#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM16	63976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	3342300	3342300	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:3342300A>G	ENST00000270722.5	+	13	3144	c.3095A>G	c.(3094-3096)cAc>cGc	p.H1032R	PRDM16_ENST00000441472.2_Missense_Mutation_p.H1031R|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Missense_Mutation_p.H1032R|PRDM16_ENST00000378391.2_Missense_Mutation_p.H1032R|PRDM16_ENST00000442529.2_Missense_Mutation_p.H1031R|PRDM16_ENST00000511072.1_Missense_Mutation_p.H1033R|PRDM16_ENST00000514189.1_Missense_Mutation_p.H1032R			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	1032	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AAGCACGAGCACGAGAACGCA	0.667			T	EVI1	"""MDS, AML"""																																p.H1032R		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16-660	0			c.A3095G						.						60.0	69.0	66.0					1																	3342300		2112	4203	6315	SO:0001583	missense	63976	exon13			ACGAGCACGAGAA	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.3095A>G	1.37:g.3342300A>G	ENSP00000270722:p.His1032Arg	137	0		123	24	NM_022114	0	0	0	0	0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904180	0.52333	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53	4.02	4.02	0.46733	Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	U	0.000113	T	0.33702	0.0872	M	0.68317	2.08	0.51012	D	0.999906	D;D;B;D	0.60575	0.973;0.988;0.369;0.979	D;D;B;D	0.72982	0.921;0.979;0.364;0.953	T	0.08659	-1.0711	10	0.66056	D	0.02	.	12.9149	0.58200	1.0:0.0:0.0:0.0	.	1032;1032;1031;1031	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	R	1033;1032;1031;1031;1032;1032;1032;848;848;840	ENSP00000426975:H1033R;ENSP00000367651:H1032R;ENSP00000407968:H1031R;ENSP00000405253:H1031R;ENSP00000367643:H1032R;ENSP00000421400:H1032R;ENSP00000270722:H1032R;ENSP00000422504:H848R;ENSP00000425796:H840R	ENSP00000270722:H1032R	H	+	2	0	PRDM16	3332160	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.051000	0.76627	1.451000	0.47736	0.379000	0.24179	CAC	.		0.667	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
TAS1R1	80835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	6639491	6639491	+	Silent	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:6639491C>T	ENST00000333172.6	+	6	2566	c.2373C>T	c.(2371-2373)gcC>gcT	p.A791A	TAS1R1_ENST00000328191.4_3'UTR|ZBTB48_ENST00000377674.4_5'Flank|TAS1R1_ENST00000351136.3_Silent_p.A537A	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	791					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGCCTGCGGCCAACATGATGG	0.587																																					p.A791A		.											.	TAS1R1-516	0			c.C2373T						.						97.0	86.0	90.0					1																	6639491		2203	4300	6503	SO:0001819	synonymous_variant	80835	exon6			TGCGGCCAACATG		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.2373C>T	1.37:g.6639491C>T		105	0		114	46	NM_138697	0	0	0	0	0	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	37	CCDS81.1																																																																																			.		0.587	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
COL8A2	1296	hgsc.bcm.edu;bcgsc.ca	37	1	36564488	36564488	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:36564488T>C	ENST00000397799.1	-	4	1018	c.794A>G	c.(793-795)gAg>gGg	p.E265G	COL8A2_ENST00000481785.1_Missense_Mutation_p.E200G|COL8A2_ENST00000303143.4_Missense_Mutation_p.E265G			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	265	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGCTCCTGGCTCCCCCCTGGG	0.657																																					p.E265G		.											.	COL8A2-90	0			c.A794G						.						14.0	17.0	16.0					1																	36564488		2193	4289	6482	SO:0001583	missense	1296	exon2			CCTGGCTCCCCCC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.794A>G	1.37:g.36564488T>C	ENSP00000380901:p.Glu265Gly	61	0		65	4	NM_005202	0	0	0	0	0	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	37	CCDS403.1	.	.	.	.	.	.	.	.	.	.	T	6.827	0.521652	0.13005	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785	D;D;D	0.93906	-3.31;-3.31;-3.31	3.91	3.91	0.45181	.	0.198447	0.43747	D	0.000533	D	0.88742	0.6519	L	0.52206	1.635	0.46298	D	0.998977	P	0.44877	0.845	B	0.40329	0.326	D	0.84976	0.0885	10	0.18276	T	0.48	.	8.5265	0.33309	0.1725:0.0:0.0:0.8275	.	265	P25067	CO8A2_HUMAN	G	265;265;200	ENSP00000305913:E265G;ENSP00000380901:E265G;ENSP00000436433:E200G	ENSP00000305913:E265G	E	-	2	0	COL8A2	36337075	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	3.987000	0.56944	1.639000	0.50556	0.334000	0.21626	GAG	.		0.657	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
MACF1	23499	hgsc.bcm.edu	37	1	39908528	39908528	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:39908528C>G	ENST00000372915.3	+	77	19031	c.18944C>G	c.(18943-18945)tCa>tGa	p.S6315*	MACF1_ENST00000539005.1_Nonsense_Mutation_p.S4227*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.S6453*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.S4859*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.S6416*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.S4357*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.S4357*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.S4357*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6315					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCTGGGAGTCAGTGTTACAG	0.483																																					p.S4357X		.											.	MACF1-165	0			c.C13070G						.						63.0	54.0	57.0					1																	39908528		2203	4300	6503	SO:0001587	stop_gained	23499	exon75			GGGAGTCAGTGTT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18944C>G	1.37:g.39908528C>G	ENSP00000362006:p.Ser6315*	67	0		46	3	NM_012090	0	0	43	43	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	50	16.952701	0.99876	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.	.	.	5.82	5.82	0.92795	.	0.129756	0.35495	N	0.003165	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	13.3128	0.60390	0.0:0.9281:0.0:0.0719	.	.	.	.	X	4357;6315;4357;4357;4227;4859	.	ENSP00000289893:S4859X	S	+	2	0	MACF1	39681115	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.693000	0.47027	2.752000	0.94435	0.655000	0.94253	TCA	.		0.483	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
NPR1	4881	hgsc.bcm.edu	37	1	153651704	153651704	+	Silent	SNP	A	A	G	rs375325568	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:153651704A>G	ENST00000368680.3	+	1	592	c.120A>G	c.(118-120)gtA>gtG	p.V40V		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	40					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TAGCCGTGGTACTGCCGCTGG	0.741													A|||	5	0.000998403	0.0038	0.0	5008	,	,		13275	0.0		0.0	False		,,,				2504	0.0				p.V40V	Pancreas(141;1349 1870 15144 15830 40702)	.											.	NPR1-393	0			c.A120G						.	A		10,3462		0,10,1726	5.0	5.0	5.0		120	1.6	1.0	1		5	0,6794		0,0,3397	no	coding-synonymous	NPR1	NM_000906.3		0,10,5123	GG,GA,AA		0.0,0.288,0.0974		40/1062	153651704	10,10256	1736	3397	5133	SO:0001819	synonymous_variant	4881	exon1			CGTGGTACTGCCG	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.120A>G	1.37:g.153651704A>G		1	0		2	2	NM_000906	0	0	0	0	0	B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	ENST00000368680.3	37	CCDS1051.1																																																																																			.		0.741	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	176809321	176809321	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:176809321G>A	ENST00000367662.3	+	22	6379	c.5215G>A	c.(5215-5217)Gat>Aat	p.D1739N		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1739				D -> N (in Ref. 6; CAC11134). {ECO:0000305}.	bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTTCCAAGCAGATGGTTGGTG	0.507																																					p.D1739N		.											.	PAPPA2-548	0			c.G5215A						.						155.0	155.0	155.0					1																	176809321		2032	4183	6215	SO:0001583	missense	60676	exon22			CAAGCAGATGGTT	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5215G>A	1.37:g.176809321G>A	ENSP00000356634:p.Asp1739Asn	277	0		310	90	NM_020318	0	0	0	0	0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437435	0.96168	.	.	ENSG00000116183	ENST00000367662	D	0.91894	-2.93	5.44	5.44	0.79542	Notch domain (2);	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95767	0.8805	10	0.66056	D	0.02	-17.6405	18.8699	0.92309	0.0:0.0:1.0:0.0	.	1739	Q9BXP8	PAPP2_HUMAN	N	1739	ENSP00000356634:D1739N	ENSP00000356634:D1739N	D	+	1	0	PAPPA2	175075944	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.729000	0.91490	2.544000	0.85801	0.655000	0.94253	GAT	.		0.507	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
RYR2	6262	broad.mit.edu;bcgsc.ca	37	1	237604652	237604652	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:237604652G>C	ENST00000366574.2	+	13	1356	c.1039G>C	c.(1039-1041)Gat>Cat	p.D347H	RYR2_ENST00000360064.6_Missense_Mutation_p.D345H|RYR2_ENST00000542537.1_Missense_Mutation_p.D331H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	347					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAAGAAGTAGATGGCATGGG	0.388																																					p.D347H													.	RYR2-158	0			c.G1039C						.						152.0	147.0	149.0					1																	237604652		1865	4108	5973	SO:0001583	missense	6262	exon13			GAAGTAGATGGCA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1039G>C	1.37:g.237604652G>C	ENSP00000355533:p.Asp347His	112	0		133	5	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.599191	0.66332	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.86497	-2.13;-2.13;-2.13	5.39	5.39	0.77823	MIR motif (1);MIR (2);	0.076275	0.48767	D	0.000165	D	0.90587	0.7049	L	0.33485	1.01	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.91523	0.5236	10	0.87932	D	0	.	19.5142	0.95155	0.0:0.0:1.0:0.0	.	347	Q92736	RYR2_HUMAN	H	347;345;331	ENSP00000355533:D347H;ENSP00000353174:D345H;ENSP00000443798:D331H	ENSP00000353174:D345H	D	+	1	0	RYR2	235671275	1.000000	0.71417	0.892000	0.35008	0.325000	0.28411	9.800000	0.99124	2.679000	0.91253	0.655000	0.94253	GAT	.		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CDH23	64072	hgsc.bcm.edu	37	10	73454012	73454012	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr10:73454012C>G	ENST00000224721.6	+	20	2305	c.2300C>G	c.(2299-2301)gCc>gGc	p.A767G	CDH23_ENST00000299366.7_Missense_Mutation_p.A807G	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	762	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						ACTGGCATCGCCACCGTGAGT	0.642																																					p.A762G		.											.	CDH23-563	0			c.C2285G						.						47.0	58.0	54.0					10																	73454012		2119	4228	6347	SO:0001583	missense	64072	exon20			GCATCGCCACCGT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2300C>G	10.37:g.73454012C>G	ENSP00000224721:p.Ala767Gly	34	0		32	2	NM_022124	0	0	0	0	0	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	C	26.2	4.709952	0.89018	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.55	4.64	0.57946	Cadherin (4);Cadherin-like (1);	0.139502	0.47093	D	0.000241	T	0.65026	0.2652	L	0.48642	1.525	0.80722	D	1	B;P;P	0.47350	0.349;0.747;0.894	B;P;P	0.56398	0.257;0.477;0.797	T	0.63559	-0.6610	9	0.37606	T	0.19	.	14.7666	0.69642	0.0:0.9301:0.0:0.0699	.	762;765;762	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	G	767;762;762;765;765;279	.	ENSP00000224721:A767G	A	+	2	0	CDH23	73124018	1.000000	0.71417	0.998000	0.56505	0.806000	0.45545	4.951000	0.63610	1.339000	0.45563	0.643000	0.83706	GCC	.		0.642	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
PAPSS2	9060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	89501012	89501012	+	Silent	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr10:89501012C>T	ENST00000361175.4	+	9	1461	c.1092C>T	c.(1090-1092)gaC>gaT	p.D364D	PAPSS2_ENST00000456849.1_Silent_p.D369D|PAPSS2_ENST00000427144.2_Silent_p.D368D	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	364					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		AAAGTGGGGACTGGCTGGTTG	0.403																																					p.D369D		.											.	PAPSS2-493	0			c.C1107T						.						145.0	129.0	134.0					10																	89501012		2203	4300	6503	SO:0001819	synonymous_variant	9060	exon10			TGGGGACTGGCTG	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1092C>T	10.37:g.89501012C>T		155	1		119	34	NM_001015880	0	0	4	16	12	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Silent	SNP	ENST00000361175.4	37	CCDS7385.1																																																																																			.		0.403	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
ANO5	203859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	22294380	22294380	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:22294380C>A	ENST00000324559.8	+	19	2397	c.2080C>A	c.(2080-2082)Cct>Act	p.P694T	ANO5_ENST00000532043.1_3'UTR	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	694					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.P694fs*7(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCTTTGGCTCCTCTTCTTGC	0.378																																					p.P694T		.											.	ANO5-515	1	Deletion - Frameshift(1)	breast(1)	c.C2080A						.						150.0	131.0	138.0					11																	22294380		2203	4300	6503	SO:0001583	missense	203859	exon19			TTGGCTCCTCTTC	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.2080C>A	11.37:g.22294380C>A	ENSP00000315371:p.Pro694Thr	98	1		98	29	NM_213599	0	0	0	0	0		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.087948	0.76642	.	.	ENSG00000171714	ENST00000324559	T	0.68025	-0.3	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	H	0.96748	3.875	0.80722	D	1	B	0.22276	0.067	B	0.39771	0.309	D	0.85101	0.0957	10	0.87932	D	0	.	19.9071	0.97012	0.0:1.0:0.0:0.0	.	694	Q75V66	ANO5_HUMAN	T	694	ENSP00000315371:P694T	ENSP00000315371:P694T	P	+	1	0	ANO5	22250956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.767000	0.85331	2.776000	0.95493	0.651000	0.88453	CCT	.		0.378	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
HSD17B12	51144	hgsc.bcm.edu	37	11	43837920	43837920	+	Silent	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:43837920T>C	ENST00000278353.4	+	6	599	c.480T>C	c.(478-480)atT>atC	p.I160I	HSD17B12_ENST00000529261.1_3'UTR	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	160					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						TGATAAATATTAATATTCTTT	0.289																																					p.I160I	Ovarian(58;548 1143 13948 16572 34258)	.											.	HSD17B12-90	0			c.T480C						.						44.0	47.0	46.0					11																	43837920		2198	4291	6489	SO:0001819	synonymous_variant	51144	exon6			AAATATTAATATT	AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.480T>C	11.37:g.43837920T>C		16	0		40	3	NM_016142	0	0	57	57	0	A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Silent	SNP	ENST00000278353.4	37	CCDS7905.1																																																																																			.		0.289	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389594.1		
RCOR2	283248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63679913	63679913	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:63679913C>A	ENST00000301459.4	-	11	1508	c.1121G>T	c.(1120-1122)cGg>cTg	p.R374L	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	374	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						GAAGCGGCGCCGGTAGCTCAC	0.587																																					p.R374L		.											.	RCOR2-92	0			c.G1121T						.						64.0	76.0	72.0					11																	63679913		2201	4297	6498	SO:0001583	missense	283248	exon11			CGGCGCCGGTAGC	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.1121G>T	11.37:g.63679913C>A	ENSP00000301459:p.Arg374Leu	188	0		180	55	NM_173587	0	0	0	0	0	Q96FP3	Missense_Mutation	SNP	ENST00000301459.4	37	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040706	0.93685	.	.	ENSG00000167771	ENST00000301459	T	0.37411	1.2	4.55	4.55	0.56014	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.89287	3.02	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.74237	-0.3730	10	0.87932	D	0	.	16.6282	0.84992	0.0:1.0:0.0:0.0	.	374	Q8IZ40	RCOR2_HUMAN	L	374	ENSP00000301459:R374L	ENSP00000301459:R374L	R	-	2	0	RCOR2	63436489	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.314000	0.78988	2.536000	0.85505	0.561000	0.74099	CGG	.		0.587	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
EHBP1L1	254102	hgsc.bcm.edu	37	11	65346571	65346571	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:65346571G>C	ENST00000309295.4	+	2	392	c.127G>C	c.(127-129)Gta>Cta	p.V43L		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	43						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GCTGGTGGTGGTATGGACCCG	0.647																																					p.V43L		.											.	EHBP1L1-69	0			c.G127C						.						19.0	20.0	20.0					11																	65346571		1961	4141	6102	SO:0001583	missense	254102	exon2			GTGGTGGTATGGA	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.127G>C	11.37:g.65346571G>C	ENSP00000312671:p.Val43Leu	17	0		19	2	NM_001099409	0	0	13	13	0	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	G	32	5.108044	0.94292	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.45276	0.9;0.9	5.05	4.13	0.48395	.	0.000000	0.64402	D	0.000018	T	0.56031	0.1958	M	0.63428	1.95	0.80722	D	1	D	0.54772	0.968	D	0.64321	0.924	T	0.58896	-0.7555	10	0.87932	D	0	.	9.9196	0.41457	0.0986:0.0:0.9014:0.0	.	43	Q8N3D4	EH1L1_HUMAN	L	43	ENSP00000312671:V43L;ENSP00000431996:V43L	ENSP00000312671:V43L	V	+	1	0	EHBP1L1	65103147	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.685000	0.61693	2.345000	0.79718	0.561000	0.74099	GTA	.		0.647	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
RBM4B	83759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66444485	66444485	+	Silent	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:66444485G>A	ENST00000525754.1	-	1	734	c.66C>T	c.(64-66)ttC>ttT	p.F22F	RBM4B_ENST00000524637.1_Silent_p.F22F|RBM4B_ENST00000531969.1_Silent_p.F22F|RBM4B_ENST00000531036.2_Silent_p.F22F|RBM4B_ENST00000310046.4_Silent_p.F22F			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	22	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						CATACTGCTCGAAGAGTGAGC	0.512																																					p.F22F		.											.	RBM4B-90	0			c.C66T						.						91.0	91.0	91.0					11																	66444485		2200	4295	6495	SO:0001819	synonymous_variant	83759	exon2			CTGCTCGAAGAGT	AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.66C>T	11.37:g.66444485G>A		259	0		235	52	NM_031492	0	0	98	98	0	B3KT83	Silent	SNP	ENST00000525754.1	37	CCDS8149.1																																																																																			.		0.512	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393851.1	NM_031492	
SLC36A4	120103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	92917687	92917687	+	Splice_Site	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:92917687C>A	ENST00000326402.4	-	3	310		c.e3-1		SLC36A4_ENST00000529184.1_Splice_Site	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4						L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTACAAATCTGAAAAGTAA	0.313																																					.		.											.	SLC36A4-93	0			c.180-1G>T						.						99.0	105.0	103.0					11																	92917687		2201	4297	6498	SO:0001630	splice_region_variant	120103	exon4			ACAAATCTGAAAA	AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.180-1G>T	11.37:g.92917687C>A		135	0		135	50	NM_152313	0	0	0	0	0	Q86X30|Q8IVM5|Q8N8S6	Splice_Site	SNP	ENST00000326402.4	37	CCDS8291.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172159	0.78452	.	.	ENSG00000180773	ENST00000326402	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2544	0.98414	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC36A4	92557335	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.132000	0.71676	2.885000	0.99019	0.655000	0.94253	.	.		0.313	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2		Intron
TEP1	7011	broad.mit.edu;bcgsc.ca	37	14	20840924	20840924	+	Silent	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr14:20840924T>C	ENST00000262715.5	-	49	7084	c.7044A>G	c.(7042-7044)aaA>aaG	p.K2348K	TEP1_ENST00000556935.1_Silent_p.K2240K|TEP1_ENST00000545983.1_Intron	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2348					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCTTCCGCAGTTTCACTTGCC	0.507																																					p.K2348K													.	TEP1-95	0			c.A7044G						.						135.0	125.0	129.0					14																	20840924		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon49			CCGCAGTTTCACT		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.7044A>G	14.37:g.20840924T>C		229	1		186	7	NM_007110	0	0	14	15	1	A0AUV9	Silent	SNP	ENST00000262715.5	37	CCDS9548.1																																																																																			.		0.507	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
SLC9A3R2	9351	hgsc.bcm.edu	37	16	2077090	2077090	+	Missense_Mutation	SNP	G	G	C	rs73496087	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:2077090G>C	ENST00000424542.2	+	1	222	c.84G>C	c.(82-84)gaG>gaC	p.E28D	SLC9A3R2_ENST00000432365.2_Missense_Mutation_p.E28D|SLC9A3R2_ENST00000563587.1_5'Flank	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2	28	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						TGCACGGCGAGAAGGGCCGCC	0.781													G|||	174	0.0347444	0.1233	0.013	5008	,	,		5109	0.0		0.002	False		,,,				2504	0.0				p.E28D	Ovarian(69;105 1552 17724 23473)	.											.	SLC9A3R2-23	0			c.G84C						.	G	ASP/GLU,ASP/GLU	92,1620		0,92,764	1.0	1.0	1.0		84,84	2.6	1.0	16	dbSNP_131	1	1,4161		0,1,2080	no	missense,missense	SLC9A3R2	NM_001130012.1,NM_004785.4	45,45	0,93,2844	CC,CG,GG		0.024,5.3738,1.5832	probably-damaging,probably-damaging	28/338,28/327	2077090	93,5781	856	2081	2937	SO:0001583	missense	9351	exon1			CGGCGAGAAGGGC	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956	ENST00000424542.2:c.84G>C	16.37:g.2077090G>C	ENSP00000408005:p.Glu28Asp	1	1		4	4	NM_004785	0	0	0	0	0	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Missense_Mutation	SNP	ENST00000424542.2	37	CCDS45382.1	82	0.037545787545787544	71	0.1443089430894309	7	0.019337016574585635	4	0.006993006993006993	0	0.0	G	26.4	4.733652	0.89482	0.053738	2.4E-4	ENSG00000065054	ENST00000424542;ENST00000432365	T;T	0.51071	0.72;0.72	2.63	2.63	0.31362	PDZ/DHR/GLGF (4);	0.000000	0.85682	U	0.000000	T	0.00468	0.0015	N	0.16602	0.42	0.09310	P	1.0	D;D	0.89917	0.972;1.0	D;D	0.91635	0.912;0.999	T	0.15838	-1.0423	9	0.44086	T	0.13	-11.9793	12.2597	0.54642	0.0:0.0:1.0:0.0	.	28;28	D3DU85;Q15599	.;NHRF2_HUMAN	D	28	ENSP00000408005:E28D;ENSP00000402857:E28D	ENSP00000408005:E28D	E	+	3	2	SLC9A3R2	2017091	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	1.478000	0.35442	1.497000	0.48584	0.298000	0.19748	GAG	G|0.962;C|0.038		0.781	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434448.1		
ITGAL	3683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30490672	30490672	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:30490672G>A	ENST00000356798.6	+	6	646	c.466G>A	c.(466-468)Gac>Aac	p.D156N	ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000433423.2_Intron|RP11-297C4.3_ENST00000562525.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000454514.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	156	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGGCAACGTAGACCTGGTATT	0.478																																					p.D156N	NSCLC(110;1462 1641 3311 33990 49495)	.											.	ITGAL-994	0			c.G466A						.						120.0	108.0	112.0					16																	30490672		2197	4300	6497	SO:0001583	missense	3683	exon6			AACGTAGACCTGG		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.466G>A	16.37:g.30490672G>A	ENSP00000349252:p.Asp156Asn	104	0		101	43	NM_002209	0	0	2	2	0	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796940	0.90453	.	.	ENSG00000005844	ENST00000356798	D	0.92149	-2.98	5.98	5.98	0.97165	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000021	D	0.94434	0.8209	M	0.73430	2.235	0.80722	D	1	P	0.44006	0.824	P	0.51193	0.662	D	0.94464	0.7679	10	0.72032	D	0.01	.	17.3632	0.87357	0.0:0.0:1.0:0.0	.	156	P20701	ITAL_HUMAN	N	156	ENSP00000349252:D156N	ENSP00000349252:D156N	D	+	1	0	ITGAL	30398173	1.000000	0.71417	0.978000	0.43139	0.941000	0.58515	4.655000	0.61476	2.838000	0.97847	0.514000	0.50259	GAC	.		0.478	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
MMP15	4324	hgsc.bcm.edu	37	16	58079306	58079306	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:58079306C>T	ENST00000219271.3	+	10	2751	c.1966C>T	c.(1966-1968)Cgt>Tgt	p.R656C		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	656					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	GGGTGCGCCACGTGTCCTGCT	0.647																																					p.R656C		.											.	MMP15-713	0			c.C1966T						.						101.0	101.0	101.0					16																	58079306		2190	4290	6480	SO:0001583	missense	4324	exon10			GCGCCACGTGTCC	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1966C>T	16.37:g.58079306C>T	ENSP00000219271:p.Arg656Cys	2	1		10	7	NM_002428	0	0	13	21	8	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.621358	0.28889	.	.	ENSG00000102996	ENST00000219271	T	0.41065	1.01	5.08	2.89	0.33648	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.219462	0.42294	D	0.000730	T	0.58409	0.2120	M	0.61703	1.905	0.30757	N	0.744488	D	0.89917	1.0	D	0.77557	0.99	T	0.62760	-0.6786	10	0.87932	D	0	.	11.7648	0.51924	0.4094:0.5906:0.0:0.0	.	656	P51511	MMP15_HUMAN	C	656	ENSP00000219271:R656C	ENSP00000219271:R656C	R	+	1	0	MMP15	56636807	0.077000	0.21312	0.513000	0.27749	0.005000	0.04900	1.011000	0.29911	1.139000	0.42245	-0.466000	0.05196	CGT	.		0.647	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
KRT10	3858	hgsc.bcm.edu	37	17	38975327	38975327	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr17:38975327T>G	ENST00000269576.5	-	7	1469	c.1460A>C	c.(1459-1461)cAc>cCc	p.H487P	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	487	Gly-rich.|Ser-rich.|Tail.		H -> Y (in dbSNP:rs17855579). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2448602, ECO:0000269|PubMed:2459124, ECO:0000269|PubMed:2464696}.	Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				gccgccgccgtggccgccgcc	0.786																																					p.H487P		.											.	KRT10-90	0			c.A1460C						.						1.0	2.0	1.0					17																	38975327		484	1205	1689	SO:0001583	missense	3858	exon7			CCGCCGTGGCCGC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1460A>C	17.37:g.38975327T>G	ENSP00000269576:p.His487Pro	1	1		9	5	NM_000421	0	0	0	0	0	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	37	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.647306	0.47258	.	.	ENSG00000186395	ENST00000269576	D	0.91237	-2.81	4.29	1.08	0.20341	.	1.067520	0.07539	N	0.913467	T	0.78966	0.4367	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.64939	-0.6289	10	0.30078	T	0.28	.	6.1771	0.20449	0.0:0.2066:0.4458:0.3476	.	487	P13645	K1C10_HUMAN	P	487	ENSP00000269576:H487P	ENSP00000269576:H487P	H	-	2	0	KRT10	36228853	0.000000	0.05858	0.085000	0.20634	0.080000	0.17528	-3.816000	0.00359	0.303000	0.22785	-0.263000	0.10527	CAC	.		0.786	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRTAP4-6	81871	broad.mit.edu	37	17	39296626	39296626	+	Silent	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr17:39296626G>A	ENST00000345847.4	-	1	113	c.114C>T	c.(112-114)ccC>ccT	p.P38P		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	38	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						CACAGCAGCTGGGGCGGCAGC	0.667																																					p.P38P													.	.	0			c.C114T						.																																			SO:0001819	synonymous_variant	81871	exon1			GCAGCTGGGGCGG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.114C>T	17.37:g.39296626G>A		139	1		210	5	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.667	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
C17orf82	388407	hgsc.bcm.edu	37	17	59489911	59489911	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr17:59489911G>C	ENST00000335108.2	+	1	800	c.575G>C	c.(574-576)gGc>gCc	p.G192A	RP11-332H18.4_ENST00000592009.1_RNA	NM_203425.1	NP_982249	Q86X59	CQ082_HUMAN	chromosome 17 open reading frame 82	192										cervix(1)|lung(1)	2						CCACGAGATGGCGCTGCAGGC	0.751																																					p.G192A		.											.	C17orf82-226	0			c.G575C						.																																			SO:0001583	missense	388407	exon1			GAGATGGCGCTGC	BC046200	CCDS11628.1	17q23.2	2012-10-23			ENSG00000187013	ENSG00000187013			32699	protein-coding gene	gene with protein product							Standard	NM_203425		Approved		uc002izh.1	Q86X59	OTTHUMG00000180077	ENST00000335108.2:c.575G>C	17.37:g.59489911G>C	ENSP00000335229:p.Gly192Ala	1	1		13	4	NM_203425	0	0	0	0	0		Missense_Mutation	SNP	ENST00000335108.2	37	CCDS11628.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718970	0.48622	.	.	ENSG00000187013	ENST00000335108	T	0.58358	0.34	4.29	2.08	0.27032	.	.	.	.	.	T	0.45736	0.1357	N	0.08118	0	0.21553	N	0.999642	D	0.76494	0.999	D	0.71414	0.973	T	0.22591	-1.0212	9	0.87932	D	0	.	3.225	0.06729	0.2203:0.0:0.57:0.2097	.	192	Q86X59	CQ082_HUMAN	A	192	ENSP00000335229:G192A	ENSP00000335229:G192A	G	+	2	0	C17orf82	56844693	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	1.447000	0.35101	1.101000	0.41535	0.448000	0.29417	GGC	.		0.751	C17orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449646.1	NM_203425	
LPIN2	9663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2951317	2951317	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr18:2951317G>T	ENST00000261596.4	-	4	564	c.326C>A	c.(325-327)cCt>cAt	p.P109H	RP11-737O24.2_ENST00000584431.1_RNA|RP11-737O24.2_ENST00000581488.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	109					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		ATCTTCAGTAGGAATTGGTGA	0.418																																					p.P109H		.											.	LPIN2-227	0			c.C326A						.						74.0	73.0	74.0					18																	2951317		2203	4300	6503	SO:0001583	missense	9663	exon4			TCAGTAGGAATTG	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.326C>A	18.37:g.2951317G>T	ENSP00000261596:p.Pro109His	90	1		88	10	NM_014646	0	0	19	28	9	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704863	0.88924	.	.	ENSG00000101577	ENST00000261596;ENST00000455369	T	0.77098	-1.07	5.92	5.92	0.95590	Lipin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89743	0.6803	M	0.87900	2.915	0.80722	D	1	D	0.69078	0.997	D	0.73708	0.981	D	0.87681	0.2547	10	0.33141	T	0.24	-13.5139	20.3206	0.98668	0.0:0.0:1.0:0.0	.	109	Q92539	LPIN2_HUMAN	H	109	ENSP00000261596:P109H	ENSP00000261596:P109H	P	-	2	0	LPIN2	2941317	1.000000	0.71417	0.978000	0.43139	0.966000	0.64601	6.527000	0.73803	2.809000	0.96659	0.655000	0.94253	CCT	.		0.418	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
JSRP1	126306	hgsc.bcm.edu	37	19	2253780	2253780	+	Missense_Mutation	SNP	A	A	G	rs10426549	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:2253780A>G	ENST00000300961.6	-	5	339	c.275T>C	c.(274-276)gTc>gCc	p.V92A	JSRP1_ENST00000586471.2_Missense_Mutation_p.V92A	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	92			V -> A (in dbSNP:rs10426549).		protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCGCGGGGACGCTCCGAGG	0.761													G|||	1026	0.204872	0.5219	0.072	5008	,	,		11441	0.0734		0.0845	False		,,,				2504	0.1299				p.V92A		.											.	JSRP1-91	0			c.T275C						.	G	ALA/VAL	495,1775		30,435,670	2.0	4.0	3.0		275	0.1	0.4	19	dbSNP_119	3	248,4804		5,238,2283	no	missense	JSRP1	NM_144616.3	64	35,673,2953	GG,GA,AA		4.9089,21.8062,10.1475	benign	92/332	2253780	743,6579	1135	2526	3661	SO:0001583	missense	126306	exon5			GCGGGGACGCTCC	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.275T>C	19.37:g.2253780A>G	ENSP00000300961:p.Val92Ala	0	0		2	2	NM_144616	0	0	0	0	0		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	362	0.16575091575091574	231	0.4695121951219512	21	0.058011049723756904	48	0.08391608391608392	62	0.08179419525065963	a	0.017	-1.492342	0.01009	0.218062	0.049089	ENSG00000167476	ENST00000300961	T	0.18657	2.2	3.74	0.0998	0.14504	.	1.682840	0.03947	N	0.287865	T	0.00012	0.0000	N	0.04508	-0.205	0.46927	P	7.479999999999709E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.47560	-0.9108	9	0.18710	T	0.47	0.0096	4.6604	0.12639	0.3093:0.1591:0.5316:0.0	rs10426549;rs58800051	92	Q96MG2	JSPR1_HUMAN	A	92	ENSP00000300961:V92A	ENSP00000300961:V92A	V	-	2	0	JSRP1	2204780	0.001000	0.12720	0.427000	0.26684	0.036000	0.12997	-0.186000	0.09670	-0.634000	0.05538	-0.930000	0.02707	GTC	A|0.832;G|0.168		0.761	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
MRPL54	116541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3762750	3762750	+	Missense_Mutation	SNP	G	G	T	rs200308520		TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:3762750G>T	ENST00000330133.4	+	1	89	c.52G>T	c.(52-54)Gcc>Tcc	p.A18S	APBA3_ENST00000316757.3_5'Flank	NM_172251.2	NP_758455.1	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54	18						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCTGGGGGGCCTGGGAGCT	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		14484	0.001		0.0	False		,,,				2504	0.0				p.A18S		.											.	MRPL54-90	0			c.G52T						.																																			SO:0001583	missense	116541	exon1			TGGGGGGCCTGGG		CCDS12111.1	19p13.3	2012-11-14			ENSG00000183617	ENSG00000183617		"""Mitochondrial ribosomal proteins / large subunits"""	16685	protein-coding gene	gene with protein product		611858				11551941	Standard	NM_172251		Approved		uc002lyq.4	Q6P161	OTTHUMG00000180873	ENST00000330133.4:c.52G>T	19.37:g.3762750G>T	ENSP00000331849:p.Ala18Ser	138	0		140	42	NM_172251	0	0	40	65	25		Missense_Mutation	SNP	ENST00000330133.4	37	CCDS12111.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.41	1.629158	0.28978	.	.	ENSG00000183617	ENST00000330133	.	.	.	5.57	-7.27	0.01461	.	1.148870	0.06434	N	0.724730	T	0.15176	0.0366	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27502	-1.0072	9	0.09590	T	0.72	-1.6956	1.7102	0.02891	0.2105:0.3326:0.273:0.184	.	18	Q6P161	RM54_HUMAN	S	18	.	ENSP00000331849:A18S	A	+	1	0	MRPL54	3713750	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.357000	0.02607	-1.580000	0.01644	-1.134000	0.01955	GCC	G|0.999;T|0.000		0.617	MRPL54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453443.1	NM_172251	
SHD	56961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4290585	4290585	+	Silent	SNP	C	C	T	rs111268424		TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:4290585C>T	ENST00000543264.2	+	6	2441	c.978C>T	c.(976-978)gcC>gcT	p.A326A	SHD_ENST00000599689.1_Silent_p.A286A	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	326	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCAGGGTGCCGAGCATCTGG	0.657																																					p.A326A		.											.	SHD-90	0			c.C978T						.						59.0	53.0	55.0					19																	4290585		2203	4300	6503	SO:0001819	synonymous_variant	56961	exon6			GGGTGCCGAGCAT	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.978C>T	19.37:g.4290585C>T		105	0		107	42	NM_020209	0	0	0	0	0	Q96NC2	Silent	SNP	ENST00000543264.2	37	CCDS12125.1																																																																																			C|0.500;T|0.500		0.657	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
SPTBN4	57731	hgsc.bcm.edu	37	19	41025619	41025619	+	Missense_Mutation	SNP	C	C	G	rs529933555	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:41025619C>G	ENST00000352632.3	+	16	3301	c.3215C>G	c.(3214-3216)gCg>gGg	p.A1072G	SPTBN4_ENST00000344104.3_Missense_Mutation_p.A1072G|SPTBN4_ENST00000595535.1_Missense_Mutation_p.A1072G|SPTBN4_ENST00000598249.1_Missense_Mutation_p.A1072G|SPTBN4_ENST00000338932.3_Missense_Mutation_p.A1072G			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1072					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGTGGGGCGCGCTAGCTAGC	0.746													C|||	9	0.00179712	0.0045	0.0029	5008	,	,		10299	0.0		0.001	False		,,,				2504	0.0				p.A1072G		.											.	SPTBN4-94	0			c.C3215G						.																																			SO:0001583	missense	57731	exon16			GGGGCGCGCTAGC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3215C>G	19.37:g.41025619C>G	ENSP00000263373:p.Ala1072Gly	0	0		2	2	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	5.929	0.355426	0.11239	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.78246	-1.02;1.3;-1.16	4.11	1.84	0.25277	.	0.292311	0.27554	N	0.018848	T	0.73079	0.3541	L	0.34521	1.04	0.52099	D	0.999943	P;B	0.47545	0.897;0.01	P;B	0.51701	0.677;0.006	T	0.66724	-0.5851	10	0.27785	T	0.31	.	11.1789	0.48616	0.3346:0.6654:0.0:0.0	.	1072;1072	Q9H254;Q71S06	SPTN4_HUMAN;.	G	1072	ENSP00000263373:A1072G;ENSP00000340345:A1072G;ENSP00000340741:A1072G	ENSP00000340345:A1072G	A	+	2	0	SPTBN4	45717459	0.501000	0.26099	0.095000	0.20976	0.212000	0.24457	1.342000	0.33919	0.328000	0.23435	0.462000	0.41574	GCG	.		0.746	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		0	0		6	6	NM_000836	0	0	0	0	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
GREB1	9687	broad.mit.edu;bcgsc.ca	37	2	11716612	11716612	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr2:11716612T>A	ENST00000381486.2	+	5	888	c.588T>A	c.(586-588)aaT>aaA	p.N196K	GREB1_ENST00000234142.5_Missense_Mutation_p.N196K|GREB1_ENST00000389825.3_Missense_Mutation_p.N86K|GREB1_ENST00000381483.2_Missense_Mutation_p.N196K|GREB1_ENST00000263834.5_Missense_Mutation_p.N196K	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	196						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGGTCCGTAATGCACAAGGGA	0.478																																					p.N196K	Ovarian(39;850 945 2785 23371 33093)												.	GREB1-91	0			c.T588A						.						126.0	120.0	122.0					2																	11716612		2203	4300	6503	SO:0001583	missense	9687	exon5			CCGTAATGCACAA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.588T>A	2.37:g.11716612T>A	ENSP00000370896:p.Asn196Lys	160	0		182	7	NM_148903	0	0	0	0	0	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.520760	0.64747	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;D;D;D;T	0.82167	3.02;-1.58;-1.58;-1.58;3.02	5.08	-3.82	0.04281	.	0.000000	0.85682	D	0.000000	D	0.84428	0.5470	M	0.66939	2.045	0.58432	D	0.99999	P;D;P;D	0.54772	0.94;0.968;0.897;0.959	P;P;P;P	0.54889	0.625;0.763;0.465;0.526	T	0.82952	-0.0202	10	0.72032	D	0.01	-8.2171	13.0658	0.59032	0.0:0.4458:0.0:0.5542	.	196;86;196;196	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	K	196;196;86;196;196	ENSP00000370896:N196K;ENSP00000263834:N196K;ENSP00000374475:N86K;ENSP00000370892:N196K;ENSP00000234142:N196K	ENSP00000234142:N196K	N	+	3	2	GREB1	11634063	0.667000	0.27484	0.014000	0.15608	0.860000	0.49131	-0.199000	0.09491	-1.399000	0.02063	-1.139000	0.01908	AAT	.		0.478	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
TP53RK	112858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	45315804	45315804	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr20:45315804T>C	ENST00000372102.3	-	2	380	c.355A>G	c.(355-357)Aag>Gag	p.K119E	RP1-28H20.3_ENST00000606362.1_lincRNA			Q96S44	PRPK_HUMAN	TP53 regulating kinase	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				lipopolysaccharide biosynthetic process (GO:0009103)|protein phosphorylation (GO:0006468)|tRNA processing (GO:0008033)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|large_intestine(1)|lung(4)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				CACTGAGCCTTCAATTTCTTC	0.418																																					p.E117G		.											.	TP53RK-333	0			c.A350G						.						151.0	172.0	165.0					20																	45315804		2202	4300	6502	SO:0001583	missense	112858	exon2			GAGCCTTCAATTT		CCDS13401.1	20q13.2	2014-05-14	2004-05-10	2004-05-12	ENSG00000172315	ENSG00000172315			16197	protein-coding gene	gene with protein product		608679	"""chromosome 20 open reading frame 64"""	C20orf64		11546806, 12914926	Standard	NM_033550		Approved	dJ101A2.2, prpk, Nori-2p, BUD32	uc002xsk.3	Q96S44	OTTHUMG00000085887	ENST00000372102.3:c.355A>G	20.37:g.45315804T>C	ENSP00000361174:p.Lys119Glu	408	1		360	116	NM_033550	0	0	7	17	10	B3KU44|Q3T977|Q5JZ01|Q6NZ60|Q96FM7|Q9NQE6	Missense_Mutation	SNP	ENST00000372102.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.74|11.74	1.727453|1.727453	0.30593|0.30593	.|.	.|.	ENSG00000172315|ENSG00000172315	ENST00000372114|ENST00000372102	T|T	0.12361|0.47869	2.69|0.83	5.38|5.38	3.04|3.04	0.35103|0.35103	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.167964|.	0.52532|.	D|.	0.000073|.	T|T	0.33731|0.33731	0.0873|0.0873	L|L	0.39898|0.39898	1.24|1.24	0.23677|0.23677	N|N	0.997139|0.997139	P|B	0.49961|0.31548	0.93|0.328	P|B	0.53224|0.34242	0.721|0.178	T|T	0.25641|0.25641	-1.0126|-1.0126	10|9	0.42905|0.07644	T|T	0.14|0.81	-10.1094|-10.1094	6.7483|6.7483	0.23474|0.23474	0.1725:0.0:0.2393:0.5882|0.1725:0.0:0.2393:0.5882	.|.	117|119	Q96S44|Q5JZ02	PRPK_HUMAN|.	G|E	117|119	ENSP00000361186:E117G|ENSP00000361174:K119E	ENSP00000361186:E117G|ENSP00000361174:K119E	E|K	-|-	2|1	0|0	TP53RK|TP53RK	44749211|44749211	0.999000|0.999000	0.42202|0.42202	0.971000|0.971000	0.41717|0.41717	0.502000|0.502000	0.33828|0.33828	1.944000|1.944000	0.40263|0.40263	0.449000|0.449000	0.26747|0.26747	-0.313000|-0.313000	0.08912|0.08912	GAA|AAG	.		0.418	TP53RK-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000193688.1	NM_033550	
EVA1C	59271	hgsc.bcm.edu	37	21	33785313	33785313	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr21:33785313A>G	ENST00000300255.2	+	1	625	c.152A>G	c.(151-153)gAc>gGc	p.D51G	EVA1C_ENST00000382699.3_Missense_Mutation_p.D51G|EVA1C_ENST00000401402.3_Missense_Mutation_p.D51G	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	51						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										GCGCTCACCGACTTCTCTGGT	0.692																																					p.D51G		.											.	.	0			c.A152G						.						17.0	17.0	17.0					21																	33785313		2202	4299	6501	SO:0001583	missense	59271	exon1			TCACCGACTTCTC	AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.152A>G	21.37:g.33785313A>G	ENSP00000300255:p.Asp51Gly	28	0		31	2	NM_058187	0	0	1	1	0	A6ND58|Q8IXZ0	Missense_Mutation	SNP	ENST00000300255.2	37	CCDS13614.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824968	0.50739	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699	T;T;T	0.10099	2.91;3.01;2.92	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.11793	0.0287	L	0.59436	1.845	0.32695	N	0.513686	B;B;B	0.26445	0.01;0.149;0.114	B;B;B	0.24701	0.012;0.048;0.055	T	0.05068	-1.0908	10	0.37606	T	0.19	-13.1462	9.541	0.39251	1.0:0.0:0.0:0.0	.	51;51;51	A6ND58;P58658;B5MC74	.;CU063_HUMAN;.	G	51	ENSP00000300255:D51G;ENSP00000384594:D51G;ENSP00000372146:D51G	ENSP00000300255:D51G	D	+	2	0	C21orf63	32707184	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.857000	0.55972	1.735000	0.51646	0.528000	0.53228	GAC	.		0.692	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187	
KDELR3	11015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38877225	38877225	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr22:38877225G>A	ENST00000216014.4	+	4	532	c.360G>A	c.(358-360)tgG>tgA	p.W120*	KDELR3_ENST00000409006.3_Nonsense_Mutation_p.W120*|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	120					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					AGATCCTCTGGACTTTCTCTA	0.448																																					p.W120X	Ovarian(11;103 529 24120 28493 32980)	.											.	KDELR3-92	0			c.G360A						.						173.0	182.0	179.0					22																	38877225		2203	4300	6503	SO:0001587	stop_gained	11015	exon4			CCTCTGGACTTTC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.360G>A	22.37:g.38877225G>A	ENSP00000216014:p.Trp120*	285	0		282	79	NM_016657	0	0	0	0	0	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Nonsense_Mutation	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	G	35	5.560833	0.96527	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4255	0.90607	0.0:0.0:1.0:0.0	.	.	.	.	X	120	.	ENSP00000216014:W120X	W	+	3	0	KDELR3	37207171	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.595000	0.87683	0.650000	0.86243	TGG	.		0.448	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
GRM2	2912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	51750001	51750001	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:51750001C>T	ENST00000395052.3	+	4	2446	c.2212C>T	c.(2212-2214)Ctc>Ttc	p.L738F	GRM2_ENST00000442933.2_Intron|GRM2_ENST00000475478.1_3'UTR	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	738					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAATGTGCTCCTCATCGCGCT	0.577																																					p.L738F		.											.	GRM2-522	0			c.C2212T						.						120.0	94.0	103.0					3																	51750001		2203	4300	6503	SO:0001583	missense	2912	exon4			GTGCTCCTCATCG	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2212C>T	3.37:g.51750001C>T	ENSP00000378492:p.Leu738Phe	133	0		104	31	NM_000839	0	0	0	0	0	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937162	0.73557	.	.	ENSG00000164082	ENST00000395052	D	0.96365	-3.99	5.14	5.14	0.70334	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98604	0.9533	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98917	1.0782	10	0.87932	D	0	.	10.6161	0.45451	0.0:0.8753:0.0:0.1247	.	738	Q14416	GRM2_HUMAN	F	738	ENSP00000378492:L738F	ENSP00000378492:L738F	L	+	1	0	GRM2	51725041	1.000000	0.71417	0.998000	0.56505	0.864000	0.49448	5.989000	0.70587	2.567000	0.86603	0.549000	0.68633	CTC	.		0.577	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
PBRM1	55193	hgsc.bcm.edu	37	3	52678740	52678740	+	Silent	SNP	A	A	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:52678740A>G	ENST00000296302.7	-	8	880	c.879T>C	c.(877-879)gcT>gcC	p.A293A	PBRM1_ENST00000409057.1_Silent_p.A293A|PBRM1_ENST00000409767.1_Silent_p.A293A|PBRM1_ENST00000410007.1_Silent_p.A293A|PBRM1_ENST00000394830.3_Silent_p.A293A|PBRM1_ENST00000356770.4_Silent_p.A293A|PBRM1_ENST00000337303.4_Silent_p.A293A|PBRM1_ENST00000409114.3_Silent_p.A293A			Q86U86	PB1_HUMAN	polybromo 1	293					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GACTTGACTTAGCCATTTCAT	0.383			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.A293A		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1-575	0			c.T879C						.						113.0	98.0	103.0					3																	52678740		2202	4300	6502	SO:0001819	synonymous_variant	55193	exon9			TGACTTAGCCATT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.879T>C	3.37:g.52678740A>G		25	0		27	2	NM_018313	0	0	4	4	0	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	ENST00000296302.7	37																																																																																				.		0.383	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
LMOD3	56203	hgsc.bcm.edu	37	3	69169080	69169080	+	Silent	SNP	T	T	C	rs111848977	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:69169080T>C	ENST00000420581.2	-	2	605	c.426A>G	c.(424-426)gaA>gaG	p.E142E	LMOD3_ENST00000475434.1_Silent_p.E142E|LMOD3_ENST00000489031.1_Silent_p.E142E	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	142	Glu-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		cttcatctgtttcttGGATAT	0.358													T|||	36	0.0071885	0.0265	0.0014	5008	,	,		19320	0.0		0.0	False		,,,				2504	0.0				p.E142E		.											.	LMOD3-23	0			c.A426G						.	T		76,3864		3,70,1897	99.0	85.0	89.0		426	1.2	0.7	3	dbSNP_132	89	0,8242		0,0,4121	no	coding-synonymous	LMOD3	NM_198271.3		3,70,6018	CC,CT,TT		0.0,1.9289,0.6239		142/561	69169080	76,12106	1970	4121	6091	SO:0001819	synonymous_variant	56203	exon2			ATCTGTTTCTTGG	AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.426A>G	3.37:g.69169080T>C		6	1		7	4	NM_198271	0	0	0	0	0	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	ENST00000420581.2	37	CCDS46862.1																																																																																			T|0.995;C|0.005		0.358	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1	XM_067529	
KIAA2018	205717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113376859	113376859	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:113376859C>A	ENST00000478658.1	-	5	3687	c.3670G>T	c.(3670-3672)Gca>Tca	p.A1224S	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.A1224S			Q68DE3	K2018_HUMAN	KIAA2018	1224						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGTAAAGATGCATTTGATGTT	0.418																																					p.A1224S		.											.	KIAA2018-93	0			c.G3670T						.						86.0	83.0	84.0					3																	113376859		1945	4164	6109	SO:0001583	missense	205717	exon7			AAGATGCATTTGA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3670G>T	3.37:g.113376859C>A	ENSP00000420721:p.Ala1224Ser	97	0		101	29	NM_001009899	0	0	2	2	0	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	C	3.356	-0.131444	0.06753	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.14022	2.54;2.54	5.67	3.84	0.44239	.	0.282276	0.34386	N	0.004013	T	0.05547	0.0146	N	0.14661	0.345	0.28041	N	0.933755	B	0.15141	0.012	B	0.12156	0.007	T	0.38950	-0.9637	10	0.07030	T	0.85	-2.1301	2.9175	0.05757	0.3149:0.4409:0.1391:0.1051	.	1224	Q68DE3	K2018_HUMAN	S	1224	ENSP00000320794:A1224S;ENSP00000420721:A1224S	ENSP00000320794:A1224S	A	-	1	0	KIAA2018	114859549	0.971000	0.33674	0.911000	0.35937	0.515000	0.34225	0.248000	0.18198	0.701000	0.31803	0.561000	0.74099	GCA	.		0.418	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
MUC20	200958	hgsc.bcm.edu	37	3	195456549	195456549	+	Missense_Mutation	SNP	T	T	C	rs201857816	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:195456549T>C	ENST00000447234.2	+	3	2126	c.2000T>C	c.(1999-2001)cTg>cCg	p.L667P	MUC20_ENST00000445522.2_Missense_Mutation_p.L632P|MUC20_ENST00000320736.6_Missense_Mutation_p.L496P|MUC20_ENST00000436408.1_Missense_Mutation_p.L667P	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	667	Interaction with MET.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTCCTGCGGCTGAGTGTGGCT	0.577													.|||	18	0.00359425	0.0136	0.0	5008	,	,		29066	0.0		0.0	False		,,,				2504	0.0				p.L496P		.											.	.	0			c.T1487C						.		PRO/LEU,PRO/LEU	22,3968		0,22,1973	50.0	48.0	49.0		1382,1487	4.6	1.0	3		49	0,8354		0,0,4177	yes	missense,missense	MUC20	NM_001098516.1,NM_152673.2	98,98	0,22,6150	CC,CT,TT		0.0,0.5514,0.1782	probably-damaging,probably-damaging	461/504,496/539	195456549	22,12322	1995	4177	6172	SO:0001583	missense	200958	exon4			TGCGGCTGAGTGT	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.2000T>C	3.37:g.195456549T>C	ENSP00000414350:p.Leu667Pro	24	1		22	6	NM_152673	0	0	17	19	2	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	37		.	.	.	.	.	.	.	.	.	.	T	14.72	2.618589	0.46736	0.005514	0.0	ENSG00000176945	ENST00000381954;ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.44083	1.44;1.76;1.47;0.93	4.63	4.63	0.57726	.	0.000000	0.32258	N	0.006354	T	0.44808	0.1311	L	0.39245	1.2	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.51513	-0.8696	10	0.66056	D	0.02	-6.0446	10.3989	0.44218	0.0:0.0:0.0:1.0	.	496	E9PH32	.	P	478;667;496;667;632	ENSP00000414350:L667P;ENSP00000325431:L496P;ENSP00000396774:L667P;ENSP00000405629:L632P	ENSP00000325431:L496P	L	+	2	0	MUC20	196942220	0.750000	0.28316	0.986000	0.45419	0.443000	0.32047	3.128000	0.50492	1.943000	0.56356	0.456000	0.33151	CTG	.		0.577	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
ADAD1	132612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123305047	123305047	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr4:123305047C>G	ENST00000296513.2	+	5	640	c.455C>G	c.(454-456)tCc>tGc	p.S152C	ADAD1_ENST00000388725.2_Missense_Mutation_p.S134C|ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388724.2_Missense_Mutation_p.S152C	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	152	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GAGTCTAGATCCAATGCAGCA	0.368																																					p.S152C		.											.	ADAD1-90	0			c.C455G						.						123.0	120.0	121.0					4																	123305047		2203	4300	6503	SO:0001583	missense	132612	exon5			CTAGATCCAATGC	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.455C>G	4.37:g.123305047C>G	ENSP00000296513:p.Ser152Cys	99	0		115	29	NM_139243	0	0	0	0	0	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	37	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993627	0.74703	.	.	ENSG00000164113	ENST00000446706;ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.84	5.84	0.93424	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.354445	0.30455	N	0.009587	T	0.82181	0.4981	L	0.29908	0.895	0.33397	D	0.576823	D;D	0.69078	0.996;0.997	D;D	0.66351	0.936;0.943	D	0.85408	0.1135	10	0.54805	T	0.06	-7.2127	18.912	0.92489	0.0:1.0:0.0:0.0	.	152;152	Q96M93-2;Q96M93	.;ADAD1_HUMAN	C	152;152;152;152;134	ENSP00000390510:S152C;ENSP00000296513:S152C;ENSP00000397254:S152C;ENSP00000373376:S152C;ENSP00000373377:S134C	ENSP00000296513:S152C	S	+	2	0	ADAD1	123524497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.447000	0.35101	2.768000	0.95171	0.579000	0.79373	TCC	.		0.368	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
PGBD1	84547	broad.mit.edu;bcgsc.ca	37	6	28269463	28269463	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr6:28269463C>T	ENST00000405948.2	+	7	2252	c.1832C>T	c.(1831-1833)gCt>gTt	p.A611V	PGBD1_ENST00000259883.3_Missense_Mutation_p.A611V	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	611						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						ATGAACTTCGCTGATGTTCTT	0.408																																					p.A611V													.	PGBD1-94	0			c.C1832T						.						159.0	158.0	158.0					6																	28269463		2203	4300	6503	SO:0001583	missense	84547	exon7			ACTTCGCTGATGT	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1832C>T	6.37:g.28269463C>T	ENSP00000385213:p.Ala611Val	250	0		272	9	NM_001184743	0	0	0	0	0	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	C	9.249	1.040200	0.19669	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.15487	2.42;2.42	4.66	3.79	0.43588	.	0.000000	0.48767	D	0.000165	T	0.02083	0.0065	N	0.05306	-0.075	0.27589	N	0.94933	B	0.20550	0.046	B	0.31869	0.137	T	0.46898	-0.9158	10	0.02654	T	1	-14.8085	8.97	0.35901	0.0:0.8988:0.0:0.1012	.	611	Q96JS3	PGBD1_HUMAN	V	611	ENSP00000385213:A611V;ENSP00000259883:A611V	ENSP00000259883:A611V	A	+	2	0	PGBD1	28377442	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.137000	0.31479	1.323000	0.45263	0.655000	0.94253	GCT	.		0.408	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
SLC35D3	340146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	137245376	137245376	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr6:137245376G>A	ENST00000331858.4	+	2	958	c.793G>A	c.(793-795)Gcc>Acc	p.A265T		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	265					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		GAAGAGCATCGCCACCATCAC	0.592																																					p.A265T		.											.	SLC35D3-91	0			c.G793A						.						77.0	64.0	68.0					6																	137245376		2203	4300	6503	SO:0001583	missense	340146	exon2			AGCATCGCCACCA		CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.793G>A	6.37:g.137245376G>A	ENSP00000333591:p.Ala265Thr	72	0		76	12	NM_001008783	0	0	0	0	0	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	ENST00000331858.4	37	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354459	0.82243	.	.	ENSG00000182747	ENST00000331858	T	0.64085	-0.08	5.68	5.68	0.88126	Domain of unknown function DUF250 (1);	0.056787	0.64402	D	0.000001	T	0.63034	0.2477	L	0.36672	1.1	0.58432	D	0.999995	D	0.67145	0.996	P	0.60682	0.878	T	0.58713	-0.7588	10	0.34782	T	0.22	-25.1818	19.7951	0.96477	0.0:0.0:1.0:0.0	.	265	Q5M8T2	S35D3_HUMAN	T	265	ENSP00000333591:A265T	ENSP00000333591:A265T	A	+	1	0	SLC35D3	137287069	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.777000	0.85628	2.698000	0.92095	0.561000	0.74099	GCC	.		0.592	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017	
IFNGR1	3459	broad.mit.edu;bcgsc.ca	37	6	137519461	137519461	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr6:137519461C>A	ENST00000367739.4	-	7	1298	c.1177G>T	c.(1177-1179)Gct>Tct	p.A393S	IFNGR1_ENST00000543628.1_Missense_Mutation_p.A365S	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	393					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	GAGTTTAAAGCGATGCTGCCA	0.443																																					p.A393S													.	IFNGR1-91	0			c.G1177T						.						88.0	88.0	88.0					6																	137519461		2203	4300	6503	SO:0001583	missense	3459	exon7			TTAAAGCGATGCT		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.1177G>T	6.37:g.137519461C>A	ENSP00000356713:p.Ala393Ser	123	0		101	5	NM_000416	1	0	72	73	0	B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	ENST00000367739.4	37	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776120	0.31411	.	.	ENSG00000027697	ENST00000367739;ENST00000543628	T;T	0.72394	-0.65;-0.49	6.06	-12.1	0.00011	.	2.161120	0.01880	N	0.037820	T	0.20577	0.0495	N	0.12182	0.205	0.09310	N	1	B;B	0.20164	0.031;0.042	B;B	0.22601	0.04;0.03	T	0.10917	-1.0609	10	0.27082	T	0.32	-0.1572	5.4548	0.16584	0.1953:0.5294:0.0993:0.176	.	365;393	F5H5M7;P15260	.;INGR1_HUMAN	S	393;365	ENSP00000356713:A393S;ENSP00000443282:A365S	ENSP00000356713:A393S	A	-	1	0	IFNGR1	137561154	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.897000	0.01603	-2.423000	0.00562	-1.202000	0.01658	GCT	.		0.443	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		
RP9	6100	broad.mit.edu	37	7	33136131	33136131	+	Silent	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:33136131G>A	ENST00000297157.3	-	5	458	c.441C>T	c.(439-441)gaC>gaT	p.D147D		NM_203288.1	NP_976033.1	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9 (autosomal dominant)	147	PIM1-binding. {ECO:0000250}.				cognition (GO:0050890)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|signal recognition particle receptor complex (GO:0005785)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|urinary_tract(1)	7			GBM - Glioblastoma multiforme(11;0.0403)			GTCGTTTATTGTCTCGTATGA	0.368																																					p.D147D													.	RP9-90	0			c.C441T						.						255.0	217.0	230.0					7																	33136131		2203	4300	6503	SO:0001819	synonymous_variant	6100	exon5			TTTATTGTCTCGT	AX016710	CCDS5440.1	7p14.3	2014-01-28			ENSG00000164610	ENSG00000164610			10288	protein-coding gene	gene with protein product	"""Pim-1 kinase associated protein"""	607331				8513323	Standard	NM_203288		Approved	PAP-1	uc003tdm.3	Q8TA86	OTTHUMG00000152988	ENST00000297157.3:c.441C>T	7.37:g.33136131G>A		127	1		111	6	NM_203288	0	0	19	19	0		Silent	SNP	ENST00000297157.3	37	CCDS5440.1																																																																																			.		0.368	RP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328914.1	NM_203288	
LAMB1	3912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107572810	107572810	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:107572810G>A	ENST00000222399.6	-	28	4431	c.4201C>T	c.(4201-4203)Ccc>Tcc	p.P1401S	LAMB1_ENST00000474380.1_5'UTR|LAMB1_ENST00000393561.1_Missense_Mutation_p.P1425S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1401	Domain alpha.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.P1401T(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GCCCCTGGGGGTGTTCCACAG	0.592																																					p.P1401S		.											.	LAMB1-97	1	Substitution - Missense(1)	lung(1)	c.C4201T						.						67.0	64.0	65.0					7																	107572810		2203	4300	6503	SO:0001583	missense	3912	exon28			CTGGGGGTGTTCC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4201C>T	7.37:g.107572810G>A	ENSP00000222399:p.Pro1401Ser	132	1		152	45	NM_002291	0	0	0	0	0	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918956	0.33908	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.29917	1.55;1.55	5.28	5.28	0.74379	.	.	.	.	.	T	0.24890	0.0604	L	0.37850	1.14	0.33891	D	0.637353	B;B	0.17667	0.023;0.014	B;B	0.17098	0.017;0.016	T	0.20042	-1.0287	9	0.45353	T	0.12	.	9.8304	0.40939	0.0744:0.1405:0.7851:0.0	.	1401;1425	P07942;G3XAI2	LAMB1_HUMAN;.	S	1425;1401	ENSP00000377191:P1425S;ENSP00000222399:P1401S	ENSP00000222399:P1401S	P	-	1	0	LAMB1	107360046	0.999000	0.42202	0.979000	0.43373	0.967000	0.64934	4.639000	0.61361	2.627000	0.88993	0.655000	0.94253	CCC	.		0.592	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	121653581	121653581	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:121653581G>T	ENST00000393386.2	+	12	4892	c.4481G>T	c.(4480-4482)aGt>aTt	p.S1494I	PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1494					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TCCTCAGACAGTCAAACTGGT	0.398																																					p.S1494I		.											.	PTPRZ1-699	0			c.G4481T						.						88.0	85.0	86.0					7																	121653581		2203	4300	6503	SO:0001583	missense	5803	exon12			CAGACAGTCAAAC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4481G>T	7.37:g.121653581G>T	ENSP00000377047:p.Ser1494Ile	78	0		91	29	NM_002851	0	0	0	0	0	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756857	0.49362	.	.	ENSG00000106278	ENST00000393386	T	0.54071	0.59	4.95	4.07	0.47477	.	0.299113	0.33057	N	0.005339	T	0.43456	0.1248	L	0.44542	1.39	0.80722	D	1	B	0.33379	0.41	B	0.35550	0.205	T	0.33394	-0.9870	10	0.37606	T	0.19	.	9.1534	0.36978	0.1675:0.0:0.8325:0.0	.	1494	P23471	PTPRZ_HUMAN	I	1494	ENSP00000377047:S1494I	ENSP00000377047:S1494I	S	+	2	0	PTPRZ1	121440817	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.448000	0.35112	1.215000	0.43411	0.555000	0.69702	AGT	.		0.398	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SHH	6469	hgsc.bcm.edu	37	7	155596098	155596098	+	Silent	SNP	G	G	A	rs549625672	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:155596098G>A	ENST00000297261.2	-	3	1035	c.885C>T	c.(883-885)tcC>tcT	p.S295S		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	295					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGCGCCCCCGGAAGGCGGCC	0.776													G|||	13	0.00259585	0.0091	0.0014	5008	,	,		6904	0.0		0.0	False		,,,				2504	0.0				p.S295S		.											.	SHH-1134	0			c.C885T						.																																			SO:0001819	synonymous_variant	6469	exon3			GCCCCCGGAAGGC		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.885C>T	7.37:g.155596098G>A		3	1		5	4	NM_000193	0	0	0	0	0	A4D247|Q75MC9	Silent	SNP	ENST00000297261.2	37	CCDS5942.1																																																																																			.		0.776	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
SCARA5	286133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27737097	27737097	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr8:27737097C>T	ENST00000354914.3	-	8	1825	c.1340G>A	c.(1339-1341)cGa>cAa	p.R447Q	SCARA5_ENST00000380385.2_Missense_Mutation_p.R222Q	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	447	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.R447P(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TTGCCCGAATCGAGCTGTGCG	0.622																																					p.R447Q		.											.	SCARA5-91	1	Substitution - Missense(1)	lung(1)	c.G1340A						.						142.0	110.0	121.0					8																	27737097		2203	4300	6503	SO:0001583	missense	286133	exon8			CCGAATCGAGCTG	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1340G>A	8.37:g.27737097C>T	ENSP00000346990:p.Arg447Gln	171	0		187	49	NM_173833	0	0	0	0	0	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491434	0.44249	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.44482	0.92;0.92	4.87	1.96	0.26148	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.165261	0.40554	N	0.001077	T	0.28732	0.0712	L	0.38649	1.16	0.80722	D	1	B;B	0.22851	0.003;0.076	B;B	0.15870	0.003;0.014	T	0.07501	-1.0769	10	0.46703	T	0.11	.	7.6192	0.28175	0.0:0.6991:0.0:0.3009	.	222;447	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	Q	447;222	ENSP00000346990:R447Q;ENSP00000369746:R222Q	ENSP00000346990:R447Q	R	-	2	0	SCARA5	27793016	0.174000	0.23070	0.360000	0.25837	0.505000	0.33919	1.411000	0.34702	0.536000	0.28733	0.591000	0.81541	CGA	.		0.622	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
RAD21	5885	broad.mit.edu;bcgsc.ca	37	8	117862960	117862960	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr8:117862960G>A	ENST00000297338.2	-	12	1804	c.1517C>T	c.(1516-1518)cCa>cTa	p.P506L	RAD21_ENST00000518055.1_Missense_Mutation_p.P51L|RAD21_ENST00000523986.1_Missense_Mutation_p.P10L|RAD21_ENST00000517749.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	506	Pro-rich.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AGGTTCTTCTGGGGGAAGCTC	0.378																																					p.P506L													.	RAD21-227	0			c.C1517T						.						131.0	130.0	130.0					8																	117862960		2203	4300	6503	SO:0001583	missense	5885	exon12			TCTTCTGGGGGAA	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1517C>T	8.37:g.117862960G>A	ENSP00000297338:p.Pro506Leu	144	0		165	7	NM_006265	1	0	112	119	6	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208572	0.58343	.	.	ENSG00000164754	ENST00000297338;ENST00000523986;ENST00000518055	T;T;T	0.80123	0.64;-1.34;-0.19	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	L	0.60455	1.87	0.80722	D	1	B	0.31318	0.319	B	0.27608	0.081	T	0.74262	-0.3722	10	0.22109	T	0.4	-6.1488	19.0827	0.93188	0.0:0.0:1.0:0.0	.	506	O60216	RAD21_HUMAN	L	506;10;51	ENSP00000297338:P506L;ENSP00000428513:P10L;ENSP00000428003:P51L	ENSP00000297338:P506L	P	-	2	0	RAD21	117932141	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.869000	0.87170	2.477000	0.83638	0.460000	0.39030	CCA	.		0.378	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
FBXL6	26233	hgsc.bcm.edu	37	8	145581950	145581950	+	Missense_Mutation	SNP	C	C	G	rs200282665	byFrequency	TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr8:145581950C>G	ENST00000331890.5	-	1	222	c.158G>C	c.(157-159)gGc>gCc	p.G53A	SLC52A2_ENST00000540505.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000455319.2_Missense_Mutation_p.G53A	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	53	F-box.				protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			ccgggcggggccgggTTCGGA	0.791													C|||	85	0.0169728	0.0575	0.0101	5008	,	,		6467	0.0		0.001	False		,,,				2504	0.001				p.G53A		.											.	FBXL6-658	0			c.G158C						.	C	ALA/GLY,ALA/GLY	39,2553		0,39,1257	3.0	3.0	3.0		158,158	1.7	0.0	8		3	11,5933		0,11,2961	no	missense,missense	FBXL6	NM_012162.1,NM_024555.3	60,60	0,50,4218	GG,GC,CC		0.1851,1.5046,0.5858	benign,benign	53/540,53/534	145581950	50,8486	1296	2972	4268	SO:0001583	missense	26233	exon1			GCGGGGCCGGGTT	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.158G>C	8.37:g.145581950C>G	ENSP00000330098:p.Gly53Ala	4	1		9	5	NM_024555	0	0	0	0	0	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	37	CCDS6422.1	32	0.014652014652014652	27	0.054878048780487805	4	0.011049723756906077	0	0.0	1	0.0013192612137203166	C	11.26	1.586411	0.28268	0.015046	0.001851	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.25085	1.83;1.82	3.66	1.72	0.24424	.	0.566152	0.14975	U	0.287596	T	0.02455	0.0075	L	0.39898	1.24	0.09310	N	1	B;B	0.33171	0.279;0.4	B;B	0.32211	0.067;0.142	T	0.14671	-1.0464	10	0.20519	T	0.43	-16.4339	6.039	0.19724	0.0:0.7105:0.0:0.2895	.	53;53	Q8N531;Q8N531-2	FBXL6_HUMAN;.	A	53	ENSP00000403873:G53A;ENSP00000330098:G53A	ENSP00000330098:G53A	G	-	2	0	FBXL6	145552758	0.000000	0.05858	0.023000	0.16930	0.016000	0.09150	0.118000	0.15605	0.602000	0.29896	0.563000	0.77884	GGC	C|0.985;G|0.015		0.791	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
CCIN	881	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	36170395	36170395	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr9:36170395C>T	ENST00000335119.2	+	1	1007	c.896C>T	c.(895-897)gCt>gTt	p.A299V		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	299					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GGAGTGTTTGCTTATATCATC	0.557																																					p.A299V		.											.	CCIN-92	0			c.C896T						.						79.0	75.0	76.0					9																	36170395		2203	4300	6503	SO:0001583	missense	881	exon1			TGTTTGCTTATAT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.896C>T	9.37:g.36170395C>T	ENSP00000334996:p.Ala299Val	169	0		135	8	NM_005893	0	0	0	0	0	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502198	0.64298	.	.	ENSG00000185972	ENST00000335119	T	0.65732	-0.17	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000024	T	0.66577	0.2803	L	0.29908	0.895	0.39812	D	0.972727	D	0.63880	0.993	D	0.68192	0.956	T	0.59386	-0.7464	10	0.12766	T	0.61	.	15.9243	0.79603	0.0:1.0:0.0:0.0	.	299	Q13939	CALI_HUMAN	V	299	ENSP00000334996:A299V	ENSP00000334996:A299V	A	+	2	0	CCIN	36160395	0.997000	0.39634	1.000000	0.80357	0.954000	0.61252	4.483000	0.60264	2.839000	0.97877	0.655000	0.94253	GCT	.		0.557	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
USP20	10868	hgsc.bcm.edu	37	9	132625508	132625508	+	Missense_Mutation	SNP	C	C	T	rs370020171		TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr9:132625508C>T	ENST00000315480.4	+	9	699	c.541C>T	c.(541-543)Cgc>Tgc	p.R181C	USP20_ENST00000358355.1_Missense_Mutation_p.R181C|USP20_ENST00000372429.3_Missense_Mutation_p.R181C			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	181	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				CGGCCTGGTGCGCACAGATAA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12876	0.0		0.0	False		,,,				2504	0.0				p.R181C		.											.	USP20-658	0			c.C541T						.	C	CYS/ARG,CYS/ARG,CYS/ARG	1,3963		0,1,1981	21.0	23.0	22.0		541,541,541	5.7	1.0	9		22	0,8164		0,0,4082	no	missense,missense,missense	USP20	NM_001008563.3,NM_001110303.2,NM_006676.6	180,180,180	0,1,6063	TT,TC,CC		0.0,0.0252,0.0082	probably-damaging,probably-damaging,probably-damaging	181/915,181/915,181/915	132625508	1,12127	1982	4082	6064	SO:0001583	missense	10868	exon9			CTGGTGCGCACAG	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.541C>T	9.37:g.132625508C>T	ENSP00000313811:p.Arg181Cys	5	2		8	6	NM_001008563	0	0	6	10	4	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	35	5.446654	0.96205	2.52E-4	0.0	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.32272	1.46;1.46;1.46	5.65	5.65	0.86999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.098333	0.64402	D	0.000001	T	0.62600	0.2441	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67593	-0.5631	10	0.87932	D	0	.	18.7287	0.91726	0.0:1.0:0.0:0.0	.	181	Q9Y2K6	UBP20_HUMAN	C	181	ENSP00000361506:R181C;ENSP00000313811:R181C;ENSP00000351122:R181C	ENSP00000313811:R181C	R	+	1	0	USP20	131665329	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.052000	0.49893	2.655000	0.90218	0.655000	0.94253	CGC	.		0.597	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
MAP7D3	79649	broad.mit.edu	37	X	135312676	135312676	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chrX:135312676A>G	ENST00000316077.9	-	10	1838	c.1618T>C	c.(1618-1620)Tat>Cat	p.Y540H	MAP7D3_ENST00000370661.1_Missense_Mutation_p.Y505H|MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370663.5_Missense_Mutation_p.Y522H	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	540					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					ATTATTTTATAAGGAAAAGAA	0.363																																					p.Y540H													.	MAP7D3-110	0			c.T1618C						.						140.0	131.0	134.0					X																	135312676		1838	4080	5918	SO:0001583	missense	79649	exon10			TTTTATAAGGAAA	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1618T>C	X.37:g.135312676A>G	ENSP00000318086:p.Tyr540His	204	0		228	3	NM_024597	0	0	28	28	0	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	A	7.290	0.610842	0.14066	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.04194	4.29;3.68;3.68;3.68	4.96	-2.35	0.06684	.	1.832210	0.03370	N	0.198761	T	0.04588	0.0125	L	0.32530	0.975	0.09310	N	1	P;P;P;P	0.46512	0.59;0.879;0.59;0.713	B;B;B;B	0.41571	0.118;0.36;0.118;0.234	T	0.31752	-0.9932	10	0.36615	T	0.2	0.0869	4.3898	0.11334	0.34:0.0:0.1543:0.5057	.	522;499;540;505	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	H	505;540;522;499	ENSP00000359695:Y505H;ENSP00000318086:Y540H;ENSP00000359697:Y522H;ENSP00000359694:Y499H	ENSP00000318086:Y540H	Y	-	1	0	MAP7D3	135140342	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.213000	0.17521	-0.659000	0.05359	-1.378000	0.01179	TAT	.		0.363	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
DNAJA2	10294	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	47005807	47005807	+	Splice_Site	DEL	C	C	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:47005807delC	ENST00000317089.5	-	2	354		c.e2+1		RP11-169E6.1_ENST00000562536.1_RNA	NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2						positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				AAATAACTTACTTTGTCTCCT	0.343																																					.		.											.	DNAJA2-226	0			c.138+1G>-						.						127.0	126.0	126.0					16																	47005807		2203	4300	6503	SO:0001630	splice_region_variant	10294	exon3			.	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.138+1G>-	16.37:g.47005807delC		179	0		155	47	NM_005880	0	0	0	0	0	B2R7L7|O14711	Splice_Site	DEL	ENST00000317089.5	37	CCDS10726.1																																																																																			.		0.343	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2		Intron
ARHGAP35	2909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	47422875	47422875	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:47422875delC	ENST00000404338.3	+	1	943	c.943delC	c.(943-945)cagfs	p.Q315fs		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	315	FF 1.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GGAAGGGACTCAGAAAGCCAA	0.507																																					p.Q315fs		.											.	.	0			c.943delC						.						32.0	32.0	32.0					19																	47422875		1979	4167	6146	SO:0001589	frameshift_variant	2909	exon1			.	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.943delC	19.37:g.47422875delC	ENSP00000385720:p.Gln315fs	55	0		46	13	NM_004491	0	0	0	0	0	A7E2A4|Q14452|Q9C0E1	Frame_Shift_Del	DEL	ENST00000404338.3	37	CCDS46127.1																																																																																			.		0.507	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
CADPS	8618	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	62477094	62477096	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:62477094_62477096delAAC	ENST00000383710.4	-	21	3293_3295	c.2944_2946delGTT	c.(2944-2946)gttdel	p.V982del	CADPS_ENST00000283269.9_In_Frame_Del_p.V992del|CADPS_ENST00000357948.3_In_Frame_Del_p.V952del	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	982	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCACATATCTAACAACAAGTGGG	0.419																																					p.992_992del		.											.	CADPS-281	0			c.2974_2976del						.																																			SO:0001651	inframe_deletion	8618	exon20			.	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2944_2946delGTT	3.37:g.62477097_62477099delAAC	ENSP00000373215:p.Val982del	203	0		191	53	NM_183394	0	0	0	0	0	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	In_Frame_Del	DEL	ENST00000383710.4	37	CCDS46858.1																																																																																			.		0.419	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
