#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC3	8714	hgsc.bcm.edu	37	17	48742604	48742604	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr17:48742604C>G	ENST00000285238.8	+	11	1509	c.1429C>G	c.(1429-1431)Cag>Gag	p.Q477E	ABCC3_ENST00000427699.1_Missense_Mutation_p.Q477E	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	477	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GCGCGCCTTCCAGGTAGGTGC	0.617																																																	0													102.0	72.0	82.0					17																	48742604		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1429C>G	17.37:g.48742604C>G	ENSP00000285238:p.Gln477Glu		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787923	0.90367	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.89552	-2.53;-2.53	4.47	4.47	0.54385	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.64402	D	0.000001	D	0.96163	0.8749	H	0.96015	3.755	0.80722	D	1	P;D	0.63046	0.898;0.992	P;D	0.68039	0.669;0.955	D	0.97386	0.9986	10	0.66056	D	0.02	-24.2967	17.6918	0.88270	0.0:1.0:0.0:0.0	.	477;477	O15438;O15438-5	MRP3_HUMAN;.	E	477	ENSP00000395160:Q477E;ENSP00000285238:Q477E	ENSP00000285238:Q477E	Q	+	1	0	ABCC3	46097603	1.000000	0.71417	0.973000	0.42090	0.974000	0.67602	7.643000	0.83403	2.502000	0.84385	0.655000	0.94253	CAG		0.617	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2		NM_020038	
ABL1	25	hgsc.bcm.edu	37	9	133730431	133730431	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr9:133730431G>A	ENST00000318560.5	+	3	878	c.497G>A	c.(496-498)aGa>aAa	p.R166K		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	166	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		R -> K (in a melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.R166K(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	ATCTCGCTGAGATACGAAGGG	0.597			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																			Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Substitution - Missense(1)	skin(1)											99.0	87.0	91.0					9																	133730431		2203	4300	6503	SO:0001583	missense	25			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.497G>A	9.37:g.133730431G>A	ENSP00000323315:p.Arg166Lys		A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	G	36	5.663128	0.96745	.	.	ENSG00000097007	ENST00000372348;ENST00000318560	D;D	0.88664	-2.41;-2.41	5.27	5.27	0.74061	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.91116	0.7203	L	0.48174	1.505	0.80722	D	1	P;P	0.39665	0.547;0.682	P;P	0.51657	0.676;0.676	D	0.91882	0.5516	10	0.87932	D	0	.	17.9692	0.89108	0.0:0.0:1.0:0.0	.	166;203	P00519;Q59FK4	ABL1_HUMAN;.	K	185;166	ENSP00000361423:R185K;ENSP00000323315:R166K	ENSP00000323315:R166K	R	+	2	0	ABL1	132720252	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	9.752000	0.98900	2.471000	0.83476	0.638000	0.83543	AGA		0.597	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1		NM_007313	
ALS2	57679	hgsc.bcm.edu;ucsc.edu	37	2	202589118	202589118	+	Silent	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:202589118G>A	ENST00000264276.6	-	21	3784	c.3412C>T	c.(3412-3414)Cta>Tta	p.L1138L	ALS2_ENST00000457679.2_Silent_p.L450L	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1138					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CCACTTCGTAGAAGACCATGA	0.413																																																	0													189.0	167.0	174.0					2																	202589118		1912	4131	6043	SO:0001819	synonymous_variant	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3412C>T	2.37:g.202589118G>A			Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	CCDS42800.1																																																																																				0.413	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3		NM_020919	
AGFG1	3267	hgsc.bcm.edu	37	2	228398468	228398468	+	Missense_Mutation	SNP	G	G	T	rs267599235		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:228398468G>T	ENST00000310078.8	+	7	1278	c.1018G>T	c.(1018-1020)Ggg>Tgg	p.G340W	AGFG1_ENST00000373671.3_Missense_Mutation_p.G300W|AGFG1_ENST00000409171.1_Missense_Mutation_p.G340W|AGFG1_ENST00000409315.1_Missense_Mutation_p.G340W|AGFG1_ENST00000409979.2_Missense_Mutation_p.G364W	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	340					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G340R(2)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						CTTCAGTGCCGGGCAAGGTAT	0.348																																																	2	Substitution - Missense(2)	skin(2)											54.0	51.0	52.0					2																	228398468		2203	4300	6503	SO:0001583	missense	3267				CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1018G>T	2.37:g.228398468G>T	ENSP00000312059:p.Gly340Trp		B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	ENST00000310078.8	37	CCDS2467.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801754	0.70682	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171	T;T;T;T;T	0.26957	1.79;1.73;1.7;1.81;1.73	5.14	4.25	0.50352	.	0.166320	0.53938	D	0.000049	T	0.33962	0.0881	N	0.19112	0.55	0.53005	D	0.999964	D;D;D;D	0.89917	1.0;0.996;0.999;0.998	D;D;D;P	0.80764	0.994;0.942;0.948;0.877	T	0.08722	-1.0708	10	0.41790	T	0.15	.	13.9942	0.64386	0.0746:0.0:0.9254:0.0	.	300;340;364;340	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	W	364;349;340;340;300;340	ENSP00000387282:G364W;ENSP00000312059:G340W;ENSP00000387154:G340W;ENSP00000362775:G300W;ENSP00000387218:G340W	ENSP00000312059:G340W	G	+	1	0	AGFG1	228106712	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	4.854000	0.62918	2.395000	0.81488	0.655000	0.94253	GGG		0.348	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2		NM_004504	
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32921822	32921822	+	Missense_Mutation	SNP	C	C	G	rs145484357		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr15:32921822C>G	ENST00000361627.3	+	8	1686	c.964C>G	c.(964-966)Ctt>Gtt	p.L322V	ARHGAP11A_ENST00000563864.1_Missense_Mutation_p.L322V|ARHGAP11A_ENST00000567348.1_Missense_Mutation_p.L322V|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.L133V|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.L133V	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	322					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		ACCAGTGATTCTTACACCAAA	0.348																																					Colon(45;757 1134 30003 36652)												0													130.0	130.0	130.0					15																	32921822		2201	4300	6501	SO:0001583	missense	9824			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.964C>G	15.37:g.32921822C>G	ENSP00000355090:p.Leu322Val		B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	11.04	1.522109	0.27211	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	D;D	0.92495	-3.05;-3.05	5.39	1.21	0.21127	.	0.279510	0.25411	N	0.030873	D	0.86226	0.5882	L	0.44542	1.39	0.23510	N	0.997524	B;B	0.15141	0.005;0.012	B;B	0.16722	0.012;0.016	T	0.73917	-0.3831	10	0.29301	T	0.29	.	9.1559	0.36992	0.0:0.5403:0.3283:0.1314	.	322;133	Q6P4F7;B4DZN9	RHGBA_HUMAN;.	V	322;133	ENSP00000355090:L322V;ENSP00000440073:L133V	ENSP00000355090:L322V	L	+	1	0	ARHGAP11A	30709114	1.000000	0.71417	0.986000	0.45419	0.959000	0.62525	1.169000	0.31871	0.666000	0.31087	-0.223000	0.12442	CTT		0.348	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1		NM_014783	
ATP2A1	487	hgsc.bcm.edu	37	16	28912226	28912226	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr16:28912226A>C	ENST00000357084.3	+	15	2356	c.2089A>C	c.(2089-2091)Atc>Ctc	p.I697L	ATP2A1_ENST00000395503.4_Missense_Mutation_p.I697L|ATP2A1_ENST00000536376.1_Missense_Mutation_p.I572L	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	697					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CTACGATGAGATCACAGCCAT	0.632																																																	0													61.0	56.0	58.0					16																	28912226		2197	4300	6497	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2089A>C	16.37:g.28912226A>C	ENSP00000349595:p.Ile697Leu		A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.008625	0.75046	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.96491	-4.03;-4.03;-4.03	5.4	5.4	0.78164	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97458	0.9168	M	0.91663	3.23	0.58432	D	0.999994	B;B;B	0.19583	0.037;0.013;0.027	B;B;B	0.37780	0.136;0.258;0.12	D	0.97004	0.9731	10	0.87932	D	0	.	14.4434	0.67333	1.0:0.0:0.0:0.0	.	572;697;697	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	L	697;697;734;572	ENSP00000349595:I697L;ENSP00000378879:I697L;ENSP00000443101:I572L	ENSP00000349595:I697L	I	+	1	0	ATP2A1	28819727	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.258000	0.95555	2.054000	0.61138	0.454000	0.30748	ATC		0.632	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2		NM_004320	
R3HCC1L	27291	hgsc.bcm.edu;ucsc.edu	37	10	99968925	99968925	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr10:99968925A>C	ENST00000298999.3	+	5	1357	c.1054A>C	c.(1054-1056)Aca>Cca	p.T352P	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.T352P|R3HCC1L_ENST00000314594.5_5'UTR	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	352							nucleotide binding (GO:0000166)										ACCTCCTGATACAGCTGTCCT	0.403																																																	0													182.0	154.0	164.0					10																	99968925		2203	4300	6503	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1054A>C	10.37:g.99968925A>C	ENSP00000298999:p.Thr352Pro		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312497	0.23908	.	.	ENSG00000166024	ENST00000370584;ENST00000298999	T;T	0.09163	3.01;3.01	5.05	1.16	0.20824	.	0.645138	0.15159	N	0.277267	T	0.17109	0.0411	M	0.69823	2.125	0.23459	N	0.997636	D;D	0.59767	0.986;0.986	P;P	0.54174	0.744;0.744	T	0.12708	-1.0537	9	.	.	.	-0.3161	1.5387	0.02551	0.5475:0.1814:0.0968:0.1743	.	352;352	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	P	352	ENSP00000359616:T352P;ENSP00000298999:T352P	.	T	+	1	0	C10orf28	99958915	0.298000	0.24417	0.776000	0.31678	0.068000	0.16541	0.659000	0.24994	0.747000	0.32809	0.460000	0.39030	ACA		0.403	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1		NM_014472	
FAM208A	23272	hgsc.bcm.edu	37	3	56716710	56716710	+	Missense_Mutation	SNP	T	T	C	rs113199481		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr3:56716710T>C	ENST00000493960.2	-	1	335	c.325A>G	c.(325-327)Aag>Gag	p.K109E	FAM208A_ENST00000355628.5_Missense_Mutation_p.K109E	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	109							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CCACCTTTCTTTTCTCTGCTC	0.572																																																	0													78.0	75.0	76.0					3																	56716710		692	1591	2283	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.325A>G	3.37:g.56716710T>C	ENSP00000417509:p.Lys109Glu		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.730485	0.48939	.	.	ENSG00000163946	ENST00000493960;ENST00000355628	T;T	0.10860	2.83;2.85	4.5	4.5	0.54988	.	.	.	.	.	T	0.24236	0.0587	L	0.43923	1.385	0.37560	D	0.919027	P;D	0.71674	0.51;0.998	B;D	0.70935	0.107;0.971	T	0.04650	-1.0936	9	0.59425	D	0.04	-3.9509	13.9868	0.64341	0.0:0.0:0.0:1.0	.	109;109	Q9UK61-3;Q9UK61-4	.;.	E	109	ENSP00000417509:K109E;ENSP00000347845:K109E	ENSP00000347845:K109E	K	-	1	0	C3orf63	56691750	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	4.162000	0.58177	2.034000	0.60081	0.454000	0.30748	AAG		0.572	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2		NM_015224	
ZBED6CL	113763	hgsc.bcm.edu;ucsc.edu	37	7	150028096	150028096	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:150028096G>A	ENST00000343855.4	+	1	1159	c.603G>A	c.(601-603)tgG>tgA	p.W201*	LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000323078.7_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	201																	AGTATCTGTGGGAGAATGAGA	0.597																																																	0													41.0	43.0	42.0					7																	150028096		2203	4300	6503	SO:0001587	stop_gained	113763			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.603G>A	7.37:g.150028096G>A	ENSP00000343242:p.Trp201*			Nonsense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	G	33	5.214467	0.95104	.	.	ENSG00000188707	ENST00000343855	.	.	.	4.18	-0.4	0.12411	.	5.880450	0.03666	U	0.243338	.	.	.	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	0.118	0.00062	0.256:0.2391:0.2359:0.269	.	.	.	.	X	201	.	ENSP00000343242:W201X	W	+	3	0	C7orf29	149659029	0.046000	0.20272	0.070000	0.20053	0.031000	0.12232	-0.893000	0.04127	-0.025000	0.13918	0.558000	0.71614	TGG		0.597	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1		NM_138434	
CCDC105	126402	hgsc.bcm.edu	37	19	15131445	15131445	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr19:15131445C>A	ENST00000292574.3	+	3	930	c.848C>A	c.(847-849)cCa>cAa	p.P283Q		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	283						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						ACGCCTCCTCCAGACCCTGTG	0.617																																																	0													36.0	36.0	36.0					19																	15131445		2203	4300	6503	SO:0001583	missense	126402			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.848C>A	19.37:g.15131445C>A	ENSP00000292574:p.Pro283Gln		Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789646	0.50102	.	.	ENSG00000160994	ENST00000292574	T	0.16743	2.32	4.11	1.91	0.25777	.	0.695530	0.11752	N	0.532916	T	0.28732	0.0712	M	0.67953	2.075	0.19775	N	0.99996	D	0.53462	0.96	P	0.54815	0.761	T	0.07829	-1.0752	10	0.56958	D	0.05	-3.8262	6.8281	0.23895	0.0:0.7595:0.0:0.2405	.	283	Q8IYK2	CC105_HUMAN	Q	283	ENSP00000292574:P283Q	ENSP00000292574:P283Q	P	+	2	0	CCDC105	14992445	0.001000	0.12720	0.956000	0.39512	0.716000	0.41182	0.954000	0.29175	0.825000	0.34637	0.558000	0.71614	CCA		0.617	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1		NM_173482	
CACNG7	59284	hgsc.bcm.edu;ucsc.edu	37	19	54444777	54444777	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr19:54444777G>T	ENST00000391767.1	+	5	690	c.478G>T	c.(478-480)Gtc>Ttc	p.V160F	CACNG7_ENST00000222212.2_Missense_Mutation_p.V160F|CACNG7_ENST00000468076.1_3'UTR|CACNG7_ENST00000391766.1_Missense_Mutation_p.V160F			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	160					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		CAACGACGAGGTCATGAACAG	0.557																																																	0													159.0	134.0	142.0					19																	54444777		2203	4300	6503	SO:0001583	missense	59284			AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.478G>T	19.37:g.54444777G>T	ENSP00000375647:p.Val160Phe		Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	37	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719785	0.89205	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.87966	-2.32;-2.32;-2.32	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000001	D	0.87545	0.6204	L	0.40543	1.245	0.80722	D	1	D	0.57257	0.979	P	0.59056	0.851	D	0.83624	0.0141	10	0.10902	T	0.67	-32.0205	15.4355	0.75143	0.0:0.0:1.0:0.0	.	160	P62955	CCG7_HUMAN	F	160	ENSP00000375647:V160F;ENSP00000222212:V160F;ENSP00000375646:V160F	ENSP00000222212:V160F	V	+	1	0	CACNG7	59136589	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.496000	0.45346	2.323000	0.78572	0.462000	0.41574	GTC		0.557	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2			
CCZ1	51622	hgsc.bcm.edu	37	7	5939957	5939957	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:5939957A>G	ENST00000325974.6	+	2	229	c.163A>G	c.(163-165)Aag>Gag	p.K55E	CCZ1_ENST00000537980.1_5'UTR	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	55						lysosome (GO:0005764)|membrane (GO:0016020)				large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						TGAGGTAGAAAAGAATGAGAA	0.323																																																	0													11.0	11.0	11.0					7																	5939957		2102	4227	6329	SO:0001583	missense	51622			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.163A>G	7.37:g.5939957A>G	ENSP00000325681:p.Lys55Glu		A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000325974.6	37	CCDS34597.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124463	0.56613	.	.	ENSG00000122674	ENST00000325974	.	.	.	4.67	4.67	0.58626	.	0.049034	0.85682	D	0.000000	T	0.42223	0.1193	L	0.33485	1.01	0.80722	D	1	B	0.19073	0.033	B	0.21151	0.033	T	0.29579	-1.0007	9	0.05436	T	0.98	-25.1295	13.2705	0.60157	1.0:0.0:0.0:0.0	.	55	P86790	CCZ1L_HUMAN	E	55	.	ENSP00000325681:K55E	K	+	1	0	CCZ1	5906483	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.991000	0.93514	1.727000	0.51537	0.416000	0.27883	AAG		0.323	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1		NM_015622	
CD177	57126	hgsc.bcm.edu;ucsc.edu	37	19	43866359	43866359	+	RNA	SNP	C	C	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr19:43866359C>T	ENST00000607109.1	-	0	300				CD177_ENST00000378009.4_RNA|CD177_ENST00000607517.1_RNA																							TGTGCAGCCTCCTGCCTCTCA	0.622																																																	0													76.0	72.0	73.0					19																	43866359		2038	4186	6224			57126																															19.37:g.43866359C>T				Missense_Mutation	SNP	ENST00000607109.1	37																																																																																					0.622	CTC-490G23.4-001	KNOWN	basic	antisense	antisense	OTTHUMT00000470165.1			
CDKL5	6792	hgsc.bcm.edu	37	X	18622766	18622766	+	Silent	SNP	G	G	T	rs371603866		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:18622766G>T	ENST00000379989.3	+	13	2007	c.1722G>T	c.(1720-1722)ccG>ccT	p.P574P	CDKL5_ENST00000379996.3_Silent_p.P574P|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	574			P -> Q (in an ovarian serous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					TGAAGCTGCCGGAGCACATGG	0.507																																																	0													124.0	117.0	119.0					X																	18622766		2203	4300	6503	SO:0001819	synonymous_variant	6792			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1722G>T	X.37:g.18622766G>T			G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	37	CCDS14186.1																																																																																				0.507	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2		NM_003159	
CEP170	9859	hgsc.bcm.edu	37	1	243336127	243336127	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:243336127G>C	ENST00000366542.1	-	11	1639	c.1588C>G	c.(1588-1590)Cag>Gag	p.Q530E	CEP170_ENST00000366543.1_Missense_Mutation_p.Q432E|CEP170_ENST00000366544.1_Missense_Mutation_p.Q432E	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	530						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TTATAATCCTGATTGTCATCT	0.318																																																	0													73.0	62.0	65.0					1																	243336127		1798	4069	5867	SO:0001583	missense	9859			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1588C>G	1.37:g.243336127G>C	ENSP00000355500:p.Gln530Glu		O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.1|22.1|22.1	4.248334|4.248334|4.248334	0.80024|0.80024|0.80024	.|.|.	.|.|.	ENSG00000143702|ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543|ENST00000522895	.|T;T;T|.	.|0.50277|.	.|0.95;0.77;0.75|.	5.35|5.35|5.35	5.35|5.35|5.35	0.76521|0.76521|0.76521	.|.|.	.|0.221171|.	.|0.42682|.	.|D|.	.|0.000667|.	T|T|.	0.71467|0.71467|.	0.3343|0.3343|.	L|L|L	0.56769|0.56769|0.56769	1.78|1.78|1.78	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;D;P|.	.|0.58970|.	.|0.394;0.984;0.775|.	.|B;D;B|.	.|0.63793|.	.|0.405;0.918;0.304|.	T|T|.	0.69098|0.69098|.	-0.5235|-0.5235|.	5|10|.	.|0.10902|.	.|T|.	.|0.67|.	-8.4782|-8.4782|-8.4782	17.2392|17.2392|17.2392	0.87008|0.87008|0.87008	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|432;432;530|.	.|Q5SW79-3;Q5SW79-2;Q5SW79|.	.|.;.;CE170_HUMAN|.	M|E|X	493|530;432;432|58	.|ENSP00000355500:Q530E;ENSP00000355502:Q432E;ENSP00000355501:Q432E|.	.|ENSP00000355500:Q530E|.	I|Q|S	-|-|-	3|1|2	3|0|0	CEP170|CEP170|CEP170	241402750|241402750|241402750	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	4.374000|4.374000|4.374000	0.59543|0.59543|0.59543	2.506000|2.506000|2.506000	0.84524|0.84524|0.84524	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	ATC|CAG|TCA		0.318	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2		NM_014812	
CILP	8483	hgsc.bcm.edu;ucsc.edu	37	15	65489590	65489590	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr15:65489590C>A	ENST00000261883.4	-	9	3200	c.3034G>T	c.(3034-3036)Ggg>Tgg	p.G1012W		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1012					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TAGAGCATCCCACTGCACTTG	0.592																																																	0													88.0	67.0	74.0					15																	65489590		2202	4299	6501	SO:0001583	missense	8483			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3034G>T	15.37:g.65489590C>A	ENSP00000261883:p.Gly1012Trp		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713382	0.68730	.	.	ENSG00000138615	ENST00000261883	T	0.10860	2.83	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18147	-1.0346	10	0.87932	D	0	-19.423	18.4768	0.90795	0.0:1.0:0.0:0.0	.	1012	O75339	CILP1_HUMAN	W	1012	ENSP00000261883:G1012W	ENSP00000261883:G1012W	G	-	1	0	CILP	63276643	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.795000	0.85887	2.608000	0.88229	0.655000	0.94253	GGG		0.592	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1		NM_003613	
COX6B1	1340	hgsc.bcm.edu;ucsc.edu	37	19	36142196	36142196	+	Silent	SNP	T	T	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr19:36142196T>C	ENST00000592141.1	+	2	316	c.51T>C	c.(49-51)ttT>ttC	p.F17F	COX6B1_ENST00000246554.3_Silent_p.F17F|COX6B1_ENST00000392201.1_Silent_p.F17F			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)	17					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCGCCCCTTTTGACAGCCGCT	0.567																																																	0													96.0	81.0	86.0					19																	36142196		2203	4300	6503	SO:0001819	synonymous_variant	1340			BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.51T>C	19.37:g.36142196T>C			B2R5C9|Q6IBL4	Silent	SNP	ENST00000592141.1	37	CCDS12469.1																																																																																				0.567	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3		NM_001863	
CYP7B1	9420	hgsc.bcm.edu;ucsc.edu	37	8	65517238	65517238	+	Splice_Site	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr8:65517238C>A	ENST00000310193.3	-	5	1407		c.e5+1		CYP7B1_ENST00000523954.1_Splice_Site	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1						bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGTTTACTTACCTCTGGAGCT	0.493																																																	0													119.0	125.0	123.0					8																	65517238		2203	4300	6503	SO:0001630	splice_region_variant	9420			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1233+1G>T	8.37:g.65517238C>A			B2RN07|Q9UNF5	Splice_Site	SNP	ENST00000310193.3	37	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536615	0.45176	.	.	ENSG00000172817	ENST00000310193	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYP7B1	65679792	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	7.487000	0.81328	2.832000	0.97577	0.655000	0.94253	.		0.493	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1			Intron
D2HGDH	728294	hgsc.bcm.edu	37	2	242680459	242680459	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:242680459G>A	ENST00000321264.4	+	3	513	c.304G>A	c.(304-306)Gtg>Atg	p.V102M	D2HGDH_ENST00000403782.1_5'UTR|D2HGDH_ENST00000537090.1_Missense_Mutation_p.V102M|D2HGDH_ENST00000342518.6_Missense_Mutation_p.V102M	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	102	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CTGTAGCAAGGTGCTGCTGAG	0.597																																																	0													58.0	51.0	53.0					2																	242680459		2203	4296	6499	SO:0001583	missense	728294			AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.304G>A	2.37:g.242680459G>A	ENSP00000315351:p.Val102Met		B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	ENST00000321264.4	37	CCDS33426.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089161	0.36855	.	.	ENSG00000180902	ENST00000537090;ENST00000321264;ENST00000342518	D;D;D	0.95918	-3.85;-3.85;-3.85	4.13	3.23	0.37069	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.260915	0.30492	N	0.009507	D	0.95297	0.8474	M	0.62209	1.925	0.39282	D	0.964584	P	0.37731	0.607	P	0.46208	0.507	D	0.94916	0.8069	10	0.62326	D	0.03	.	13.6989	0.62597	0.0:0.4546:0.5454:0.0	.	102	Q8N465	D2HDH_HUMAN	M	102	ENSP00000442796:V102M;ENSP00000315351:V102M;ENSP00000339536:V102M	ENSP00000315351:V102M	V	+	1	0	D2HGDH	242329132	1.000000	0.71417	0.942000	0.38095	0.285000	0.27093	1.511000	0.35801	0.716000	0.32124	0.561000	0.74099	GTG		0.597	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2		NM_152783	
DAND5	199699	hgsc.bcm.edu	37	19	13080510	13080510	+	Silent	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr19:13080510G>A	ENST00000317060.2	+	1	215	c.36G>A	c.(34-36)ctG>ctA	p.L12L	DAND5_ENST00000585548.1_Silent_p.L42L	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	12					atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)			kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			TTCTGTGCCTGCTTAGCGGGG	0.627																																																	0													107.0	109.0	108.0					19																	13080510		2203	4300	6503	SO:0001819	synonymous_variant	199699			AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.36G>A	19.37:g.13080510G>A				Silent	SNP	ENST00000317060.2	37	CCDS12291.1																																																																																				0.627	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452761.1		NM_152654	
DDIT3	1649	hgsc.bcm.edu	37	12	57910757	57910757	+	Silent	SNP	A	A	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr12:57910757A>G	ENST00000346473.3	-	4	524	c.345T>C	c.(343-345)gcT>gcC	p.A115A	DDIT3_ENST00000547303.1_Silent_p.A115A|DDIT3_ENST00000552740.1_Silent_p.A138A|MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000551116.1_Silent_p.A138A|RN7SL312P_ENST00000582079.1_RNA	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	115	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.		A -> V (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A115A(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GCTGCTTTCCAGCCCGGGCTG	0.542			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)			Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	1	Substitution - coding silent(1)	large_intestine(1)											142.0	151.0	148.0					12																	57910757		2203	4300	6503	SO:0001819	synonymous_variant	1649			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.345T>C	12.37:g.57910757A>G			F8VS99	Silent	SNP	ENST00000346473.3	37	CCDS8943.1																																																																																				0.542	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1		NM_004083	
DMBT1	1755	hgsc.bcm.edu;ucsc.edu	37	10	124351826	124351826	+	Missense_Mutation	SNP	A	A	G	rs190617825		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr10:124351826A>G	ENST00000338354.3	+	20	2321	c.2215A>G	c.(2215-2217)Agt>Ggt	p.S739G	DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.S739G|DMBT1_ENST00000344338.3_Missense_Mutation_p.S729G|DMBT1_ENST00000368955.3_Missense_Mutation_p.S729G|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000330163.4_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	739	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGTGAATGGAAGTGACAGGTG	0.532																																					Ovarian(182;93 2026 18125 22222 38972)												0													359.0	262.0	294.0					10																	124351826		2000	4138	6138	SO:0001583	missense	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2215A>G	10.37:g.124351826A>G	ENSP00000342210:p.Ser739Gly		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	A	0.010	-1.759438	0.00657	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	3.69	-2.13	0.07144	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.21103	0.0508	N	0.11651	0.15	0.09310	N	0.999997	P;B;B	0.47350	0.894;0.001;0.0	P;B;B	0.48704	0.587;0.002;0.0	T	0.22312	-1.0220	9	0.21540	T	0.41	.	5.951	0.19246	0.5586:0.2709:0.1705:0.0	.	739;729;739	Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;DMBT1_HUMAN	G	739;739;739;739;739;739;729;739;729	ENSP00000342210:S739G;ENSP00000343175:S729G;ENSP00000357905:S739G;ENSP00000357951:S729G	ENSP00000342210:S739G	S	+	1	0	DMBT1	124341816	0.000000	0.05858	0.664000	0.29753	0.335000	0.28730	-3.881000	0.00343	-0.071000	0.12886	-0.259000	0.10710	AGT		0.532	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2		NM_004406	
DMXL1	1657	hgsc.bcm.edu;ucsc.edu	37	5	118506224	118506224	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr5:118506224A>T	ENST00000311085.8	+	24	5818	c.5738A>T	c.(5737-5739)gAt>gTt	p.D1913V	DMXL1_ENST00000539542.1_Missense_Mutation_p.D1913V	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1913										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTAAAGTTGGATGCAAGGGAA	0.393																																																	0													111.0	108.0	109.0					5																	118506224		2202	4300	6502	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.5738A>T	5.37:g.118506224A>T	ENSP00000309690:p.Asp1913Val			Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	8.689	0.907049	0.17833	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10382	2.88;2.89	5.68	4.49	0.54785	.	0.519448	0.22565	N	0.058413	T	0.07413	0.0187	N	0.14661	0.345	0.53688	D	0.999973	B;B	0.20261	0.043;0.015	B;B	0.24541	0.054;0.014	T	0.30327	-0.9982	10	0.27785	T	0.31	-4.152	12.0343	0.53417	0.8706:0.0:0.0:0.1294	.	1913;1913	F5H269;Q9Y485	.;DMXL1_HUMAN	V	1913	ENSP00000309690:D1913V;ENSP00000439479:D1913V	ENSP00000309690:D1913V	D	+	2	0	DMXL1	118534123	1.000000	0.71417	0.936000	0.37596	0.578000	0.36192	3.276000	0.51646	0.941000	0.37499	0.455000	0.32223	GAT		0.393	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1		NM_005509	
DRD3	1814	hgsc.bcm.edu	37	3	113866367	113866367	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr3:113866367C>T	ENST00000460779.1	-	5	710	c.421G>A	c.(421-423)Ggc>Agc	p.G141S	DRD3_ENST00000295881.7_Missense_Mutation_p.G141S|DRD3_ENST00000467632.1_Missense_Mutation_p.G141S|DRD3_ENST00000383673.2_Missense_Mutation_p.G141S	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	141					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGTCCCGTGCCATGCTGGTAG	0.557																																																	0													107.0	92.0	97.0					3																	113866367		2203	4300	6503	SO:0001583	missense	1814				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.421G>A	3.37:g.113866367C>T	ENSP00000419402:p.Gly141Ser		A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864626	0.51482	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.46	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.214383	0.48767	N	0.000176	T	0.36608	0.0973	N	0.01197	-0.965	0.36146	D	0.847145	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.13407	0.003;0.009;0.009;0.006	T	0.30446	-0.9978	10	0.34782	T	0.22	.	4.7662	0.13134	0.0:0.6216:0.0:0.3784	.	141;141;141;141	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	S	141	ENSP00000419402:G141S;ENSP00000420662:G141S;ENSP00000373169:G141S;ENSP00000295881:G141S	ENSP00000281274:G141S	G	-	1	0	DRD3	115349057	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.676000	0.46883	1.540000	0.49301	0.655000	0.94253	GGC		0.557	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1		NM_000796.3	
EBF3	253738	hgsc.bcm.edu	37	10	131671768	131671768	+	Silent	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr10:131671768C>A	ENST00000355311.5	-	8	801	c.729G>T	c.(727-729)cgG>cgT	p.R243R	EBF3_ENST00000368648.3_Silent_p.R243R			Q9H4W6	COE3_HUMAN	early B-cell factor 3	243					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GGCGGCGGGCCCGCCTCCCGT	0.502																																																	0													58.0	58.0	58.0					10																	131671768		2203	4300	6503	SO:0001819	synonymous_variant	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.729G>T	10.37:g.131671768C>A			A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	37																																																																																					0.502	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2		NM_001005463	
EMX1	2016	hgsc.bcm.edu	37	2	73161063	73161063	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:73161063G>A	ENST00000258106.6	+	3	1231	c.853G>A	c.(853-855)Gat>Aat	p.D285N	EMX1_ENST00000394111.5_3'UTR	NM_004097.2	NP_004088.2	Q04741	EMX1_HUMAN	empty spiracles homeobox 1	252					brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|in utero embryonic development (GO:0001701)|neuron projection extension (GO:1990138)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.D285N(1)		cervix(1)|large_intestine(2)|lung(3)	6						GGAGGACATCGATGTCACCTC	0.622																																																	1	Substitution - Missense(1)	large_intestine(1)											61.0	70.0	67.0					2																	73161063		2132	4240	6372	SO:0001583	missense	2016			X68879	CCDS1921.2	2p13.2	2011-06-20	2007-02-15		ENSG00000135638	ENSG00000135638		"""Homeoboxes / ANTP class : NKL subclass"""	3340	protein-coding gene	gene with protein product		600034	"""empty spiracles homolog 1 (Drosophila)"""			7959790	Standard	XM_005264203		Approved		uc002sin.1	Q04741	OTTHUMG00000129778	ENST00000258106.6:c.853G>A	2.37:g.73161063G>A	ENSP00000258106:p.Asp285Asn		Q0D2P0|Q53T30|Q86XB0	Missense_Mutation	SNP	ENST00000258106.6	37	CCDS1921.2	.	.	.	.	.	.	.	.	.	.	G	33	5.199590	0.94997	.	.	ENSG00000135638	ENST00000258106	D	0.94417	-3.42	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.96870	0.8978	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96958	0.9699	10	0.59425	D	0.04	-15.1927	16.7907	0.85589	0.0:0.0:1.0:0.0	.	252	Q04741	EMX1_HUMAN	N	285	ENSP00000258106:D285N	ENSP00000258106:D285N	D	+	1	0	EMX1	73014571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.639000	0.89480	0.491000	0.48974	GAT		0.622	EMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251994.3			
FAM185A	222234	hgsc.bcm.edu	37	7	102417753	102417753	+	Missense_Mutation	SNP	T	T	G	rs201667800	byFrequency	TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:102417753T>G	ENST00000413034.2	+	6	889	c.889T>G	c.(889-891)Tat>Gat	p.Y297D	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Missense_Mutation_p.Y180D	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	297										kidney(1)	1						CATAGATGTTTATGTCAGCCA	0.343																																																	0													37.0	30.0	32.0					7																	102417753		692	1576	2268	SO:0001583	missense	222234			BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.889T>G	7.37:g.102417753T>G	ENSP00000395340:p.Tyr297Asp		A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	ENST00000413034.2	37	CCDS47676.1	.	.	.	.	.	.	.	.	.	.	T	13.11	2.140376	0.37825	.	.	ENSG00000222011	ENST00000432852;ENST00000409231;ENST00000413034	T;T	0.48836	0.93;0.8	4.05	4.05	0.47172	.	.	.	.	.	T	0.63474	0.2514	M	0.78916	2.43	0.46849	D	0.999225	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.80764	0.994;0.961;0.982	T	0.61888	-0.6970	9	0.21014	T	0.42	-9.9649	9.535	0.39218	0.0:0.0:0.0:1.0	.	197;180;297	B4DMG7;Q8N0U4-3;Q8N0U4	.;.;F185A_HUMAN	D	197;180;297	ENSP00000387066:Y180D;ENSP00000395340:Y297D	ENSP00000387066:Y180D	Y	+	1	0	FAM185A	102204989	1.000000	0.71417	0.993000	0.49108	0.492000	0.33523	2.697000	0.47060	1.815000	0.52974	0.358000	0.22013	TAT		0.343	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349482.1		NM_001145268	
FREM1	158326	hgsc.bcm.edu;ucsc.edu	37	9	14792818	14792818	+	Missense_Mutation	SNP	T	T	C	rs577186728		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr9:14792818T>C	ENST00000380880.3	-	22	4687	c.3904A>G	c.(3904-3906)Ata>Gta	p.I1302V	FREM1_ENST00000380881.4_Missense_Mutation_p.I1303V|FREM1_ENST00000422223.2_Missense_Mutation_p.I1302V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1302					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCTTCATCTATGGCTGAAAGA	0.358													T|||	1	0.000199681	0.0	0.0014	5008	,	,		18201	0.0		0.0	False		,,,				2504	0.0																0													66.0	62.0	63.0					9																	14792818		1826	4072	5898	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3904A>G	9.37:g.14792818T>C	ENSP00000370262:p.Ile1302Val		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	T	7.621	0.676908	0.14841	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.50277	0.75;0.75;0.75	6.08	-5.37	0.02681	.	0.922187	0.09530	N	0.789729	T	0.30885	0.0779	L	0.41710	1.295	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20840	-1.0263	10	0.30854	T	0.27	1.2207	6.5598	0.22479	0.1244:0.5578:0.1168:0.201	.	1302	Q5H8C1	FREM1_HUMAN	V	1303;1302;1302	ENSP00000370263:I1303V;ENSP00000412940:I1302V;ENSP00000370262:I1302V	ENSP00000370257:I1305V	I	-	1	0	FREM1	14782818	0.679000	0.27596	0.006000	0.13384	0.466000	0.32739	1.064000	0.30579	-1.018000	0.03363	-0.435000	0.05868	ATA		0.358	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2		NM_144966	
FAM78A	286336	hgsc.bcm.edu	37	9	134136484	134136484	+	Silent	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr9:134136484G>A	ENST00000372271.3	-	2	944	c.577C>T	c.(577-579)Ctg>Ttg	p.L193L	FAM78A_ENST00000247295.4_5'UTR|FAM78A_ENST00000372269.3_Silent_p.L190L	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	193										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		GTGGCCACCAGCCAGGTGGTG	0.612																																																	0													103.0	93.0	96.0					9																	134136484		2203	4300	6503	SO:0001819	synonymous_variant	286336			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.577C>T	9.37:g.134136484G>A			Q86VQ9|Q9H7P4	Silent	SNP	ENST00000372271.3	37	CCDS6941.2																																																																																				0.612	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054720.1		NM_033387	
FRMPD4	9758	hgsc.bcm.edu	37	X	12701706	12701706	+	Splice_Site	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:12701706G>T	ENST00000380682.1	+	6	1079	c.573G>T	c.(571-573)tcG>tcT	p.S191S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	191					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.S191S(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCCAAGTGTCGGTGAGTTTAC	0.448																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											96.0	73.0	81.0					X																	12701706		2203	4300	6503	SO:0001630	splice_region_variant	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.573+1G>T	X.37:g.12701706G>T			A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	CCDS35201.1																																																																																				0.448	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1		XM_045712	Silent
FZD4	8322	hgsc.bcm.edu	37	11	86662759	86662759	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr11:86662759A>C	ENST00000531380.1	-	2	1344	c.1039T>G	c.(1039-1041)Ttc>Gtc	p.F347V	PRSS23_ENST00000531521.1_3'UTR|PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	347					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCAATGTGGAAATAAGAGCTG	0.478																																																	0													82.0	79.0	80.0					11																	86662759		2201	4299	6500	SO:0001583	missense	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1039T>G	11.37:g.86662759A>C	ENSP00000434034:p.Phe347Val		A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	ENST00000531380.1	37	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.776044	0.70107	.	.	ENSG00000174804	ENST00000531380	D	0.89196	-2.48	5.59	5.59	0.84812	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.94781	0.8315	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.95155	0.8276	9	.	.	.	.	15.7697	0.78157	1.0:0.0:0.0:0.0	.	347	Q9ULV1	FZD4_HUMAN	V	347	ENSP00000434034:F347V	.	F	-	1	0	FZD4	86340407	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.135000	0.66039	0.459000	0.35465	TTC		0.478	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2		NM_012193	
GAB3	139716	hgsc.bcm.edu	37	X	153940887	153940887	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:153940887G>C	ENST00000369575.3	-	4	714	c.683C>G	c.(682-684)cCg>cGg	p.P228R	GAB3_ENST00000496390.1_Intron|GAB3_ENST00000424127.2_Missense_Mutation_p.P229R	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	228					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGAGGGGAGCGGCTGCAGGCA	0.542																																																	0													78.0	78.0	78.0					X																	153940887		2203	4300	6503	SO:0001583	missense	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.683C>G	X.37:g.153940887G>C	ENSP00000358588:p.Pro228Arg		A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	G	3.044	-0.196802	0.06259	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.18657	2.2;2.2;2.2	5.53	1.6	0.23607	.	0.947335	0.08825	N	0.888243	T	0.20251	0.0487	M	0.65975	2.015	0.09310	N	1	B;B;B	0.29341	0.242;0.111;0.111	B;B;B	0.25506	0.061;0.037;0.037	T	0.29336	-1.0015	10	0.26408	T	0.33	-7.5065	5.6105	0.17402	0.2586:0.1408:0.6006:0.0	.	229;229;228	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	R	228;229;229	ENSP00000358588:P228R;ENSP00000358581:P229R;ENSP00000399588:P229R	ENSP00000358581:P229R	P	-	2	0	GAB3	153594081	0.206000	0.23470	0.000000	0.03702	0.062000	0.15995	3.028000	0.49705	0.159000	0.19401	-0.322000	0.08575	CCG		0.542	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2		NM_001081573	
GNL3L	54552	hgsc.bcm.edu	37	X	54577458	54577458	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:54577458G>A	ENST00000336470.4	+	10	977	c.838G>A	c.(838-840)Gtg>Atg	p.V280M	GNL3L_ENST00000360845.2_Missense_Mutation_p.V280M	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	280	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						CGCATGCAGCGTGGGAGCTGT	0.557																																																	0													104.0	83.0	90.0					X																	54577458		2203	4300	6503	SO:0001583	missense	54552			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.838G>A	X.37:g.54577458G>A	ENSP00000338573:p.Val280Met			Missense_Mutation	SNP	ENST00000336470.4	37	CCDS14360.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154464	0.78114	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.25085	1.82;1.82	4.63	4.63	0.57726	GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71262	-0.4645	10	0.87932	D	0	-10.5393	15.9996	0.80285	0.0:0.0:1.0:0.0	.	280	Q9NVN8	GNL3L_HUMAN	M	280	ENSP00000338573:V280M;ENSP00000354091:V280M	ENSP00000338573:V280M	V	+	1	0	GNL3L	54594183	1.000000	0.71417	0.956000	0.39512	0.700000	0.40528	9.005000	0.93587	2.227000	0.72691	0.436000	0.28706	GTG		0.557	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056805.1		NM_019067	
GAB3	139716	hgsc.bcm.edu	37	X	153940946	153940946	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:153940946G>C	ENST00000369575.3	-	4	655	c.624C>G	c.(622-624)aaC>aaG	p.N208K	GAB3_ENST00000496390.1_Intron|GAB3_ENST00000424127.2_Missense_Mutation_p.N209K	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	208					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AACGGTCTGAGTTTGACCAGC	0.507																																																	0													59.0	55.0	57.0					X																	153940946		2203	4300	6503	SO:0001583	missense	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.624C>G	X.37:g.153940946G>C	ENSP00000358588:p.Asn208Lys		A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840603	0.51057	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.27890	1.64;1.64;1.64	5.53	0.542	0.17174	.	0.131367	0.64402	D	0.000003	T	0.42017	0.1184	M	0.77616	2.38	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.963;0.963	T	0.60571	-0.7237	10	0.02654	T	1	-11.8113	4.4623	0.11671	0.4499:0.0:0.4007:0.1494	.	209;209;208	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	K	208;209;209	ENSP00000358588:N208K;ENSP00000358581:N209K;ENSP00000399588:N209K	ENSP00000358581:N209K	N	-	3	2	GAB3	153594140	1.000000	0.71417	0.964000	0.40570	0.786000	0.44442	1.315000	0.33608	-0.066000	0.12998	0.506000	0.49869	AAC		0.507	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2		NM_001081573	
GUSB	2990	hgsc.bcm.edu	37	7	65432870	65432870	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:65432870A>C	ENST00000304895.4	-	10	1631	c.1501T>G	c.(1501-1503)Ttg>Gtg	p.L501V	GUSB_ENST00000421103.1_Missense_Mutation_p.L355V|GUSB_ENST00000345660.6_Missense_Mutation_p.L450V	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	501					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						TAGCTGTTCAAACAGATCACA	0.522																																																	0													67.0	65.0	66.0					7																	65432870		2203	4300	6503	SO:0001583	missense	2990			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1501T>G	7.37:g.65432870A>C	ENSP00000302728:p.Leu501Val		B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	A	5.957	0.360516	0.11296	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.95238	-3.65;-3.65;-3.65	5.45	2.15	0.27550	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.250325	0.39985	N	0.001219	D	0.83487	0.5265	N	0.11255	0.115	0.24607	N	0.993747	B;B	0.14438	0.01;0.0	B;B	0.20577	0.03;0.007	T	0.68390	-0.5421	10	0.02654	T	1	.	8.3781	0.32455	0.1313:0.7109:0.0:0.1578	.	355;501	E9PCV0;P08236	.;BGLR_HUMAN	V	501;355;450	ENSP00000302728:L501V;ENSP00000391390:L355V;ENSP00000340734:L450V	ENSP00000302728:L501V	L	-	1	2	GUSB	65070305	0.998000	0.40836	0.992000	0.48379	0.645000	0.38454	2.087000	0.41653	0.663000	0.31027	-0.326000	0.08463	TTG		0.522	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3		NM_000181	
GUSB	2990	hgsc.bcm.edu	37	7	65432873	65432873	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:65432873A>G	ENST00000304895.4	-	10	1628	c.1498T>C	c.(1498-1500)Tgt>Cgt	p.C500R	GUSB_ENST00000421103.1_Missense_Mutation_p.C354R|GUSB_ENST00000345660.6_Missense_Mutation_p.C449R	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	500					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						CTGTTCAAACAGATCACATCC	0.522																																																	0													65.0	63.0	64.0					7																	65432873		2203	4300	6503	SO:0001583	missense	2990			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1498T>C	7.37:g.65432873A>G	ENSP00000302728:p.Cys500Arg		B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	A	17.27	3.346863	0.61183	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.95342	-3.68;-3.68;-3.68	5.45	4.26	0.50523	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.042416	0.85682	D	0.000000	D	0.97766	0.9267	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97707	1.0188	10	0.72032	D	0.01	.	11.6644	0.51366	0.8513:0.1487:0.0:0.0	.	354;500	E9PCV0;P08236	.;BGLR_HUMAN	R	500;354;449	ENSP00000302728:C500R;ENSP00000391390:C354R;ENSP00000340734:C449R	ENSP00000302728:C500R	C	-	1	0	GUSB	65070308	1.000000	0.71417	0.997000	0.53966	0.610000	0.37248	9.200000	0.95010	0.864000	0.35578	0.443000	0.29094	TGT		0.522	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3		NM_000181	
GRM8	2918	hgsc.bcm.edu	37	7	126086265	126086265	+	Silent	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr7:126086265G>T	ENST00000339582.2	-	10	3400	c.2592C>A	c.(2590-2592)acC>acA	p.T864T	GRM8_ENST00000444921.2_Silent_p.T864T|GRM8_ENST00000358373.3_Silent_p.T864T			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	864					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TGCTTTGCATGGTGGCAGCTG	0.418										HNSCC(24;0.065)																																							0													192.0	171.0	178.0					7																	126086265		2203	4300	6503	SO:0001819	synonymous_variant	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2592C>A	7.37:g.126086265G>T			A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	ENST00000339582.2	37	CCDS5794.1																																																																																				0.418	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			
IKBKE	9641	hgsc.bcm.edu	37	1	206661295	206661295	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:206661295A>T	ENST00000367120.3	+	16	2034	c.1661A>T	c.(1660-1662)tAc>tTc	p.Y554F	IKBKE_ENST00000537984.1_Missense_Mutation_p.Y469F	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	554	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					AACTTCATCTACAAACAGTTC	0.507																																																	0													55.0	51.0	53.0					1																	206661295		2203	4300	6503	SO:0001583	missense	9641			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1661A>T	1.37:g.206661295A>T	ENSP00000356087:p.Tyr554Phe		D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	37	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801029	0.50315	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.17370	2.28;2.28	5.83	4.69	0.59074	.	0.126953	0.53938	D	0.000050	T	0.15305	0.0369	L	0.42245	1.32	0.24466	N	0.994419	B;B	0.17852	0.004;0.024	B;B	0.15484	0.008;0.013	T	0.14783	-1.0460	10	0.42905	T	0.14	-4.7271	10.0463	0.42188	0.8497:0.0:0.0:0.1502	.	469;554	Q3B754;Q14164	.;IKKE_HUMAN	F	554;469	ENSP00000356087:Y554F;ENSP00000444529:Y469F	ENSP00000356087:Y554F	Y	+	2	0	IKBKE	204727918	1.000000	0.71417	0.991000	0.47740	0.980000	0.70556	5.880000	0.69698	1.010000	0.39314	-0.468000	0.05107	TAC		0.507	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1			
INTS8	55656	hgsc.bcm.edu;ucsc.edu	37	8	95850820	95850820	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr8:95850820A>G	ENST00000523731.1	+	8	1124	c.991A>G	c.(991-993)Att>Gtt	p.I331V	INTS8_ENST00000447247.1_Missense_Mutation_p.I331V	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	331					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					TCAAGTCCATATTTGTTTGAG	0.423																																																	0													172.0	154.0	160.0					8																	95850820		2203	4300	6503	SO:0001583	missense	55656			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.991A>G	8.37:g.95850820A>G	ENSP00000430338:p.Ile331Val		B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	CCDS34925.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.54|11.54	1.669020|1.669020	0.29604|0.29604	.|.	.|.	ENSG00000164941|ENSG00000164941	ENST00000520526|ENST00000523731;ENST00000447247	.|.	.|.	.|.	5.42|5.42	2.97|2.97	0.34412|0.34412	.|.	0.327504|0.327504	0.38381|0.38381	N|N	0.001708|0.001708	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.08118|0.08118	0|0	0.25234|0.25234	N|N	0.989807|0.989807	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.09377	.|0.004;0.0	T|T	0.19386|0.19386	-1.0307|-1.0307	6|9	.|0.25106	.|T	.|0.35	-18.0105|-18.0105	7.8447|7.8447	0.29419|0.29419	0.789:0.139:0.0721:0.0|0.789:0.139:0.0721:0.0	.|.	.|331;331	.|Q75QN2;Q75QN2-2	.|INT8_HUMAN;.	M|V	152|331	.|.	.|ENSP00000343274:I331V	I|I	+|+	3|1	3|0	INTS8|INTS8	95919996|95919996	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.927000|0.927000	0.56198|0.56198	3.061000|3.061000	0.49963|0.49963	0.327000|0.327000	0.23409|0.23409	0.402000|0.402000	0.26972|0.26972	ATA|ATT		0.423	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1		NM_017864	
KDM5C	8242	hgsc.bcm.edu	37	X	53240705	53240705	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:53240705T>A	ENST00000375401.3	-	10	1907	c.1375A>T	c.(1375-1377)Aaa>Taa	p.K459*	KDM5C_ENST00000375379.3_Nonsense_Mutation_p.K459*|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000375383.3_Nonsense_Mutation_p.K418*|KDM5C_ENST00000452825.3_Nonsense_Mutation_p.K392*|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000404049.3_Nonsense_Mutation_p.K458*	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	459					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AGGTGCCGTTTACTGTCACTG	0.463			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													93.0	65.0	75.0					X																	53240705		2203	4300	6503	SO:0001587	stop_gained	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1375A>T	X.37:g.53240705T>A	ENSP00000364550:p.Lys459*		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Nonsense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	T	44	10.848525	0.99477	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	.	.	.	5.79	5.79	0.91817	.	0.045370	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.7162	12.8555	0.57882	0.0:0.0:0.0:1.0	.	.	.	.	X	392;459;458;459;418	.	ENSP00000364528:K459X	K	-	1	0	KDM5C	53257430	0.991000	0.36638	1.000000	0.80357	0.933000	0.57130	1.431000	0.34925	1.943000	0.56356	0.486000	0.48141	AAA		0.463	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
KIAA2022	340533	hgsc.bcm.edu	37	X	73964285	73964285	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chrX:73964285T>A	ENST00000055682.6	-	3	718	c.107A>T	c.(106-108)aAg>aTg	p.K36M		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	36					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TGCAAATGACTTCATTGCCAC	0.463																																																	0													34.0	34.0	34.0					X																	73964285		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.107A>T	X.37:g.73964285T>A	ENSP00000055682:p.Lys36Met		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733984	0.69189	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.38887	1.11;1.11	5.11	5.11	0.69529	.	0.177255	0.49305	D	0.000158	T	0.49508	0.1561	L	0.36672	1.1	0.35559	D	0.804489	D	0.76494	0.999	D	0.65443	0.935	T	0.62329	-0.6877	10	0.87932	D	0	-13.7939	8.8093	0.34956	0.0:0.0959:0.0:0.9041	.	36	Q5QGS0	K2022_HUMAN	M	36	ENSP00000362567:K36M;ENSP00000055682:K36M	ENSP00000055682:K36M	K	-	2	0	KIAA2022	73881010	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	3.965000	0.56788	1.886000	0.54624	0.486000	0.48141	AAG		0.463	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2		NM_001008537	
KLF9	687	hgsc.bcm.edu	37	9	73027905	73027905	+	Silent	SNP	G	G	A	rs546443212		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr9:73027905G>A	ENST00000377126.2	-	1	1635	c.375C>T	c.(373-375)tcC>tcT	p.S125S		NM_001206.2	NP_001197.1	Q13886	KLF9_HUMAN	Kruppel-like factor 9	125					cellular response to thyroid hormone stimulus (GO:0097067)|embryo implantation (GO:0007566)|progesterone receptor signaling pathway (GO:0050847)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	9						GATGGAGGAGGGAGAGCGGGC	0.612																																																	0													92.0	95.0	94.0					9																	73027905		2203	4300	6503	SO:0001819	synonymous_variant	687			BC069431	CCDS6633.1	9q21.11	2013-01-08	2004-11-29	2004-12-01	ENSG00000119138	ENSG00000119138		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	1123	protein-coding gene	gene with protein product		602902	"""basic transcription element binding protein 1"""	BTEB1		1356762	Standard	NM_001206		Approved		uc004aht.3	Q13886	OTTHUMG00000019991	ENST00000377126.2:c.375C>T	9.37:g.73027905G>A			B2R943|Q16196	Silent	SNP	ENST00000377126.2	37	CCDS6633.1																																																																																				0.612	KLF9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052602.1		NM_001206	
LDB3	11155	hgsc.bcm.edu	37	10	88476182	88476182	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr10:88476182G>C	ENST00000361373.4	+	9	1351	c.1330G>C	c.(1330-1332)Gcc>Ccc	p.A444P	LDB3_ENST00000263066.6_Missense_Mutation_p.A334P|LDB3_ENST00000429277.2_Missense_Mutation_p.A449P|LDB3_ENST00000458213.2_Missense_Mutation_p.A334P|LDB3_ENST00000352360.5_Missense_Mutation_p.A187P	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						ccctgcccctgcctacacccc	0.652																																																	0													25.0	24.0	24.0					10																	88476182		2192	4264	6456	SO:0001583	missense	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1330G>C	10.37:g.88476182G>C	ENSP00000355296:p.Ala444Pro			Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208962	0.39003	.	.	ENSG00000122367	ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	T;T;T;T;T	0.54071	0.78;0.63;0.6;0.63;0.59	4.32	2.05	0.26809	.	0.805872	0.10145	N	0.710390	T	0.29389	0.0732	N	0.03608	-0.345	0.80722	D	1	B;B;B;D;B	0.53885	0.001;0.437;0.0;0.963;0.0	B;B;B;P;B	0.46796	0.001;0.143;0.002;0.527;0.001	T	0.04400	-1.0954	10	0.21540	T	0.41	.	4.7296	0.12957	0.1602:0.2243:0.6155:0.0	.	449;381;187;444;334	B4E3K3;F5H0C2;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	P	449;334;187;334;444	ENSP00000401437:A449P;ENSP00000409148:A334P;ENSP00000263067:A187P;ENSP00000263066:A334P;ENSP00000355296:A444P	ENSP00000263066:A334P	A	+	1	0	LDB3	88466162	0.931000	0.31567	0.999000	0.59377	0.787000	0.44495	0.960000	0.29253	0.761000	0.33130	0.650000	0.86243	GCC		0.652	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			
LONP2	83752	hgsc.bcm.edu;ucsc.edu	37	16	48286144	48286144	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr16:48286144G>C	ENST00000285737.4	+	2	429	c.336G>C	c.(334-336)caG>caC	p.Q112H	LONP2_ENST00000535754.1_Missense_Mutation_p.Q112H	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AGATTGTACAGGTCTTAAAAG	0.512																																																	0													78.0	70.0	73.0					16																	48286144		2200	4300	6500	SO:0001583	missense	83752			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.336G>C	16.37:g.48286144G>C	ENSP00000285737:p.Gln112His			Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199727	0.58126	.	.	ENSG00000102910	ENST00000285737;ENST00000535754;ENST00000416006	T;T;T	0.42900	0.96;0.96;0.96	5.08	4.11	0.48088	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.324362	0.33572	N	0.004772	T	0.38746	0.1052	L	0.44542	1.39	0.33996	D	0.649691	P;P	0.34815	0.47;0.47	B;B	0.41619	0.361;0.361	T	0.53315	-0.8456	10	0.44086	T	0.13	-15.0781	9.6864	0.40100	0.1561:0.0:0.8439:0.0	.	112;112	B7ZKL7;Q86WA8	.;LONP2_HUMAN	H	112	ENSP00000285737:Q112H;ENSP00000445426:Q112H;ENSP00000415983:Q112H	ENSP00000285737:Q112H	Q	+	3	2	LONP2	46843645	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.459000	0.35234	2.524000	0.85096	0.650000	0.86243	CAG		0.512	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2		NM_031490	
KMT2D	8085	hgsc.bcm.edu	37	12	49427984	49427984	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr12:49427984G>A	ENST00000301067.7	-	38	10605	c.10606C>T	c.(10606-10608)Cgc>Tgc	p.R3536C	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3536	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CGGGACTTGCGGTGTACACCA	0.552																																																	0													106.0	105.0	105.0					12																	49427984		2028	4195	6223	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10606C>T	12.37:g.49427984G>A	ENSP00000301067:p.Arg3536Cys		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	9.769	1.172050	0.21704	.	.	ENSG00000167548	ENST00000301067	T	0.44083	0.93	5.38	5.38	0.77491	.	0.000000	0.37304	N	0.002144	T	0.59046	0.2165	L	0.54323	1.7	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.60239	-0.7302	10	0.87932	D	0	.	13.2868	0.60247	0.0:0.0:0.8414:0.1586	.	3536	O14686	MLL2_HUMAN	C	3536	ENSP00000301067:R3536C	ENSP00000301067:R3536C	R	-	1	0	MLL2	47714251	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.427000	0.34881	2.711000	0.92665	0.563000	0.77884	CGC		0.552	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			
NDST4	64579	hgsc.bcm.edu;ucsc.edu	37	4	115997895	115997895	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr4:115997895C>T	ENST00000264363.2	-	2	976	c.298G>A	c.(298-300)Gag>Aag	p.E100K		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	100	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CGGCTGGACTCCAAAATAGCT	0.413																																																	0													109.0	121.0	117.0					4																	115997895		2203	4300	6503	SO:0001583	missense	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.298G>A	4.37:g.115997895C>T	ENSP00000264363:p.Glu100Lys		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783231	0.90282	.	.	ENSG00000138653	ENST00000264363	T	0.39787	1.06	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.64216	0.2578	M	0.83692	2.655	0.80722	D	1	B	0.32800	0.385	P	0.48952	0.596	T	0.68281	-0.5450	10	0.59425	D	0.04	.	18.0522	0.89353	0.0:1.0:0.0:0.0	.	100	Q9H3R1	NDST4_HUMAN	K	100	ENSP00000264363:E100K	ENSP00000264363:E100K	E	-	1	0	NDST4	116217344	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.767000	0.85331	2.239000	0.73571	0.467000	0.42956	GAG		0.413	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1		NM_022569	
NPR1	4881	hgsc.bcm.edu;ucsc.edu	37	1	153659771	153659771	+	Silent	SNP	C	C	A	rs139564474		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:153659771C>A	ENST00000368680.3	+	13	2503	c.2031C>A	c.(2029-2031)acC>acA	p.T677T		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	677	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TCAAGATCACCGACTATGGGC	0.547																																					Pancreas(141;1349 1870 15144 15830 40702)												0													130.0	106.0	114.0					1																	153659771		2203	4300	6503	SO:0001819	synonymous_variant	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2031C>A	1.37:g.153659771C>A			B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	ENST00000368680.3	37	CCDS1051.1																																																																																				0.547	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1		NM_000906	
NUP93	9688	hgsc.bcm.edu	37	16	56875675	56875675	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr16:56875675T>G	ENST00000308159.5	+	21	2400	c.2279T>G	c.(2278-2280)tTt>tGt	p.F760C	NUP93_ENST00000542526.1_Missense_Mutation_p.F637C|NUP93_ENST00000569842.1_Missense_Mutation_p.F760C|NUP93_ENST00000564887.1_Missense_Mutation_p.F637C	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	760					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TTCACACAGTTTAAGAGGCTC	0.488																																					Colon(33;610 796 1305 1705 38917)												0													143.0	127.0	133.0					16																	56875675		2198	4300	6498	SO:0001583	missense	9688			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.2279T>G	16.37:g.56875675T>G	ENSP00000310668:p.Phe760Cys		B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034020	0.54896	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.42900	0.96;0.96	6.17	5.02	0.67125	.	0.147736	0.64402	D	0.000006	T	0.25005	0.0607	N	0.14661	0.345	0.43965	D	0.996645	B	0.02656	0.0	B	0.09377	0.004	T	0.06534	-1.0821	10	0.39692	T	0.17	-17.0143	9.2766	0.37703	0.2795:0.0:0.0:0.7205	.	760	Q8N1F7	NUP93_HUMAN	C	760;637	ENSP00000310668:F760C;ENSP00000440235:F637C	ENSP00000310668:F760C	F	+	2	0	NUP93	55433176	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.595000	0.74109	2.371000	0.80710	0.533000	0.62120	TTT		0.488	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4		NM_014669	
NABP1	64859	hgsc.bcm.edu;ucsc.edu	37	2	192550347	192550347	+	Silent	SNP	T	T	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:192550347T>G	ENST00000425611.2	+	6	551	c.468T>G	c.(466-468)ccT>ccG	p.P156P	NABP1_ENST00000410026.2_Silent_p.P76P|NABP1_ENST00000409510.1_Silent_p.P76P	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	156					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)										ACACTGGCCCTGAATCAAGGG	0.393																																																	0													69.0	63.0	65.0					2																	192550347		2203	4300	6503	SO:0001819	synonymous_variant	0			BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.468T>G	2.37:g.192550347T>G			Q658Y8|Q9H5X6	Silent	SNP	ENST00000425611.2	37	CCDS33352.1	.	.	.	.	.	.	.	.	.	.	T	2.651	-0.281866	0.05642	.	.	ENSG00000173559	ENST00000435931	.	.	.	5.09	1.12	0.20585	.	.	.	.	.	T	0.45558	0.1348	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23297	-1.0192	4	.	.	.	.	3.6836	0.08320	0.3801:0.1737:0.0:0.4462	.	.	.	.	R	120	.	.	L	+	2	0	OBFC2A	192258592	1.000000	0.71417	0.953000	0.39169	0.347000	0.29111	0.586000	0.23894	0.097000	0.17492	0.528000	0.53228	CTG		0.393	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1		NM_022837	
PDYN	5173	hgsc.bcm.edu	37	20	1961196	1961196	+	Missense_Mutation	SNP	G	G	C	rs370283678		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr20:1961196G>C	ENST00000217305.2	-	4	763	c.538C>G	c.(538-540)Cgc>Ggc	p.R180G	PDYN_ENST00000540134.1_Missense_Mutation_p.R180G|PDYN_ENST00000539905.1_Missense_Mutation_p.R180G|RP4-684O24.5_ENST00000446562.1_RNA	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	180					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.R180C(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGTATTTGCGCAAAAAGCCC	0.602																																																	1	Substitution - Missense(1)	ovary(1)											98.0	103.0	101.0					20																	1961196		2203	4300	6503	SO:0001583	missense	5173				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.538C>G	20.37:g.1961196G>C	ENSP00000217305:p.Arg180Gly		A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	37	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294688	0.81025	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.86769	-2.17;-2.17;-2.17	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.94162	0.8127	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95090	0.8221	10	0.87932	D	0	-18.2484	15.1657	0.72821	0.0:0.0:1.0:0.0	.	180	P01213	PDYN_HUMAN	G	180	ENSP00000440185:R180G;ENSP00000442259:R180G;ENSP00000217305:R180G	ENSP00000217305:R180G	R	-	1	0	PDYN	1909196	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	1.034000	0.30204	2.445000	0.82738	0.313000	0.20887	CGC		0.602	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2			
PABPC1L	80336	hgsc.bcm.edu	37	20	43541488	43541488	+	Silent	SNP	T	T	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr20:43541488T>C	ENST00000217073.2	+	2	381	c.381T>C	c.(379-381)tcT>tcC	p.S127S	PABPC1L_ENST00000255136.3_Silent_p.S127S|PABPC1L_ENST00000217074.4_Silent_p.S127S|PABPC1L_ENST00000537323.1_Silent_p.S127S			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	127	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						ACATCCTCTCTTGCAAGGTAG	0.478																																																	0													114.0	96.0	101.0					20																	43541488		1568	3582	5150	SO:0001819	synonymous_variant	80336			AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.381T>C	20.37:g.43541488T>C			Q4VY17	Silent	SNP	ENST00000217073.2	37	CCDS42878.1																																																																																				0.478	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2			
PIGR	5284	hgsc.bcm.edu	37	1	207110590	207110590	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:207110590G>A	ENST00000356495.4	-	4	1078	c.895C>T	c.(895-897)Ctc>Ttc	p.L299F		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	299	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGGGGGTTGAGCAGGATCCTG	0.592																																																	0													82.0	77.0	78.0					1																	207110590		2203	4300	6503	SO:0001583	missense	5284				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.895C>T	1.37:g.207110590G>A	ENSP00000348888:p.Leu299Phe		Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722784	0.30503	.	.	ENSG00000162896	ENST00000356495	T	0.67345	-0.26	5.49	-0.581	0.11713	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.696678	0.13551	N	0.379481	T	0.54367	0.1854	L	0.58669	1.825	0.09310	N	1	B	0.19445	0.036	B	0.21917	0.037	T	0.40813	-0.9543	10	0.27082	T	0.32	-20.4398	4.0249	0.09683	0.3111:0.0:0.4247:0.2642	.	299	P01833	PIGR_HUMAN	F	299	ENSP00000348888:L299F	ENSP00000348888:L299F	L	-	1	0	PIGR	205177213	0.001000	0.12720	0.001000	0.08648	0.246000	0.25737	-0.037000	0.12164	-0.002000	0.14469	0.650000	0.86243	CTC		0.592	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1		NM_002644	
POTED	317754	hgsc.bcm.edu	37	21	15013880	15013880	+	Missense_Mutation	SNP	A	A	G	rs199555161		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr21:15013880A>G	ENST00000299443.5	+	11	1800	c.1748A>G	c.(1747-1749)aAt>aGt	p.N583S		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	583						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						ACGAAAACCAATATTTAAGTA	0.358																																																	0																																										SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1748A>G	21.37:g.15013880A>G	ENSP00000299443:p.Asn583Ser		C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	538	0.24633699633699635	132	0.2682926829268293	53	0.1464088397790055	187	0.3269230769230769	166	0.21899736147757257	A	0.001	-3.501032	0.00010	.	.	ENSG00000166351	ENST00000299443	T	0.26223	1.75	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36939	-0.9727	7	0.06891	T	0.86	.	.	.	.	.	583	Q86YR6	POTED_HUMAN	S	583	ENSP00000299443:N583S	ENSP00000299443:N583S	N	+	2	0	POTED	13935751	0.002000	0.14202	0.002000	0.10522	0.001000	0.01503	-0.414000	0.07114	-1.299000	0.02344	-1.288000	0.01363	AAT		0.358	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1		NM_174981	
POTEF	728378	hgsc.bcm.edu	37	2	130831983	130831983	+	Missense_Mutation	SNP	G	G	A	rs202034265		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:130831983G>A	ENST00000409914.2	-	17	3461	c.3062C>T	c.(3061-3063)gCg>gTg	p.A1021V	POTEF_ENST00000357462.5_Missense_Mutation_p.A1021V	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	1021	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CATGCTAGGCGCCAGGGCAGC	0.592																																																	0													1.0	1.0	1.0					2																	130831983		153	429	582	SO:0001583	missense	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.3062C>T	2.37:g.130831983G>A	ENSP00000386786:p.Ala1021Val		A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	15.47	2.842482	0.51057	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.94723	-3.5;-3.5	.	.	.	.	.	.	.	.	D	0.93331	0.7874	M	0.79475	2.455	0.80722	D	1	P	0.48834	0.916	P	0.46172	0.506	D	0.90048	0.4147	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	1021	A5A3E0	POTEF_HUMAN	V	1021	ENSP00000350052:A1021V;ENSP00000386786:A1021V	ENSP00000350052:A1021V	A	-	2	0	POTEF	130548453	1.000000	0.71417	0.075000	0.20258	0.076000	0.17211	6.566000	0.73978	0.119000	0.18210	0.121000	0.15741	GCG		0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2		NM_001099771	
PPM1E	22843	hgsc.bcm.edu	37	17	57047047	57047047	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr17:57047047C>T	ENST00000308249.2	+	4	1060	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	36					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)	p.R311G(1)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			CAGGGCCTTCCGGGTCACTGA	0.517																																																	1	Substitution - Missense(1)	breast(1)											83.0	75.0	77.0					17																	57047047		2203	4300	6503	SO:0001583	missense	22843			AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.931C>T	17.37:g.57047047C>T	ENSP00000312411:p.Arg311Trp		Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168648	0.78339	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.18338	2.22	5.49	4.49	0.54785	.	0.052050	0.85682	D	0.000000	T	0.44030	0.1274	M	0.81682	2.555	0.45867	D	0.99872	D;D	0.89917	1.0;1.0	D;D	0.74023	0.972;0.982	T	0.47586	-0.9106	10	0.49607	T	0.09	-6.2566	15.7291	0.77788	0.1378:0.8621:0.0:0.0	.	320;311	Q8WY54-3;Q8WY54-2	.;.	W	311;162	ENSP00000312411:R311W	ENSP00000312411:R311W	R	+	1	2	PPM1E	54401829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.125000	0.57931	1.398000	0.46701	0.563000	0.77884	CGG		0.517	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1		NM_014906	
PPP3CA	5530	hgsc.bcm.edu;ucsc.edu	37	4	102015047	102015047	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr4:102015047G>T	ENST00000394854.3	-	6	1351	c.668C>A	c.(667-669)gCa>gAa	p.A223E	PPP3CA_ENST00000394853.4_Missense_Mutation_p.A223E|PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000323055.6_Missense_Mutation_p.A223E|PPP3CA_ENST00000510292.1_5'UTR|PPP3CA_ENST00000523694.2_Missense_Mutation_p.A156E|PPP3CA_ENST00000507176.1_Missense_Mutation_p.A125E	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	223	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		AGGTCCATATGCAGGTGGTTC	0.403																																																	0													92.0	91.0	91.0					4																	102015047		2203	4300	6503	SO:0001583	missense	5530				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.668C>A	4.37:g.102015047G>T	ENSP00000378323:p.Ala223Glu		A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091752	0.76756	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T	0.05139	3.49;3.49;3.49;3.49;3.49	5.26	5.26	0.73747	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.05090	0.0136	N	0.05124	-0.11	0.80722	D	1	B;B;B;P;B	0.36974	0.115;0.012;0.039;0.576;0.207	B;B;B;B;B	0.37943	0.261;0.07;0.05;0.188;0.121	T	0.53308	-0.8457	10	0.49607	T	0.09	-11.8689	18.4949	0.90861	0.0:0.0:1.0:0.0	.	223;223;223;125;156	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	E	223;223;223;125;156	ENSP00000378323:A223E;ENSP00000320580:A223E;ENSP00000378322:A223E;ENSP00000422990:A125E;ENSP00000429350:A156E	ENSP00000320580:A223E	A	-	2	0	PPP3CA	102234070	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.497000	0.97970	2.453000	0.82957	0.453000	0.30009	GCA		0.403	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2		NM_000944	
PSD4	23550	hgsc.bcm.edu;ucsc.edu	37	2	113942578	113942578	+	Silent	SNP	C	C	T	rs373584220	byFrequency	TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:113942578C>T	ENST00000245796.6	+	3	1296	c.1101C>T	c.(1099-1101)gaC>gaT	p.D367D	PSD4_ENST00000441564.3_Silent_p.D367D	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	367					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						cgtgtgtggacgaagcattga	0.547													C|||	4	0.000798722	0.0	0.0	5008	,	,		21949	0.0		0.0	False		,,,				2504	0.0041																0													276.0	249.0	258.0					2																	113942578		2203	4300	6503	SO:0001819	synonymous_variant	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1101C>T	2.37:g.113942578C>T			A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	ENST00000245796.6	37	CCDS33276.1																																																																																				0.547	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1		NM_012455	
PTPN4	5775	hgsc.bcm.edu;ucsc.edu	37	2	120709630	120709630	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:120709630G>T	ENST00000263708.2	+	19	2509	c.1738G>T	c.(1738-1740)Gat>Tat	p.D580Y	PTPN4_ENST00000544261.1_Missense_Mutation_p.D213Y	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	580	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	ACACACTCATGATCAGGTTGT	0.423																																																	0													163.0	150.0	154.0					2																	120709630		2203	4300	6503	SO:0001583	missense	5775				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1738G>T	2.37:g.120709630G>T	ENSP00000263708:p.Asp580Tyr		B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	32	5.133568	0.94517	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	T;T	0.33654	1.4;1.4	6.07	6.07	0.98685	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	M	0.74546	2.27	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.64114	-0.6483	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	580	P29074	PTN4_HUMAN	Y	580;213	ENSP00000263708:D580Y;ENSP00000445841:D213Y	ENSP00000263708:D580Y	D	+	1	0	PTPN4	120426100	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.705000	0.98719	2.885000	0.99019	0.655000	0.94253	GAT		0.423	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			
PYGL	5836	hgsc.bcm.edu;ucsc.edu	37	14	51372121	51372121	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr14:51372121T>G	ENST00000216392.7	-	20	2865	c.2533A>C	c.(2533-2535)Aat>Cat	p.N845H	PYGL_ENST00000532462.1_Intron|PYGL_ENST00000544180.2_Missense_Mutation_p.N811H	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	845			N -> S (in dbSNP:rs78558135). {ECO:0000269|PubMed:14702039}.		5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	CAATTTCCATTGACTTTGTTA	0.328																																																	0													124.0	122.0	123.0					14																	51372121		2203	4300	6503	SO:0001583	missense	5836				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.2533A>C	14.37:g.51372121T>G	ENSP00000216392:p.Asn845His		A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	ENST00000216392.7	37	CCDS32080.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165684	0.38217	.	.	ENSG00000100504	ENST00000544180;ENST00000216392	D;D	0.93019	-3.12;-3.15	6.07	2.46	0.29980	.	0.548656	0.21650	N	0.071191	D	0.84511	0.5488	N	0.08118	0	0.22050	N	0.999392	B;B	0.31351	0.32;0.214	B;B	0.38056	0.264;0.085	T	0.75858	-0.3169	10	0.49607	T	0.09	-6.3846	5.1483	0.14996	0.0:0.1563:0.1529:0.6908	.	811;845	F5H816;P06737	.;PYGL_HUMAN	H	811;845	ENSP00000443787:N811H;ENSP00000216392:N845H	ENSP00000216392:N845H	N	-	1	0	PYGL	50441871	0.009000	0.17119	0.059000	0.19551	0.424000	0.31475	1.038000	0.30254	0.185000	0.20105	-0.996000	0.02517	AAT		0.328	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3		NM_002863	
RGPD5	84220	hgsc.bcm.edu	37	2	110593536	110593536	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:110593536C>A	ENST00000016946.3	+	20	2996	c.2838C>A	c.(2836-2838)ttC>ttA	p.F946L		NM_005054.2	NP_005045.2	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5	946				F -> L (in Ref. 1; AAB41848). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)				central_nervous_system(1)	1						ATACTGGCTTCCAGGCTCAGG	0.423																																																	0													0.0	1.0	1.0					2																	110593536		0	4	4	SO:0001583	missense	84220			U64675	CCDS2082.1, CCDS2083.1	2q13	2013-01-10			ENSG00000015568	ENSG00000015568		"""Tetratricopeptide (TTC) repeat domain containing"""	32418	protein-coding gene	gene with protein product		612708				15710750, 15815621	Standard	NM_032260		Approved	RGP5, BS-63, DKFZp686I1842		Q99666	OTTHUMG00000130985	ENST00000016946.3:c.2838C>A	2.37:g.110593536C>A	ENSP00000016946:p.Phe946Leu		Q53QN2|Q53T03|Q59GM7|Q9H0B2	Missense_Mutation	SNP	ENST00000016946.3	37	CCDS2082.1	.	.	.	.	.	.	.	.	.	.	c	0.016	-1.528123	0.00959	.	.	ENSG00000015568	ENST00000016946	T	0.36520	1.25	.	.	.	.	.	.	.	.	T	0.19087	0.0458	N	0.25647	0.755	0.43913	P	0.003441999999999945	B	0.16802	0.019	B	0.12156	0.007	T	0.26883	-1.0090	7	0.20046	T	0.44	1.6924	2.6652	0.05046	0.0:0.5:0.0:0.5	.	946	Q99666	RGPD5_HUMAN	L	946	ENSP00000016946:F946L	ENSP00000016946:F946L	F	+	3	2	RGPD5	109950825	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.316000	0.19469	-0.000000	0.14550	0.000000	0.15137	TTC		0.423	RGPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253599.3		NM_005054	
RNASEL	6041	hgsc.bcm.edu;ucsc.edu	37	1	182551218	182551218	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:182551218A>G	ENST00000367559.3	-	4	1995	c.1742T>C	c.(1741-1743)cTg>cCg	p.L581P	RNASEL_ENST00000539397.1_Missense_Mutation_p.L581P|RNASEL_ENST00000444138.1_Missense_Mutation_p.L581P	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						GGGATGACCCAGCAGGTCACT	0.502																																																	0													153.0	146.0	148.0					1																	182551218		2203	4300	6503	SO:0001583	missense	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1742T>C	1.37:g.182551218A>G	ENSP00000356530:p.Leu581Pro		Q5W0L2|Q6AI46	Missense_Mutation	SNP	ENST00000367559.3	37	CCDS1347.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.474898	0.63737	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.25579	1.79;1.79;1.79	5.1	3.95	0.45737	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.298438	0.23894	N	0.043505	T	0.50854	0.1640	M	0.90870	3.155	0.21020	N	0.999804	D;D	0.56746	0.977;0.977	P;P	0.58013	0.831;0.831	T	0.51442	-0.8705	10	0.66056	D	0.02	-5.6465	9.4899	0.38953	0.8426:0.0:0.0:0.1574	.	581;581	Q6AI46;Q05823	.;RN5A_HUMAN	P	581	ENSP00000356530:L581P;ENSP00000411147:L581P;ENSP00000440844:L581P	ENSP00000356530:L581P	L	-	2	0	RNASEL	180817841	0.584000	0.26766	0.052000	0.19188	0.348000	0.29142	1.481000	0.35476	0.865000	0.35603	0.528000	0.53228	CTG		0.502	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1		NM_021133	
RNF212	285498	hgsc.bcm.edu;ucsc.edu	37	4	1075245	1075245	+	Silent	SNP	G	G	A	rs146814980	byFrequency	TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr4:1075245G>A	ENST00000433731.2	-	7	487	c.426C>T	c.(424-426)caC>caT	p.H142H	RNF212_ENST00000382968.5_Silent_p.H142H			Q495C1	RN212_HUMAN	ring finger protein 212	142					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		GCAGGCATCCGTGTGGTTTTG	0.517													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17833	0.0		0.0	False		,,,				2504	0.001																0								G	,	7,4399	12.9+/-30.5	0,7,2196	204.0	189.0	194.0		426,426	-0.4	0.0	4	dbSNP_134	194	0,8600		0,0,4300	yes	coding-synonymous,coding-synonymous	RNF212	NM_001131034.3,NM_194439.4	,	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	,	142/298,142/233	1075245	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	285498			AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.426C>T	4.37:g.1075245G>A			C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Silent	SNP	ENST00000433731.2	37	CCDS46996.1																																																																																				0.517	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2		NM_194439	
ROS1	6098	hgsc.bcm.edu;ucsc.edu	37	6	117706977	117706977	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr6:117706977C>T	ENST00000368508.3	-	15	2371	c.2173G>A	c.(2173-2175)Gac>Aac	p.D725N	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.D720N	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	725					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D725N(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ACAAAAACGTCGCCTTTCGTG	0.428			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	2	Substitution - Missense(2)	large_intestine(2)											138.0	123.0	128.0					6																	117706977		2203	4300	6503	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2173G>A	6.37:g.117706977C>T	ENSP00000357494:p.Asp725Asn		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	0.063	-1.220299	0.01542	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.90844	-2.74;-2.74	5.37	3.57	0.40892	.	0.648009	0.15688	N	0.249598	T	0.60392	0.2265	N	0.12182	0.205	0.30685	N	0.751981	B	0.14438	0.01	B	0.06405	0.002	T	0.39623	-0.9605	10	0.10902	T	0.67	.	5.7956	0.18385	0.0:0.6192:0.1415:0.2393	.	725	P08922	ROS1_HUMAN	N	725;720	ENSP00000357494:D725N;ENSP00000357493:D720N	ENSP00000357493:D720N	D	-	1	0	ROS1	117813670	0.024000	0.19004	0.144000	0.22314	0.361000	0.29550	0.130000	0.15850	0.814000	0.34374	0.655000	0.94253	GAC		0.428	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			
S1PR3	1903	hgsc.bcm.edu;ucsc.edu	37	9	91617209	91617209	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr9:91617209T>C	ENST00000375846.3	+	1	5789	c.1094T>C	c.(1093-1095)aTg>aCg	p.M365T	S1PR3_ENST00000358157.2_Missense_Mutation_p.M365T			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	365					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						TCCTGCATCATGGACAAGAAC	0.532																																																	0													68.0	68.0	68.0					9																	91617209		2203	4300	6503	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.1094T>C	9.37:g.91617209T>C	ENSP00000365006:p.Met365Thr		Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.996250	0.00044	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.66099	-0.19;-0.19	5.31	-1.7	0.08159	.	2.152540	0.01684	N	0.026309	T	0.39708	0.1088	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34477	-0.9827	10	0.36615	T	0.2	.	12.5995	0.56489	0.0:0.4167:0.0:0.5833	.	365	Q99500	S1PR3_HUMAN	T	365	ENSP00000350878:M365T;ENSP00000365006:M365T	ENSP00000350878:M365T	M	+	2	0	S1PR3	90807029	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-1.257000	0.02866	-0.158000	0.11040	-0.415000	0.06103	ATG		0.532	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2		NM_005226	
SLC5A8	160728	hgsc.bcm.edu;ucsc.edu	37	12	101584299	101584299	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr12:101584299G>T	ENST00000536262.2	-	6	1338	c.780C>A	c.(778-780)aaC>aaA	p.N260K		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CCTGGGATTGGTTGACACCGT	0.393																																					GBM(60;420 1056 13605 22380 47675)												0													151.0	144.0	147.0					12																	101584299		2203	4300	6503	SO:0001583	missense	160728			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.780C>A	12.37:g.101584299G>T	ENSP00000445340:p.Asn260Lys			Missense_Mutation	SNP	ENST00000536262.2	37	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632992	0.67015	.	.	ENSG00000256870	ENST00000536262	D	0.86865	-2.18	5.86	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.95424	0.8514	H	0.96142	3.775	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.96383	0.9283	10	0.87932	D	0	.	15.3842	0.74684	0.068:0.0:0.932:0.0	.	260	Q8N695	SC5A8_HUMAN	K	260	ENSP00000445340:N260K	ENSP00000445340:N260K	N	-	3	2	SLC5A8	100108430	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	5.412000	0.66392	2.774000	0.95407	0.585000	0.79938	AAC		0.393	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1		NM_145913	
SPP2	6694	hgsc.bcm.edu;ucsc.edu	37	2	234959667	234959667	+	Silent	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr2:234959667C>A	ENST00000168148.3	+	2	226	c.138C>A	c.(136-138)gcC>gcA	p.A46A	SPP2_ENST00000373368.1_Silent_p.A46A|SPP2_ENST00000492481.1_3'UTR	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	46					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		CCCTCAGTGCCTCTGTGGTAA	0.483																																																	0													128.0	108.0	115.0					2																	234959667		2203	4300	6503	SO:0001819	synonymous_variant	6694				CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.138C>A	2.37:g.234959667C>A			A4QMV3|Q3B892|Q546M5	Silent	SNP	ENST00000168148.3	37	CCDS2511.1																																																																																				0.483	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131313.3		NM_006944	
SREBF1	6720	hgsc.bcm.edu	37	17	17722891	17722891	+	Silent	SNP	A	A	G	rs371247619		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr17:17722891A>G	ENST00000261646.5	-	3	856	c.672T>C	c.(670-672)ccT>ccC	p.P224P	SREBF1_ENST00000435530.2_Silent_p.P224P|SREBF1_ENST00000395757.1_5'UTR|SREBF1_ENST00000355815.4_Silent_p.P254P|SREBF1_ENST00000583732.1_5'UTR|SREBF1_ENST00000338854.5_Silent_p.P224P	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	224					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						TGGTCGTTACAGGGGCTGCCG	0.677																																																	0								A	,	0,4404		0,0,2202	23.0	27.0	26.0		762,672	-0.1	0.0	17		26	7,8589		0,7,4291	no	coding-synonymous,coding-synonymous	SREBF1	NM_001005291.2,NM_004176.4	,	0,7,6493	GG,GA,AA		0.0814,0.0,0.0538	,	254/1178,224/1148	17722891	7,12993	2202	4298	6500	SO:0001819	synonymous_variant	6720			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.672T>C	17.37:g.17722891A>G			B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Silent	SNP	ENST00000261646.5	37	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	A	5.210	0.224182	0.09863	0.0	8.14E-4	ENSG00000072310	ENST00000395751	.	.	.	3.84	-0.0675	0.13760	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.21719	N	0.999578	.	.	.	.	.	.	T	0.24476	-1.0159	4	.	.	.	-7.2767	2.9509	0.05861	0.4499:0.0:0.1168:0.4333	.	.	.	.	R	232	.	.	C	-	1	0	SREBF1	17663616	0.001000	0.12720	0.038000	0.18304	0.781000	0.44180	-0.560000	0.05964	0.158000	0.19367	-0.542000	0.04241	TGT		0.677	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1		NM_004176	
TDRD5	163589	hgsc.bcm.edu	37	1	179561874	179561874	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr1:179561874C>A	ENST00000367614.1	+	2	483	c.124C>A	c.(124-126)Cat>Aat	p.H42N	TDRD5_ENST00000294848.8_Missense_Mutation_p.H42N|TDRD5_ENST00000444136.1_Missense_Mutation_p.H42N|RP11-545A16.4_ENST00000567150.1_RNA	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	42	HTH OST-type 1. {ECO:0000255|PROSITE- ProRule:PRU00975}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GGTTGGCAACCATCTACCACT	0.498																																																	0													211.0	190.0	197.0					1																	179561874		2203	4300	6503	SO:0001583	missense	163589			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.124C>A	1.37:g.179561874C>A	ENSP00000356586:p.His42Asn		A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192184	0.38707	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.40476	1.03;1.03;1.03	5.91	4.99	0.66335	.	0.142257	0.49305	D	0.000145	T	0.31389	0.0795	L	0.33485	1.01	0.09310	N	1	B;B	0.31548	0.328;0.144	B;B	0.29267	0.1;0.083	T	0.12319	-1.0552	10	0.15066	T	0.55	-2.7516	15.2239	0.73336	0.1418:0.8582:0.0:0.0	.	42;42	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	N	42	ENSP00000356586:H42N;ENSP00000294848:H42N;ENSP00000406052:H42N	ENSP00000294848:H42N	H	+	1	0	TDRD5	177828497	0.212000	0.23540	0.589000	0.28718	0.986000	0.74619	3.960000	0.56752	1.486000	0.48398	0.655000	0.94253	CAT		0.498	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1		NM_173533	
TFF1	7031	hgsc.bcm.edu	37	21	43783445	43783445	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr21:43783445T>G	ENST00000291527.2	-	2	255	c.157A>C	c.(157-159)Aat>Cat	p.N53H		NM_003225.2	NP_003216.1	P04155	TFF1_HUMAN	trefoil factor 1	53	P-type. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|digestion (GO:0007586)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of cell proliferation (GO:0008285)|response to estradiol (GO:0032355)|response to iron ion (GO:0010039)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)				cervix(1)|lung(1)	2						CAGCCCTTATTTGCACACTGG	0.517																																																	0													101.0	88.0	93.0					21																	43783445		2203	4300	6503	SO:0001583	missense	7031			BC032811	CCDS13685.1	21q22.3	2012-10-02	2007-01-29		ENSG00000160182	ENSG00000160182			11755	protein-coding gene	gene with protein product		113710	"""breast cancer, estrogen-inducible sequence expressed in"""	BCEI		9043862	Standard	NM_003225		Approved	D21S21, HPS2, pS2, pNR-2, HP1.A	uc002zax.1	P04155	OTTHUMG00000086799	ENST00000291527.2:c.157A>C	21.37:g.43783445T>G	ENSP00000291527:p.Asn53His			Missense_Mutation	SNP	ENST00000291527.2	37	CCDS13685.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314344	0.40996	.	.	ENSG00000160182	ENST00000291527	T	0.55413	0.52	4.05	-2.29	0.06805	P-type trefoil, conserved site (1);P-type trefoil (5);	2.068430	0.01883	N	0.038018	T	0.41534	0.1163	.	.	.	0.09310	N	1	P	0.34757	0.467	B	0.39258	0.295	T	0.22347	-1.0219	8	.	.	.	-16.4348	4.9549	0.14035	0.0:0.4506:0.1755:0.3739	.	53	P04155	TFF1_HUMAN	H	53	ENSP00000291527:N53H	.	N	-	1	0	TFF1	42656514	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.259000	0.01178	-0.280000	0.09154	0.379000	0.24179	AAT		0.517	TFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195361.1		NM_003225	
TG	7038	hgsc.bcm.edu;ucsc.edu	37	8	133911116	133911116	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr8:133911116C>G	ENST00000220616.4	+	14	3331	c.3291C>G	c.(3289-3291)aaC>aaG	p.N1097K	TG_ENST00000377869.1_Missense_Mutation_p.N1097K	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1097	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCAAGAAAACCCATCTCCAA	0.537																																																	0													77.0	65.0	69.0					8																	133911116		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3291C>G	8.37:g.133911116C>G	ENSP00000220616:p.Asn1097Lys		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	9.571|9.571|9.571	1.121107|1.121107|1.121107	0.20877|0.20877|0.20877	.|.|.	.|.|.	ENSG00000042832|ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000220616|ENST00000543313|ENST00000518505	T;T|.|.	0.62232|.|.	0.04;0.04|.|.	5.74|5.74|5.74	-1.77|-1.77|-1.77	0.07982|0.07982|0.07982	Thyroglobulin type-1 (4);|.|.	0.669691|.|.	0.15081|.|.	N|.|.	0.281652|.|.	T|T|T	0.27559|0.27559|0.27559	0.0677|0.0677|0.0677	L|L|L	0.47716|0.47716|0.47716	1.5|1.5|1.5	0.09310|0.09310|0.09310	N|N|N	1|1|1	B|.|.	0.30146|.|.	0.27|.|.	B|.|.	0.28011|.|.	0.085|.|.	T|T|T	0.32322|0.32322|0.32322	-0.9911|-0.9911|-0.9911	10|5|5	0.51188|.|.	T|.|.	0.08|.|.	.|.|.	1.2715|1.2715|1.2715	0.02022|0.02022|0.02022	0.1427:0.2414:0.3369:0.279|0.1427:0.2414:0.3369:0.279|0.1427:0.2414:0.3369:0.279	.|.|.	1097|.|.	P01266|.|.	THYG_HUMAN|.|.	K|A|S	1097|5|64	ENSP00000367100:N1097K;ENSP00000220616:N1097K|.|.	ENSP00000220616:N1097K|.|.	N|P|T	+|+|+	3|1|2	2|0|0	TG|TG|TG	133980298|133980298|133980298	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.006000|0.006000|0.006000	0.13384|0.13384|0.13384	0.589000|0.589000|0.589000	0.36550|0.36550|0.36550	-1.778000|-1.778000|-1.778000	0.01778|0.01778|0.01778	-0.003000|-0.003000|-0.003000	0.14444|0.14444|0.14444	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	AAC|CCC|ACC		0.537	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1		NM_003235	
VHL	7428	hgsc.bcm.edu;ucsc.edu	37	3	10188315	10188315	+	Missense_Mutation	SNP	T	T	C	rs193922611		TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr3:10188315T>C	ENST00000256474.2	+	2	1298	c.458T>C	c.(457-459)cTg>cCg	p.L153P	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	153	Involved in binding to CCT complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L153P(5)|p.?(2)|p.L153fs*4(1)|p.?fs(1)|p.P154fs*2(1)|p.G144fs*19(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AATATCACACTGCCAGGTACT	0.403		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	11	Substitution - Missense(5)|Deletion - Frameshift(2)|Insertion - Frameshift(2)|Unknown(2)	kidney(11)											182.0	172.0	175.0					3																	10188315		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.458T>C	3.37:g.10188315T>C	ENSP00000256474:p.Leu153Pro		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.930995	0.73327	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	D	0.99848	-7.14	4.79	4.79	0.61399	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.64402	D	0.000001	D	0.99715	0.9890	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97136	0.9821	10	0.72032	D	0.01	0.5194	12.5822	0.56397	0.0:0.0:0.0:1.0	.	153	P40337	VHL_HUMAN	P	153;71	ENSP00000256474:L153P	ENSP00000256474:L153P	L	+	2	0	VHL	10163315	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.968000	0.70413	1.928000	0.55862	0.460000	0.39030	CTG		0.403	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZNF33A	7581	hgsc.bcm.edu	37	10	38343868	38343868	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr10:38343868C>A	ENST00000458705.2	+	5	971	c.813C>A	c.(811-813)gaC>gaA	p.D271E	ZNF33A_ENST00000307441.9_Missense_Mutation_p.D271E|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.D272E|ZNF33A_ENST00000432900.2_Missense_Mutation_p.D278E			Q06730	ZN33A_HUMAN	zinc finger protein 33A	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CGTCAAGGGACAATCACTATG	0.383																																																	0													70.0	68.0	69.0					10																	38343868		2203	4300	6503	SO:0001583	missense	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.813C>A	10.37:g.38343868C>A	ENSP00000387713:p.Asp271Glu		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.496306	0.01009	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.04758	3.57;3.56;3.56;3.56	2.05	-4.09	0.03951	.	0.207799	0.24037	N	0.042127	T	0.00845	0.0028	N	0.00385	-1.57	0.20926	N	0.999825	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.30446	-0.9978	10	0.02654	T	1	.	4.8343	0.13456	0.2512:0.3315:0.4173:0.0	.	278;271;272	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	E	272;278;271;271	ENSP00000363747:D272E;ENSP00000402467:D278E;ENSP00000387713:D271E;ENSP00000304268:D271E	ENSP00000304268:D271E	D	+	3	2	ZNF33A	38383874	0.008000	0.16893	0.003000	0.11579	0.012000	0.07955	-0.732000	0.04904	-1.227000	0.02571	-0.535000	0.04281	GAC		0.383	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1		NM_006974	
PBRM1	55193	ucsc.edu	37	3	52682363	52682363	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BP-4159-01A-02D-1366-10	TCGA-BP-4159-11A-01D-1366-10	G	G	G	-	G	G	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	9b0b1d34-a704-4d47-89e9-d1b0d187c8de	63af4766-b112-4605-a1b9-a26272148aa7	g.chr3:52682363delG	ENST00000296302.7	-	7	811	c.810delC	c.(808-810)ttcfs	p.F270fs	PBRM1_ENST00000356770.4_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.F270fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.F270fs			Q86U86	PB1_HUMAN	polybromo 1	270	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AACTAACCTTGAATACTTGAG	0.308			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	.		Rec	yes		3	3p21	55193	polybromo 1		E	0													142.0	139.0	140.0					3																	52682363		2202	4300	6502	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.810delC	3.37:g.52682363delG	ENSP00000296302:p.Phe270fs		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.308	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
