#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R1	80835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	6639633	6639633	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:6639633G>A	ENST00000333172.6	+	6	2708	c.2515G>A	c.(2515-2517)Ggc>Agc	p.G839S	ZBTB48_ENST00000377674.4_5'Flank|TAS1R1_ENST00000351136.3_Missense_Mutation_p.G585S|TAS1R1_ENST00000328191.4_3'UTR	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	839					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GAGGCGCTGCGGCTCCACCTG	0.632																																					p.G839S		.											.	TAS1R1-516	0			c.G2515A						.						41.0	41.0	41.0					1																	6639633		2203	4299	6502	SO:0001583	missense	80835	exon6			CGCTGCGGCTCCA		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.2515G>A	1.37:g.6639633G>A	ENSP00000331867:p.Gly839Ser	32	0		32	12	NM_138697	0	0	0	0	0	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	37	CCDS81.1	.	.	.	.	.	.	.	.	.	.	G	2.898	-0.228154	0.06022	.	.	ENSG00000173662	ENST00000333172;ENST00000351136	D;D	0.90900	-2.37;-2.75	5.18	-0.747	0.11091	.	0.840078	0.10725	N	0.641242	T	0.80188	0.4577	N	0.22421	0.69	0.18873	N	0.999982	B;B	0.18310	0.027;0.003	B;B	0.12156	0.007;0.004	T	0.64050	-0.6498	10	0.25751	T	0.34	.	5.538	0.17021	0.3891:0.1411:0.4698:0.0	.	585;839	Q7RTX1-2;Q7RTX1	.;TS1R1_HUMAN	S	839;585	ENSP00000331867:G839S;ENSP00000312558:G585S	ENSP00000331867:G839S	G	+	1	0	TAS1R1	6562220	0.000000	0.05858	0.059000	0.19551	0.071000	0.16799	-0.005000	0.12855	-0.027000	0.13873	-0.216000	0.12614	GGC	.		0.632	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
SZT2	23334	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	43902958	43902958	+	Missense_Mutation	SNP	C	C	T	rs534888615		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:43902958C>T	ENST00000562955.1	+	42	5980	c.5980C>T	c.(5980-5982)Cgc>Tgc	p.R1994C	SZT2_ENST00000372442.1_Missense_Mutation_p.R1152C	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2051					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						AGTCCATTCACGCCTCAAAAT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19955	0.001		0.0	False		,,,				2504	0.0				p.R1994C													.	SZT2-144	0			c.C5980T						.						97.0	96.0	96.0					1																	43902958		2203	4300	6503	SO:0001583	missense	23334	exon42			CATTCACGCCTCA	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.5980C>T	1.37:g.43902958C>T	ENSP00000457168:p.Arg1994Cys	123	1		107	52	NM_015284	0	0	0	4	4	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584433	0.86748	.	.	ENSG00000198198	ENST00000372442	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.78604	0.4309	L	0.57536	1.79	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.78137	-0.2321	9	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1994	Q5T011-5	.	C	1152	.	ENSP00000361519:R1152C	R	+	1	0	SZT2	43675545	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.735000	0.84939	2.884000	0.98904	0.655000	0.94253	CGC	.		0.572	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
NOTCH2	4853	bcgsc.ca	37	1	120539926	120539926	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:120539926G>C	ENST00000256646.2	-	4	664	c.445C>G	c.(445-447)Ctg>Gtg	p.L149V	NOTCH2_ENST00000602566.1_Missense_Mutation_p.L110V	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	149	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGATGAGACAGGCAGGCATCC	0.498			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.L149V				Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C445G						.						123.0	98.0	107.0					1																	120539926		2201	4299	6500	SO:0001583	missense	4853	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GAGACAGGCAGGC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.445C>G	1.37:g.120539926G>C	ENSP00000256646:p.Leu149Val	350	3		362	33	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493005	0.26774	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	T	0.50548	0.74	5.71	4.61	0.57282	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.29799	U	0.011171	T	0.31231	0.0790	N	0.25957	0.775	0.33759	D	0.621659	P;B;P	0.45715	0.698;0.248;0.865	B;B;P	0.60012	0.338;0.206;0.867	T	0.20538	-1.0272	10	0.20046	T	0.44	.	4.9587	0.14056	0.0883:0.1371:0.6152:0.1595	.	110;149;149	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	V	149;110;122;110	ENSP00000256646:L149V	ENSP00000256646:L149V	L	-	1	2	NOTCH2	120341449	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.758000	0.38410	2.686000	0.91538	0.585000	0.79938	CTG	.		0.498	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
RORC	6097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151785765	151785765	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:151785765G>A	ENST00000318247.6	-	8	1231	c.1124C>T	c.(1123-1125)aCg>aTg	p.T375M	RORC_ENST00000356728.6_Missense_Mutation_p.T354M|RORC_ENST00000392697.3_Missense_Mutation_p.T429M|RORC_ENST00000480719.1_5'UTR	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	375	Ligand-binding.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAAAAGACCGTGCGGTTGTC	0.557																																					p.T375M		.											.	RORC-227	0			c.C1124T						.						236.0	234.0	235.0					1																	151785765		2203	4300	6503	SO:0001583	missense	6097	exon8			AAGACCGTGCGGT	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1124C>T	1.37:g.151785765G>A	ENSP00000327025:p.Thr375Met	79	0		97	41	NM_005060	0	0	7	13	6	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	ENST00000318247.6	37	CCDS1004.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478730	0.84747	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.96427	-4.01;-4.01;-4.01	4.62	4.62	0.57501	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	U	0.000012	D	0.97532	0.9192	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98360	1.0548	10	0.87932	D	0	.	16.1933	0.82006	0.0:0.0:1.0:0.0	.	375;429;375;354	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	M	354;429;375	ENSP00000349164:T354M;ENSP00000376461:T429M;ENSP00000327025:T375M	ENSP00000327025:T375M	T	-	2	0	RORC	150052389	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	9.469000	0.97679	2.391000	0.81399	0.563000	0.77884	ACG	.		0.557	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036626.1		
FASLG	356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	172634980	172634980	+	Missense_Mutation	SNP	A	A	G	rs111238176		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:172634980A>G	ENST00000367721.2	+	4	854	c.670A>G	c.(670-672)Atg>Gtg	p.M224V	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	224					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						GGATCTGGTGATGATGGAGGG	0.507																																					p.M224V	Ovarian(28;486 876 30334 44033)	.											.	FASLG-618	0			c.A670G						.						107.0	102.0	104.0					1																	172634980		2203	4300	6503	SO:0001583	missense	356	exon4			CTGGTGATGATGG	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.670A>G	1.37:g.172634980A>G	ENSP00000356694:p.Met224Val	94	0		103	46	NM_000639	0	0	0	0	0	Q9BZP9	Missense_Mutation	SNP	ENST00000367721.2	37	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.431408	0.43122	.	.	ENSG00000117560	ENST00000367721	D	0.94457	-3.43	5.34	4.41	0.53225	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.257132	0.32624	N	0.005854	T	0.78033	0.4220	N	0.02539	-0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.75068	-0.3448	10	0.66056	D	0.02	-4.9683	13.2687	0.60150	0.1797:0.8202:0.0:0.0	.	224	P48023	TNFL6_HUMAN	V	224	ENSP00000356694:M224V	ENSP00000356694:M224V	M	+	1	0	FASLG	170901603	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.680000	0.25306	1.203000	0.43233	0.528000	0.53228	ATG	A|0.500;G|0.500		0.507	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		
SEC16B	89866	broad.mit.edu	37	1	177902408	177902408	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:177902408G>T	ENST00000308284.6	-	22	2853	c.2764C>A	c.(2764-2766)Ccc>Acc	p.P922T	SEC16B_ENST00000495165.1_5'UTR|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	922					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						TTCTTGGTGGGCTTCGATCGA	0.577																																					p.P922T													.	SEC16B-93	0			c.C2764A						.						30.0	38.0	35.0					1																	177902408		1977	4172	6149	SO:0001583	missense	89866	exon22			TGGTGGGCTTCGA	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2764C>A	1.37:g.177902408G>T	ENSP00000308339:p.Pro922Thr	136	2		160	9	NM_033127	0	0	14	14	0	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433855	0.43224	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.21543	2.0	5.65	4.73	0.59995	.	0.084911	0.51477	D	0.000082	T	0.41259	0.1151	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;P;D	0.85130	0.997;0.997;0.895;0.997	T	0.17440	-1.0369	10	0.62326	D	0.03	-20.473	9.517	0.39111	0.0931:0.0:0.9069:0.0	.	477;923;922;619	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	T	922;606;637	ENSP00000308339:P922T	ENSP00000239472:P637T	P	-	1	0	AL359075.1	176169031	1.000000	0.71417	0.987000	0.45799	0.049000	0.14656	3.299000	0.51826	2.659000	0.90383	0.655000	0.94253	CCC	.		0.577	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	
PIGR	5284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207112530	207112530	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:207112530A>G	ENST00000356495.4	-	3	505	c.322T>C	c.(322-324)Tac>Cac	p.Y108H		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	108	Ig-like V-type 1.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCACACTTGTAGCGCCCGGAG	0.577																																					p.Y108H		.											.	PIGR-92	0			c.T322C						.						75.0	64.0	68.0					1																	207112530		2203	4300	6503	SO:0001583	missense	5284	exon3			ACTTGTAGCGCCC		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.322T>C	1.37:g.207112530A>G	ENSP00000348888:p.Tyr108His	149	0		158	56	NM_002644	0	0	14	32	18	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035080	0.75617	.	.	ENSG00000162896	ENST00000356495	D	0.94537	-3.45	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	D	0.97939	0.9322	H	0.95004	3.61	0.44890	D	0.997906	D	0.89917	1.0	D	0.97110	1.0	D	0.98953	1.0795	10	0.87932	D	0	-20.6353	13.9439	0.64073	1.0:0.0:0.0:0.0	.	108	P01833	PIGR_HUMAN	H	108	ENSP00000348888:Y108H	ENSP00000348888:Y108H	Y	-	1	0	PIGR	205179153	1.000000	0.71417	0.979000	0.43373	0.686000	0.39977	5.514000	0.67043	2.288000	0.76882	0.533000	0.62120	TAC	.		0.577	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
RAB3GAP2	25782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	220324630	220324630	+	Missense_Mutation	SNP	A	A	G	rs376300719		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:220324630A>G	ENST00000358951.2	-	35	4261	c.4145T>C	c.(4144-4146)aTt>aCt	p.I1382T		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	1382					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CACAGCTTCAATGAGGTGTAA	0.348																																					p.I1382T		.											.	RAB3GAP2-90	0			c.T4145C						.	A	THR/ILE	0,4406		0,0,2203	115.0	113.0	114.0		4145	0.9	0.0	1		114	1,8599	1.2+/-3.3	0,1,4299	no	missense	RAB3GAP2	NM_012414.3	89	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	1382/1394	220324630	1,13005	2203	4300	6503	SO:0001583	missense	25782	exon35			GCTTCAATGAGGT	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.4145T>C	1.37:g.220324630A>G	ENSP00000351832:p.Ile1382Thr	102	0		113	8	NM_012414	0	0	1	1	0	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.596066	0.28445	0.0	1.16E-4	ENSG00000118873	ENST00000358951	T	0.32753	1.44	5.84	0.898	0.19264	.	0.368085	0.29286	N	0.012581	T	0.23210	0.0561	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.19516	-1.0303	10	0.52906	T	0.07	.	8.7515	0.34618	0.7065:0.0:0.2935:0.0	.	1382	Q9H2M9	RBGPR_HUMAN	T	1382	ENSP00000351832:I1382T	ENSP00000351832:I1382T	I	-	2	0	RAB3GAP2	218391253	0.956000	0.32656	0.003000	0.11579	0.894000	0.52154	2.838000	0.48199	0.145000	0.18977	0.533000	0.62120	ATT	.		0.348	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
DDX50	79009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70670106	70670106	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr10:70670106C>A	ENST00000373585.3	+	3	535	c.428C>A	c.(427-429)cCt>cAt	p.P143H	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	143						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TCCAATTTTCCTATTTCTGAA	0.378																																					p.P143H		.											.	DDX50-91	0			c.C428A						.						129.0	133.0	132.0					10																	70670106		2203	4300	6503	SO:0001583	missense	79009	exon3			ATTTTCCTATTTC	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.428C>A	10.37:g.70670106C>A	ENSP00000362687:p.Pro143His	72	0		39	11	NM_024045	0	0	3	3	0	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489203	0.64074	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.21543	2.0	5.23	5.23	0.72850	RNA helicase, DEAD-box type, Q motif (1);	0.210307	0.43110	D	0.000611	T	0.19005	0.0456	L	0.32530	0.975	0.35802	D	0.82318	P;P	0.48016	0.904;0.604	B;B	0.42882	0.401;0.396	T	0.11891	-1.0569	10	0.48119	T	0.1	-3.6785	13.2098	0.59817	0.1588:0.8412:0.0:0.0	.	143;143	Q9BQ39;B4DED6	DDX50_HUMAN;.	H	143	ENSP00000362687:P143H	ENSP00000362687:P143H	P	+	2	0	DDX50	70340112	0.366000	0.25014	1.000000	0.80357	0.993000	0.82548	1.963000	0.40452	2.585000	0.87301	0.555000	0.69702	CCT	.		0.378	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
RBM20	282996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	112540726	112540726	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr10:112540726T>C	ENST00000369519.3	+	2	417	c.359T>C	c.(358-360)cTg>cCg	p.L120P		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	120					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						GCCACAGTCCTGAACCAAGTC	0.612																																					p.L120P		.											.	.	0			c.T359C						.						67.0	79.0	76.0					10																	112540726		692	1591	2283	SO:0001583	missense	282996	exon2			CAGTCCTGAACCA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.359T>C	10.37:g.112540726T>C	ENSP00000358532:p.Leu120Pro	90	0		87	30	NM_001134363	0	0	1	4	3	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747988	0.69533	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.96774	-4.12	5.85	4.71	0.59529	.	0.397222	0.23640	N	0.046035	D	0.91851	0.7421	L	0.29908	0.895	0.80722	D	1	P	0.38110	0.618	B	0.32211	0.142	D	0.90678	0.4603	10	0.87932	D	0	.	11.9472	0.52934	0.0:0.0678:0.0:0.9322	.	120	Q5T481	RBM20_HUMAN	P	120	ENSP00000358532:L120P	ENSP00000358532:L120P	L	+	2	0	RBM20	112530716	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.673000	0.83973	1.036000	0.39998	0.533000	0.62120	CTG	.		0.612	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
SLC5A12	159963	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	26720060	26720060	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:26720060C>A	ENST00000396005.3	-	7	1153	c.844G>T	c.(844-846)Ggt>Tgt	p.G282C	SLC5A12_ENST00000280467.6_Missense_Mutation_p.G282C	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	282					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						ATCCAGAGACCCAGCAAGTTA	0.453																																					p.G282C													.	SLC5A12-92	0			c.G844T						.						120.0	108.0	112.0					11																	26720060		2203	4299	6502	SO:0001583	missense	159963	exon7			AGAGACCCAGCAA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.844G>T	11.37:g.26720060C>A	ENSP00000379326:p.Gly282Cys	137	1		142	80	NM_178498	0	0	0	0	0	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454419	0.84209	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.87729	-2.29;-2.29;-2.29	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.94489	0.8226	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.93232	0.6618	10	0.45353	T	0.12	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	282;282	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	C	282;282;94	ENSP00000379326:G282C;ENSP00000280467:G282C;ENSP00000435053:G94C	ENSP00000280467:G282C	G	-	1	0	SLC5A12	26676636	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.669000	0.83911	2.890000	0.99128	0.650000	0.86243	GGT	.		0.453	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
INCENP	3619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61897408	61897408	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:61897408G>A	ENST00000394818.3	+	4	611	c.409G>A	c.(409-411)Gca>Aca	p.A137T	INCENP_ENST00000278849.4_Missense_Mutation_p.A137T	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	137			A -> V (in dbSNP:rs34441559).		chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GGCTACCATGGCATTGGCTGC	0.627																																					p.A137T		.											.	INCENP-227	0			c.G409A						.						60.0	60.0	60.0					11																	61897408		2201	4299	6500	SO:0001583	missense	3619	exon4			ACCATGGCATTGG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.409G>A	11.37:g.61897408G>A	ENSP00000378295:p.Ala137Thr	77	0		72	29	NM_001040694	0	0	0	0	0	A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	37	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	9.095	1.002664	0.19121	.	.	ENSG00000149503	ENST00000394818;ENST00000533896;ENST00000278849	T;T;T	0.23754	2.52;1.89;2.51	3.14	-3.13	0.05266	.	2.075460	0.02904	N	0.135798	T	0.13884	0.0336	N	0.22421	0.69	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.001	T	0.14671	-1.0464	10	0.10636	T	0.68	.	4.1359	0.10170	0.3443:0.3363:0.3194:0.0	.	137;137;137	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	T	137	ENSP00000378295:A137T;ENSP00000433100:A137T;ENSP00000278849:A137T	ENSP00000278849:A137T	A	+	1	0	INCENP	61653984	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.779000	0.04659	-0.725000	0.04901	-0.459000	0.05422	GCA	.		0.627	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
PDE2A	5138	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	72293520	72293520	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:72293520G>T	ENST00000334456.5	-	21	2064	c.1819C>A	c.(1819-1821)Cct>Act	p.P607T	RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000444035.2_Missense_Mutation_p.P598T|PDE2A_ENST00000540345.1_Missense_Mutation_p.P598T|PDE2A_ENST00000418754.2_Missense_Mutation_p.P492T|PDE2A_ENST00000376450.3_Missense_Mutation_p.P351T|PDE2A_ENST00000544570.1_Missense_Mutation_p.P600T	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	607					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	AGGGAACGAGGGGTATAGGTG	0.517																																					p.P607T													.	PDE2A-156	0			c.C1819A						.						103.0	83.0	90.0					11																	72293520		2200	4293	6493	SO:0001583	missense	5138	exon21			AACGAGGGGTATA	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.1819C>A	11.37:g.72293520G>T	ENSP00000334910:p.Pro607Thr	77	1		108	56	NM_002599	0	0	0	0	0	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	ENST00000334456.5	37	CCDS8216.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039400	0.75617	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000441209;ENST00000542223	T;T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	4.74	4.74	0.60224	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.245967	0.32952	N	0.005459	D	0.84786	0.5549	M	0.75777	2.31	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.79108	0.982;0.981;0.981;0.992;0.981;0.986	D	0.85408	0.1135	10	0.46703	T	0.11	.	14.4911	0.67651	0.0:0.0:1.0:0.0	.	492;607;598;600;607;351	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646;Q6ZMR1	.;PDE2A_HUMAN;.;.;.;.	T	607;351;598;676;600;492;598;148;38	ENSP00000334910:P607T;ENSP00000365633:P351T;ENSP00000411657:P598T;ENSP00000442256:P600T;ENSP00000410310:P492T;ENSP00000446399:P598T;ENSP00000392457:P148T;ENSP00000440834:P38T	ENSP00000334910:P607T	P	-	1	0	PDE2A	71971168	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	8.586000	0.90806	2.197000	0.70478	0.563000	0.77884	CCT	.		0.517	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599	
ARHGAP42	143872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	100641096	100641096	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:100641096A>T	ENST00000298815.8	+	2	180	c.177A>T	c.(175-177)aaA>aaT	p.K59N	ARHGAP42_ENST00000534060.1_3'UTR|ARHGAP42_ENST00000524892.2_Missense_Mutation_p.K59N	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	59	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						CAGTGCAGAAATTTTCCCAGT	0.343																																					p.K59N		.											.	.	0			c.A177T						.						107.0	100.0	102.0					11																	100641096		692	1591	2283	SO:0001583	missense	143872	exon2			GCAGAAATTTTCC			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.177A>T	11.37:g.100641096A>T	ENSP00000298815:p.Lys59Asn	61	0		47	22	NM_152432	0	0	0	0	0	Q96M56	Missense_Mutation	SNP	ENST00000298815.8	37		.	.	.	.	.	.	.	.	.	.	A	20.5	4.009102	0.75046	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.33438	1.41;1.41	5.89	-0.0565	0.13805	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.56097	U	0.000035	T	0.37865	0.1019	L	0.52364	1.645	0.53005	D	0.999963	P	0.46656	0.882	P	0.54759	0.76	T	0.08086	-1.0739	10	0.51188	T	0.08	.	10.5006	0.44804	0.4519:0.0:0.5481:0.0	.	59	A6NI28	RHG42_HUMAN	N	59	ENSP00000431776:K59N;ENSP00000298815:K59N	ENSP00000298815:K59N	K	+	3	2	ARHGAP42	100146306	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	2.099000	0.41767	-0.241000	0.09681	0.459000	0.35465	AAA	.		0.343	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
SSPN	8082	hgsc.bcm.edu	37	12	26348668	26348668	+	Silent	SNP	C	C	G	rs200655450	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr12:26348668C>G	ENST00000242729.2	+	1	240	c.63C>G	c.(61-63)gcC>gcG	p.A21A	SSPN_ENST00000422622.2_Intron|SSPN_ENST00000540266.1_Intron|SSPN_ENST00000535504.1_Silent_p.A21A	NM_005086.4	NP_005077.2	Q14714	SSPN_HUMAN	sarcospan	21					cell adhesion (GO:0007155)|muscle contraction (GO:0006936)	cell junction (GO:0030054)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10	Colorectal(261;0.0847)					ccgcggacgccgctgggcccg	0.756													C|||	11	0.00219649	0.0008	0.0029	5008	,	,		8179	0.0		0.007	False		,,,				2504	0.001				p.A21A		.											.	SSPN-90	0			c.C63G						.						2.0	3.0	2.0					12																	26348668		1476	3051	4527	SO:0001819	synonymous_variant	8082	exon1			GGACGCCGCTGGG	AF016028	CCDS8707.1, CCDS44850.1	12p11.2	2014-09-17	2012-03-14			ENSG00000123096			11322	protein-coding gene	gene with protein product		601599	"""Kras oncogene-associated gene"""	KRAG		9395445, 8661122	Standard	NM_005086		Approved	SPN1, SPN2	uc001rhe.3	Q14714		ENST00000242729.2:c.63C>G	12.37:g.26348668C>G		1	0		16	6	NM_005086	0	0	0	0	0	B3KS67	Silent	SNP	ENST00000242729.2	37	CCDS8707.1																																																																																			C|0.997;G|0.003		0.756	SSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402654.2	NM_005086	
SLC25A3	5250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	98995295	98995295	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr12:98995295T>A	ENST00000228318.3	+	8	1198	c.1078T>A	c.(1078-1080)Tta>Ata	p.L360I	SLC25A3_ENST00000552981.1_Missense_Mutation_p.L359I|SLC25A3_ENST00000548847.1_Missense_Mutation_p.L322I|SLC25A3_ENST00000401722.3_Missense_Mutation_p.L359I|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000549338.1_Missense_Mutation_p.L359I|SLC25A3_ENST00000551917.1_Missense_Mutation_p.L360I|SLC25A3_ENST00000188376.5_Missense_Mutation_p.L359I	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	360					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GAAGCTTGGGTTAACTCAGTA	0.433																																					p.L360I		.											.	SLC25A3-90	0			c.T1078A						.						83.0	79.0	80.0					12																	98995295		2203	4300	6503	SO:0001583	missense	5250	exon8			CTTGGGTTAACTC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.1078T>A	12.37:g.98995295T>A	ENSP00000228318:p.Leu360Ile	72	0		76	48	NM_005888	1	0	229	573	343	B3KS34|Q7Z7N7|Q96A03	Missense_Mutation	SNP	ENST00000228318.3	37	CCDS9066.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008501	0.75046	.	.	ENSG00000075415	ENST00000401722;ENST00000188376;ENST00000228318;ENST00000551917;ENST00000552981;ENST00000549338;ENST00000548847	T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-0.89;-0.89;-1.15;-1.15;-1.13	5.48	3.14	0.36123	.	0.132239	0.49305	D	0.000142	T	0.72112	0.3420	N	0.17674	0.51	0.51012	D	0.999902	B;P;P;B	0.52842	0.135;0.956;0.598;0.135	B;D;B;B	0.65010	0.121;0.931;0.19;0.145	T	0.66324	-0.5952	10	0.09590	T	0.72	-0.9242	7.4149	0.27038	0.0:0.3411:0.0:0.6589	.	322;359;360;359	F8VVM2;B2RE88;Q00325;Q00325-2	.;.;MPCP_HUMAN;.	I	359;359;360;360;359;359;322	ENSP00000383898:L359I;ENSP00000188376:L359I;ENSP00000228318:L360I;ENSP00000447310:L360I;ENSP00000448708:L359I;ENSP00000447740:L359I;ENSP00000449166:L322I	ENSP00000188376:L359I	L	+	1	2	SLC25A3	97519426	0.996000	0.38824	1.000000	0.80357	0.956000	0.61745	0.932000	0.28884	1.022000	0.39626	0.533000	0.62120	TTA	.		0.433	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407989.1	NM_005888	
RPGRIP1	57096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21793036	21793036	+	Silent	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr14:21793036C>T	ENST00000400017.2	+	14	2022	c.2022C>T	c.(2020-2022)ccC>ccT	p.P674P	RPGRIP1_ENST00000557771.1_Silent_p.P636P|RPGRIP1_ENST00000307974.4_Silent_p.P33P|RPGRIP1_ENST00000382933.4_Intron|RPGRIP1_ENST00000206660.6_Silent_p.P674P|RPGRIP1_ENST00000556336.1_Intron|RPGRIP1_ENST00000553500.1_Intron	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	674					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GGCCACAGCCCCTCTATGACT	0.512																																					p.P674P		.											.	RPGRIP1-140	0			c.C2022T						.						169.0	159.0	162.0					14																	21793036		1949	4136	6085	SO:0001819	synonymous_variant	57096	exon14			ACAGCCCCTCTAT	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2022C>T	14.37:g.21793036C>T		109	0		126	46	NM_020366	0	0	0	0	0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1																																																																																			.		0.512	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
POMT2	29954	broad.mit.edu;bcgsc.ca	37	14	77769260	77769260	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr14:77769260A>G	ENST00000261534.4	-	5	776	c.574T>C	c.(574-576)Tac>Cac	p.Y192H	POMT2_ENST00000556880.1_5'UTR	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	192						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		AGGAGGATGTACTGGGACAGA	0.532																																					p.Y192H													.	POMT2-91	0			c.T574C						.						94.0	80.0	85.0					14																	77769260		2203	4300	6503	SO:0001583	missense	29954	exon5			GGATGTACTGGGA	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.574T>C	14.37:g.77769260A>G	ENSP00000261534:p.Tyr192His	72	0		96	7	NM_013382	0	0	5	5	0	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.782604	0.90282	.	.	ENSG00000009830	ENST00000261534;ENST00000554948	D;D	0.86865	-2.18;-2.18	5.54	5.54	0.83059	Glycosyl transferase, family 39 (1);	0.066257	0.64402	D	0.000006	D	0.93268	0.7855	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93930	0.7213	10	0.66056	D	0.02	-16.8283	15.6626	0.77199	1.0:0.0:0.0:0.0	.	192	Q9UKY4	POMT2_HUMAN	H	192;101	ENSP00000261534:Y192H;ENSP00000452060:Y101H	ENSP00000261534:Y192H	Y	-	1	0	POMT2	76839013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.972000	0.93424	2.095000	0.63458	0.533000	0.62120	TAC	.		0.532	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
FAM98B	283742	hgsc.bcm.edu	37	15	38776827	38776827	+	IGR	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr15:38776827T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G423G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		gtggtggtggtggtggtggag	0.443																																					p.G423G		.											.	FAM98B-515	0			c.T1269A						.						19.0	18.0	18.0					15																	38776827		1515	3413	4928	SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776827T>A		21	0		27	4	NM_173611	0	0	0	0	0	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																			.		0.443	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	81181040	81181040	+	Splice_Site	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr15:81181040A>T	ENST00000394685.3	+	9	1287		c.e9-1		KIAA1199_ENST00000220244.3_Splice_Site|KIAA1199_ENST00000356249.5_Splice_Site			Q8WUJ3	CEMIP_HUMAN							hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTTCTCTGACAGGACATCGAG	0.498																																					.		.											.	KIAA1199-93	0			c.869-2A>T						.						101.0	99.0	100.0					15																	81181040		2203	4300	6503	SO:0001630	splice_region_variant	57214	exon8			TCTGACAGGACAT																												ENST00000394685.3:c.869-1A>T	15.37:g.81181040A>T		57	0		52	27	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Splice_Site	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.547385	0.27652	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6315	0.68660	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1199	78968095	1.000000	0.71417	0.786000	0.31890	0.035000	0.12851	6.504000	0.73704	2.046000	0.60703	0.455000	0.32223	.	.		0.498	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		Intron
SETD6	79918	broad.mit.edu	37	16	58549753	58549753	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr16:58549753G>T	ENST00000219315.4	+	2	136	c.86G>T	c.(85-87)tGc>tTc	p.C29F	SETD6_ENST00000394266.4_Missense_Mutation_p.C29F|SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000310682.2_Missense_Mutation_p.C29F			Q8TBK2	SETD6_HUMAN	SET domain containing 6	29					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						CTGAGCTGGTGCCGGCGGGTG	0.736																																					p.C29F													.	SETD6-91	0			c.G86T						.						6.0	8.0	8.0					16																	58549753		2130	4188	6318	SO:0001583	missense	79918	exon2			GCTGGTGCCGGCG	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.86G>T	16.37:g.58549753G>T	ENSP00000219315:p.Cys29Phe	16	0		69	8	NM_024860	0	0	0	1	1	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651671	0.67472	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315;ENST00000447443;ENST00000458571	T;T;T;T	0.74632	2.52;2.52;2.52;-0.86	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.84786	0.5549	M	0.70275	2.135	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.996;0.999	D;P;D	0.73708	0.981;0.879;0.974	D	0.85594	0.1248	10	0.51188	T	0.08	6.0364	16.4587	0.84030	0.0:0.0:1.0:0.0	.	29;29;29	E9PC53;Q8TBK2;Q8TBK2-2	.;SETD6_HUMAN;.	F	29	ENSP00000310082:C29F;ENSP00000377809:C29F;ENSP00000219315:C29F;ENSP00000396437:C29F	ENSP00000219315:C29F	C	+	2	0	SETD6	57107254	1.000000	0.71417	0.979000	0.43373	0.135000	0.20990	4.541000	0.60670	2.437000	0.82529	0.555000	0.69702	TGC	.		0.736	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860	
GLTPD2	388323	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	4693110	4693110	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr17:4693110A>G	ENST00000331264.7	+	4	448	c.395A>G	c.(394-396)aAg>aGg	p.K132R		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	132						cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GCCTTCACCAAGGTGACAGAC	0.672																																					p.K132R		.											.	GLTPD2-68	0			c.A395G						.						16.0	17.0	16.0					17																	4693110		2178	4256	6434	SO:0001583	missense	388323	exon4			TCACCAAGGTGAC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.395A>G	17.37:g.4693110A>G	ENSP00000328070:p.Lys132Arg	86	0		157	88	NM_001014985	0	0	3	7	4	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	.	.	.	.	.	.	.	.	.	.	A	32	5.182952	0.94885	.	.	ENSG00000182327	ENST00000331264	.	.	.	4.55	4.55	0.56014	Glycolipid transfer protein domain (3);	0.000000	0.85682	D	0.000000	T	0.81312	0.4796	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84725	0.0742	9	0.66056	D	0.02	-15.1395	11.95	0.52950	1.0:0.0:0.0:0.0	.	132	A6NH11	GLTD2_HUMAN	R	132	.	ENSP00000328070:K132R	K	+	2	0	GLTPD2	4639850	1.000000	0.71417	0.999000	0.59377	0.879000	0.50718	5.451000	0.66632	1.924000	0.55735	0.454000	0.30748	AAG	.		0.672	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
KDM6B	23135	broad.mit.edu	37	17	7751756	7751756	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr17:7751756C>T	ENST00000448097.2	+	11	2481	c.2150C>T	c.(2149-2151)gCa>gTa	p.A717V	KDM6B_ENST00000254846.5_Missense_Mutation_p.A717V			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	717	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CAACACGAAGCAGGCGTGGCC	0.587																																					p.A717V													.	KDM6B-205	0			c.C2150T						.						88.0	102.0	97.0					17																	7751756		2203	4300	6503	SO:0001583	missense	23135	exon11			ACGAAGCAGGCGT	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2150C>T	17.37:g.7751756C>T	ENSP00000412513:p.Ala717Val	46	0		74	5	NM_001080424	0	0	11	11	0	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	C	13.19	2.162661	0.38217	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.12879	2.64;2.64	4.52	4.52	0.55395	.	0.954393	0.08691	N	0.907886	T	0.12263	0.0298	N	0.08118	0	0.29511	N	0.854171	P;P	0.50819	0.816;0.939	B;P	0.48524	0.115;0.58	T	0.13548	-1.0505	10	0.52906	T	0.07	-8.824	12.2604	0.54647	0.1706:0.8294:0.0:0.0	.	717;717	O15054;O15054-1	KDM6B_HUMAN;.	V	717	ENSP00000254846:A717V;ENSP00000412513:A717V	ENSP00000254846:A717V	A	+	2	0	KDM6B	7692481	0.702000	0.27816	0.999000	0.59377	0.929000	0.56500	1.157000	0.31724	2.523000	0.85059	0.491000	0.48974	GCA	.		0.587	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	24	0		70	15	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
TRIM25	7706	bcgsc.ca	37	17	54990934	54990934	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr17:54990934G>A	ENST00000316881.4	-	1	465	c.416C>T	c.(415-417)gCc>gTc	p.A139V	TRIM25_ENST00000537230.1_Missense_Mutation_p.A139V	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	139					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					GTCCTGGAAGGCGGGGCTGTC	0.652																																					p.A139V													.	TRIM25-289	0			c.C416T						.						25.0	32.0	30.0					17																	54990934		2202	4297	6499	SO:0001583	missense	7706	exon1			TGGAAGGCGGGGC	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.416C>T	17.37:g.54990934G>A	ENSP00000323889:p.Ala139Val	119	4		259	149	NM_005082	0	0	0	4	4		Missense_Mutation	SNP	ENST00000316881.4	37	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094815	0.56075	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.69685	-0.42;-0.42	5.63	0.746	0.18365	.	0.274132	0.31809	N	0.007021	T	0.55033	0.1895	M	0.67625	2.065	0.09310	N	1	B	0.33379	0.41	B	0.25884	0.064	T	0.46289	-0.9202	10	0.35671	T	0.21	.	7.7359	0.28815	0.2116:0.1238:0.6646:0.0	.	139	Q14258	TRI25_HUMAN	V	139	ENSP00000323889:A139V;ENSP00000445961:A139V	ENSP00000323889:A139V	A	-	2	0	TRIM25	52345933	0.005000	0.15991	0.408000	0.26446	0.974000	0.67602	1.255000	0.32909	0.621000	0.30232	0.561000	0.74099	GCC	.		0.652	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082	
SETBP1	26040	broad.mit.edu	37	18	42281356	42281356	+	Silent	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr18:42281356C>T	ENST00000282030.5	+	2	341	c.45C>T	c.(43-45)ggC>ggT	p.G15G	SETBP1_ENST00000426838.4_Silent_p.G15G	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	15						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAAGAGGGGGCGAGTCAGACT	0.592									Schinzel-Giedion syndrome																												p.G15G													.	SETBP1-155	0			c.C45T						.						17.0	21.0	20.0					18																	42281356		692	1591	2283	SO:0001819	synonymous_variant	26040	exon2	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AGGGGGCGAGTCA	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.45C>T	18.37:g.42281356C>T		90	0		79	4	NM_001130110	0	0	2	2	0	A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	CCDS11923.2																																																																																			.		0.592	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
ZNF516	9658	broad.mit.edu	37	18	74154244	74154244	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr18:74154244G>T	ENST00000443185.2	-	3	1084	c.767C>A	c.(766-768)gCc>gAc	p.A256D	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A256D(2)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGGCTGAAGGCCTGGCCACA	0.687																																					p.A256D													.	ZNF516-69	2	Substitution - Missense(2)	kidney(2)	c.C767A						.						17.0	20.0	19.0					18																	74154244		2007	4189	6196	SO:0001583	missense	9658	exon3			CTGAAGGCCTGGC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.767C>A	18.37:g.74154244G>T	ENSP00000394757:p.Ala256Asp	56	1		91	6	NM_014643	0	0	0	0	0		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	G	18.16	3.562224	0.65538	.	.	ENSG00000101493	ENST00000443185	T	0.52295	0.67	4.52	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.074994	0.53938	D	0.000047	T	0.65637	0.2710	.	.	.	0.37315	D	0.909299	D	0.76494	0.999	D	0.73708	0.981	T	0.72924	-0.4144	9	0.87932	D	0	-8.9982	11.3066	0.49338	0.084:0.0:0.916:0.0	.	256	Q92618	ZN516_HUMAN	D	256	ENSP00000394757:A256D	ENSP00000394757:A256D	A	-	2	0	ZNF516	72283232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.515000	0.67049	2.508000	0.84585	0.650000	0.86243	GCC	.		0.687	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
CDC37	11140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10506875	10506875	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr19:10506875C>T	ENST00000222005.2	-	2	160	c.107G>A	c.(106-108)cGg>cAg	p.R36Q		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	36					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GCGTTCCACCCGGGCCTGCGG	0.632																																					p.R36Q		.											.	CDC37-522	0			c.G107A						.						39.0	42.0	41.0					19																	10506875		2203	4300	6503	SO:0001583	missense	11140	exon2			TCCACCCGGGCCT	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.107G>A	19.37:g.10506875C>T	ENSP00000222005:p.Arg36Gln	128	0		141	69	NM_007065	0	0	0	0	0	Q53YA2	Missense_Mutation	SNP	ENST00000222005.2	37	CCDS12237.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265565	0.95399	.	.	ENSG00000105401	ENST00000222005	T	0.57436	0.4	4.19	4.19	0.49359	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	M	0.83852	2.665	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.56216	0.794;0.794	T	0.76130	-0.3072	10	0.87932	D	0	.	14.3942	0.67001	0.0:1.0:0.0:0.0	.	36;36	Q6FG59;Q16543	.;CDC37_HUMAN	Q	36	ENSP00000222005:R36Q	ENSP00000222005:R36Q	R	-	2	0	CDC37	10367875	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.268000	0.78473	2.058000	0.61347	0.555000	0.69702	CGG	.		0.632	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
LTBP4	8425	broad.mit.edu	37	19	41119074	41119074	+	Silent	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr19:41119074G>T	ENST00000308370.7	+	19	2604	c.2604G>T	c.(2602-2604)gcG>gcT	p.A868A	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Silent_p.A321A|LTBP4_ENST00000204005.9_Silent_p.A831A|LTBP4_ENST00000396819.3_Silent_p.A801A|LTBP4_ENST00000243562.9_5'Flank	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	868	Cys-rich.|EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A868A(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTACCGGGCGCCGTCGGGTC	0.692																																					.													.	LTBP4-93	1	Substitution - coding silent(1)	prostate(1)	.						.						14.0	15.0	14.0					19																	41119074		1885	4101	5986	SO:0001819	synonymous_variant	8425	.			CCGGGCGCCGTCG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2604G>T	19.37:g.41119074G>T		23	1		83	11	.	0	0	4	4	0	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.692	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
GALNT14	79623	broad.mit.edu	37	2	31154974	31154974	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:31154974G>T	ENST00000349752.5	-	10	1657	c.1018C>A	c.(1018-1020)Ccc>Acc	p.P340T	GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000356174.3_Missense_Mutation_p.P307T|GALNT14_ENST00000406653.1_Missense_Mutation_p.P320T|GALNT14_ENST00000324589.5_Missense_Mutation_p.P345T|GALNT14_ENST00000420311.2_Missense_Mutation_p.P305T	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	340					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					AAAACGTAGGGGTGCTTCTTC	0.602																																					p.P345T													.	GALNT14-93	0			c.C1033A						.						93.0	86.0	88.0					2																	31154974		2203	4300	6503	SO:0001583	missense	79623	exon11			CGTAGGGGTGCTT	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1018C>A	2.37:g.31154974G>T	ENSP00000288988:p.Pro340Thr	61	1		107	5	NM_001253826	0	0	50	50	0	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819624	0.90873	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.92509	0.7621	M	0.93420	3.415	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;0.999	D	0.94523	0.7729	10	0.87932	D	0	.	18.2582	0.90025	0.0:0.0:1.0:0.0	.	305;307;345;340;320	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	T	340;345;320;307;305;307	ENSP00000288988:P340T;ENSP00000314500:P345T;ENSP00000385435:P320T;ENSP00000348497:P307T;ENSP00000415514:P305T;ENSP00000406399:P307T	ENSP00000314500:P345T	P	-	1	0	GALNT14	31008478	1.000000	0.71417	0.990000	0.47175	0.874000	0.50279	9.869000	0.99810	2.315000	0.78130	0.561000	0.74099	CCC	.		0.602	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
PPM1B	5495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44457731	44457731	+	Silent	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:44457731T>C	ENST00000282412.4	+	6	1726	c.1314T>C	c.(1312-1314)tcT>tcC	p.S438S	PPM1B_ENST00000378551.2_Intron|PPM1B_ENST00000378540.4_Intron|PPM1B_ENST00000345249.4_Silent_p.S151S|PPM1B_ENST00000409432.3_3'UTR	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	438					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAGCTACTTCTTCGAACAGTG	0.473																																					p.S438S		.											.	PPM1B-227	0			c.T1314C						.						76.0	74.0	75.0					2																	44457731		2203	4300	6503	SO:0001819	synonymous_variant	5495	exon6			TACTTCTTCGAAC	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.1314T>C	2.37:g.44457731T>C		150	0		197	131	NM_002706	0	0	5	19	14	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Silent	SNP	ENST00000282412.4	37	CCDS1817.1																																																																																			.		0.473	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1	NM_002706	
PRKCE	5581	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	45879246	45879246	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:45879246G>C	ENST00000306156.3	+	1	334	c.7G>C	c.(7-9)Gtg>Ctg	p.V3L		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	3	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GACCATGGTAGTGTTCAATGG	0.652																																					p.V3L		.											.	PRKCE-1019	0			c.G7C						.						31.0	36.0	35.0					2																	45879246		2196	4297	6493	SO:0001583	missense	5581	exon1			ATGGTAGTGTTCA		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.7G>C	2.37:g.45879246G>C	ENSP00000306124:p.Val3Leu	33	0		55	28	NM_005400	0	0	1	1	0	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	37	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.565679	0.65651	.	.	ENSG00000171132	ENST00000421201;ENST00000306156	T;T	0.08458	3.09;3.09	4.71	4.71	0.59529	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	0.080242	0.47852	D	0.000211	T	0.09202	0.0227	L	0.40543	1.245	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.19192	-1.0313	10	0.20519	T	0.43	.	17.673	0.88224	0.0:0.0:1.0:0.0	.	3	Q02156	KPCE_HUMAN	L	3	ENSP00000394574:V3L;ENSP00000306124:V3L	ENSP00000306124:V3L	V	+	1	0	PRKCE	45732750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.766000	0.98957	2.152000	0.67230	0.561000	0.74099	GTG	.		0.652	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	215865727	215865727	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:215865727G>C	ENST00000272895.7	-	22	3100	c.2881C>G	c.(2881-2883)Cct>Gct	p.P961A	ABCA12_ENST00000389661.4_Missense_Mutation_p.P643A	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	961					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTGTTAGAAGGAAGCTTAAAA	0.403																																					p.P961A	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12-99	0			c.C2881G						.						55.0	58.0	57.0					2																	215865727		2202	4300	6502	SO:0001583	missense	26154	exon22			TAGAAGGAAGCTT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2881C>G	2.37:g.215865727G>C	ENSP00000272895:p.Pro961Ala	46	0		51	18	NM_173076	0	0	0	0	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749673	0.69533	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.86627	-2.15;-2.15	5.9	5.9	0.94986	.	0.627251	0.15788	N	0.244589	D	0.92221	0.7533	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.87578	0.998;0.885	D	0.91505	0.5222	10	0.59425	D	0.04	.	20.2664	0.98460	0.0:0.0:1.0:0.0	.	961;643	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	A	961;643	ENSP00000272895:P961A;ENSP00000374312:P643A	ENSP00000272895:P961A	P	-	1	0	ABCA12	215573972	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.627000	0.67784	2.786000	0.95864	0.561000	0.74099	CCT	.		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218713569	218713569	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:218713569C>G	ENST00000171887.4	-	17	1748	c.1296G>C	c.(1294-1296)ttG>ttC	p.L432F	TNS1_ENST00000419504.1_Missense_Mutation_p.L432F|TNS1_ENST00000430930.1_Missense_Mutation_p.L432F|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	432					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCTGGGGACTCAAGGCAGCAG	0.642																																					p.L432F		.											.	TNS1-156	0			c.G1296C						.						64.0	67.0	66.0					2																	218713569		2203	4300	6503	SO:0001583	missense	7145	exon17			GGGACTCAAGGCA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1296G>C	2.37:g.218713569C>G	ENSP00000171887:p.Leu432Phe	98	0		125	47	NM_022648	0	0	6	10	4	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454564	0.43634	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.95447	-3.48;-3.47;-3.49;-3.71	4.79	3.9	0.45041	.	0.172150	0.40469	N	0.001094	D	0.96929	0.8997	M	0.76328	2.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.943;0.974;0.994;0.981	D	0.96213	0.9154	10	0.46703	T	0.11	.	10.7558	0.46237	0.0:0.8443:0.0:0.1557	.	432;486;432;432;432	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	F	432;432;432;557	ENSP00000171887:L432F;ENSP00000408724:L432F;ENSP00000406016:L432F;ENSP00000405460:L557F	ENSP00000171887:L432F	L	-	3	2	TNS1	218421814	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	1.405000	0.34635	1.227000	0.43598	0.561000	0.74099	TTG	.		0.642	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
FAM182B	728882	ucsc.edu	37	20	25755562	25755562	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr20:25755562A>C	ENST00000376403.1	-	3	772	c.394T>G	c.(394-396)Tgg>Ggg	p.W132G	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	132										lung(1)	1						TCCTGGGACCACTCCGGCCCC	0.716																																					.													.	.	0			.						.																																			SO:0001583	missense	728882	.			GGGACCACTCCGG			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.394T>G	20.37:g.25755562A>C	ENSP00000365585:p.Trp132Gly	18	1		78	12	.	0	0	1	1	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	0.433	-0.902472	0.02453	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	G	132	.	ENSP00000365585:W132G	W	-	1	0	FAM182B	25703562	0.019000	0.18553	0.149000	0.22428	0.150000	0.21749	-1.161000	0.03144	0.056000	0.16144	0.055000	0.15244	TGG	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
GATA5	140628	hgsc.bcm.edu	37	20	61050059	61050059	+	Silent	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr20:61050059G>T	ENST00000252997.2	-	2	580	c.519C>A	c.(517-519)acC>acA	p.T173T	RP13-379O24.3_ENST00000606283.1_lincRNA	NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	173					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			ACTCACCGAAGGTGGGCCTGC	0.721																																					p.T173T		.											.	GATA5-90	0			c.C519A						.						3.0	4.0	3.0					20																	61050059		1891	3784	5675	SO:0001819	synonymous_variant	140628	exon2			ACCGAAGGTGGGC	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.519C>A	20.37:g.61050059G>T		11	0		83	5	NM_080473	0	0	0	0	0	D9ZGF7|Q17RE2|Q86VU4	Silent	SNP	ENST00000252997.2	37	CCDS13499.1																																																																																			.		0.721	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473	
COL20A1	57642	broad.mit.edu	37	20	61945126	61945126	+	Silent	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr20:61945126G>T	ENST00000358894.6	+	18	2341	c.2241G>T	c.(2239-2241)ctG>ctT	p.L747L	COL20A1_ENST00000326996.6_Silent_p.L747L|COL20A1_ENST00000435874.1_Silent_p.L754L|COL20A1_ENST00000422202.1_Silent_p.L754L	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	747	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCTCCAACCTGGCCCTGGCCT	0.701																																					p.L747L													.	COL20A1-90	0			c.G2241T						.						17.0	23.0	21.0					20																	61945126		2027	4173	6200	SO:0001819	synonymous_variant	57642	exon18			CAACCTGGCCCTG	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2241G>T	20.37:g.61945126G>T		24	0		107	4	NM_020882	0	0	0	0	0	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	ENST00000358894.6	37	CCDS46628.1																																																																																			.		0.701	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	164	0		162	12	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
ACO2	50	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41911896	41911896	+	Silent	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr22:41911896T>C	ENST00000216254.4	+	6	832	c.810T>C	c.(808-810)ccT>ccC	p.P270P	ACO2_ENST00000396512.3_Silent_p.P270P|ACO2_ENST00000466237.1_3'UTR	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	270				P -> H (in Ref. 6; AAH26196). {ECO:0000305}.	cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						ACCACGGGCCTGGTGTAGACT	0.607																																					p.P270P		.											.	ACO2-290	0			c.T810C						.						63.0	48.0	53.0					22																	41911896		2203	4300	6503	SO:0001819	synonymous_variant	50	exon6			CGGGCCTGGTGTA	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.810T>C	22.37:g.41911896T>C		114	0		124	69	NM_001098	0	0	26	50	24	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Silent	SNP	ENST00000216254.4	37	CCDS14017.1																																																																																			.		0.607	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098	
C22orf34	348645	bcgsc.ca	37	22	50017005	50017005	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr22:50017005T>A	ENST00000444628.1	-	5	1960	c.889A>T	c.(889-891)Agc>Tgc	p.S297C	C22orf34_ENST00000400023.1_Intron|C22orf34_ENST00000405854.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						GGGCAGTGGCTATGGCTGACG	0.627																																					.													.	.	0			.						.																																			SO:0001583	missense	348645	.			AGTGGCTATGGCT	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.889A>T	22.37:g.50017005T>A	ENSP00000395549:p.Ser297Cys	107	0		87	37	.	0	0	0	0	0	Q147Y0|Q5R3D1|Q6ZTN8	RNA	SNP	ENST00000444628.1	37		.	.	.	.	.	.	.	.	.	.	T	0.844	-0.740946	0.03088	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.409	-0.817	0.10836	.	.	.	.	.	T	0.22704	0.0548	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25398	-1.0133	3	.	.	.	.	.	.	.	.	.	.	.	C	297	.	.	S	-	1	0	C22orf34	48403009	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.961000	0.03845	-0.625000	0.05604	-0.639000	0.03973	AGC	.		0.627	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_026997	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52526011	52526011	+	Missense_Mutation	SNP	C	C	T	rs369447186		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr3:52526011C>T	ENST00000479054.1	+	22	4100	c.4028C>T	c.(4027-4029)cCa>cTa	p.P1343L	NISCH_ENST00000345716.4_Missense_Mutation_p.P1343L			Q9Y2I1	NISCH_HUMAN	nischarin	1343					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GAGAAGGCCCCAGCCCTCAGC	0.627																																					p.P1343L		.											.	NISCH-93	0			c.C4028T						.	C	LEU/PRO	0,4406		0,0,2203	71.0	73.0	72.0		4028	4.7	0.1	3		72	2,8598	2.2+/-6.3	0,2,4298	no	missense	NISCH	NM_007184.3	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	1343/1505	52526011	2,13004	2203	4300	6503	SO:0001583	missense	11188	exon21			AGGCCCCAGCCCT	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.4028C>T	3.37:g.52526011C>T	ENSP00000418232:p.Pro1343Leu	107	0		137	36	NM_007184	0	0	21	33	12	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744827	0.49151	0.0	2.33E-4	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.07908	3.15;3.15	5.6	4.7	0.59300	.	0.353140	0.30277	N	0.009998	T	0.07458	0.0188	N	0.24115	0.695	0.09310	N	0.999995	B	0.06786	0.001	B	0.09377	0.004	T	0.24728	-1.0152	10	0.62326	D	0.03	-9.2061	14.0883	0.64973	0.4654:0.5346:0.0:0.0	.	1343	Q9Y2I1	NISCH_HUMAN	L	1343;1343;267;687	ENSP00000418232:P1343L;ENSP00000339958:P1343L	ENSP00000339958:P1343L	P	+	2	0	NISCH	52501051	0.002000	0.14202	0.052000	0.19188	0.991000	0.79684	1.108000	0.31123	1.309000	0.44985	0.491000	0.48974	CCA	.		0.627	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
CC2D2A	57545	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	15552558	15552558	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr4:15552558A>G	ENST00000503292.1	+	19	2473	c.2293A>G	c.(2293-2295)Agc>Ggc	p.S765G	CC2D2A_ENST00000413206.1_Missense_Mutation_p.S765G|CC2D2A_ENST00000424120.1_Missense_Mutation_p.S765G|CC2D2A_ENST00000389652.5_Missense_Mutation_p.S716G	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	765					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						AGTGGAGTTTAGCAGTAATCA	0.453																																					p.S765G													.	CC2D2A-25	0			c.A2293G						.						99.0	91.0	94.0					4																	15552558		1929	4162	6091	SO:0001583	missense	57545	exon19			GAGTTTAGCAGTA	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.2293A>G	4.37:g.15552558A>G	ENSP00000421809:p.Ser765Gly	70	0		67	31	NM_001080522	0	0	0	4	4	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702496	0.88924	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.3	5.3	0.74995	.	0.091915	0.85682	D	0.000000	T	0.74261	0.3693	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77603	-0.2526	10	0.87932	D	0	.	15.2238	0.73333	1.0:0.0:0.0:0.0	.	765;716	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	G	765;765;716;716;765;716	ENSP00000403465:S765G;ENSP00000398391:S765G;ENSP00000421809:S765G;ENSP00000374303:S716G	ENSP00000374303:S716G	S	+	1	0	CC2D2A	15161656	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.979000	0.93455	2.013000	0.59113	0.460000	0.39030	AGC	.		0.453	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	55237637	55237637	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr5:55237637T>A	ENST00000381298.2	-	17	2342	c.2030A>T	c.(2029-2031)aAt>aTt	p.N677I	IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000381286.3_Missense_Mutation_p.I53F|IL6ST_ENST00000336909.5_Missense_Mutation_p.N677I|IL6ST_ENST00000381293.2_Missense_Mutation_p.I190F|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000381294.3_Missense_Mutation_p.N616I|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.N677I	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	677					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ATCTTTTGAATTAAAATTGTG	0.343			O		hepatocellular ca																																p.N677I		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST-290	0			c.A2030T						.						43.0	47.0	46.0					5																	55237637		2199	4298	6497	SO:0001583	missense	3572	exon17			TTTGAATTAAAAT	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2030A>T	5.37:g.55237637T>A	ENSP00000370698:p.Asn677Ile	170	0		135	55	NM_002184	0	0	0	0	0	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.125|9.125	1.009945|1.009945	0.19277|0.19277	.|.	.|.	ENSG00000134352|ENSG00000134352	ENST00000381293;ENST00000381286|ENST00000381298;ENST00000336909;ENST00000381294	T;T|T;T;T	0.56611|0.40225	1.87;0.45|1.31;1.31;1.04	5.68|5.68	1.97|1.97	0.26223|0.26223	.|.	.|0.501171	.|0.23920	.|N	.|0.043246	T|T	0.37732|0.37732	0.1014|0.1014	N|N	0.19112|0.19112	0.55|0.55	0.41896|0.41896	D|D	0.990396|0.990396	P|P;D;P	0.39216|0.60160	0.664|0.822;0.987;0.822	B|B;P;P	0.36030|0.56216	0.216|0.406;0.794;0.534	T|T	0.03608|0.03608	-1.1020|-1.1020	9|10	0.87932|0.22706	D|T	0|0.39	.|.	11.3078|11.3078	0.49345|0.49345	0.0:0.2696:0.0:0.7304|0.0:0.2696:0.0:0.7304	.|.	190|677;616;677	Q5FC05|Q17RA0;Q5FC04;P40189	.|.;.;IL6RB_HUMAN	F|I	190;53|677;677;616	ENSP00000370693:I190F;ENSP00000370686:I53F|ENSP00000370698:N677I;ENSP00000338799:N677I;ENSP00000370694:N616I	ENSP00000370686:I53F|ENSP00000338799:N677I	I|N	-|-	1|2	0|0	IL6ST|IL6ST	55273394|55273394	0.905000|0.905000	0.30787|0.30787	0.932000|0.932000	0.37286|0.37286	0.603000|0.603000	0.37013|0.37013	0.092000|0.092000	0.15066|0.15066	-0.059000|-0.059000	0.13154|0.13154	-1.162000|-1.162000	0.01777|0.01777	ATT|AAT	.		0.343	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
ZNF474	133923	broad.mit.edu	37	5	121487938	121487938	+	Missense_Mutation	SNP	C	C	T	rs143759385	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr5:121487938C>T	ENST00000296600.4	+	2	636	c.253C>T	c.(253-255)Cct>Tct	p.P85S	CTC-441N14.2_ENST00000504829.1_RNA|ZNF474_ENST00000514925.1_Intron|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	85							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		GCTTAGCCCCCCTGTGATCCC	0.478																																					p.P85S													.	ZNF474-90	0			c.C253T						.						82.0	94.0	90.0					5																	121487938		2203	4300	6503	SO:0001583	missense	133923	exon2			AGCCCCCCTGTGA	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.253C>T	5.37:g.121487938C>T	ENSP00000296600:p.Pro85Ser	75	1		48	3	NM_207317	0	0	0	0	0	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.737799	0.30774	.	.	ENSG00000164185	ENST00000296600	T	0.55052	0.54	5.58	5.58	0.84498	.	0.000000	0.48286	U	0.000193	T	0.47581	0.1453	L	0.36672	1.1	0.48511	D	0.999669	P	0.36438	0.553	B	0.35899	0.213	T	0.47686	-0.9098	10	0.49607	T	0.09	-13.0415	19.1747	0.93599	0.0:1.0:0.0:0.0	.	85	Q6S9Z5	ZN474_HUMAN	S	85	ENSP00000296600:P85S	ENSP00000296600:P85S	P	+	1	0	ZNF474	121515837	0.995000	0.38212	0.967000	0.41034	0.012000	0.07955	5.490000	0.66881	2.624000	0.88883	0.655000	0.94253	CCT	C|1.000;G|0.000		0.478	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
BAG6	7917	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31612378	31612378	+	Splice_Site	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr6:31612378A>T	ENST00000375964.6	-	11	1702	c.1389T>A	c.(1387-1389)gaT>gaA	p.D463E	BAG6_ENST00000375976.4_Splice_Site_p.D457E|BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000362049.6_Splice_Site_p.D457E|BAG6_ENST00000404765.2_Splice_Site_p.D457E|BAG6_ENST00000211379.5_Splice_Site_p.D457E|BAG6_ENST00000439687.2_Splice_Site_p.D457E	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	463	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						GTGTGCCAGAATCTGGGCAGG	0.597																																					p.D463E													.	BAG6-154	0			c.T1389A						.						50.0	35.0	41.0					6																	31612378		1509	2708	4217	SO:0001630	splice_region_variant	7917	exon11			GCCAGAATCTGGG	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1388-1T>A	6.37:g.31612378A>T		66	1		70	30	NM_004639	0	0	0	0	0	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	a	17.87	3.494104	0.64186	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771;ENST00000438149;ENST00000436214;ENST00000435080	T;T;T;T;T;T;T;T	0.53423	1.47;1.48;1.47;1.2;0.91;1.48;0.62;0.91	4.66	3.46	0.39613	.	0.115441	0.56097	D	0.000026	T	0.32852	0.0843	L	0.32530	0.975	0.33181	D	0.5495	P;P;D;P;P	0.69078	0.953;0.756;0.997;0.841;0.902	P;P;D;P;P	0.72338	0.739;0.893;0.977;0.846;0.893	T	0.11767	-1.0574	10	0.13853	T	0.58	.	7.1945	0.25845	0.8977:0.0:0.1023:0.0	.	457;457;457;463;457	E7EMZ4;F8VXY4;B0UX85;P46379;P46379-2	.;.;.;BAG6_HUMAN;.	E	457;463;457;457;457;457;457;51;71;457	ENSP00000365143:D457E;ENSP00000365131:D463E;ENSP00000211379:D457E;ENSP00000384494:D457E;ENSP00000402856:D457E;ENSP00000354875:D457E;ENSP00000397978:D457E;ENSP00000410280:D51E	ENSP00000211379:D457E	D	-	3	2	BAG6	31720357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.019000	0.41001	0.769000	0.33313	0.525000	0.51046	GAT	.		0.597	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	Missense_Mutation
FHL5	9457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	97051597	97051597	+	Silent	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr6:97051597A>G	ENST00000326771.2	+	3	488	c.108A>G	c.(106-108)gtA>gtG	p.V36V	FHL5_ENST00000541107.1_Silent_p.V36V	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	36					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ATGATCGTGTATTTTCTAACT	0.363																																					p.V36V		.											.	FHL5-92	0			c.A108G						.						166.0	146.0	153.0					6																	97051597		2203	4300	6503	SO:0001819	synonymous_variant	9457	exon3			TCGTGTATTTTCT	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.108A>G	6.37:g.97051597A>G		85	0		73	28	NM_020482	0	0	0	0	0	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Silent	SNP	ENST00000326771.2	37	CCDS5035.1																																																																																			.		0.363	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
TNRC18	84629	hgsc.bcm.edu	37	7	5372499	5372499	+	Silent	SNP	C	C	T	rs113405524	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:5372499C>T	ENST00000430969.1	-	19	6249	c.5901G>A	c.(5899-5901)aaG>aaA	p.K1967K	TNRC18_ENST00000399537.4_Silent_p.K1967K	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1967							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCTTGCGCCCCTTCTCCACCG	0.771													C|||	67	0.0133786	0.0	0.0086	5008	,	,		9553	0.0		0.0149	False		,,,				2504	0.047				p.K1967K		.											.	TNRC18-46	0			c.G5901A						.	C		2,2776		0,2,1387	3.0	4.0	3.0		5901	3.2	1.0	7	dbSNP_132	3	19,6349		0,19,3165	no	coding-synonymous	TNRC18	NM_001080495.2		0,21,4552	TT,TC,CC		0.2984,0.072,0.2296		1967/2969	5372499	21,9125	1389	3184	4573	SO:0001819	synonymous_variant	84629	exon19			GCGCCCCTTCTCC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5901G>A	7.37:g.5372499C>T		0	0		25	9	NM_001080495	0	0	4	5	1	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	23	0.010531135531135532	7	0.014227642276422764	3	0.008287292817679558	2	0.0034965034965034965	11	0.014511873350923483	.	9.698	1.153785	0.21371	7.2E-4	0.002984	ENSG00000182095	ENST00000455076	.	.	.	4.35	3.21	0.36854	.	.	.	.	.	T	0.49847	0.1581	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51957	-0.8639	4	.	.	.	.	9.2245	0.37398	0.0:0.8174:0.0:0.1826	.	.	.	.	K	4	.	.	R	-	2	0	TNRC18	5339025	1.000000	0.71417	0.999000	0.59377	0.817000	0.46193	0.720000	0.25896	1.955000	0.56771	0.555000	0.69702	AGG	C|0.989;T|0.011		0.771	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ZMIZ2	83637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44796552	44796552	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:44796552G>A	ENST00000309315.4	+	4	295	c.172G>A	c.(172-174)Ggg>Agg	p.G58R	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.G58R|ZMIZ2_ENST00000413916.1_Intron|ZMIZ2_ENST00000433667.1_Intron|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.G58R	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	58	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATAGGTTTTGGGGAACCCCAT	0.592																																					p.G58R	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2-137	0			c.G172A						.						112.0	114.0	113.0					7																	44796552		1971	4146	6117	SO:0001583	missense	83637	exon3			GTTTTGGGGAACC	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.172G>A	7.37:g.44796552G>A	ENSP00000311778:p.Gly58Arg	63	0		97	43	NM_174929	0	0	7	7	0	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707309	0.89018	.	.	ENSG00000122515	ENST00000457123;ENST00000309315;ENST00000441627;ENST00000265346;ENST00000414051	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	4.8	4.8	0.61643	.	0.000000	0.56097	D	0.000030	D	0.98466	0.9489	M	0.71036	2.16	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.79108	0.962;0.992	D	0.99771	1.1024	10	0.87932	D	0	-8.5125	17.6515	0.88165	0.0:0.0:1.0:0.0	.	58;58	Q8NF64-2;Q8NF64	.;ZMIZ2_HUMAN	R	58	ENSP00000415501:G58R;ENSP00000311778:G58R;ENSP00000414723:G58R;ENSP00000265346:G58R	ENSP00000265346:G58R	G	+	1	0	ZMIZ2	44763077	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.810000	0.91950	2.485000	0.83878	0.655000	0.94253	GGG	.		0.592	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
AUTS2	26053	broad.mit.edu;bcgsc.ca	37	7	70229864	70229864	+	Silent	SNP	C	C	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:70229864C>G	ENST00000342771.4	+	8	1662	c.1341C>G	c.(1339-1341)acC>acG	p.T447T	AUTS2_ENST00000406775.2_Silent_p.T447T	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	447										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		tcacacccaccctccagcccc	0.652																																					p.T447T													.	AUTS2-92	0			c.C1341G						.						78.0	66.0	70.0					7																	70229864		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon8			ACCCACCCTCCAG	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1341C>G	7.37:g.70229864C>G		97	1		224	121	NM_001127231	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1																																																																																			.		0.652	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
PON2	5445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	95040981	95040981	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:95040981G>T	ENST00000222572.3	-	5	724	c.478C>A	c.(478-480)Cat>Aat	p.H160N	PON2_ENST00000433091.2_Missense_Mutation_p.H148N|PON2_ENST00000483292.1_5'UTR|PON2_ENST00000536183.1_Missense_Mutation_p.H181N			Q15165	PON2_HUMAN	paraoxonase 2	160					aromatic compound catabolic process (GO:0019439)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arylesterase activity (GO:0004064)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			AGAAGCTCATGTTTGACTGTT	0.358																																					p.H160N	GBM(42;803 823 13649 23368 31463)	.											.	PON2-90	0			c.C478A						.						76.0	78.0	78.0					7																	95040981		2203	4300	6503	SO:0001583	missense	5445	exon5			GCTCATGTTTGAC	M63012, AF001601	CCDS5640.1, CCDS47644.1	7q21.3	2014-03-14			ENSG00000105854	ENSG00000105854	3.1.1.2	"""Paraoxonases"""	9205	protein-coding gene	gene with protein product	"""paraoxonase nirs"", ""arylesterase 2"""	602447				8661009, 9714608	Standard	XM_005250453		Approved		uc003unv.3	Q15165	OTTHUMG00000153948	ENST00000222572.3:c.478C>A	7.37:g.95040981G>T	ENSP00000222572:p.His160Asn	99	0		98	47	NM_000305	0	1	52	81	28	A4D1H7|B2RCP9|B4DJD5|O15114|O15115|O75856|Q5FBX7|Q86YL0	Missense_Mutation	SNP	ENST00000222572.3	37	CCDS5640.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921121	0.33908	.	.	ENSG00000105854	ENST00000536183;ENST00000355659;ENST00000433091;ENST00000222572	T;T;T	0.40476	2.34;1.03;2.34	4.94	3.1	0.35709	Six-bladed beta-propeller, TolB-like (1);	0.093511	0.85682	D	0.000000	T	0.60077	0.2241	M	0.83118	2.625	0.52501	D	0.999956	D;D	0.76494	0.998;0.999	D;D	0.69824	0.946;0.966	T	0.60944	-0.7162	10	0.14252	T	0.57	-9.4713	10.7179	0.46023	0.0717:0.132:0.7963:0.0	.	160;160	A4D1H7;Q15165	.;PON2_HUMAN	N	181;158;148;160	ENSP00000440282:H181N;ENSP00000404622:H148N;ENSP00000222572:H160N	ENSP00000222572:H160N	H	-	1	0	PON2	94878917	1.000000	0.71417	0.894000	0.35097	0.062000	0.15995	7.184000	0.77705	0.774000	0.33427	-0.157000	0.13467	CAT	.		0.358	PON2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333142.1	NM_000305	
SLC35B4	84912	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	133984905	133984905	+	Splice_Site	SNP	T	T	C	rs570322971		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:133984905T>C	ENST00000378509.4	-	7	895	c.596A>G	c.(595-597)aAt>aGt	p.N199S		NM_032826.4	NP_116215.1	Q969S0	S35B4_HUMAN	solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4	199					carbohydrate transport (GO:0008643)|regulation of gluconeogenesis (GO:0006111)|transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine transport (GO:0015788)|UDP-xylose transport (GO:0015790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)|UDP-xylose transmembrane transporter activity (GO:0005464)			large_intestine(1)|lung(2)|skin(1)|stomach(1)	5						GTTGCTTACATTATAAAACAA	0.378													T|||	1	0.000199681	0.0	0.0	5008	,	,		18423	0.0		0.0	False		,,,				2504	0.001				p.N199S													.	SLC35B4-91	0			c.A596G						.						91.0	91.0	91.0					7																	133984905		2203	4300	6503	SO:0001630	splice_region_variant	84912	exon7			CTTACATTATAAA	AB052892	CCDS34756.1	7q33	2013-07-17	2013-07-17		ENSG00000205060	ENSG00000205060		"""Solute carriers"""	20584	protein-coding gene	gene with protein product		610923	"""solute carrier family 35, member B4"""				Standard	NM_032826		Approved	FLJ14697, YEA4	uc003vrn.3	Q969S0	OTTHUMG00000155321	ENST00000378509.4:c.597+1A>G	7.37:g.133984905T>C		69	1		120	56	NM_032826	0	0	1	2	1	A4D1P3|A6NNS4|Q53GQ7|Q8TCU7|Q96K33	Missense_Mutation	SNP	ENST00000378509.4	37	CCDS34756.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337875	0.60963	.	.	ENSG00000205060	ENST00000378509	T	0.25579	1.79	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.15176	0.0366	N	0.13352	0.335	0.80722	D	1	B;B;B	0.20164	0.034;0.034;0.042	B;B;B	0.21917	0.022;0.022;0.037	T	0.05937	-1.0855	10	0.05436	T	0.98	-14.4544	16.0396	0.80654	0.0:0.0:0.0:1.0	.	199;199;199	Q969S0-3;Q969S0-2;Q969S0	.;.;S35B4_HUMAN	S	199	ENSP00000367770:N199S	ENSP00000367770:N199S	N	-	2	0	SLC35B4	133635445	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	7.927000	0.87577	2.277000	0.76020	0.528000	0.53228	AAT	.		0.378	SLC35B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339444.2	NM_032826	Missense_Mutation
PDP1	54704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	94934633	94934633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr8:94934633C>T	ENST00000297598.4	+	2	615	c.346C>T	c.(346-348)Cag>Tag	p.Q116*	PDP1_ENST00000520728.1_Nonsense_Mutation_p.Q116*|PDP1_ENST00000396200.3_Nonsense_Mutation_p.Q141*|PDP1_ENST00000517764.1_Nonsense_Mutation_p.Q116*	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	116				NVSSILGFDSNQ -> MSVLSLDLTAIK (in Ref. 1; AAF67480). {ECO:0000305}.	cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						TGACAGCAATCAGCTGCCTGC	0.463																																					p.Q141X		.											.	PDP1-229	0			c.C421T						.						88.0	92.0	90.0					8																	94934633		2203	4300	6503	SO:0001587	stop_gained	54704	exon3			AGCAATCAGCTGC	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.346C>T	8.37:g.94934633C>T	ENSP00000297598:p.Gln116*	95	0		81	37	NM_001161780	0	0	1	4	3	B3KX71|J3KPU0|Q5U5K1	Nonsense_Mutation	SNP	ENST00000297598.4	37	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	C	33	5.196332	0.94960	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000518573;ENST00000517764;ENST00000518827;ENST00000521144	.	.	.	6.03	6.03	0.97812	.	0.120323	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.0857	20.5753	0.99366	0.0:1.0:0.0:0.0	.	.	.	.	X	116;116;141;116;116;116;116	.	ENSP00000297598:Q116X	Q	+	1	0	PDP1	95003809	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.792000	0.85828	2.868000	0.98415	0.557000	0.71058	CAG	.		0.463	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
VPS13B	157680	broad.mit.edu	37	8	100729543	100729543	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr8:100729543C>G	ENST00000358544.2	+	37	6785	c.6674C>G	c.(6673-6675)cCa>cGa	p.P2225R	VPS13B_ENST00000357162.2_Missense_Mutation_p.P2200R|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2225					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGCGGGAATCCAGGCCCAGAA	0.418																																					p.P2225R	Colon(161;2205 2542 7338 31318)												.	VPS13B-301	0			c.C6674G						.						97.0	91.0	93.0					8																	100729543		2203	4300	6503	SO:0001583	missense	157680	exon37			GGAATCCAGGCCC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6674C>G	8.37:g.100729543C>G	ENSP00000351346:p.Pro2225Arg	139	0		141	7	NM_017890	0	0	0	0	0	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229592	0.39399	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.68903	-0.36;-0.36	5.27	3.48	0.39840	.	0.130594	0.50627	D	0.000112	T	0.75332	0.3835	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.67382	0.951;0.844	T	0.76113	-0.3078	10	0.72032	D	0.01	.	11.9882	0.53159	0.0:0.8584:0.0:0.1416	.	2200;2225	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	R	2200;2225	ENSP00000349685:P2200R;ENSP00000351346:P2225R	ENSP00000349685:P2200R	P	+	2	0	VPS13B	100798719	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	3.399000	0.52586	0.704000	0.31869	-0.150000	0.13652	CCA	.		0.418	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ENPP2	5168	broad.mit.edu;bcgsc.ca	37	8	120580455	120580455	+	Silent	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr8:120580455G>A	ENST00000075322.6	-	22	2149	c.2091C>T	c.(2089-2091)ttC>ttT	p.F697F	ENPP2_ENST00000522167.1_Silent_p.F332F|ENPP2_ENST00000427067.2_Silent_p.F718F|ENPP2_ENST00000522826.1_Silent_p.F722F|ENPP2_ENST00000259486.6_Silent_p.F749F	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	697					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGGTTACAAGGAATGCATCAT	0.294																																					p.F749F	Melanoma(20;305 879 2501 4818 31020)												.	ENPP2-292	0			c.C2247T						.						131.0	136.0	134.0					8																	120580455		2203	4298	6501	SO:0001819	synonymous_variant	5168	exon23			TACAAGGAATGCA	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2091C>T	8.37:g.120580455G>A		359	0		348	11	NM_006209	0	0	3	3	0	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	ENST00000075322.6	37	CCDS34936.1																																																																																			.		0.294	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
BRCC3	79184	broad.mit.edu;bcgsc.ca	37	X	154299904	154299904	+	Silent	SNP	A	A	C	rs367616741		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chrX:154299904A>C	ENST00000369462.1	+	1	127	c.102A>C	c.(100-102)gtA>gtC	p.V34V	BRCC3_ENST00000399042.1_Silent_p.V34V|CMC4_ENST00000369484.3_5'Flank|MTCP1_ENST00000482244.1_5'Flank|MTCP1_ENST00000369476.3_5'Flank|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Silent_p.V34V|BRCC3_ENST00000340647.4_Silent_p.V34V|BRCC3_ENST00000330045.7_Silent_p.V34V	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	34	MPN.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGGAGGAAGTAATGGGGCTGT	0.612																																					p.V34V													.	BRCC3-706	0			c.A102C						.	A	,,	1,3664		0,1,1546,571	41.0	54.0	50.0		102,102,102	2.2	1.0	X		50	0,6585		0,0,2383,1819	no	coding-synonymous,coding-synonymous,coding-synonymous	BRCC3	NM_001018055.2,NM_001242640.1,NM_024332.3	,,	0,1,3929,2390	CC,CA,AA,A		0.0,0.0273,0.0098	,,	34/292,34/293,34/317	154299904	1,10249	2118	4202	6320	SO:0001819	synonymous_variant	79184	exon1			GGAAGTAATGGGG	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.102A>C	X.37:g.154299904A>C		97	0		114	6	NM_024332	0	0	0	0	0	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Silent	SNP	ENST00000369462.1	37	CCDS56611.1																																																																																			.		0.612	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332	
DISC1	27185	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	231931003	231931003	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:231931003delA	ENST00000602281.1	+	7	1703	c.1650delA	c.(1648-1650)atafs	p.I550fs	DISC1_ENST00000537876.1_Intron|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000535983.1_Frame_Shift_Del_p.I550fs|DISC1_ENST00000366636.4_Frame_Shift_Del_p.I550fs|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000539444.1_Frame_Shift_Del_p.I550fs|DISC1_ENST00000366633.3_Frame_Shift_Del_p.I550fs|DISC1_ENST00000439617.2_Frame_Shift_Del_p.I550fs	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	550	Interaction with TRAF3IP1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Required for localization to punctate cytoplasmic foci.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AGGAAAGAATAAAATCCCTCA	0.358																																					p.I582fs		.											.	DISC1-91	0			c.1746delA						.						84.0	85.0	85.0					1																	231931003		2203	4300	6503	SO:0001589	frameshift_variant	27185	exon8			.	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.1650delA	1.37:g.231931003delA	ENSP00000473425:p.Ile550fs	59	0		59	27	NM_001164537	0	0	0	0	0	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Frame_Shift_Del	DEL	ENST00000602281.1	37	CCDS59205.1																																																																																			.		0.358	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	207	0		202	34	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
ZNF721	170960	hgsc.bcm.edu;bcgsc.ca	37	4	436799	436801	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr4:436799_436801delGAG	ENST00000338977.5	-	2	1467_1469	c.1419_1421delCTC	c.(1417-1422)tcctca>tca	p.473_474SS>S	ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_In_Frame_Del_p.485_486SS>S			Q8TF20	ZN721_HUMAN	zinc finger protein 721	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AGCAAAGCTTGAGGATGAGGTAA	0.369																																					p.485_486del		.											.	ZNF721-47	0			c.1455_1457del						.			2,3976		1,0,1988						0.4	0.1			78	1,8109		0,1,4054	no	coding	ZNF721	NM_133474.2		1,1,6042	A1A1,A1R,RR		0.0123,0.0503,0.0248				3,12085				SO:0001651	inframe_deletion	170960	exon3			.	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1419_1421delCTC	4.37:g.436799_436801delGAG	ENSP00000340524:p.Ser475del	81	0		80	23	NM_133474	0	0	0	0	0	Q69YG7	In_Frame_Del	DEL	ENST00000338977.5	37																																																																																				.		0.369	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
DSPP	1834	hgsc.bcm.edu	37	4	88537224	88537232	+	In_Frame_Del	DEL	ACAGCAGCA	ACAGCAGCA	-	rs201608130|rs140656082|rs200679221|rs564674887	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	ACAGCAGCA	ACAGCAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr4:88537224_88537232delACAGCAGCA	ENST00000282478.7	+	4	3443_3451	c.3410_3418delACAGCAGCA	c.(3409-3420)gacagcagcaac>gac	p.SSN1138del	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Del_p.SSN1138del			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1138	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gatagcagtgacagcagcaacagcagtga	0.569																																					p.1137_1140del		.											.	DSPP-90	0			c.3410_3418del						.																																			SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3410_3418delACAGCAGCA	4.37:g.88537224_88537232delACAGCAGCA	ENSP00000282478:p.Ser1138_Asn1140del	190	0		250	114	NM_014208	0	0	0	0	0	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.569	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
NOTCH1	4851	broad.mit.edu	37	9	139417461	139417462	+	Frame_Shift_Ins	INS	-	-	G	rs146350322		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr9:139417461_139417462insG	ENST00000277541.6	-	4	657_658	c.582_583insC	c.(580-585)acctgcfs	p.C195fs	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	195	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGTTGTGGCAGGTGCCTCCGT	0.698			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.C195fs				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.583_584insC						.																																			SO:0001589	frameshift_variant	4851	exon4			TGTGGCAGGTGCC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.583dupC	9.37:g.139417463_139417463dupG	ENSP00000277541:p.Cys195fs	34	0		145	4	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Frame_Shift_Ins	INS	ENST00000277541.6	37	CCDS43905.1																																																																																			.		0.698	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
