45126	D	0.000381	T	0.39253	0.1071	L	0.55103	1.725	0.46028	D	0.998824	B;B	0.22746	0.074;0.046	B;B	0.33690	0.139;0.168	T	0.43814	-0.9368	10	0.45353	T	0.12	-8.3909	13.84	0.63432	0.0:0.0:0.0:1.0	.	58;78	F5GZZ8;P31513	.;FMO3_HUMAN	L	78;78;58	ENSP00000356729:F78L;ENSP00000375935:F78L;ENSP00000444073:F58L	ENSP00000356729:F78L	F	+	1	0	FMO3	169339649	0.973000	0.33851	0.994000	0.49952	0.846000	0.48090	7.677000	0.84024	1.800000	0.52685	0.482000	0.46254	TTC		0.418	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
ARAP1	116985	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	72438103	72438103	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:72438103G>A	ENST00000393609.3	-	3	273	c.71C>T	c.(70-72)aCg>aTg	p.T24M	ARAP1_ENST00000455638.2_Missense_Mutation_p.T24M|ARAP1_ENST00000359373.5_Missense_Mutation_p.T24M	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	24	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						AAAGAGCCCCGTGTACTGCTC	0.657																																					Ovarian(102;1198 1520 13195 17913 37529)	.											0													16.0	21.0	20.0					11																	72438103		2084	4202	6286	SO:0001583	missense	116985			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.71C>T	11.37:g.72438103G>A	ENSP00000377233:p.Thr24Met		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830810	0.50845	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393609	T;T;T	0.50001	0.76;0.76;0.76	4.59	3.67	0.42095	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.356212	0.26190	N	0.025808	T	0.41673	0.1169	L	0.46157	1.445	0.26422	N	0.976081	D;D	0.54207	0.957;0.965	B;P	0.47102	0.402;0.537	T	0.36553	-0.9743	10	0.54805	T	0.06	.	4.6932	0.12791	0.1784:0.2125:0.609:0.0	.	24;24	Q96P48-3;Q96P48	.;ARAP1_HUMAN	M	24	ENSP00000352332:T24M;ENSP00000390461:T24M;ENSP00000377233:T24M	ENSP00000352332:T24M	T	-	2	0	ARAP1	72115751	0.170000	0.23016	0.821000	0.32701	0.955000	0.61496	1.164000	0.31810	1.130000	0.42092	0.555000	0.69702	ACG		0.657	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
TMPRSS13	84000	broad.mit.edu;bcgsc.ca	37	11	117784539	117784539	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:117784539C>G	ENST00000430170.2	-	5	849	c.762G>C	c.(760-762)tgG>tgC	p.W254C	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.W254C|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.W254C|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.W254C|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.W219C	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	254	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		AGGAGTCATTCCAGTTGCTGC	0.537																																						.											0													75.0	79.0	78.0					11																	117784539		1907	4112	6019	SO:0001583	missense	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.762G>C	11.37:g.117784539C>G	ENSP00000387702:p.Trp254Cys		B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365229	0.82463	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000015	D	0.88190	0.6370	M	0.91140	3.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90128	0.4204	10	0.87932	D	0	.	19.4133	0.94685	0.0:1.0:0.0:0.0	.	249;254	Q9BYE2-4;E9PRA0	.;.	C	219;249;254;254;254;254	ENSP00000435813:W219C;ENSP00000434279:W254C;ENSP00000387702:W254C;ENSP00000394114:W254C;ENSP00000436502:W254C	ENSP00000337113:W249C	W	-	3	0	TMPRSS13	117289749	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.462000	0.73526	2.700000	0.92200	0.561000	0.74099	TGG		0.537	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
KIF5A	3798	broad.mit.edu	37	12	57957254	57957254	+	Silent	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr12:57957254C>T	ENST00000455537.2	+	2	436	c.162C>T	c.(160-162)ccC>ccT	p.P54P	KIF5A_ENST00000286452.5_Intron	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	54	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GTGTATTCCCCCCAAACACGA	0.413																																						.											0													99.0	89.0	92.0					12																	57957254		2203	4300	6503	SO:0001819	synonymous_variant	3798			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.162C>T	12.37:g.57957254C>T			A6H8M5|Q4LE26	Silent	SNP	ENST00000455537.2	37	CCDS8945.1																																																																																				0.413	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
PIBF1	10464	broad.mit.edu	37	13	73572977	73572977	+	Silent	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr13:73572977A>G	ENST00000326291.6	+	17	2405	c.2067A>G	c.(2065-2067)aaA>aaG	p.K689K	PIBF1_ENST00000489922.1_3'UTR	NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	689						centrosome (GO:0005813)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		CAGCAATGAAACAGATTCTCG	0.303																																						.											0													61.0	55.0	57.0					13																	73572977		2203	4299	6502	SO:0001819	synonymous_variant	10464			AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.2067A>G	13.37:g.73572977A>G			O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Silent	SNP	ENST00000326291.6	37	CCDS31991.1																																																																																				0.303	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	
LRFN5	145581	broad.mit.edu	37	14	42355997	42355997	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr14:42355997C>T	ENST00000298119.4	+	3	1358	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	LRFN5_ENST00000554171.1_Missense_Mutation_p.R57W|LRFN5_ENST00000554120.1_Missense_Mutation_p.R57W	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	57						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTGGAACTGCGGTTGGCAGA	0.383										HNSCC(30;0.082)																												.											0													64.0	58.0	60.0					14																	42355997		2203	4300	6503	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.169C>T	14.37:g.42355997C>T	ENSP00000298119:p.Arg57Trp		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905412	0.52333	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52983	0.64;0.64;0.64	5.56	4.64	0.57946	.	0.000000	0.50627	D	0.000116	T	0.69214	0.3086	M	0.79805	2.47	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73751	-0.3884	10	0.72032	D	0.01	.	13.2597	0.60098	0.16:0.84:0.0:0.0	.	57;57	G3V364;Q96NI6	.;LRFN5_HUMAN	W	57	ENSP00000298119:R57W;ENSP00000451897:R57W;ENSP00000451067:R57W	ENSP00000298119:R57W	R	+	1	2	LRFN5	41425747	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	3.226000	0.51254	1.276000	0.44395	0.650000	0.86243	CGG		0.383	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
TRIP11	9321	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	92471894	92471894	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr14:92471894A>C	ENST00000267622.4	-	11	2799	c.2426T>G	c.(2425-2427)cTt>cGt	p.L809R		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	809					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTTGTTTATAAGTTGTGTCAA	0.318			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													87.0	93.0	91.0					14																	92471894		2203	4300	6503	SO:0001583	missense	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2426T>G	14.37:g.92471894A>C	ENSP00000267622:p.Leu809Arg		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	A	9.614	1.131949	0.21041	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.10005	2.92	5.77	4.6	0.57074	.	0.211258	0.41396	N	0.000885	T	0.26846	0.0657	M	0.66939	2.045	0.49687	D	0.999814	P;D	0.76494	0.565;0.999	B;D	0.70935	0.16;0.971	T	0.04870	-1.0921	10	0.16420	T	0.52	.	12.8783	0.58001	0.864:0.136:0.0:0.0	.	545;809	F5H1Z0;Q15643	.;TRIPB_HUMAN	R	809;545	ENSP00000267622:L809R	ENSP00000267622:L809R	L	-	2	0	TRIP11	91541647	0.998000	0.40836	0.004000	0.12327	0.073000	0.16967	5.005000	0.63972	0.970000	0.38263	0.254000	0.18369	CTT		0.318	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
NIPA2	81614	broad.mit.edu	37	15	23006232	23006232	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr15:23006232T>C	ENST00000337451.3	-	8	1684	c.1072A>G	c.(1072-1074)Aca>Gca	p.T358A	NIPA2_ENST00000539711.2_Missense_Mutation_p.T339A|NIPA2_ENST00000359727.4_Missense_Mutation_p.T339A|NIPA2_ENST00000398013.3_Missense_Mutation_p.T358A|NIPA2_ENST00000398014.2_Missense_Mutation_p.T358A	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	358						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		TAAAAAGCTGTCAGATTTCCA	0.318																																						.											0													56.0	58.0	57.0					15																	23006232		2203	4299	6502	SO:0001583	missense	81614			AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.1072A>G	15.37:g.23006232T>C	ENSP00000337618:p.Thr358Ala		F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	ENST00000337451.3	37	CCDS10010.1	.	.	.	.	.	.	.	.	.	.	T	10.10	1.258288	0.23051	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59	5.76	-8.9	0.00782	.	0.726605	0.14377	N	0.323405	T	0.66297	0.2775	N	0.08118	0	0.20074	N	0.999935	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.58814	-0.7570	10	0.19590	T	0.45	-5.4043	4.4746	0.11729	0.3697:0.4077:0.0876:0.135	.	339;358	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	A	358;358;339;358;339	ENSP00000337618:T358A;ENSP00000381096:T358A;ENSP00000352762:T339A;ENSP00000381095:T339A	ENSP00000337618:T358A	T	-	1	0	NIPA2	20557673	0.895000	0.30542	0.064000	0.19789	0.726000	0.41606	-0.125000	0.10579	-1.658000	0.01490	-1.100000	0.02121	ACA		0.318	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251137.1	NM_030922	
ZNF106	64397	broad.mit.edu	37	15	42734362	42734362	+	Silent	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr15:42734362T>C	ENST00000263805.4	-	7	3929	c.3603A>G	c.(3601-3603)caA>caG	p.Q1201Q	ZNF106_ENST00000565380.1_Silent_p.Q429Q|ZNF106_ENST00000565611.1_Silent_p.Q386Q	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1201					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										ACATGGGCTCTTGTTTAATCT	0.478																																						.											0													165.0	151.0	155.0					15																	42734362		2203	4299	6502	SO:0001819	synonymous_variant	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.3603A>G	15.37:g.42734362T>C			B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Silent	SNP	ENST00000263805.4	37	CCDS32208.1																																																																																				0.478	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
POLDIP2	26073	broad.mit.edu	37	17	26677558	26677558	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr17:26677558T>C	ENST00000540200.1	-	10	814	c.815A>G	c.(814-816)gAc>gGc	p.D272G	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	273	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CACATCACTGTCAAGGTTCTC	0.532																																						.											0													64.0	65.0	65.0					17																	26677558		1965	4169	6134	SO:0001583	missense	26073			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.815A>G	17.37:g.26677558T>C	ENSP00000475924:p.Asp272Gly		B2R846|Q96JE4	Missense_Mutation	SNP	ENST00000540200.1	37																																																																																					0.532	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015584	
UTP6	55813	broad.mit.edu	37	17	30207665	30207665	+	Silent	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr17:30207665T>C	ENST00000261708.4	-	11	1031	c.894A>G	c.(892-894)aaA>aaG	p.K298K	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	298					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CCTCCACTGCTTTGGCTTGTT	0.502																																						.											0													196.0	174.0	181.0					17																	30207665		2203	4300	6503	SO:0001819	synonymous_variant	55813			AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.894A>G	17.37:g.30207665T>C			Q8IX96|Q96BL2|Q9NQ91	Silent	SNP	ENST00000261708.4	37	CCDS11269.1																																																																																				0.502	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	
SMARCA4	6597	broad.mit.edu	37	19	11096982	11096982	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr19:11096982A>G	ENST00000429416.3	+	5	754	c.473A>G	c.(472-474)gAc>gGc	p.D158G	SMARCA4_ENST00000541122.2_Missense_Mutation_p.D158G|SMARCA4_ENST00000590574.1_Missense_Mutation_p.D158G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.D158G|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D158G|SMARCA4_ENST00000589677.1_Missense_Mutation_p.D158G|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D158G|SMARCA4_ENST00000413806.3_Missense_Mutation_p.D158G|SMARCA4_ENST00000450717.3_Missense_Mutation_p.D158G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	158	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GATGGTGCTGACCCCCAGGCC	0.642			"""F, N, Mis"""		NSCLC																																	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											28.0	28.0	28.0					19																	11096982		2203	4299	6502	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.473A>G	19.37:g.11096982A>G	ENSP00000395654:p.Asp158Gly		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	8.408	0.843558	0.16963	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.87103	-2.21;-2.2;-2.21;-2.21;-2.2;-2.21;-2.21	4.46	4.46	0.54185	.	0.122556	0.52532	D	0.000066	T	0.81093	0.4751	L	0.43152	1.355	0.37701	D	0.924203	B;B;B;P;B;B;B	0.37466	0.007;0.007;0.007;0.596;0.007;0.007;0.007	B;B;B;B;B;B;B	0.32289	0.007;0.007;0.007;0.143;0.007;0.012;0.012	D	0.84683	0.0718	10	0.56958	D	0.05	-46.7299	12.871	0.57965	1.0:0.0:0.0:0.0	.	158;158;158;158;158;158;158	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	G	158	ENSP00000395654:D158G;ENSP00000350720:D158G;ENSP00000343896:D158G;ENSP00000445036:D158G;ENSP00000392837:D158G;ENSP00000397783:D158G;ENSP00000414727:D158G	ENSP00000343896:D158G	D	+	2	0	SMARCA4	10957982	1.000000	0.71417	0.917000	0.36280	0.019000	0.09904	7.120000	0.77153	1.877000	0.54381	0.460000	0.39030	GAC		0.642	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
FOXI3	344167	broad.mit.edu	37	2	88747871	88747871	+	RNA	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr2:88747871C>T	ENST00000398142.3	-	0	1194							A8MTJ6	FOXI3_HUMAN	forkhead box I3						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)	2						GGTGCTATTGCTGGTGCTATT	0.607																																					Pancreas(81;472 1448 16397 17495 22123)	.											0													68.0	62.0	64.0					2																	88747871		692	1591	2283			344167			BN001221, BN001222		2p11.2	2008-12-18				ENSG00000214336			35123	protein-coding gene	gene with protein product		612351				18787161	Standard	NM_001135649		Approved		uc010ytq.1	A8MTJ6			2.37:g.88747871C>T			B5RI09	Missense_Mutation	SNP	ENST00000398142.3	37																																																																																					0.607	FOXI3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000338241.2	NM_001135649	
TNRC6B	23112	broad.mit.edu	37	22	40552184	40552184	+	Silent	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr22:40552184A>G	ENST00000301923.9	+	4	413	c.111A>G	c.(109-111)aaA>aaG	p.K37K	TNRC6B_ENST00000402203.1_Silent_p.K37K	NM_001024843.1	NP_001020014.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	0	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AAGAAAGCAAACAGTGAGTCA	0.448																																						.											0													62.0	59.0	60.0					22																	40552184		1939	4160	6099	SO:0001819	synonymous_variant	23112			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000301923.9:c.111A>G	22.37:g.40552184A>G			B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000301923.9	37	CCDS46712.1																																																																																				0.448	TNRC6B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321393.1		
IGSF10	285313	broad.mit.edu	37	3	151165623	151165623	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:151165623T>C	ENST00000282466.3	-	4	2145	c.2146A>G	c.(2146-2148)Agt>Ggt	p.S716G		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	716					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGCCTCTTACTTGTGCTTGAG	0.493																																						.											0													84.0	68.0	74.0					3																	151165623		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.2146A>G	3.37:g.151165623T>C	ENSP00000282466:p.Ser716Gly		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	10.49	1.363613	0.24684	.	.	ENSG00000152580	ENST00000282466	T	0.68765	-0.35	4.73	-0.335	0.12662	.	0.460607	0.18317	N	0.144904	T	0.46073	0.1374	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19321	-1.0309	10	0.19147	T	0.46	.	5.3033	0.15790	0.0:0.2302:0.1453:0.6245	.	716	Q6WRI0	IGS10_HUMAN	G	716	ENSP00000282466:S716G	ENSP00000282466:S716G	S	-	1	0	IGSF10	152648313	0.003000	0.15002	0.000000	0.03702	0.044000	0.14063	0.121000	0.15667	-0.197000	0.10350	-0.353000	0.07706	AGT		0.493	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
MUC4	4585	broad.mit.edu	37	3	195509957	195509957	+	Missense_Mutation	SNP	A	A	G	rs201699932	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:195509957A>G	ENST00000463781.3	-	2	8953	c.8494T>C	c.(8494-8496)Tct>Cct	p.S2832P	MUC4_ENST00000475231.1_Missense_Mutation_p.S2832P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCATGA	0.592																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8494T>C	3.37:g.195509957A>G	ENSP00000417498:p.Ser2832Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.461	-0.109956	0.06924	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37584	1.19;1.27	.	.	.	.	.	.	.	.	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	P	0.42993	0.797	B	0.34452	0.183	T	0.11203	-1.0597	7	.	.	.	.	2.7662	0.05321	0.5841:0.0:0.0:0.4159	.	2704	E7ESK3	.	P	2832	ENSP00000417498:S2832P;ENSP00000420243:S2832P	.	S	-	1	0	MUC4	196994736	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.163000	0.00282	-0.000000	0.14550	0.000000	0.15137	TCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ANK2	287	broad.mit.edu	37	4	114278579	114278579	+	Silent	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr4:114278579T>C	ENST00000357077.4	+	38	8858	c.8805T>C	c.(8803-8805)tcT>tcC	p.S2935S	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Silent_p.S2902S|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2935					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTCCCAATCTTTTTTCTCTA	0.398																																						.											0													170.0	178.0	175.0					4																	114278579		2203	4300	6503	SO:0001819	synonymous_variant	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8805T>C	4.37:g.114278579T>C			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1																																																																																				0.398	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
SPOCK3	50859	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	167656152	167656152	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr4:167656152C>T	ENST00000357154.3	-	12	1368	c.1231G>A	c.(1231-1233)Gat>Aat	p.D411N	SPOCK3_ENST00000510741.1_Missense_Mutation_p.D368N|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D411N|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D411N|SPOCK3_ENST00000534949.1_Missense_Mutation_p.D315N|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D279N|SPOCK3_ENST00000541637.1_Missense_Mutation_p.D313N|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D408N|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D411N|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D408N|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D360N|SPOCK3_ENST00000512681.1_Missense_Mutation_p.D313N|SPOCK3_ENST00000511269.1_Missense_Mutation_p.D408N|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D291N	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	411	Asp-rich.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		tcatcttcatcattcataata	0.358																																						.											0													186.0	176.0	179.0					4																	167656152		2203	4299	6502	SO:0001583	missense	50859			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.1231G>A	4.37:g.167656152C>T	ENSP00000349677:p.Asp411Asn		B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.804648	0.31961	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.05	5.05	0.67936	.	0.497022	0.20929	N	0.083132	T	0.70842	0.3270	L	0.27053	0.805	0.54753	D	0.999981	B;B;B;B;B;B;B	0.26635	0.155;0.081;0.155;0.155;0.048;0.081;0.048	B;B;B;B;B;B;B	0.28916	0.081;0.064;0.096;0.06;0.043;0.093;0.043	T	0.70189	-0.4940	10	0.66056	D	0.02	-34.0193	18.3629	0.90380	0.0:1.0:0.0:0.0	.	313;315;360;420;368;408;411	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	N	411;408;408;411;411;411;368;291;313;408;279;360;313;315	ENSP00000349677:D411N;ENSP00000350153:D408N;ENSP00000425570:D408N;ENSP00000420920:D411N;ENSP00000423421:D411N;ENSP00000423606:D411N;ENSP00000426716:D368N;ENSP00000444789:D291N;ENSP00000426318:D313N;ENSP00000425502:D408N;ENSP00000441396:D279N;ENSP00000411344:D360N;ENSP00000445430:D313N;ENSP00000438142:D315N	ENSP00000349677:D411N	D	-	1	0	SPOCK3	167892727	1.000000	0.71417	0.960000	0.40013	0.047000	0.14425	3.662000	0.54510	2.504000	0.84457	0.637000	0.83480	GAT		0.358	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
MYOT	9499	broad.mit.edu	37	5	137221866	137221866	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:137221866A>G	ENST00000239926.4	+	8	1528	c.1154A>G	c.(1153-1155)aAt>aGt	p.N385S	RP11-381K20.2_ENST00000508281.2_RNA|MYOT_ENST00000515645.1_Missense_Mutation_p.N270S|MYOT_ENST00000421631.2_Missense_Mutation_p.N201S|RP11-381K20.2_ENST00000514616.1_RNA	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	385	Ig-like C2-type 2.|Necessary for interaction with ACTA1.|Necessary for interaction with FLNC.				muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)			cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGGAAAAGAAATAATGAAATG	0.348																																						.											0													79.0	84.0	82.0					5																	137221866		2203	4300	6503	SO:0001583	missense	9499			AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.1154A>G	5.37:g.137221866A>G	ENSP00000239926:p.Asn385Ser		A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	37	CCDS4194.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080318	0.76528	.	.	ENSG00000120729	ENST00000239926;ENST00000421631;ENST00000515645	T;T;T	0.50548	0.74;0.74;0.74	5.18	3.99	0.46301	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.152498	0.43416	N	0.000575	T	0.52500	0.1738	M	0.69823	2.125	0.54753	D	0.999983	P	0.52170	0.951	P	0.47134	0.539	T	0.57476	-0.7805	10	0.72032	D	0.01	.	11.4831	0.50337	0.8651:0.0:0.0:0.1349	.	385	Q9UBF9	MYOTI_HUMAN	S	385;201;270	ENSP00000239926:N385S;ENSP00000391185:N201S;ENSP00000426281:N270S	ENSP00000239926:N385S	N	+	2	0	MYOT	137249765	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	8.873000	0.92357	0.886000	0.36113	0.482000	0.46254	AAT		0.348	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790	
PSD2	84249	broad.mit.edu	37	5	139189307	139189307	+	Silent	SNP	G	G	A	rs146390261	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:139189307G>A	ENST00000274710.3	+	2	487	c.282G>A	c.(280-282)gcG>gcA	p.A94A		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	94					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGATTCAGCGGAGTCCAGGC	0.617																																						.											0								G		0,4406		0,0,2203	88.0	93.0	92.0		282	-2.4	0.0	5	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PSD2	NM_032289.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		94/772	139189307	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	84249			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.282G>A	5.37:g.139189307G>A			D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	37	CCDS4216.1																																																																																				0.617	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
RIPPLY2	134701	broad.mit.edu	37	6	84567032	84567032	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr6:84567032C>A	ENST00000369689.1	+	4	462	c.311C>A	c.(310-312)cCa>cAa	p.P104Q	RIPPLY2_ENST00000369687.1_Missense_Mutation_p.P46Q|CYB5R4_ENST00000369679.4_5'Flank|CYB5R4_ENST00000369681.5_5'Flank	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	104	Ripply homology domain. {ECO:0000255}.				bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)				large_intestine(2)|lung(4)|urinary_tract(1)	7						AAAAATTTTCCAATTCAAGCC	0.299																																						.											0													50.0	57.0	54.0					6																	84567032		2203	4291	6494	SO:0001583	missense	134701			BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.311C>A	6.37:g.84567032C>A	ENSP00000358703:p.Pro104Gln		Q5TAB6	Missense_Mutation	SNP	ENST00000369689.1	37	CCDS34493.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120432	0.77323	.	.	ENSG00000203877	ENST00000369689;ENST00000369687	.	.	.	5.64	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	M	0.82056	2.57	0.80722	D	1	D	0.71674	0.998	P	0.56474	0.799	T	0.77472	-0.2575	9	0.87932	D	0	-17.6487	16.1544	0.81646	0.1343:0.8657:0.0:0.0	.	104	Q5TAB7	RIPP2_HUMAN	Q	104;46	.	ENSP00000358701:P46Q	P	+	2	0	RIPPLY2	84623751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.910000	0.75741	1.606000	0.50161	0.650000	0.86243	CCA		0.299	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041360.1	NM_001009994	
OSBPL3	26031	broad.mit.edu	37	7	24931999	24931999	+	Silent	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:24931999T>C	ENST00000313367.2	-	2	544	c.93A>G	c.(91-93)cgA>cgG	p.R31R	OSBPL3_ENST00000353930.1_Silent_p.R31R|OSBPL3_ENST00000409069.1_Silent_p.R31R|OSBPL3_ENST00000396429.1_Silent_p.R31R|OSBPL3_ENST00000396431.1_Silent_p.R31R|OSBPL3_ENST00000352860.1_Silent_p.R31R|OSBPL3_ENST00000431825.2_Silent_p.R31R	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	31					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						ACTTTACCTGTCGACTTCCTT	0.408																																						.											0													109.0	92.0	98.0					7																	24931999		2203	4300	6503	SO:0001819	synonymous_variant	26031			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.93A>G	7.37:g.24931999T>C			A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	ENST00000313367.2	37	CCDS5390.1																																																																																				0.408	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																						.											0																																												643180					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A				RNA	SNP	ENST00000426828.1	37																																																																																					0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000344862.1		
HBP1	26959	broad.mit.edu	37	7	106827076	106827076	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:106827076A>G	ENST00000222574.4	+	6	901	c.715A>G	c.(715-717)Aga>Gga	p.R239G	HBP1_ENST00000468410.1_Missense_Mutation_p.R239G|HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000485846.1_Missense_Mutation_p.R239G	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	239	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						AGATTTTGCTAGAGCTGAAGG	0.358																																						.											0													150.0	146.0	147.0					7																	106827076		2203	4300	6503	SO:0001583	missense	26959			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.715A>G	7.37:g.106827076A>G	ENSP00000222574:p.Arg239Gly		B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	ENST00000222574.4	37	CCDS5741.1	.	.	.	.	.	.	.	.	.	.	A	16.22	3.062021	0.55432	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99080	-5.4;-5.4;-5.4	5.95	3.5	0.40072	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (3);	0.353809	0.39475	N	0.001345	D	0.97589	0.9210	L	0.46157	1.445	0.44652	D	0.997631	B;B;B	0.24092	0.097;0.053;0.066	B;B;B	0.32677	0.15;0.054;0.09	D	0.94990	0.8133	10	0.66056	D	0.02	-2.4346	12.8743	0.57982	0.7431:0.2569:0.0:0.0	.	249;239;239	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	G	239;239;239;231	ENSP00000420500:R239G;ENSP00000222574:R239G;ENSP00000418738:R239G	ENSP00000222574:R239G	R	+	1	2	HBP1	106614312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.231000	0.65327	0.462000	0.27095	0.528000	0.53228	AGA		0.358	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
PREX2	80243	broad.mit.edu	37	8	68939495	68939495	+	Silent	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr8:68939495T>C	ENST00000288368.4	+	5	757	c.480T>C	c.(478-480)gtT>gtC	p.V160V	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	160	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACACAGATGTTCCCTTGGAAG	0.358																																						.											0													144.0	136.0	139.0					8																	68939495		2203	4300	6503	SO:0001819	synonymous_variant	80243			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.480T>C	8.37:g.68939495T>C			B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																				0.358	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
MROH5	389690	broad.mit.edu	37	8	142500306	142500306	+	RNA	SNP	A	A	C	rs199659351		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr8:142500306A>C	ENST00000430863.1	-	0	688					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		CTGCGCCACCACCCGCCACGA	0.662																																						.											0													24.0	31.0	29.0					8																	142500306		2050	4191	6241			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142500306A>C				Missense_Mutation	SNP	ENST00000430863.1	37																																																																																					0.662	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
PHKA1	5255	broad.mit.edu	37	X	71925084	71925084	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:71925084T>C	ENST00000373542.4	-	3	407	c.248A>G	c.(247-249)aAg>aGg	p.K83R	PHKA1_ENST00000373539.3_Missense_Mutation_p.K83R|PHKA1_ENST00000339490.3_Missense_Mutation_p.K83R|PHKA1_ENST00000541944.1_Missense_Mutation_p.K83R|PHKA1_ENST00000373545.3_Missense_Mutation_p.K83R|PHKA1-AS1_ENST00000420998.1_RNA	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	83					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TCTCATCAGCTTCACTACACT	0.393																																						.											0													148.0	119.0	129.0					X																	71925084		2203	4300	6503	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.248A>G	X.37:g.71925084T>C	ENSP00000362643:p.Lys83Arg		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	t	20.8	4.047418	0.75846	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71;-2.71	3.85	3.85	0.44370	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.106591	0.64402	D	0.000006	D	0.95133	0.8423	M	0.88512	2.96	0.58432	D	0.999999	D;P;D	0.76494	0.999;0.918;0.997	D;P;D	0.79784	0.987;0.834;0.993	D	0.95033	0.8171	10	0.66056	D	0.02	-30.5936	9.9189	0.41453	0.0:0.0:0.0:1.0	.	83;83;83	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	R	83	ENSP00000362646:K83R;ENSP00000362643:K83R;ENSP00000441251:K83R;ENSP00000342469:K83R;ENSP00000362640:K83R	ENSP00000342469:K83R	K	-	2	0	PHKA1	71841809	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.689000	0.84165	1.531000	0.49152	0.433000	0.28618	AAG		0.393	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PLEKHG3	26030	broad.mit.edu	37	14	65194463	65194464	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr14:65194463_65194464insC	ENST00000394691.1	+	2	261_262	c.114_115insC	c.(115-117)cccfs	p.P39fs	PLEKHG3_ENST00000247226.7_Frame_Shift_Ins_p.P39fs			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	39	Ser-rich.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CCATGGAGGAGCCCAGCAGCTC	0.644																																						.											0																																										SO:0001589	frameshift_variant	26030			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.117dupC	14.37:g.65194466_65194466dupC	ENSP00000378183:p.Pro39fs		A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Frame_Shift_Ins	INS	ENST00000394691.1	37																																																																																					0.644	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
FMN1	342184	broad.mit.edu	37	15	33261112	33261113	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr15:33261112_33261113insG	ENST00000559047.1	-	5	2788_2789	c.2789_2790insC	c.(2788-2790)cttfs	p.L930fs	FMN1_ENST00000561249.1_Frame_Shift_Ins_p.L832fs|FMN1_ENST00000334528.9_Frame_Shift_Ins_p.L707fs|SNORD77_ENST00000391113.1_RNA			Q68DA7	FMN1_HUMAN	formin 1	930	FH1.|Pro-rich.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GGGAGTTAGGAAgtgggggtgg	0.668																																						.											0																																										SO:0001589	frameshift_variant	342184			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2789_2790insC	15.37:g.33261112_33261113insG	ENSP00000454047:p.Leu930fs		Q3B7I6|Q3ZAR4|Q6ZSY1	Frame_Shift_Ins	INS	ENST00000559047.1	37																																																																																					0.668	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
CCDC73	493860	ucsc.edu;mdanderson.org;bcgsc.ca	37	11	32636263	32636263	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:32636263G>T	ENST00000335185.5	-	16	1644	c.1601C>A	c.(1600-1602)cCa>cAa	p.P534Q	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	534										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					ATGATTATTTGGTGATTTAAA	0.318																																						.											0													131.0	118.0	122.0					11																	32636263		1819	4075	5894	SO:0001583	missense	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1601C>A	11.37:g.32636263G>T	ENSP00000335325:p.Pro534Gln		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	G	8.072	0.770379	0.15983	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.42	2.1	0.27182	.	1.166390	0.06315	N	0.703327	T	0.21550	0.0519	L	0.40543	1.245	0.09310	N	1	P	0.34462	0.454	B	0.27380	0.079	T	0.20874	-1.0262	9	0.13853	T	0.58	.	0.2746	0.00236	0.33:0.1473:0.2777:0.245	.	534	Q6ZRK6	CCD73_HUMAN	Q	534	.	ENSP00000335325:P534Q	P	-	2	0	CCDC73	32592839	0.000000	0.05858	0.064000	0.19789	0.113000	0.19764	-0.315000	0.08081	0.631000	0.30412	0.591000	0.81541	CCA		0.318	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
DGKH	160851	ucsc.edu	37	13	42623046	42623046	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr13:42623046A>G	ENST00000337343.4	+	1	158	c.137A>G	c.(136-138)gAg>gGg	p.E46G	DGKH_ENST00000540693.1_Missense_Mutation_p.E46G|DGKH_ENST00000261491.5_Missense_Mutation_p.E46G|DGKH_ENST00000379274.2_5'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	46					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GCGGAGCAAGAGGGACCCCAG	0.716																																						.											0													18.0	17.0	18.0					13																	42623046		2196	4298	6494	SO:0001583	missense	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.137A>G	13.37:g.42623046A>G	ENSP00000337572:p.Glu46Gly		A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911329	0.72983	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491	T;T;T	0.81247	-1.47;-1.29;-1.47	4.26	4.26	0.50523	.	0.091905	0.39544	N	0.001327	T	0.74891	0.3776	L	0.29908	0.895	0.80722	D	1	P;B	0.44139	0.827;0.002	P;B	0.46758	0.526;0.003	T	0.72551	-0.4259	10	0.26408	T	0.33	.	13.6415	0.62253	1.0:0.0:0.0:0.0	.	46;46	Q86XP1-2;Q86XP1	.;DGKH_HUMAN	G	46	ENSP00000440823:E46G;ENSP00000337572:E46G;ENSP00000261491:E46G	ENSP00000261491:E46G	E	+	2	0	DGKH	41521046	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.038000	0.70964	1.684000	0.51022	0.254000	0.18369	GAG		0.716	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
DNAJB7	150353	ucsc.edu;mdanderson.org;bcgsc.ca	37	22	41257713	41257713	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr22:41257713C>A	ENST00000307221.4	-	1	417	c.286G>T	c.(286-288)Gtt>Ttt	p.V96F	XPNPEP3_ENST00000357137.4_Intron|XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000482652.1_3'UTR|XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000541156.1_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	96							chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						TCTTTAAAAACATCATCTGGC	0.378																																						.											0													100.0	101.0	100.0					22																	41257713		2203	4300	6503	SO:0001583	missense	150353			AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.286G>T	22.37:g.41257713C>A	ENSP00000307197:p.Val96Phe		Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	ENST00000307221.4	37	CCDS14008.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.880043	0.33162	.	.	ENSG00000172404	ENST00000307221	T	0.79554	-1.28	4.7	1.53	0.23141	.	0.000000	0.48767	D	0.000178	D	0.84297	0.5441	M	0.90483	3.12	0.80722	D	1	P	0.38420	0.63	P	0.44561	0.453	D	0.83658	0.0159	10	0.72032	D	0.01	.	8.6484	0.34020	0.0:0.7435:0.0:0.2565	.	96	Q7Z6W7	DNJB7_HUMAN	F	96	ENSP00000307197:V96F	ENSP00000307197:V96F	V	-	1	0	DNAJB7	39587659	0.310000	0.24527	0.958000	0.39756	0.006000	0.05464	0.405000	0.21015	0.478000	0.27488	-0.218000	0.12543	GTT		0.378	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321765.1	NM_145174	
FAM134C	162427	ucsc.edu	37	17	40737279	40737279	+	Splice_Site	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr17:40737279A>G	ENST00000309428.5	-	6	650	c.591T>C	c.(589-591)ctT>ctC	p.L197L	FAM134C_ENST00000543197.1_Splice_Site_p.L2L|FAM134C_ENST00000585894.1_Splice_Site_p.L100L	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	197						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		TGACAGTGACAACTGTGAGGA	0.532																																						.											0													66.0	52.0	57.0					17																	40737279		2203	4300	6503	SO:0001630	splice_region_variant	162427			BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.590-1T>C	17.37:g.40737279A>G			B3KR75	Silent	SNP	ENST00000309428.5	37	CCDS11432.1																																																																																				0.532	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	Silent
FAM83D	81610	ucsc.edu	37	20	37555032	37555032	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr20:37555032A>G	ENST00000217429.4	+	1	78	c.37A>G	c.(37-39)Aag>Gag	p.K13E		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	0					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				GTTGCCTATAAAGCGGGACTG	0.657											OREG0025936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													22.0	26.0	25.0					20																	37555032		1874	4097	5971	SO:0001583	missense	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.37A>G	20.37:g.37555032A>G	ENSP00000217429:p.Lys13Glu	871	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.773002	0.49680	.	.	ENSG00000101447	ENST00000217429	T	0.12774	2.65	4.54	4.54	0.55810	.	2.012680	0.03311	N	0.190501	T	0.15522	0.0374	.	.	.	0.21740	N	0.999564	.	.	.	.	.	.	T	0.23619	-1.0183	7	0.36615	T	0.2	.	8.6845	0.34229	0.8302:0.0:0.0:0.1698	.	.	.	.	E	13	ENSP00000217429:K13E	ENSP00000217429:K13E	K	+	1	0	FAM83D	36988446	.	.	0.944000	0.38274	0.040000	0.13550	.	.	1.907000	0.55213	0.379000	0.24179	AAG		0.657	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
HTR3E	285242	ucsc.edu	37	3	183818222	183818222	+	Intron	SNP	G	G	A	rs5855015|rs397897677	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:183818222G>A	ENST00000415389.2	+	2	533				HTR3E_ENST00000440596.2_Missense_Mutation_p.R21K|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000436361.2_Missense_Mutation_p.R21K|HTR3E_ENST00000425359.2_Intron|HTR3E_ENST00000335304.2_Missense_Mutation_p.R21K	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	CTCTCATATAGGGAGCACAGG	0.527																																					Melanoma(7;227 727 6634 44770)	.											0													157.0	143.0	147.0					3																	183818222		2202	4293	6495	SO:0001627	intron_variant	285242			AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.68-51G>A	3.37:g.183818222G>A			A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	ENST00000415389.2	37	CCDS58868.1	.	.	.	.	.	.	.	.	.	.	g	11.61	1.689815	0.29962	.	.	ENSG00000186038	ENST00000335304;ENST00000436361;ENST00000440596	T;T;T	0.78481	-1.11;-1.14;-1.18	3.73	0.45	0.16624	.	10.888600	0.00166	N	0.000004	T	0.62466	0.2430	L	0.29908	0.895	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.09377	0.002;0.004;0.004	T	0.50583	-0.8811	10	0.02654	T	1	.	5.0949	0.14727	0.2343:0.1729:0.5928:0.0	.	21;21;21	E9PGF1;A5X5Y0-4;A5X5Y0-3	.;.;.	K	21	ENSP00000335511:R21K;ENSP00000395833:R21K;ENSP00000406050:R21K	ENSP00000335511:R21K	R	+	2	0	HTR3E	185300916	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.342000	0.19926	0.312000	0.23038	-0.150000	0.13652	AGG		0.527	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589	
IRS1	3667	ucsc.edu	37	2	227659840	227659840	+	Silent	SNP	T	T	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr2:227659840T>G	ENST00000305123.5	-	1	4635	c.3615A>C	c.(3613-3615)ccA>ccC	p.P1205P	IRS1_ENST00000498335.1_5'UTR	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	1205	Pro-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GATGAGGGGGTGGGGGTGGGG	0.577																																						.											0																																										SO:0001819	synonymous_variant	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.3615A>C	2.37:g.227659840T>G				Silent	SNP	ENST00000305123.5	37	CCDS2463.1																																																																																				0.577	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
OR51M1	390059	ucsc.edu;mdanderson.org;bcgsc.ca	37	11	5411028	5411028	+	Missense_Mutation	SNP	C	C	T	rs74683499	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:5411028C>T	ENST00000328611.3	+	1	422	c.400C>T	c.(400-402)Cgc>Tgc	p.R134C	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	134					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R134S(1)		NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCCTTTGACCGCCTTGTGGC	0.517													c|||	97	0.019369	0.0673	0.0086	5008	,	,		22578	0.001		0.0	False		,,,				2504	0.001					.											1	Substitution - Missense(1)	lung(1)						T	CYS/ARG	211,3915		8,195,1860	220.0	211.0	214.0		400	2.2	1.0	11	dbSNP_131	214	9,8477		0,9,4234	yes	missense	OR51M1	NM_001004756.2	180	8,204,6094	TT,TC,CC		0.1061,5.1139,1.7444	probably-damaging	134/327	5411028	220,12392	2063	4243	6306	SO:0001583	missense	390059			BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.400C>T	11.37:g.5411028C>T	ENSP00000333196:p.Arg134Cys		Q6IF80	Missense_Mutation	SNP	ENST00000328611.3	37	CCDS53596.1	35	0.016025641025641024	31	0.06300813008130081	3	0.008287292817679558	1	0.0017482517482517483	0	0.0	c	8.963	0.971057	0.18659	0.051139	0.001061	ENSG00000184698	ENST00000328611	T	0.77358	-1.09	5.06	2.22	0.28083	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34200	U	0.004166	T	0.42562	0.1208	M	0.87097	2.86	0.39920	D	0.974145	P	0.52316	0.952	P	0.51453	0.67	T	0.70450	-0.4868	10	0.87932	D	0	.	9.3107	0.37903	0.0:0.7644:0.0:0.2356	.	123	Q9H341	O51M1_HUMAN	C	134	ENSP00000333196:R134C	ENSP00000333196:R134C	R	+	1	0	OR51M1	5367604	0.000000	0.05858	0.968000	0.41197	0.217000	0.24651	-0.832000	0.04400	0.330000	0.23485	-0.119000	0.15052	CGC		0.517	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756	
RNF17	56163	ucsc.edu	37	13	25439115	25439115	+	Silent	SNP	T	T	C	rs372000517		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr13:25439115T>C	ENST00000255324.5	+	29	4132	c.4080T>C	c.(4078-4080)caT>caC	p.H1360H	RNF17_ENST00000381921.1_Intron|RNF17_ENST00000339524.3_Intron	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1360					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CTTCTGAACATACTGAGGAGA	0.303																																						.											0								T	,	0,4398		0,0,2199	75.0	77.0	76.0		4068,4080	-1.4	0.9	13		76	1,8563	1.2+/-3.3	0,1,4281	no	coding-synonymous,coding-synonymous	RNF17	NM_001184993.1,NM_031277.2	,	0,1,6480	CC,CT,TT		0.0117,0.0,0.0077	,	1356/1620,1360/1624	25439115	1,12961	2199	4282	6481	SO:0001819	synonymous_variant	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4080T>C	13.37:g.25439115T>C			Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	37	CCDS9308.2																																																																																				0.303	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
TMEM214	54867	ucsc.edu;bcgsc.ca	37	2	27263695	27263695	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr2:27263695C>T	ENST00000238788.9	+	17	2122	c.2060C>T	c.(2059-2061)tCc>tTc	p.S687F	TMEM214_ENST00000404032.3_Missense_Mutation_p.S642F	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	687					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GCCCTGATATCCCAGCAGTAG	0.542																																						.											0													103.0	101.0	102.0					2																	27263695		2031	4193	6224	SO:0001583	missense	54867				CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.2060C>T	2.37:g.27263695C>T	ENSP00000238788:p.Ser687Phe		A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	37	CCDS42664.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440509	0.83993	.	.	ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397	T;T	0.54479	0.57;0.58	5.92	5.92	0.95590	.	0.138939	0.49916	D	0.000122	T	0.64994	0.2649	L	0.34521	1.04	0.43385	D	0.995492	D;P	0.89917	1.0;0.948	D;P	0.91635	0.999;0.733	T	0.66268	-0.5966	10	0.87932	D	0	-10.0855	18.0937	0.89481	0.0:1.0:0.0:0.0	.	642;687	Q6NUQ4-2;Q6NUQ4	.;TM214_HUMAN	F	687;642;427	ENSP00000238788:S687F;ENSP00000384417:S642F	ENSP00000238788:S687F	S	+	2	0	TMEM214	27117199	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.558000	0.60789	2.813000	0.96785	0.561000	0.74099	TCC		0.542	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
TRIO	7204	ucsc.edu	37	5	14369520	14369520	+	Missense_Mutation	SNP	A	A	G	rs372172691		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr5:14369520A>G	ENST00000344204.4	+	18	3128	c.3104A>G	c.(3103-3105)aAg>aGg	p.K1035R	TRIO_ENST00000509967.2_Missense_Mutation_p.K986R|TRIO_ENST00000537187.1_Missense_Mutation_p.K1035R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1035					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAGGAGTACAAGAGAGAAGAA	0.582																																						.											0								A	ARG/LYS	1,4405	2.1+/-5.4	0,1,2202	81.0	86.0	84.0		3104	5.8	1.0	5		84	0,8600		0,0,4300	no	missense	TRIO	NM_007118.2	26	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	1035/3098	14369520	1,13005	2203	4300	6503	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3104A>G	5.37:g.14369520A>G	ENSP00000339299:p.Lys1035Arg		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508381	0.27036	2.27E-4	0.0	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.61980	0.06;0.08;0.65	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.53546	0.1803	N	0.02697	-0.525	0.58432	D	0.999999	B;B;D	0.69078	0.007;0.012;0.997	B;B;D	0.73380	0.005;0.028;0.98	T	0.55068	-0.8198	10	0.02654	T	1	.	16.2147	0.82198	1.0:0.0:0.0:0.0	.	986;1035;1035	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	R	1035;1035;986;722	ENSP00000339299:K1035R;ENSP00000446348:K1035R;ENSP00000445592:K986R	ENSP00000339299:K1035R	K	+	2	0	TRIO	14422520	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	5.348000	0.66004	2.231000	0.72958	0.460000	0.39030	AAG		0.582	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
ADAMTS7	11173	mdanderson.org	37	15	79067099	79067099	+	Silent	SNP	G	G	C	rs142017909	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr15:79067099G>C	ENST00000388820.4	-	12	1953	c.1743C>G	c.(1741-1743)cgC>cgG	p.R581R	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	581	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R581R(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GGAAGCGCTTGCGCTCACCCA	0.647																																						.											1	Substitution - coding silent(1)	large_intestine(1)											69.0	79.0	76.0					15																	79067099		2196	4292	6488	SO:0001819	synonymous_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1743C>G	15.37:g.79067099G>C			Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																				0.647	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
CDC42BPG	55561	mdanderson.org	37	11	64597205	64597205	+	Silent	SNP	G	G	T	rs7936466	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:64597205G>T	ENST00000342711.5	-	30	3704	c.3705C>A	c.(3703-3705)ggC>ggA	p.G1235G	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						ATAGCCGGTCGCCCAGCAGCC	0.716													G|||	1371	0.273762	0.0439	0.2147	5008	,	,		14616	0.4931		0.2555	False		,,,				2504	0.4192					.											0								G		328,3866		16,296,1785	7.0	9.0	8.0		3705	-0.6	1.0	11	dbSNP_116	8	1926,6434		211,1504,2465	no	coding-synonymous	CDC42BPG	NM_017525.2		227,1800,4250	TT,TG,GG		23.0383,7.8207,17.9544		1235/1552	64597205	2254,10300	2097	4180	6277	SO:0001819	synonymous_variant	55561			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.3705C>A	11.37:g.64597205G>T				Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				0.716	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CYP11B1	1584	mdanderson.org	37	8	143957661	143957661	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr8:143957661T>C	ENST00000292427.4	-	5	982	c.950A>G	c.(949-951)gAc>gGc	p.D317G	CYP11B1_ENST00000377675.3_Missense_Mutation_p.D388G|CYP11B1_ENST00000517471.1_Missense_Mutation_p.D317G	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	317					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CCTGACCGTGTCCACGCTCCC	0.622									Familial Hyperaldosteronism type I																													.											0													111.0	95.0	101.0					8																	143957661		2203	4300	6503	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.950A>G	8.37:g.143957661T>C	ENSP00000292427:p.Asp317Gly		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	13.62	2.291611	0.40494	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.73258	-0.73;2.26;-0.73	4.1	4.1	0.47936	.	0.123831	0.35870	N	0.002927	D	0.84288	0.5439	M	0.87269	2.87	0.54753	D	0.99998	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.75484	0.986;0.974;0.965	D	0.86624	0.1881	10	0.87932	D	0	.	11.3146	0.49383	0.0:0.0:0.0:1.0	.	388;317;317	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	G	317;317;388	ENSP00000292427:D317G;ENSP00000428043:D317G;ENSP00000366903:D388G	ENSP00000292427:D317G	D	-	2	0	CYP11B1	143954663	1.000000	0.71417	0.945000	0.38365	0.040000	0.13550	1.884000	0.39668	1.608000	0.50180	0.528000	0.53228	GAC		0.622	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
DTX2	113878	mdanderson.org	37	7	76131644	76131644	+	Silent	SNP	C	C	T	rs141587206	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:76131644C>T	ENST00000324432.5	+	9	1770	c.1260C>T	c.(1258-1260)tcC>tcT	p.S420S	DTX2_ENST00000430490.2_Silent_p.S420S|DTX2_ENST00000446600.1_Silent_p.S329S|DTX2_ENST00000413936.2_Silent_p.S420S|DTX2_ENST00000307569.8_Silent_p.S373S|DTX2_ENST00000446820.2_Silent_p.S373S	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	420					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S420S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AGAAGCTGTCCACAGCGTCTG	0.582													.|||	206	0.0411342	0.0961	0.0202	5008	,	,		17191	0.0089		0.0328	False		,,,				2504	0.0235					.											1	Substitution - coding silent(1)	large_intestine(1)											77.0	61.0	66.0					7																	76131644		2199	4295	6494	SO:0001819	synonymous_variant	113878				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1260C>T	7.37:g.76131644C>T			Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																				0.582	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
GON4L	54856	mdanderson.org	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000437809.1_Silent_p.E1528E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																						.											2	Substitution - coding silent(2)	endometrium(2)											35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																					0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
IL9R	3581	mdanderson.org	37	X	155239602	155239602	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:155239602G>A	ENST00000244174.5	+	9	1273	c.1094G>A	c.(1093-1095)cGt>cAt	p.R365H	IL9R_ENST00000424344.3_Missense_Mutation_p.R344H|IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	365			R -> H (in dbSNP:rs2228650).		cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGCCCAGCGCGTCCTTGGAAA	0.662																																						.											0													42.0	70.0	62.0					X																	155239602		1941	4257	6198	SO:0001583	missense	3581			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1094G>A	X.37:g.155239602G>A	ENSP00000244174:p.Arg365His		B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	130	0.05952380952380952	42	0.08536585365853659	11	0.03038674033149171	50	0.08741258741258741	27	0.03562005277044855	N	0.057	-1.234707	0.01505	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10099	2.91;2.91	1.44	0.201	0.15186	.	5.140280	0.00520	N	0.000181	T	0.00241	0.0007	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32481	-0.9905	9	0.13470	T	0.59	-9.2578	3.2156	0.06697	0.7419:0.0:0.2581:0.0	.	365	Q01113	IL9R_HUMAN	H	365;344	ENSP00000244174:R365H;ENSP00000388918:R344H	ENSP00000244174:R365H	R	+	2	0	IL9R	154892796	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.579000	0.05834	-0.003000	0.14444	-1.144000	0.01866	CGT		0.662	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
MGAM	8972	mdanderson.org	37	7	141796215	141796215	+	Splice_Site	SNP	T	T	C	rs199885850		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:141796215T>C	ENST00000549489.2	+	42	5099	c.5004T>C	c.(5002-5004)cgT>cgC	p.R1668R	MGAM_ENST00000475668.2_Splice_Site_p.R2564R	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1668	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R1668R(2)|p.R2565R(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCCTGGAGCGTGTGAGTATGG	0.582																																						.											3	Substitution - coding silent(3)	prostate(3)											88.0	83.0	85.0					7																	141796215		1950	4132	6082	SO:0001630	splice_region_variant	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5004+1T>C	7.37:g.141796215T>C			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																				0.582	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		Silent
MUC2	4583	mdanderson.org	37	11	1093569	1093569	+	Silent	SNP	A	A	C	rs72842460	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:1093569A>C	ENST00000441003.2	+	30	5415	c.5388A>C	c.(5386-5388)acA>acC	p.T1796T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T84T|MUC2_ENST00000359061.5_Silent_p.T1752T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tcaccaccacaactacGGTGA	0.587																																						.											0													87.0	116.0	106.0					11																	1093569		2190	4268	6458	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5388A>C	11.37:g.1093569A>C			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.587	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1093582	1093582	+	Missense_Mutation	SNP	G	G	C	rs55641679	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:1093582G>C	ENST00000441003.2	+	30	5428	c.5401G>C	c.(5401-5403)Gca>Cca	p.A1801P	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.A89P|MUC2_ENST00000359061.5_Missense_Mutation_p.A1757P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.A1801P(1)|p.A1757P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tacGGTGACCGCAACCCCAAC	0.592																																						.											2	Substitution - Missense(2)	lung(2)											94.0	127.0	115.0					11																	1093582		2189	4261	6450	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5401G>C	11.37:g.1093582G>C	ENSP00000415183:p.Ala1801Pro		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.673	0.492767	0.12702	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.06933	3.24;3.24;3.64	1.82	-3.63	0.04529	.	0.216900	0.19134	U	0.121877	T	0.04003	0.0112	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31806	-0.9930	9	0.29301	T	0.29	.	1.8833	0.03232	0.48:0.2674:0.1237:0.1289	rs55641679;rs61618459	1801	E7EUV1	.	P	1801;1757;89	ENSP00000415183:A1801P;ENSP00000351956:A1757P;ENSP00000331373:A89P	ENSP00000331373:A89P	A	+	1	0	MUC2	1083582	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.453000	0.02383	-3.045000	0.00262	-1.042000	0.02369	GCA		0.592	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195509939	195509939	+	Missense_Mutation	SNP	G	G	T	rs202039836	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:195509939G>T	ENST00000463781.3	-	2	8971	c.8512C>A	c.(8512-8514)Cct>Act	p.P2838T	MUC4_ENST00000475231.1_Missense_Mutation_p.P2838T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2838T(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGATGGTGACA	0.592													.|||	318	0.0634984	0.0045	0.0432	5008	,	,		7871	0.0417		0.1521	False		,,,				2504	0.089					.											3	Substitution - Missense(3)	kidney(3)											102.0	63.0	75.0					3																	195509939		690	1569	2259	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8512C>A	3.37:g.195509939G>T	ENSP00000417498:p.Pro2838Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.466	-0.108992	0.06924	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.55;1.55	.	.	.	.	.	.	.	.	T	0.10551	0.0258	N	0.08118	0	0.09310	N	1	P	0.38110	0.618	B	0.28638	0.092	T	0.19386	-1.0307	7	.	.	.	.	4.5444	0.12074	0.0:0.4166:0.5833:0.0	.	2710	E7ESK3	.	T	2838	ENSP00000417498:P2838T;ENSP00000420243:P2838T	.	P	-	1	0	MUC4	196994718	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.690000	0.00392	-0.000000	0.14550	0.000000	0.15137	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PAK2	5062	mdanderson.org	37	3	196509522	196509522	+	Missense_Mutation	SNP	C	C	G	rs67093638		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:196509522C>G	ENST00000327134.3	+	2	327	c.5C>G	c.(4-6)tCt>tGt	p.S2C	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	2					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.S2C(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGAATCATGTCTGATAACGGA	0.408																																						.											2	Substitution - Missense(2)	prostate(2)											81.0	87.0	85.0					3																	196509522		2203	4300	6503	SO:0001583	missense	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.5C>G	3.37:g.196509522C>G	ENSP00000314067:p.Ser2Cys		Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	42	0.019230769230769232	6	0.012195121951219513	0	0.0	7	0.012237762237762238	29	0.03825857519788918	C	14.90	2.672409	0.47781	.	.	ENSG00000180370	ENST00000327134	T	0.70631	-0.5	5.21	5.21	0.72293	.	0.055816	0.64402	D	0.000001	T	0.30417	0.0764	N	0.25426	0.745	0.54753	D	0.999985	B	0.15141	0.012	B	0.20577	0.03	T	0.51284	-0.8725	10	0.62326	D	0.03	.	18.756	0.91833	0.0:1.0:0.0:0.0	.	2	Q13177	PAK2_HUMAN	C	2	ENSP00000314067:S2C	ENSP00000314067:S2C	S	+	2	0	PAK2	197993919	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.961000	0.49168	2.456000	0.83038	0.655000	0.94253	TCT		0.408	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PRB2	653247	mdanderson.org	37	12	11546448	11546448	+	Silent	SNP	G	G	A	rs11054278		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr12:11546448G>A	ENST00000389362.4	-	3	599	c.564C>T	c.(562-564)ggC>ggT	p.G188G	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	188	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGCTGGTTGCCTCCTTGTG	0.602																																						.											0													148.0	148.0	148.0					12																	11546448		2166	4270	6436	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.564C>T	12.37:g.11546448G>A			O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
RLIM	51132	mdanderson.org	37	X	73811695	73811695	+	Silent	SNP	A	A	G	rs374955178		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:73811695A>G	ENST00000332687.6	-	4	1673	c.1455T>C	c.(1453-1455)agT>agC	p.S485S	RLIM_ENST00000349225.2_Silent_p.S485S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	485	Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TAGTTTCTGAACTTTCACCAc	0.493																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											0													35.0	32.0	33.0					X																	73811695		2203	4300	6503	SO:0001819	synonymous_variant	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1455T>C	X.37:g.73811695A>G			B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																				0.493	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RLIM	51132	mdanderson.org	37	X	73811739	73811739	+	Missense_Mutation	SNP	A	A	G	rs201164156		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:73811739A>G	ENST00000332687.6	-	4	1629	c.1411T>C	c.(1411-1413)Tca>Cca	p.S471P	RLIM_ENST00000349225.2_Missense_Mutation_p.S471P	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	471	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ctggaacttgaactggaactg	0.483																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											0																																										SO:0001583	missense	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1411T>C	X.37:g.73811739A>G	ENSP00000328059:p.Ser471Pro		B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.619369	0.00118	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	D;D	0.85258	-1.96;-1.96	1.66	0.0881	0.14453	.	0.638142	0.11946	U	0.514165	T	0.59032	0.2164	N	0.08118	0	0.09310	N	1	P	0.44734	0.842	B	0.29267	0.1	T	0.56607	-0.7951	10	0.34782	T	0.22	-0.2213	3.7245	0.08469	0.5962:0.4038:0.0:0.0	.	471	Q9NVW2	RNF12_HUMAN	P	471	ENSP00000328059:S471P;ENSP00000253571:S471P	ENSP00000328059:S471P	S	-	1	0	RLIM	73728464	0.991000	0.36638	0.012000	0.15200	0.011000	0.07611	0.068000	0.14531	0.675000	0.31264	0.441000	0.28932	TCA		0.483	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RLIM	51132	mdanderson.org	37	X	73811755	73811755	+	Silent	SNP	C	C	G	rs7883332	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:73811755C>G	ENST00000332687.6	-	4	1613	c.1395G>C	c.(1393-1395)tcG>tcC	p.S465S	RLIM_ENST00000349225.2_Silent_p.S465S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	465	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						aactggaactcgaactggaac	0.463													t|||	47	0.0124503	0.0265	0.0029	3775	,	,		15935	0.0		0.006	False		,,,				2504	0.0041				Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											0													43.0	43.0	43.0					X																	73811755		2203	4300	6503	SO:0001819	synonymous_variant	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1395G>C	X.37:g.73811755C>G			B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																				0.463	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RLIM	51132	mdanderson.org	37	X	73811761	73811761	+	Silent	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chrX:73811761G>T	ENST00000332687.6	-	4	1607	c.1389C>A	c.(1387-1389)tcC>tcA	p.S463S	RLIM_ENST00000349225.2_Silent_p.S463S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	463	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						aactcgaactggaactggaac	0.473																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											0													46.0	46.0	46.0					X																	73811761		2203	4300	6503	SO:0001819	synonymous_variant	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1389C>A	X.37:g.73811761G>T			B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																				0.473	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RP1L1	94137	mdanderson.org	37	8	10465962	10465962	+	Missense_Mutation	SNP	C	C	A	rs111646478	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr8:10465962C>A	ENST00000382483.3	-	4	5869	c.5646G>T	c.(5644-5646)gaG>gaT	p.E1882D		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1962					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGGCTGGGCCTCTCCTTCTG	0.617													C|||	159	0.0317492	0.0061	0.0548	5008	,	,		16897	0.001		0.0805	False		,,,				2504	0.0317					.											0													156.0	173.0	168.0					8																	10465962		1942	4150	6092	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5646G>T	8.37:g.10465962C>A	ENSP00000371923:p.Glu1882Asp		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	6.872	0.530264	0.13127	.	.	ENSG00000183638	ENST00000382483	T	0.07800	3.16	1.4	-2.79	0.05841	.	.	.	.	.	T	0.04861	0.0131	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.44267	-0.9339	9	0.23891	T	0.37	.	7.224	0.26005	0.6018:0.3982:0.0:0.0	.	1882	A6NKC6	.	D	1882	ENSP00000371923:E1882D	ENSP00000371923:E1882D	E	-	3	2	RP1L1	10503372	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-3.895000	0.00340	-0.232000	0.09811	-0.516000	0.04426	GAG		0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RP1L1	94137	mdanderson.org	37	8	10465990	10465990	+	Missense_Mutation	SNP	T	T	C	rs200622636	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr8:10465990T>C	ENST00000382483.3	-	4	5841	c.5618A>G	c.(5617-5619)gAt>gGt	p.D1873G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1953					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGCCTCTACATCTTCTGACTC	0.617													T|||	208	0.0415335	0.0068	0.0562	5008	,	,		15764	0.0188		0.0845	False		,,,				2504	0.0573					.											0													162.0	175.0	171.0					8																	10465990		1917	4128	6045	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5618A>G	8.37:g.10465990T>C	ENSP00000371923:p.Asp1873Gly		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	1.367	-0.587110	0.03827	.	.	ENSG00000183638	ENST00000382483	T	0.07567	3.18	1.24	-2.47	0.06442	.	.	.	.	.	T	0.02380	0.0073	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45833	-0.9234	9	0.21540	T	0.41	.	3.4646	0.07545	0.0:0.5294:0.2597:0.211	.	1873	A6NKC6	.	G	1873	ENSP00000371923:D1873G	ENSP00000371923:D1873G	D	-	2	0	RP1L1	10503400	0.001000	0.12720	0.015000	0.15790	0.046000	0.14306	0.311000	0.19380	-0.308000	0.08792	-0.769000	0.03391	GAT		0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
SLC29A4	222962	mdanderson.org	37	7	5338714	5338714	+	Silent	SNP	T	T	C	rs6950111	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:5338714T>C	ENST00000396872.3	+	8	1139	c.978T>C	c.(976-978)gaT>gaC	p.D326D	SLC29A4_ENST00000297195.4_Silent_p.D326D|SLC29A4_ENST00000406453.3_Silent_p.D312D			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	326					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	TGCGCTTTGATGTGCCGCGGC	0.716													C|||	1447	0.288938	0.5151	0.2795	5008	,	,		13632	0.12		0.3052	False		,,,				2504	0.1472					.											0								C	,	1951,2423		439,1073,675	12.0	17.0	15.0		978,978	-5.9	0.0	7	dbSNP_116	15	2915,5669		503,1909,1880	no	coding-synonymous,coding-synonymous	SLC29A4	NM_001040661.1,NM_153247.2	,	942,2982,2555	CC,CT,TT		33.9585,44.6045,37.5521	,	326/531,326/531	5338714	4866,8092	2187	4292	6479	SO:0001819	synonymous_variant	222962			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.978T>C	7.37:g.5338714T>C			Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	ENST00000396872.3	37	CCDS5340.1																																																																																				0.716	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247	
TPSAB1	7177	mdanderson.org	37	16	1291269	1291269	+	Silent	SNP	C	C	T	rs200858385		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:1291269C>T	ENST00000338844.3	+	3	210	c.177C>T	c.(175-177)tgC>tgT	p.C59C	TPSAB1_ENST00000461509.2_Silent_p.C66C	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	59	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				TGCACTTCTGCGGGGGCTCCC	0.692																																						.											0																																										SO:0001819	synonymous_variant	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.177C>T	16.37:g.1291269C>T			D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Silent	SNP	ENST00000338844.3	37	CCDS10431.1																																																																																				0.692	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TPSD1	23430	mdanderson.org	37	16	1306665	1306665	+	Silent	SNP	A	A	G	rs3993988		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr16:1306665A>G	ENST00000211076.3	+	2	379	c.231A>G	c.(229-231)ctA>ctG	p.L77L	TPSD1_ENST00000397534.2_Silent_p.L70L|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	77	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				AGTGGGTGCTAACCGCGGCGC	0.701																																						.											0													47.0	57.0	54.0					16																	1306665		2199	4299	6498	SO:0001819	synonymous_variant	23430			AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.231A>G	16.37:g.1306665A>G			O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	37	CCDS10432.1																																																																																				0.701	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
TRIM73	375593	mdanderson.org	37	7	75028240	75028241	+	Missense_Mutation	DNP	TG	TG	CA	rs73702637|rs73702636		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:75028240_75028241TG>CA	ENST00000437796.1	+	1	42_43	c.23_24TG>CA	c.(22-24)cTG>cCA	p.L8P	TRIM73_ENST00000463766.1_3'UTR|TRIM73_ENST00000447409.2_Missense_Mutation_p.L8P|TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000323819.3_Missense_Mutation_p.L8P|TRIM73_ENST00000430211.1_Missense_Mutation_p.L8P			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GTGAGCCTGCTGGAGCTGGAGG	0.614																																						.											0																																										SO:0001583	missense	375593			AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		Exception_encountered	7.37:g.75028240_75028241delinsCA	ENSP00000417040:p.Leu8Pro		Q8N0S3	Silent	DNP	ENST00000437796.1	37	CCDS34665.1																																																																																				0.614	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
UBXN11	91544	mdanderson.org	37	1	26608849	26608849	+	Missense_Mutation	SNP	T	T	A	rs199707978		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:26608849T>A	ENST00000374222.1	-	16	1968	c.1504A>T	c.(1504-1506)Agt>Tgt	p.S502C	UBXN11_ENST00000374217.2_Missense_Mutation_p.S469C|UBXN11_ENST00000357089.4_Missense_Mutation_p.S469C|UBXN11_ENST00000314675.7_Missense_Mutation_p.S382C|UBXN11_ENST00000374221.3_Missense_Mutation_p.S502C|UBXN11_ENST00000374223.1_Missense_Mutation_p.S259C			Q5T124	UBX11_HUMAN	UBX domain protein 11	502	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggaccgggactggggccggga	0.731																																						.											1	Deletion - In frame(1)	ovary(1)											19.0	22.0	21.0					1																	26608849		1706	3905	5611	SO:0001583	missense	91544			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1504A>T	1.37:g.26608849T>A	ENSP00000363339:p.Ser502Cys		D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	.	.	.	.	.	.	.	.	.	.	-	8.284	0.816212	0.16607	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.19105	2.17;2.18;2.44;2.43;2.43;2.44	.	.	.	.	.	.	.	.	T	0.10594	0.0259	N	0.08118	0	0.09310	N	0.999993	.	.	.	.	.	.	T	0.30446	-0.9978	5	0.66056	D	0.02	.	.	.	.	.	469;382;502	Q5T124-2;Q5T124-3;Q5T124	.;.;UBX11_HUMAN	C	382;259;469;502;502;469	ENSP00000324721:S382C;ENSP00000363340:S259C;ENSP00000349601:S469C;ENSP00000363338:S502C;ENSP00000363339:S502C;ENSP00000363334:S469C	ENSP00000324721:S382C	S	-	1	0	UBXN11	26481436	0.000000	0.05858	0.168000	0.22838	0.175000	0.22909	-0.694000	0.05115	0.000000	0.14550	0.000000	0.15137	AGT		0.731	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ZAR1L	646799	mdanderson.org	37	13	32885658	32885658	+	Silent	SNP	G	G	A	rs371193	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr13:32885658G>A	ENST00000533490.2	-	3	823	c.405C>T	c.(403-405)ccC>ccT	p.P135P	ZAR1L_ENST00000345108.6_Silent_p.P135P			A6NP61	ZAR1L_HUMAN	zygote arrest 1-like	135						cytoplasm (GO:0005737)				NS(1)|kidney(1)	2						GGCCGGTGGCGGGCGAAGTGA	0.731													g|||	803	0.160343	0.1785	0.1412	5008	,	,		13103	0.1528		0.1938	False		,,,				2504	0.1227					.											0													2.0	3.0	3.0					13																	32885658		495	1316	1811	SO:0001819	synonymous_variant	646799				CCDS45023.1	13q13.1	2014-02-20			ENSG00000189167	ENSG00000189167			37116	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 7"""					18442940	Standard	NM_001136571		Approved	Z3CXXC7	uc010abc.1	A6NP61	OTTHUMG00000016694	ENST00000533490.2:c.405C>T	13.37:g.32885658G>A			B2RV03|B7ZBU2	Silent	SNP	ENST00000533490.2	37	CCDS45023.1																																																																																				0.731	ZAR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044403.5		
CSDE1	7812	bcgsc.ca	37	1	115280678	115280683	+	In_Frame_Del	DEL	TTCAAA	TTCAAA	-			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	TTCAAA	TTCAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr1:115280678_115280683delTTCAAA	ENST00000358528.4	-	4	636_641	c.210_215delTTTGAA	c.(208-216)gatttgaaa>gaa	p.70_72DLK>E	CSDE1_ENST00000530886.1_5'UTR|CSDE1_ENST00000438362.2_In_Frame_Del_p.116_118DLK>E|CSDE1_ENST00000339438.6_In_Frame_Del_p.70_72DLK>E|CSDE1_ENST00000261443.5_In_Frame_Del_p.70_72DLK>E|CSDE1_ENST00000534699.1_In_Frame_Del_p.70_72DLK>E|CSDE1_ENST00000369530.1_In_Frame_Del_p.116_118DLK>E	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	70	CSD 1.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.F71C(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGATGATACTTCAAATTCAACATCAT	0.345																																						.											1	Substitution - Missense(1)	endometrium(1)																																								SO:0001651	inframe_deletion	7812				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.210_215delTTTGAA	1.37:g.115280678_115280683delTTCAAA	ENSP00000351329:p.Asp70_Lys72delinsGlu		A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	In_Frame_Del	DEL	ENST00000358528.4	37	CCDS30812.1																																																																																				0.345	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
FBXO18	84893	bcgsc.ca	37	10	5978506	5978506	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr10:5978506C>T	ENST00000362091.4	+	20	3032	c.2917C>T	c.(2917-2919)Cct>Tct	p.P973S	FBXO18_ENST00000379999.5_Missense_Mutation_p.P1024S|FBXO18_ENST00000397269.3_Missense_Mutation_p.P477S|RP11-536K7.3_ENST00000397264.4_RNA	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	973					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						CAATGCCATCCCTGTTGACAC	0.488																																						.											0													209.0	126.0	154.0					10																	5978506		2203	4300	6503	SO:0001583	missense	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2917C>T	10.37:g.5978506C>T	ENSP00000355415:p.Pro973Ser		Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	.	6.350	0.432713	0.12045	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	.	.	.	4.87	3.95	0.45737	.	0.489595	0.21027	N	0.081408	T	0.23014	0.0556	N	0.04508	-0.205	0.32363	N	0.556835	B;B;B	0.21147	0.052;0.031;0.013	B;B;B	0.21151	0.033;0.015;0.015	T	0.16778	-1.0391	9	0.10636	T	0.68	-7.8564	11.9015	0.52687	0.0:0.9126:0.0:0.0874	.	1024;973;899	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	S	477;973;1024	.	ENSP00000355415:P973S	P	+	1	0	FBXO18	6018512	0.999000	0.42202	0.997000	0.53966	0.717000	0.41224	2.003000	0.40844	2.403000	0.81681	0.454000	0.30748	CCT		0.488	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
TH	7054	bcgsc.ca	37	11	2190951	2190951	+	Missense_Mutation	SNP	C	C	T	rs6356	byFrequency	TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr11:2190951C>T	ENST00000381178.1	-	3	352	c.334G>A	c.(334-336)Gtg>Atg	p.V112M	TH_ENST00000381175.1_Missense_Mutation_p.V108M|TH_ENST00000352909.3_Missense_Mutation_p.V81M|TH_ENST00000333684.5_Missense_Mutation_p.V85M	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	112			V -> M (common polymorphism; dbSNP:rs6356). {ECO:0000269|PubMed:10391209, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:21940685, ECO:0000269|PubMed:7789962, ECO:0000269|PubMed:9613851}.		anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	AGGTTTAGCACGGCCTTCCCC	0.697													C|||	2156	0.430511	0.1014	0.3919	5008	,	,		15378	0.7877		0.4026	False		,,,				2504	0.5634					.											0								C	MET/VAL,MET/VAL,MET/VAL	623,3779	265.6+/-266.7	36,551,1614	58.0	60.0	60.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	241,334,322	-1.8	0.0	11	dbSNP_52	60	3121,5477	472.4+/-368.3	569,1983,1747	yes	missense,missense,missense	TH	NM_000360.3,NM_199292.2,NM_199293.2	21,21,21	605,2534,3361	TT,TC,CC		36.2991,14.1527,28.8	benign,benign,benign	81/498,112/529,108/525	2190951	3744,9256	2201	4299	6500	SO:0001583	missense	7054			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.334G>A	11.37:g.2190951C>T	ENSP00000370571:p.Val112Met		B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	913	0.41804029304029305	52	0.10569105691056911	127	0.35082872928176795	443	0.7744755244755245	291	0.3839050131926121	C	13.68	2.310931	0.40895	0.141527	0.362991	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.98419	-4.92;-4.92;-4.92;-4.92	3.59	-1.8	0.07907	.	0.577810	0.17552	N	0.170143	T	0.00012	0.0000	L	0.31664	0.95	0.80722	P	0.0	B;B;B;B;B	0.24576	0.037;0.037;0.044;0.016;0.106	B;B;B;B;B	0.21151	0.006;0.006;0.02;0.005;0.033	T	0.41662	-0.9496	9	0.33141	T	0.24	.	4.7289	0.12955	0.0:0.2915:0.2918:0.4167	rs6356;rs57599796;rs6356	85;81;81;112;108	Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;TY3H_HUMAN;.	M	112;108;81;85	ENSP00000370571:V112M;ENSP00000370567:V108M;ENSP00000325951:V81M;ENSP00000328814:V85M	ENSP00000328814:V85M	V	-	1	0	TH	2147527	0.000000	0.05858	0.000000	0.03702	0.948000	0.59901	-0.327000	0.07955	-0.189000	0.10482	0.491000	0.48974	GTG		0.697	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
SLC16A5	9121	bcgsc.ca	37	17	73102117	73102117	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr17:73102117A>G	ENST00000450736.2	+	6	1922	c.1507A>G	c.(1507-1509)Agc>Ggc	p.S503G	SLC16A5_ENST00000580123.1_Missense_Mutation_p.S503G|SLC16A5_ENST00000329783.4_Missense_Mutation_p.S503G			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	503					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	gggctggaatagccctacctg	0.542											OREG0024726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													38.0	30.0	33.0					17																	73102117		2203	4300	6503	SO:0001583	missense	9121			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1507A>G	17.37:g.73102117A>G	ENSP00000390564:p.Ser503Gly	1142	B4E288	Missense_Mutation	SNP	ENST00000450736.2	37	CCDS11713.1	.	.	.	.	.	.	.	.	.	.	A	9.218	1.032641	0.19590	.	.	ENSG00000170190	ENST00000329783;ENST00000450736	T;T	0.07444	3.19;3.19	2.82	-1.3	0.09259	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.09310	N	0.999999	P	0.43392	0.805	P	0.45506	0.483	T	0.31806	-0.9930	9	0.87932	D	0	.	3.237	0.06768	0.3636:0.1957:0.0:0.4407	.	503	O15375	MOT6_HUMAN	G	503	ENSP00000330141:S503G;ENSP00000390564:S503G	ENSP00000330141:S503G	S	+	1	0	SLC16A5	70613712	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.341000	0.19909	-0.321000	0.08627	0.418000	0.28097	AGC		0.542	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695	
LMAN1	3998	bcgsc.ca	37	18	57000391	57000391	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr18:57000391A>G	ENST00000251047.5	-	11	2023	c.1306T>C	c.(1306-1308)Ttc>Ctc	p.F436L		NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	436					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	ATGTCAATGAAGTGCTGTGTT	0.423																																						.											0													87.0	82.0	84.0					18																	57000391		2203	4300	6503	SO:0001583	missense	3998			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.1306T>C	18.37:g.57000391A>G	ENSP00000251047:p.Phe436Leu		Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	ENST00000251047.5	37	CCDS11974.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.238027	0.39598	.	.	ENSG00000074695	ENST00000251047	T	0.55234	0.53	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.61703	1.905	0.80722	D	1	P	0.45634	0.863	P	0.46885	0.53	T	0.54622	-0.8266	10	0.25106	T	0.35	-12.9726	15.942	0.79763	1.0:0.0:0.0:0.0	.	436	P49257	LMAN1_HUMAN	L	436	ENSP00000251047:F436L	ENSP00000251047:F436L	F	-	1	0	LMAN1	55151371	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	8.923000	0.92808	2.248000	0.74166	0.533000	0.62120	TTC		0.423	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	
IQCA1	79781	bcgsc.ca	37	2	237402454	237402454	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr2:237402454A>G	ENST00000409907.3	-	3	687	c.413T>C	c.(412-414)cTt>cCt	p.L138P	IQCA1_ENST00000431676.2_Missense_Mutation_p.L138P|IQCA1_ENST00000309507.5_Missense_Mutation_p.L134P	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	138							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TATTTGAGCAAGAATTTTCTC	0.313																																						.											0													116.0	105.0	108.0					2																	237402454		1809	4078	5887	SO:0001583	missense	79781			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.413T>C	2.37:g.237402454A>G	ENSP00000387347:p.Leu138Pro		B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	ENST00000409907.3	37	CCDS46549.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.835275	0.50951	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	D;D;D	0.95377	-3.57;-3.59;-3.69	5.05	5.05	0.67936	.	0.000000	0.50627	D	0.000103	D	0.97729	0.9255	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.99;0.996;0.99	D	0.98162	1.0447	10	0.54805	T	0.06	.	13.6585	0.62352	1.0:0.0:0.0:0.0	.	138;145;138	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	P	138;145;134;138;134	ENSP00000387347:L138P;ENSP00000311951:L134P;ENSP00000407213:L138P	ENSP00000254653:L138P	L	-	2	0	IQCA1	237067193	1.000000	0.71417	0.860000	0.33809	0.389000	0.30415	6.007000	0.70731	1.911000	0.55334	0.460000	0.39030	CTT		0.313	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
MUC4	4585	bcgsc.ca	37	3	195510133	195510133	+	Missense_Mutation	SNP	T	T	C	rs371587475		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:195510133T>C	ENST00000463781.3	-	2	8777	c.8318A>G	c.(8317-8319)aAc>aGc	p.N2773S	MUC4_ENST00000475231.1_Missense_Mutation_p.N2773S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.N2773S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTTGGTGACAGG	0.582																																						.											1	Substitution - Missense(1)	kidney(1)											42.0	25.0	30.0					3																	195510133		688	1543	2231	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8318A>G	3.37:g.195510133T>C	ENSP00000417498:p.Asn2773Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.344	-0.948616	0.02304	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.5;1.44	1.02	-1.52	0.08637	.	.	.	.	.	T	0.10465	0.0256	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32929	-0.9888	8	.	.	.	.	4.3758	0.11270	0.0:0.4779:0.0:0.5221	.	2645	E7ESK3	.	S	2773	ENSP00000417498:N2773S;ENSP00000420243:N2773S	.	N	-	2	0	MUC4	196994912	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-4.761000	0.00189	-0.419000	0.07439	0.063000	0.15292	AAC		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510146	195510146	+	Missense_Mutation	SNP	G	G	C	rs199750921		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr3:195510146G>C	ENST00000463781.3	-	2	8764	c.8305C>G	c.(8305-8307)Ctt>Gtt	p.L2769V	MUC4_ENST00000475231.1_Missense_Mutation_p.L2769V|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L2769V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCG	0.577																																						.											1	Substitution - Missense(1)	kidney(1)											35.0	21.0	25.0					3																	195510146		686	1538	2224	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8305C>G	3.37:g.195510146G>C	ENSP00000417498:p.Leu2769Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.836	-0.241610	0.05906	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38722	1.12;1.16	1.02	-1.7	0.08159	.	.	.	.	.	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.20384	0.029	T	0.19160	-1.0314	8	.	.	.	.	1.6641	0.02798	0.4545:0.0:0.2536:0.2919	.	2641	E7ESK3	.	V	2769	ENSP00000417498:L2769V;ENSP00000420243:L2769V	.	L	-	1	0	MUC4	196994925	0.000000	0.05858	0.002000	0.10522	0.103000	0.19146	-1.498000	0.02287	-0.413000	0.07507	0.074000	0.15403	CTT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CBR4	84869	bcgsc.ca	37	4	169931136	169931136	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr4:169931136G>T	ENST00000306193.3	-	1	273	c.105C>A	c.(103-105)aaC>aaA	p.N35K	RP11-483A20.3_ENST00000506933.1_RNA|CBR4_ENST00000504480.1_Missense_Mutation_p.N35K	NM_032783.4	NP_116172.2	Q8N4T8	CBR4_HUMAN	carbonyl reductase 4	35					daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|fatty acid biosynthetic process (GO:0006633)|protein homotetramerization (GO:0051289)	mitochondrial matrix (GO:0005759)	NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|NADPH binding (GO:0070402)|NADPH dehydrogenase (quinone) activity (GO:0008753)|quinone binding (GO:0048038)			kidney(1)|large_intestine(2)|lung(2)	5		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		CCCCTTCCAGGTTTCTGGCAA	0.587											OREG0016397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													22.0	26.0	25.0					4																	169931136		2203	4300	6503	SO:0001583	missense	84869			BC021973	CCDS3812.1	4q32.3	2013-10-11			ENSG00000145439	ENSG00000145439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	25891	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 45C, member 1"""					19027726	Standard	NM_032783		Approved	FLJ14431, SDR45C1	uc003iry.3	Q8N4T8	OTTHUMG00000161025	ENST00000306193.3:c.105C>A	4.37:g.169931136G>T	ENSP00000303525:p.Asn35Lys	1881	Q8WTW8|Q96K93	Missense_Mutation	SNP	ENST00000306193.3	37	CCDS3812.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894508	0.33442	.	.	ENSG00000145439	ENST00000306193;ENST00000504480;ENST00000504561	T;D;D	0.90385	1.82;-2.66;-2.66	5.22	-3.19	0.05171	NAD(P)-binding domain (1);	0.351943	0.31834	N	0.006988	D	0.82866	0.5130	N	0.25286	0.73	0.48135	D	0.999593	P	0.36027	0.533	B	0.41374	0.355	T	0.72047	-0.4408	9	.	.	.	.	13.5656	0.61815	0.4344:0.0:0.5656:0.0	.	35	Q8N4T8	CBR4_HUMAN	K	35;35;32	ENSP00000303525:N35K;ENSP00000427615:N35K;ENSP00000423128:N32K	.	N	-	3	2	CBR4	170167711	0.330000	0.24705	0.949000	0.38748	0.058000	0.15608	0.264000	0.18497	-0.445000	0.07159	0.491000	0.48974	AAC		0.587	CBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363441.2	NM_032783	
FRG1	2483	bcgsc.ca	37	4	190878626	190878626	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr4:190878626G>A	ENST00000226798.4	+	6	728	c.506G>A	c.(505-507)aGt>aAt	p.S169N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GAAGCAAAAAGTAAAACAGCA	0.363																																						.											1	Substitution - Missense(1)	skin(1)											49.0	46.0	47.0					4																	190878626		2184	4282	6466	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.506G>A	4.37:g.190878626G>A	ENSP00000226798:p.Ser169Asn		A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	14.80	2.642895	0.47153	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.48522	1.77;0.81	4.19	2.41	0.29592	Actin cross-linking (1);	0.160510	0.64402	N	0.000002	T	0.36552	0.0971	N	0.17723	0.515	0.45777	D	0.998661	P	0.35982	0.531	P	0.45406	0.479	T	0.07578	-1.0765	10	0.30854	T	0.27	0.1847	7.6816	0.28518	0.219:0.0:0.781:0.0	.	169	Q14331	FRG1_HUMAN	N	169;41;106	ENSP00000226798:S169N;ENSP00000435943:S106N	ENSP00000226798:S169N	S	+	2	0	FRG1	191115620	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	1.784000	0.38674	0.340000	0.23745	0.454000	0.30748	AGT		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
TRIM73	375593	bcgsc.ca	37	7	75028240	75028240	+	Missense_Mutation	SNP	T	T	C	rs73702636		TCGA-KN-8426-01A-11D-2310-10	TCGA-KN-8426-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a3deafcb-b54f-4b7e-89ac-c92c16fb919f	fb5c34ce-5b82-4bd7-a195-5f0c2dab07d4	g.chr7:75028240T>C	ENST00000437796.1	+	1	42	c.23T>C	c.(22-24)cTg>cCg	p.L8P	TRIM73_ENST00000463766.1_3'UTR|TRIM73_ENST00000447409.2_Missense_Mutation_p.L8P|TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000323819.3_Missense_Mutation_p.L8P|TRIM73_ENST00000430211.1_Missense_Mutation_p.L8P			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GTGAGCCTGCTGGAGCTGGAG	0.617																																						.											0													134.0	135.0	135.0					7																	75028240		2203	4300	6503	SO:0001583	missense	375593			AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.23T>C	7.37:g.75028240T>C	ENSP00000417040:p.Leu8Pro		Q8N0S3	Missense_Mutation	SNP	ENST00000437796.1	37	CCDS34665.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.453889	0.00175	.	.	ENSG00000178809	ENST00000323819;ENST00000430211;ENST00000447409;ENST00000437796	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	2.31	2.31	0.28768	Zinc finger, RING/FYVE/PHD-type (2);	0.716055	0.13135	N	0.411154	T	0.65037	0.2653	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56282	-0.8005	9	0.20046	T	0.44	.	3.1123	0.06363	0.2601:0.5871:0.0:0.1528	.	8;8	Q86UV6;Q86UV7	TRI74_HUMAN;TRI73_HUMAN	P	8	ENSP00000318615:L8P;ENSP00000410121:L8P;ENSP00000407135:L8P;ENSP00000417040:L8P	ENSP00000318615:L8P	L	+	2	0	TRIM73	74866176	0.000000	0.05858	0.274000	0.24659	0.362000	0.29581	-0.984000	0.03755	0.549000	0.28973	-0.511000	0.04467	CTG		0.617	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
