#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2436173	2436173	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:2436173G>A	ENST00000419816.2	+	22	4046	c.3772G>A	c.(3772-3774)Ggc>Agc	p.G1258S	PLCH2_ENST00000378486.3_Missense_Mutation_p.G1258S|PLCH2_ENST00000449969.1_3'UTR|PLCH2_ENST00000378488.3_Missense_Mutation_p.G1222S			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1258					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CAAGAGCCTGGGCGACCTCAC	0.701																																					p.G1258S		.											.	PLCH2-229	0			c.G3772A						.						28.0	34.0	32.0					1																	2436173		2066	4170	6236	SO:0001583	missense	9651	exon22			AGCCTGGGCGACC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3772G>A	1.37:g.2436173G>A	ENSP00000389803:p.Gly1258Ser	46	0		48	19	NM_014638	0	0	27	41	14	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.88|18.88	3.718362|3.718362	0.68844|0.68844	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000378486;ENST00000378488;ENST00000278878|ENST00000419816	T;T|.	0.76578|.	-0.69;-1.03|.	4.41|4.41	4.41|4.41	0.53225|0.53225	.|.	1.629000|.	0.03724|.	N|.	0.252361|.	T|.	0.74504|.	0.3725|.	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|.	0.76214|.	-0.3041|.	10|.	0.87932|.	D|.	0|.	.|.	15.9517|15.9517	0.79843|0.79843	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1010;1258|.	B9DI82;O75038|.	.;PLCH2_HUMAN|.	S|X	1258;1222;1010|552	ENSP00000367747:G1258S;ENSP00000367749:G1222S|.	ENSP00000278878:G1010S|.	G|W	+|+	1|3	0|0	PLCH2|PLCH2	2426033|2426033	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.712000|0.712000	0.41017|0.41017	5.901000|5.901000	0.69861|0.69861	1.999000|1.999000	0.58509|0.58509	0.491000|0.491000	0.48974|0.48974	GGC|TGG	.		0.701	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
HSPG2	3339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22214014	22214014	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:22214014C>A	ENST00000374695.3	-	8	936	c.857G>T	c.(856-858)gGg>gTg	p.G286V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	286	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CTCCTGGGGCCCACAGGGCAG	0.657																																					p.G286V		.											.	HSPG2-141	0			c.G857T						.						67.0	82.0	77.0					1																	22214014		2203	4299	6502	SO:0001583	missense	3339	exon8			TGGGGCCCACAGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.857G>T	1.37:g.22214014C>A	ENSP00000363827:p.Gly286Val	70	0		80	37	NM_005529	0	0	18	23	5	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.61|18.61	3.661500|3.661500	0.67700|0.67700	.|.	.|.	ENSG00000142798|ENSG00000142798	ENST00000412328;ENST00000374673|ENST00000374695	T;D|D	0.95918|0.95853	0.35;-3.85|-3.83	5.09|5.09	3.22|3.22	0.36961|0.36961	.|.	0.178923|0.178923	0.27027|0.27027	N|N	0.021295|0.021295	D|D	0.94771|0.94771	0.8312|0.8312	M|M	0.80183|0.80183	2.485|2.485	0.52501|0.52501	D|D	0.999955|0.999955	D|P	0.89917|0.36683	1.0|0.565	D|B	0.69479|0.41374	0.964|0.355	D|D	0.91702|0.91702	0.5374|0.5374	10|10	0.59425|0.38643	D|T	0.04|0.18	.|.	9.1776|9.1776	0.37120|0.37120	0.0:0.8213:0.0:0.1787|0.0:0.8213:0.0:0.1787	.|.	209|286	Q5SZI5|P98160	.|PGBM_HUMAN	C|V	209;113|286	ENSP00000405412:G209C;ENSP00000363805:G113C|ENSP00000363827:G286V	ENSP00000363805:G113C|ENSP00000363827:G286V	G|G	-|-	1|2	0|0	HSPG2|HSPG2	22086601|22086601	0.001000|0.001000	0.12720|0.12720	0.995000|0.995000	0.50966|0.50966	0.549000|0.549000	0.35272|0.35272	0.204000|0.204000	0.17335|0.17335	0.566000|0.566000	0.29273|0.29273	0.462000|0.462000	0.41574|0.41574	GGC|GGG	.		0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	42048585	42048585	+	Silent	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:42048585A>T	ENST00000372583.1	-	4	2769	c.1884T>A	c.(1882-1884)ctT>ctA	p.L628L	HIVEP3_ENST00000372584.1_Silent_p.L628L|HIVEP3_ENST00000247584.5_Silent_p.L628L|HIVEP3_ENST00000429157.2_Silent_p.L628L	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	628	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCTTTTTGGTAAGCTCGCTTT	0.493																																					p.L628L		.											.	HIVEP3-157	0			c.T1884A						.						123.0	120.0	121.0					1																	42048585		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			TTTGGTAAGCTCG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1884T>A	1.37:g.42048585A>T		183	0		152	61	NM_024503	0	0	5	5	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																			.		0.493	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
CYP4A11	1579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	47402352	47402352	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:47402352G>C	ENST00000310638.4	-	4	525	c.494C>G	c.(493-495)tCt>tGt	p.S165C	CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371904.4_Missense_Mutation_p.S165C|CYP4A11_ENST00000371905.1_Missense_Mutation_p.S165C|CYP4A11_ENST00000462347.1_Missense_Mutation_p.S165C|CYP4A11_ENST00000457840.2_Missense_Mutation_p.S61C	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	165					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CACTCGTACAGAGTCTGCCAT	0.562																																					p.S165C		.											.	CYP4A11-94	0			c.C494G						.						88.0	70.0	76.0					1																	47402352		2203	4300	6503	SO:0001583	missense	1579	exon4			CGTACAGAGTCTG	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.494C>G	1.37:g.47402352G>C	ENSP00000311095:p.Ser165Cys	79	0		62	23	NM_000778	0	0	5	7	2	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	.	.	.	.	.	.	.	.	.	.	N	18.30	3.593520	0.66219	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905;ENST00000457840	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	L	0.48642	1.525	0.41496	D	0.988252	P	0.45768	0.866	P	0.53988	0.739	T	0.71517	-0.4569	10	0.45353	T	0.12	.	15.1292	0.72507	0.0:0.1409:0.859:0.0	.	165	Q02928	CP4AB_HUMAN	C	165;165;165;61	ENSP00000311095:S165C;ENSP00000360971:S165C;ENSP00000360972:S165C;ENSP00000406272:S61C	ENSP00000311095:S165C	S	-	2	0	CYP4A11	47174939	1.000000	0.71417	0.448000	0.26945	0.053000	0.15095	4.950000	0.63603	2.640000	0.89533	0.644000	0.83932	TCT	.		0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
ZCCHC11	23318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	52902541	52902541	+	Silent	SNP	G	G	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:52902541G>T	ENST00000371544.3	-	26	4307	c.4045C>A	c.(4045-4047)Cga>Aga	p.R1349R	ZCCHC11_ENST00000257177.4_Silent_p.R1350R	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1349					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						CTAAAGTCTCGAGTATCGTGG	0.483																																					p.R1350R		.											.	ZCCHC11-93	0			c.C4048A						.						185.0	188.0	187.0					1																	52902541		2203	4300	6503	SO:0001819	synonymous_variant	23318	exon26			AGTCTCGAGTATC	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4045C>A	1.37:g.52902541G>T		178	0		160	72	NM_001009881	0	0	33	57	24	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Silent	SNP	ENST00000371544.3	37	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	G	8.051	0.765950	0.15983	.	.	ENSG00000134744	ENST00000474453	.	.	.	3.77	2.84	0.33178	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7235	0.34456	0.0:0.0:0.7739:0.2261	.	.	.	.	X	194	.	.	S	-	2	0	ZCCHC11	52675129	1.000000	0.71417	0.958000	0.39756	0.893000	0.52053	1.976000	0.40579	1.155000	0.42497	0.655000	0.94253	TCG	.		0.483	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
ZNF326	284695	broad.mit.edu;bcgsc.ca	37	1	90475714	90475714	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:90475714A>G	ENST00000340281.4	+	6	826	c.683A>G	c.(682-684)aAt>aGt	p.N228S	ZNF326_ENST00000455342.2_Missense_Mutation_p.N22S|ZNF326_ENST00000370447.3_Missense_Mutation_p.N139S	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	228					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		AAATCCACCAATGTGACAGTT	0.363																																					p.N228S													.	ZNF326-91	0			c.A683G						.						103.0	108.0	106.0					1																	90475714		2203	4300	6503	SO:0001583	missense	284695	exon6			CCACCAATGTGAC	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.683A>G	1.37:g.90475714A>G	ENSP00000340796:p.Asn228Ser	142	1		140	7	NM_182976	0	0	44	44	0	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	37	CCDS727.1	.	.	.	.	.	.	.	.	.	.	A	9.648	1.140917	0.21205	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.15952	2.38;2.38;2.38	5.65	3.31	0.37934	.	0.463950	0.22905	N	0.054220	T	0.01523	0.0049	N	0.03608	-0.345	0.23776	N	0.996876	B;B	0.13594	0.006;0.008	B;B	0.08055	0.003;0.003	T	0.47142	-0.9140	10	0.09843	T	0.71	-12.6231	5.7857	0.18333	0.6555:0.1833:0.1612:0.0	.	228;228	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	S	228;228;139;22	ENSP00000340796:N228S;ENSP00000359476:N139S;ENSP00000403470:N22S	ENSP00000340796:N228S	N	+	2	0	ZNF326	90248302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.135000	0.31454	0.970000	0.38263	0.472000	0.43445	AAT	.		0.363	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
MSTO1	55154	hgsc.bcm.edu	37	1	155581021	155581021	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:155581021C>G	ENST00000245564.2	+	4	329	c.305C>G	c.(304-306)aCc>aGc	p.T102S	MSTO1_ENST00000452804.2_Missense_Mutation_p.T102S|RP11-29H23.4_ENST00000456382.2_RNA|MSTO1_ENST00000483734.1_3'UTR|MSTO1_ENST00000368341.4_Missense_Mutation_p.T102S|MSTO1_ENST00000538143.1_Intron	NM_001256532.1|NM_001256533.1|NM_018116.3	NP_001243461.1|NP_001243462.1|NP_060586.2	Q9BUK6	MSTO1_HUMAN	misato 1, mitochondrial distribution and morphology regulator	102					mitochondrion distribution (GO:0048311)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)				breast(2)|endometrium(1)|lung(3)|skin(1)	7	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)					GGGAAGCTCACCACACACAAA	0.493																																					p.T102S		.											.	MSTO1-90	0			c.C305G						.																																			SO:0001583	missense	55154	exon4			AGCTCACCACACA	BX537684	CCDS1114.1	1q22	2013-08-21	2013-08-21		ENSG00000125459	ENSG00000125459			29678	protein-coding gene	gene with protein product			"""misato homolog 1 (Drosophila)"""			16545939, 17349998	Standard	NM_018116		Approved	FLJ10504, LST005, MST, misato	uc001fky.4	Q9BUK6	OTTHUMG00000014014	ENST00000245564.2:c.305C>G	1.37:g.155581021C>G	ENSP00000245564:p.Thr102Ser	159	0		132	23	NM_018116	0	0	18	36	18	Q53GR8|Q5CZ69|Q5T717|Q68CT6|Q7LBZ8|Q7Z3M7|Q7Z558|Q8TE05|Q9NQX2|Q9NVU4	Missense_Mutation	SNP	ENST00000245564.2	37	CCDS1114.1	.	.	.	.	.	.	.	.	.	.	.	11.67	1.708166	0.30322	.	.	ENSG00000125459	ENST00000452804;ENST00000245564;ENST00000368341	T;T	0.42900	0.96;0.96	3.07	2.12	0.27331	Tubulin/FtsZ, GTPase domain (1);Misato Segment II, myosin-like (1);	0.338788	0.30219	N	0.010139	T	0.09905	0.0243	N	0.21545	0.675	0.80722	D	1	B;B;B	0.24618	0.036;0.107;0.061	B;B;B	0.22386	0.018;0.039;0.015	T	0.13495	-1.0507	10	0.07175	T	0.84	.	11.2789	0.49181	0.0:0.8131:0.1868:0.0	.	102;102;102	Q9BUK6;Q9BUK6-2;Q9BUK6-3	MSTO1_HUMAN;.;.	S	102	ENSP00000245564:T102S;ENSP00000357325:T102S	ENSP00000245564:T102S	T	+	2	0	MSTO1	153847645	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	1.168000	0.31859	0.569000	0.29329	0.313000	0.20887	ACC	.		0.493	MSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039408.1	NM_018116	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	180000535	180000535	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:180000535A>C	ENST00000367607.3	+	15	4049	c.3631A>C	c.(3631-3633)Aaa>Caa	p.K1211Q		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1211	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCAAGGAAAGAAATCTGGGAC	0.398																																					p.K1211Q		.											.	CEP350-26	0			c.A3631C						.						50.0	52.0	51.0					1																	180000535		2203	4300	6503	SO:0001583	missense	9857	exon15			GGAAAGAAATCTG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3631A>C	1.37:g.180000535A>C	ENSP00000356579:p.Lys1211Gln	36	0		38	16	NM_014810	0	0	5	10	5	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.816051	0.90790	.	.	ENSG00000135837	ENST00000367607	T	0.59906	0.23	6.02	6.02	0.97574	.	0.000000	0.49916	D	0.000133	T	0.66616	0.2807	L	0.32530	0.975	0.42214	D	0.991828	D;D	0.76494	0.999;0.998	D;P	0.78314	0.991;0.796	T	0.64884	-0.6302	9	.	.	.	.	16.2108	0.82158	1.0:0.0:0.0:0.0	.	1211;1211	E7EU22;Q5VT06	.;CE350_HUMAN	Q	1211	ENSP00000356579:K1211Q	.	K	+	1	0	CEP350	178267158	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.354000	0.73036	2.299000	0.77371	0.528000	0.53228	AAA	.		0.398	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214556993	214556993	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:214556993G>A	ENST00000366956.5	-	13	2399	c.2205C>T	c.(2203-2205)gcC>gcT	p.A735A	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	735					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CCTGCAGCTGGGCACTGTACT	0.632																																					p.A735A	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14-290	0			c.C2205T						.						35.0	41.0	39.0					1																	214556993		2201	4295	6496	SO:0001819	synonymous_variant	5784	exon13			CAGCTGGGCACTG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2205C>T	1.37:g.214556993G>A		78	0		67	30	NM_005401	0	0	7	23	16	Q5VSI0	Silent	SNP	ENST00000366956.5	37	CCDS1514.1																																																																																			.		0.632	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
PITRM1	10531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	3206029	3206029	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:3206029G>A	ENST00000224949.4	-	7	713	c.679C>T	c.(679-681)Cct>Tct	p.P227S	PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000451104.2_Missense_Mutation_p.P195S|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.P227S			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	227					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GTGTGGTCAGGAAGAAGTCTG	0.448																																					p.P227S		.											.	PITRM1-91	0			c.C679T						.						124.0	122.0	123.0					10																	3206029		1934	4132	6066	SO:0001583	missense	10531	exon7			GGTCAGGAAGAAG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.679C>T	10.37:g.3206029G>A	ENSP00000224949:p.Pro227Ser	79	0		63	28	NM_014889	0	0	0	90	90	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	g	19.62	3.860856	0.71834	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.31247	1.5;1.5;1.5	5.7	5.7	0.88788	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.88241	2.94	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.995;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.927;0.947;1.0;0.998;0.998;0.998	T	0.70960	-0.4730	10	0.87932	D	0	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	220;195;227;227;227;220	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	S	227;220;227;195	ENSP00000224949:P227S;ENSP00000370377:P227S;ENSP00000401201:P195S	ENSP00000224949:P227S	P	-	1	0	PITRM1	3196029	1.000000	0.71417	0.997000	0.53966	0.075000	0.17131	9.162000	0.94745	2.698000	0.92095	0.655000	0.94253	CCT	.		0.448	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
MCM10	55388	hgsc.bcm.edu	37	10	13251301	13251301	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:13251301C>G	ENST00000484800.2	+	20	2722	c.2619C>G	c.(2617-2619)agC>agG	p.S873R	MCM10_ENST00000378714.3_Missense_Mutation_p.S872R|MCM10_ENST00000378694.1_3'UTR			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	873					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TTCTGAACAGCCTTAAATAAC	0.398																																					p.S873R		.											.	MCM10-653	0			c.C2619G						.						95.0	90.0	92.0					10																	13251301		2203	4300	6503	SO:0001583	missense	55388	exon20			GAACAGCCTTAAA	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2619C>G	10.37:g.13251301C>G	ENSP00000418268:p.Ser873Arg	30	0		46	3	NM_182751	0	0	2	2	0	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909860	0.72983	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800	T;T	0.49432	0.78;0.78	5.38	5.38	0.77491	Replication factor Mcm10 (1);	0.000000	0.85682	D	0.000000	T	0.72851	0.3512	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.77175	-0.2684	10	0.87932	D	0	.	18.7533	0.91823	0.0:1.0:0.0:0.0	.	872;873	Q7L590-2;Q7L590	.;MCM10_HUMAN	R	872;873;873	ENSP00000367986:S872R;ENSP00000418268:S873R	ENSP00000354945:S873R	S	+	3	2	MCM10	13291307	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.345000	0.33953	2.512000	0.84698	0.561000	0.74099	AGC	.		0.398	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
NCOA4	8031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	51586276	51586276	+	Silent	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:51586276A>T	ENST00000443446.1	+	9	1933	c.1704A>T	c.(1702-1704)gtA>gtT	p.V568V	NCOA4_ENST00000374082.1_Missense_Mutation_p.Y523F|NCOA4_ENST00000374087.4_Silent_p.V568V|NCOA4_ENST00000430396.2_Silent_p.V468V|NCOA4_ENST00000414907.2_Silent_p.V402V|NCOA4_ENST00000438493.1_Silent_p.V584V|NCOA4_ENST00000344348.6_Silent_p.V568V|NCOA4_ENST00000452682.1_Silent_p.V584V	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	568					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						TGCAGGAAGTATTACTTAATT	0.398			T	RET	papillary thyroid																																p.V584V		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.A1752T						.						114.0	111.0	112.0					10																	51586276		2203	4300	6503	SO:0001819	synonymous_variant	8031	exon10			GGAAGTATTACTT	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1704A>T	10.37:g.51586276A>T		137	0		127	48	NM_001145261	0	0	0	0	0	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Silent	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	A	3.664	-0.068949	0.07228	.	.	ENSG00000138293	ENST00000374082	T	0.26223	1.75	5.41	1.78	0.24846	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29181	-1.0020	6	0.02654	T	1	-2.9612	2.9009	0.05705	0.482:0.309:0.077:0.132	.	.	.	.	F	523	ENSP00000363195:Y523F	ENSP00000363195:Y523F	Y	+	2	0	NCOA4	51256282	0.994000	0.37717	0.999000	0.59377	0.958000	0.62258	0.292000	0.19011	0.141000	0.18875	0.533000	0.62120	TAT	.		0.398	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	89717669	89717669	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:89717669A>G	ENST00000371953.3	+	7	2051	c.694A>G	c.(694-696)Aca>Gca	p.T232A	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	232	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCAGGACCCACACGACGGGA	0.423		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.T232A		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN-17735	48	Whole gene deletion(37)|Deletion - Frameshift(9)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.A694G						.						155.0	133.0	140.0					10																	89717669		2203	4300	6503	SO:0001583	missense	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	GGACCCACACGAC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.694A>G	10.37:g.89717669A>G	ENSP00000361021:p.Thr232Ala	116	1		91	30	NM_000314	0	0	57	102	45	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.030305	0.35797	.	.	ENSG00000171862	ENST00000371953	D	0.85773	-2.03	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.158008	0.56097	D	0.000030	T	0.74711	0.3752	N	0.25647	0.755	0.51482	D	0.999926	B	0.16802	0.019	B	0.16289	0.015	T	0.68519	-0.5387	9	.	.	.	-10.0511	10.8662	0.46856	0.8504:0.0:0.0:0.1496	.	232	P60484	PTEN_HUMAN	A	232	ENSP00000361021:T232A	.	T	+	1	0	PTEN	89707649	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.612000	0.67681	1.928000	0.55862	0.477000	0.44152	ACA	.		0.423	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
DRD4	1815	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	639919	639919	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:639919G>A	ENST00000176183.5	+	3	682	c.670G>A	c.(670-672)Gtg>Atg	p.V224M		NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	224					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	GCGCTGGGAGGTGGCACGTCG	0.741																																					p.V224M		.											.	DRD4-90	0			c.G670A						.						30.0	23.0	25.0					11																	639919		2194	4290	6484	SO:0001583	missense	1815	exon3			TGGGAGGTGGCAC	L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.670G>A	11.37:g.639919G>A	ENSP00000176183:p.Val224Met	39	0		33	15	NM_000797	0	0	1	2	1	B0M0J7|Q7Z7Q5|Q8NGM5	Missense_Mutation	SNP	ENST00000176183.5	37	CCDS7710.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506330	0.44558	.	.	ENSG00000069696	ENST00000176183	T	0.37915	1.17	2.79	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	0.391968	0.24476	N	0.038200	T	0.30916	0.0780	.	.	.	0.24791	N	0.992753	P	0.47604	0.898	B	0.42138	0.377	T	0.14811	-1.0459	9	0.56958	D	0.05	.	10.3373	0.43858	0.0:0.2038:0.7962:0.0	.	224	P21917	DRD4_HUMAN	M	224	ENSP00000176183:V224M	ENSP00000176183:V224M	V	+	1	0	DRD4	629919	1.000000	0.71417	0.365000	0.25901	0.758000	0.43043	4.570000	0.60872	0.461000	0.27071	0.313000	0.20887	GTG	.		0.741	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257109.1	NM_000797	
OR4A16	81327	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55110978	55110978	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:55110978T>C	ENST00000314721.2	+	1	352	c.302T>C	c.(301-303)aTa>aCa	p.I101T		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CAGCTCTTCATAGAACACTTA	0.443																																					p.I101T		.											.	OR4A16-69	0			c.T302C						.						203.0	189.0	193.0					11																	55110978		2201	4296	6497	SO:0001583	missense	81327	exon1			TCTTCATAGAACA	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.302T>C	11.37:g.55110978T>C	ENSP00000325128:p.Ile101Thr	317	0		268	22	NM_001005274	0	0	0	0	0	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	t	0.119	-1.128496	0.01756	.	.	ENSG00000181961	ENST00000314721	T	0.00864	5.6	2.57	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	L	0.39085	1.19	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46317	-0.9200	9	0.20519	T	0.43	.	5.5053	0.16850	0.0:0.1562:0.0:0.8438	.	101	Q8NH70	O4A16_HUMAN	T	101	ENSP00000325128:I101T	ENSP00000325128:I101T	I	+	2	0	OR4A16	54867554	0.000000	0.05858	0.009000	0.14445	0.018000	0.09664	0.028000	0.13644	1.186000	0.42985	0.346000	0.21813	ATA	.		0.443	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
BAD	572	hgsc.bcm.edu	37	11	64039200	64039200	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:64039200T>C	ENST00000394532.3	-	2	533	c.263A>G	c.(262-264)gAg>gGg	p.E88G	BAD_ENST00000544785.1_Intron|BAD_ENST00000394531.3_Missense_Mutation_p.R135G|BAD_ENST00000309032.3_Missense_Mutation_p.E88G	NM_004322.3	NP_004313.1	Q92934	BAD_HUMAN	BCL2-associated agonist of cell death	88					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ADP metabolic process (GO:0046031)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|ATP metabolic process (GO:0046034)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to chromate (GO:0071247)|cellular response to hypoxia (GO:0071456)|cellular response to lipid (GO:0071396)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose catabolic process (GO:0006007)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|pore complex assembly (GO:0046931)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of autophagy (GO:0010508)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane potential (GO:0010918)|positive regulation of neuron death (GO:1901216)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to amino acid (GO:0043200)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to oleic acid (GO:0034201)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|suppression by virus of host apoptotic process (GO:0019050)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|lipid binding (GO:0008289)|phospholipid binding (GO:0005543)|protein kinase binding (GO:0019901)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4						GCTGGGCTCCTCCCCCATCCC	0.706																																					p.E88G		.											.	BAD-1271	0			c.A263G						.						17.0	17.0	17.0					11																	64039200		2191	4282	6473	SO:0001583	missense	572	exon3			GGCTCCTCCCCCA	AF021792	CCDS8065.1	11q13.1	2014-03-07	2008-08-19		ENSG00000002330	ENSG00000002330			936	protein-coding gene	gene with protein product		603167				8929532	Standard	NM_004322		Approved	BCL2L8, BBC2	uc001nzd.3	Q92934	OTTHUMG00000134302	ENST00000394532.3:c.263A>G	11.37:g.64039200T>C	ENSP00000378040:p.Glu88Gly	19	0		12	4	NM_032989	0	0	28	78	50	O14803|Q6FH21	Missense_Mutation	SNP	ENST00000394532.3	37	CCDS8065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.96|13.96	2.394026|2.394026	0.42410|0.42410	.|.	.|.	ENSG00000002330|ENSG00000002330	ENST00000394532;ENST00000540152;ENST00000309032;ENST00000493798;ENST00000492141|ENST00000394531	T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61|.	5.72|5.72	4.6|4.6	0.57074|0.57074	.|.	0.349556|.	0.31358|.	N|.	0.007795|.	T|T	0.52948|0.52948	0.1766|0.1766	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	B|.	0.13594|.	0.008|.	B|.	0.17722|.	0.019|.	T|T	0.47142|0.47142	-0.9140|-0.9140	10|5	0.49607|.	T|.	0.09|.	-16.5166|-16.5166	8.4964|8.4964	0.33130|0.33130	0.0:0.088:0.0:0.912|0.0:0.088:0.0:0.912	.|.	88|.	Q92934|.	BAD_HUMAN|.	G|G	88;88;88;3;3|135	ENSP00000378040:E88G;ENSP00000309103:E88G;ENSP00000438975:E3G;ENSP00000439202:E3G|.	ENSP00000309103:E88G|.	E|R	-|-	2|1	0|2	BAD|BAD	63795776|63795776	0.948000|0.948000	0.32251|0.32251	0.979000|0.979000	0.43373|0.43373	0.926000|0.926000	0.56050|0.56050	1.553000|1.553000	0.36255|0.36255	1.003000|1.003000	0.39130|0.39130	0.459000|0.459000	0.35465|0.35465	GAG|AGG	.		0.706	BAD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259180.2	NM_032989	
UBE4A	9354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118250228	118250228	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:118250228C>T	ENST00000431736.2	+	11	1732	c.1660C>T	c.(1660-1662)Cag>Tag	p.Q554*	UBE4A_ENST00000252108.3_Nonsense_Mutation_p.Q547*|UBE4A_ENST00000545354.1_Nonsense_Mutation_p.Q19*					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GCGGGATGCTCAGCAAAGTTC	0.493																																					p.Q554X		.											.	UBE4A-229	0			c.C1660T						.						107.0	101.0	103.0					11																	118250228		2200	4296	6496	SO:0001587	stop_gained	9354	exon11			GATGCTCAGCAAA	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1660C>T	11.37:g.118250228C>T	ENSP00000387362:p.Gln554*	144	0		97	51	NM_004788	0	0	24	29	5		Nonsense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	40	8.417745	0.98803	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2921	19.4627	0.94924	0.0:1.0:0.0:0.0	.	.	.	.	X	547;554;19	.	ENSP00000252108:Q547X	Q	+	1	0	UBE4A	117755438	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.588000	0.87417	0.655000	0.94253	CAG	.		0.493	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
NLRX1	79671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119044337	119044337	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:119044337C>T	ENST00000409109.1	+	5	966	c.379C>T	c.(379-381)Ccc>Tcc	p.P127S	NLRX1_ENST00000525863.1_Missense_Mutation_p.P127S|NLRX1_ENST00000292199.2_Missense_Mutation_p.P127S|NLRX1_ENST00000474751.2_3'UTR|NLRX1_ENST00000409265.4_Missense_Mutation_p.P127S|NLRX1_ENST00000409991.1_Missense_Mutation_p.P127S	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	127	Required for interaction with MAVS.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ACTTCGCCCACCCGCGGAGCT	0.667																																					p.P127S		.											.	NLRX1-92	0			c.C379T						.						43.0	44.0	44.0					11																	119044337		2200	4295	6495	SO:0001583	missense	79671	exon5			CGCCCACCCGCGG	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.379C>T	11.37:g.119044337C>T	ENSP00000387334:p.Pro127Ser	71	0		46	18	NM_024618	0	0	16	40	24	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.139675	0.00335	.	.	ENSG00000160703	ENST00000454811;ENST00000449394;ENST00000422249;ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T;T;T;T	0.69561	1.73;1.73;1.17;-0.31;-0.31;-0.41;-0.31;-0.41	5.6	-7.76	0.01232	.	1.215480	0.05625	N	0.580711	T	0.32406	0.0828	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.13953	-1.0490	10	0.18710	T	0.47	.	3.4574	0.07521	0.0971:0.1552:0.1941:0.5535	.	127;127	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	S	127	ENSP00000400268:P127S;ENSP00000402801:P127S;ENSP00000402381:P127S;ENSP00000386851:P127S;ENSP00000292199:P127S;ENSP00000386858:P127S;ENSP00000387334:P127S;ENSP00000433442:P127S	ENSP00000292199:P127S	P	+	1	0	NLRX1	118549547	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.553000	0.06012	-1.611000	0.01581	-0.459000	0.05422	CCC	.		0.667	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
TRIM29	23650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119988941	119988941	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:119988941G>A	ENST00000341846.5	-	7	2038	c.1617C>T	c.(1615-1617)ttC>ttT	p.F539F	TRIM29_ENST00000529044.1_Silent_p.F278F|TRIM29_ENST00000541857.1_Silent_p.F272F|TRIM29_ENST00000528870.1_Silent_p.F72F|TRIM29_ENST00000524816.3_Silent_p.F105F|TRIM29_ENST00000525887.1_5'UTR	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	539					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		CTTTCAGGGAGAAGGAGGAGC	0.592																																					p.F539F		.											.	TRIM29-291	0			c.C1617T						.						100.0	85.0	90.0					11																	119988941		2199	4295	6494	SO:0001819	synonymous_variant	23650	exon7			CAGGGAGAAGGAG	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1617C>T	11.37:g.119988941G>A		37	0		33	12	NM_012101	0	0	0	0	0	Q96AA9|Q9BZY7	Silent	SNP	ENST00000341846.5	37	CCDS8428.1	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089611	0.20390	.	.	ENSG00000137699	ENST00000525327;ENST00000524956	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	T	0.69187	0.3083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68135	-0.5489	4	.	.	.	.	13.87	0.63612	0.0:0.0:1.0:0.0	.	.	.	.	F	132;77	.	.	L	-	1	0	TRIM29	119494151	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.287000	0.51732	2.343000	0.79666	0.407000	0.27541	CTC	.		0.592	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2909052	2909052	+	Silent	SNP	A	A	G	rs201311104		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:2909052A>G	ENST00000001008.4	+	6	895	c.708A>G	c.(706-708)caA>caG	p.Q236Q	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	236	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			AAAAGTTCCAAATCCCACCAA	0.438																																					p.Q236Q		.											.	FKBP4-226	0			c.A708G						.						86.0	89.0	88.0					12																	2909052		2203	4300	6503	SO:0001819	synonymous_variant	2288	exon6			GTTCCAAATCCCA	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.708A>G	12.37:g.2909052A>G		39	0		33	19	NM_002014	0	0	106	186	80	D3DUQ1|Q9UCP1|Q9UCV7	Silent	SNP	ENST00000001008.4	37	CCDS8512.1																																																																																			A|0.999;G|0.001		0.438	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
DPPA3	359787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7867786	7867786	+	Silent	SNP	T	T	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:7867786T>A	ENST00000345088.2	+	2	207	c.90T>A	c.(88-90)tcT>tcA	p.S30S		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	30					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		CAGGGGCCTCTCAAATCTCCT	0.468																																					p.S30S		.											.	DPPA3-226	0			c.T90A						.						122.0	136.0	131.0					12																	7867786		2203	4300	6503	SO:0001819	synonymous_variant	359787	exon2			GGCCTCTCAAATC	AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.90T>A	12.37:g.7867786T>A		235	0		223	102	NM_199286	0	0	0	0	0	Q0P5U3|Q6JZS6	Silent	SNP	ENST00000345088.2	37	CCDS8582.1																																																																																			.		0.468	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399718.1	NM_199286	
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41323760	41323760	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:41323760A>G	ENST00000551295.2	+	7	776	c.659A>G	c.(658-660)aAg>aGg	p.K220R	CNTN1_ENST00000547702.1_Missense_Mutation_p.K220R|CNTN1_ENST00000360099.3_Missense_Mutation_p.K220R|CNTN1_ENST00000547849.1_Missense_Mutation_p.K220R|CNTN1_ENST00000347616.1_Missense_Mutation_p.K220R|CNTN1_ENST00000348761.2_Missense_Mutation_p.K209R	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	220	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TCTATTACAAAGAGCGTGTTC	0.383																																					p.K220R		.											.	CNTN1-1149	0			c.A659G						.						174.0	169.0	171.0					12																	41323760		2203	4300	6503	SO:0001583	missense	1272	exon7			TTACAAAGAGCGT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.659A>G	12.37:g.41323760A>G	ENSP00000447006:p.Lys220Arg	219	0		210	85	NM_001256063	0	0	0	0	0	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.375898	0.61735	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.39	5.39	0.77823	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.78534	0.4298	L	0.53671	1.685	0.58432	D	0.99999	P;P;D	0.53151	0.61;0.948;0.958	B;P;P	0.53593	0.298;0.611;0.73	T	0.77059	-0.2728	10	0.33141	T	0.24	.	15.7149	0.77661	1.0:0.0:0.0:0.0	.	220;209;220	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	R	220;220;220;220;220;209	ENSP00000448004:K220R;ENSP00000447006:K220R;ENSP00000448653:K220R;ENSP00000325660:K220R;ENSP00000353213:K220R;ENSP00000261160:K209R	ENSP00000325660:K220R	K	+	2	0	CNTN1	39610027	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.180000	0.69256	0.533000	0.62120	AAG	.		0.383	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
CCNT1	904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49087909	49087909	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:49087909G>T	ENST00000261900.3	-	9	1310	c.1088C>A	c.(1087-1089)tCc>tAc	p.S363Y		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	363					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						CTGTGGTAAGGAATGATCAAC	0.458																																					p.S363Y		.											.	CCNT1-418	0			c.C1088A						.						177.0	170.0	172.0					12																	49087909		2203	4300	6503	SO:0001583	missense	904	exon9			GGTAAGGAATGAT	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1088C>A	12.37:g.49087909G>T	ENSP00000261900:p.Ser363Tyr	154	0		176	78	NM_001240	0	0	12	21	9	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.543525	0.45280	.	.	ENSG00000129315	ENST00000261900	T	0.52057	0.68	5.49	4.54	0.55810	.	0.669254	0.16281	N	0.221349	T	0.44623	0.1302	N	0.22421	0.69	0.37399	D	0.912769	D	0.63880	0.993	P	0.50440	0.641	T	0.52815	-0.8525	10	0.56958	D	0.05	-7.9232	14.673	0.68958	0.0:0.1463:0.8536:0.0	.	363	O60563	CCNT1_HUMAN	Y	363	ENSP00000261900:S363Y	ENSP00000261900:S363Y	S	-	2	0	CCNT1	47374176	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.968000	0.56809	2.587000	0.87381	0.491000	0.48974	TCC	.		0.458	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
KRT80	144501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52579248	52579248	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:52579248C>G	ENST00000394815.2	-	2	521	c.424G>C	c.(424-426)Gaa>Caa	p.E142Q	KRT80_ENST00000313234.5_Missense_Mutation_p.E142Q	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	142	Coil 1B.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		TTGCGCAGTTCCTCCTGCAGC	0.612																																					p.E142Q	GBM(178;2309 2916 15678 35873)	.											.	KRT80-226	0			c.G424C						.						68.0	68.0	68.0					12																	52579248		2203	4300	6503	SO:0001583	missense	144501	exon2			GCAGTTCCTCCTG	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.424G>C	12.37:g.52579248C>G	ENSP00000378292:p.Glu142Gln	117	1		89	42	NM_182507	0	0	16	37	21	Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	37	CCDS8821.2	.	.	.	.	.	.	.	.	.	.	C	3.574	-0.087018	0.07097	.	.	ENSG00000167767	ENST00000313234;ENST00000394815	T;T	0.76448	-1.02;-1.02	5.08	3.25	0.37280	Filament (1);	0.183620	0.26503	N	0.024016	T	0.31104	0.0786	N	0.00049	-2.415	0.29420	N	0.860606	B;B;B	0.23377	0.005;0.016;0.084	B;B;B	0.21917	0.007;0.011;0.037	T	0.50013	-0.8877	10	0.02654	T	1	.	9.7671	0.40567	0.0:0.7822:0.1405:0.0773	.	142;142;79	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	Q	142	ENSP00000369361:E142Q;ENSP00000378292:E142Q	ENSP00000369361:E142Q	E	-	1	0	KRT80	50865515	0.955000	0.32602	0.352000	0.25734	0.959000	0.62525	1.307000	0.33516	0.721000	0.32231	0.655000	0.94253	GAA	.		0.612	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	67699344	67699344	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:67699344G>A	ENST00000545606.1	+	10	2333	c.1896G>A	c.(1894-1896)ttG>ttA	p.L632L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	632					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TAAAGGCATTGACACTGATTG	0.408																																					p.L632L		.											.	CAND1-516	0			c.G1896A						.						110.0	112.0	112.0					12																	67699344		2203	4300	6503	SO:0001819	synonymous_variant	55832	exon10			GGCATTGACACTG		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1896G>A	12.37:g.67699344G>A		150	1		152	78	NM_018448	0	0	27	50	23	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Silent	SNP	ENST00000545606.1	37	CCDS8977.1																																																																																			.		0.408	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
DCLK1	9201	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	36700222	36700222	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr13:36700222G>A	ENST00000360631.3	-	2	264	c.53C>T	c.(52-54)gCg>gTg	p.A18V	DCLK1_ENST00000255448.4_Missense_Mutation_p.A18V|DCLK1_ENST00000379892.4_Missense_Mutation_p.A18V			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	18					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GTATCTCTGCGCCTTATCCCG	0.622																																					p.A18V													.	DCLK1-826	0			c.C53T						.						61.0	62.0	62.0					13																	36700222		2203	4300	6503	SO:0001583	missense	9201	exon2			CTCTGCGCCTTAT	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.53C>T	13.37:g.36700222G>A	ENSP00000353846:p.Ala18Val	142	0		87	17	NM_004734	0	0	0	0	0	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	15.01	2.706275	0.48412	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	T;T;T	0.67523	-0.27;-0.27;1.88	5.67	5.67	0.87782	.	0.110579	0.64402	D	0.000012	T	0.56848	0.2013	N	0.22421	0.69	0.50632	D	0.999889	B	0.22346	0.068	B	0.18263	0.021	T	0.51379	-0.8713	10	0.44086	T	0.13	.	19.7802	0.96413	0.0:0.0:1.0:0.0	.	18	O15075-2	.	V	18	ENSP00000255448:A18V;ENSP00000353846:A18V;ENSP00000369222:A18V	ENSP00000255448:A18V	A	-	2	0	DCLK1	35598222	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.096000	0.64535	2.675000	0.91044	0.655000	0.94253	GCG	.		0.622	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39450406	39450406	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr13:39450406T>G	ENST00000280481.7	+	20	8647	c.8431T>G	c.(8431-8433)Tat>Gat	p.Y2811D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2811					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTCAGGGACCTATACTGTGAA	0.448																																					p.Y2811D		.											.	FREM2-100	0			c.T8431G						.						124.0	112.0	116.0					13																	39450406		2203	4300	6503	SO:0001583	missense	341640	exon20			GGGACCTATACTG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8431T>G	13.37:g.39450406T>G	ENSP00000280481:p.Tyr2811Asp	97	0		82	42	NM_207361	0	0	18	37	19	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	T	18.86	3.712772	0.68730	.	.	ENSG00000150893	ENST00000280481	T	0.47528	0.84	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.73853	0.3640	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.79769	-0.1664	10	0.87932	D	0	.	15.9477	0.79806	0.0:0.0:0.0:1.0	.	2811	Q5SZK8	FREM2_HUMAN	D	2811	ENSP00000280481:Y2811D	ENSP00000280481:Y2811D	Y	+	1	0	FREM2	38348406	1.000000	0.71417	0.984000	0.44739	0.366000	0.29705	7.967000	0.87967	2.179000	0.69175	0.460000	0.39030	TAT	.		0.448	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
TEP1	7011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20845481	20845481	+	Silent	SNP	G	G	A	rs375172392		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:20845481G>A	ENST00000262715.5	-	41	6086	c.6046C>T	c.(6046-6048)Cta>Tta	p.L2016L	TEP1_ENST00000556935.1_Silent_p.L1908L|TEP1_ENST00000545983.1_Silent_p.L354L	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2016					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCCAGTCCTAGCACAGGCTTC	0.507																																					p.L2016L		.											.	TEP1-95	0			c.C6046T						.						36.0	36.0	36.0					14																	20845481		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon41			GTCCTAGCACAGG		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.6046C>T	14.37:g.20845481G>A		41	0		49	22	NM_007110	0	0	17	30	13	A0AUV9	Silent	SNP	ENST00000262715.5	37	CCDS9548.1																																																																																			.		0.507	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
PNP	4860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20944608	20944608	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:20944608C>T	ENST00000361505.5	+	6	864	c.718C>T	c.(718-720)Ctc>Ttc	p.L240F	RP11-203M5.8_ENST00000554678.1_lincRNA	NM_000270.3	NP_000261.2	P01298	PAHO_HUMAN	purine nucleoside phosphorylase	0					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(2)	10						TGGCTTCTCACTCATCACTAA	0.458																																					p.L240F		.											.	PNP-229	0			c.C718T						.						150.0	128.0	135.0					14																	20944608		2203	4300	6503	SO:0001583	missense	4860	exon6			TTCTCACTCATCA		CCDS9552.1	14q11.2	2014-09-17	2009-12-02	2009-12-02	ENSG00000198805	ENSG00000198805	2.4.2.1		7892	protein-coding gene	gene with protein product		164050	"""nucleoside phosphorylase"""	NP		6087295	Standard	NM_000270		Approved	PUNP	uc001vxo.4	P00491	OTTHUMG00000029546	ENST00000361505.5:c.718C>T	14.37:g.20944608C>T	ENSP00000354532:p.Leu240Phe	94	0		93	43	NM_000270	0	0	131	213	82		Missense_Mutation	SNP	ENST00000361505.5	37	CCDS9552.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542982	0.86022	.	.	ENSG00000198805	ENST00000361505	D	0.88046	-2.33	4.88	4.88	0.63580	Nucleoside phosphorylase domain (1);	0.064044	0.64402	D	0.000003	D	0.93762	0.8006	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94473	0.7686	10	0.72032	D	0.01	-21.5214	16.9641	0.86281	0.0:1.0:0.0:0.0	.	240	P00491	PNPH_HUMAN	F	240	ENSP00000354532:L240F	ENSP00000354532:L240F	L	+	1	0	PNP	20014448	0.999000	0.42202	0.994000	0.49952	0.951000	0.60555	4.327000	0.59247	2.528000	0.85240	0.655000	0.94253	CTC	.		0.458	PNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073646.2	NM_000270.2	
RNF31	55072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24626550	24626550	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:24626550C>T	ENST00000324103.6	+	15	2865	c.2545C>T	c.(2545-2547)Cgc>Tgc	p.R849C	RNF31_ENST00000382687.3_Missense_Mutation_p.R698C|RNA5SP383_ENST00000362934.1_RNA|RNF31_ENST00000559275.1_Missense_Mutation_p.R698C|RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.R324C	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	849					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GAACTGGAAACGCATGAACGA	0.567																																					p.R849C		.											.	RNF31-90	0			c.C2545T						.						75.0	81.0	79.0					14																	24626550		1988	4157	6145	SO:0001583	missense	55072	exon15			TGGAAACGCATGA	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.2545C>T	14.37:g.24626550C>T	ENSP00000315112:p.Arg849Cys	37	0		28	16	NM_017999	0	0	29	49	20	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997602	0.54147	.	.	ENSG00000092098	ENST00000382682;ENST00000324103;ENST00000382687	T;T	0.77877	-1.13;-1.13	5.34	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.85296	0.5664	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.951;0.996;0.998	D	0.86555	0.1837	10	0.87932	D	0	-19.6302	12.2841	0.54783	0.308:0.692:0.0:0.0	.	849;608;849;698	A0A962;B3KV71;Q96EP0;Q96EP0-3	.;.;RNF31_HUMAN;.	C	282;849;698	ENSP00000315112:R849C;ENSP00000372134:R698C	ENSP00000315112:R849C	R	+	1	0	RNF31	23696390	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	0.675000	0.25232	1.467000	0.48044	-0.203000	0.12734	CGC	.		0.567	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
KIAA0391	9692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35592664	35592664	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:35592664T>G	ENST00000557565.1	+	2	594	c.213T>G	c.(211-213)gaT>gaG	p.D71E	KIAA0391_ENST00000321130.10_Missense_Mutation_p.D71E|KIAA0391_ENST00000604948.1_Intron|KIAA0391_ENST00000250377.7_De_novo_Start_OutOfFrame|KIAA0391_ENST00000603544.1_Missense_Mutation_p.D71E|KIAA0391_ENST00000605870.1_Intron|PPP2R3C_ENST00000261475.5_5'Flank|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000534898.4_Missense_Mutation_p.D71E|KIAA0391_ENST00000603588.1_Intron	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	71					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TCAGGAAAGATGAGGGCAGTA	0.408																																					p.D71E		.											.	KIAA0391-226	0			c.T213G						.						65.0	62.0	63.0					14																	35592664		2203	4300	6503	SO:0001583	missense	9692	exon2			GAAAGATGAGGGC	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.213T>G	14.37:g.35592664T>G	ENSP00000454657:p.Asp71Glu	61	0		52	25	NM_014672	0	0	21	39	18	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	37	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	T	2.705	-0.270055	0.05716	.	.	ENSG00000100890	ENST00000321130;ENST00000534898;ENST00000556121	T;T	0.40756	1.03;1.02	5.25	-5.42	0.02640	.	0.854894	0.10131	N	0.712121	T	0.21509	0.0518	N	0.22421	0.69	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18116	-1.0347	10	0.25751	T	0.34	-0.2169	6.1442	0.20276	0.2948:0.0:0.2418:0.4635	.	71;71	O15091-2;O15091	.;MRRP3_HUMAN	E	71	ENSP00000324697:D71E;ENSP00000440915:D71E	ENSP00000324697:D71E	D	+	3	2	KIAA0391	34662415	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.292000	0.08332	-1.164000	0.02790	-1.783000	0.00646	GAT	.		0.408	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
VTI1B	10490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68118141	68118141	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:68118141C>T	ENST00000554659.1	-	6	1001	c.660G>A	c.(658-660)ctG>ctA	p.L220L	ARG2_ENST00000261783.3_3'UTR	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	220					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		CCAGGCCTCCCAGGATGGCGA	0.453																																					p.L220L		.											.	VTI1B-90	0			c.G660A						.						69.0	71.0	70.0					14																	68118141		2203	4300	6503	SO:0001819	synonymous_variant	10490	exon6			GCCTCCCAGGATG	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.660G>A	14.37:g.68118141C>T		98	0		89	48	NM_006370	0	0	135	257	122	O43547|Q96J28	Silent	SNP	ENST00000554659.1	37	CCDS9786.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801303	0.70567	.	.	ENSG00000100568	ENST00000554636	.	.	.	6.17	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6819	0.28518	0.1315:0.7266:0.0:0.1419	.	.	.	.	X	98	.	.	W	-	2	0	VTI1B	67187894	0.123000	0.22298	1.000000	0.80357	0.996000	0.88848	-0.529000	0.06186	1.560000	0.49568	0.655000	0.94253	TGG	.		0.453	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412558.2		
HHIPL1	84439	hgsc.bcm.edu	37	14	100119115	100119115	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:100119115C>G	ENST00000330710.5	+	2	908	c.810C>G	c.(808-810)taC>taG	p.Y270*	HHIPL1_ENST00000357223.2_Nonsense_Mutation_p.Y270*	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	270					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				ACGTCTACTACTCAGTGGGTA	0.617																																					p.Y270X		.											.	HHIPL1-70	0			c.C810G						.						46.0	37.0	40.0					14																	100119115		2203	4300	6503	SO:0001587	stop_gained	84439	exon2			CTACTACTCAGTG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.810C>G	14.37:g.100119115C>G	ENSP00000330601:p.Tyr270*	44	0		35	2	NM_032425	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Nonsense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	.	.	.	.	.	.	.	.	.	.	c	36	5.713025	0.96830	.	.	ENSG00000182218	ENST00000330710;ENST00000357223	.	.	.	4.59	3.68	0.42216	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.5806	0.17248	0.0:0.614:0.0:0.386	.	.	.	.	X	270	.	ENSP00000330601:Y270X	Y	+	3	2	HHIPL1	99188868	1.000000	0.71417	0.996000	0.52242	0.657000	0.38888	0.890000	0.28295	0.885000	0.36088	0.655000	0.94253	TAC	.		0.617	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
SIN3A	25942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75664533	75664533	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:75664533G>A	ENST00000394947.3	-	21	3923	c.3609C>T	c.(3607-3609)agC>agT	p.S1203S	SIN3A_ENST00000394949.4_Silent_p.S1203S|SIN3A_ENST00000360439.4_Silent_p.S1203S|RP11-817O13.8_ENST00000563278.1_lincRNA	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GTAGACGCTTGCTTACACGCT	0.433																																					p.S1203S		.											.	SIN3A-230	0			c.C3609T						.						109.0	105.0	106.0					15																	75664533		2197	4294	6491	SO:0001819	synonymous_variant	25942	exon21			ACGCTTGCTTACA	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3609C>T	15.37:g.75664533G>A		151	0		135	47	NM_001145358	0	0	33	66	33		Silent	SNP	ENST00000394947.3	37	CCDS10279.1																																																																																			.		0.433	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
TICRR	90381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90138745	90138745	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:90138745T>C	ENST00000268138.7	+	7	1908	c.1803T>C	c.(1801-1803)gaT>gaC	p.D601D	TICRR_ENST00000560985.1_Silent_p.D600D			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	601					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCAGTCCGGATGTGGCTGGGG	0.443																																					p.D601D		.											.	.	0			c.T1803C						.						112.0	107.0	108.0					15																	90138745		1888	4113	6001	SO:0001819	synonymous_variant	90381	exon7			TCCGGATGTGGCT	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1803T>C	15.37:g.90138745T>C		119	0		88	40	NM_152259	0	0	0	0	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																			.		0.443	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
GUCY2D	3000	ucsc.edu	37	17	7919110	7919110	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:7919110G>A	ENST00000254854.4	+	16	3144	c.2994G>A	c.(2992-2994)ctG>ctA	p.L998L		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	998	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GGTACTGCCTGTTTGGGGACA	0.706																																					p.L998L													.	GUCY2D-319	0			c.G2994A						.						26.0	24.0	25.0					17																	7919110		2203	4299	6502	SO:0001819	synonymous_variant	3000	exon16			CTGCCTGTTTGGG	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2994G>A	17.37:g.7919110G>A		27	0		35	4	NM_000180	0	0	0	0	0	Q6LEA7	Silent	SNP	ENST00000254854.4	37	CCDS11127.1																																																																																			.		0.706	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	345	51		524	80	NM_145301	0	0	20	123	103	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
SPAG5	10615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26911390	26911390	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:26911390A>G	ENST00000321765.5	-	12	2602	c.2270T>C	c.(2269-2271)cTc>cCc	p.L757P		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	757	Gln-rich.|Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					AAGCTGGCAGAGTAACTCATC	0.522																																					p.L757P		.											.	SPAG5-90	0			c.T2270C						.						218.0	200.0	206.0					17																	26911390		2203	4300	6503	SO:0001583	missense	10615	exon12			TGGCAGAGTAACT	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2270T>C	17.37:g.26911390A>G	ENSP00000323300:p.Leu757Pro	291	0		368	253	NM_006461	0	0	4	9	5	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.998487	0.54147	.	.	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	6.02	6.02	0.97574	.	0.363685	0.23744	N	0.044981	T	0.64394	0.2594	L	0.34521	1.04	0.48901	D	0.999721	D	0.76494	0.999	D	0.66497	0.944	T	0.65030	-0.6267	9	0.49607	T	0.09	-0.4993	12.9338	0.58303	1.0:0.0:0.0:0.0	.	757	Q96R06	SPAG5_HUMAN	P	757;254	.	ENSP00000323300:L757P	L	-	2	0	SPAG5	23935517	0.987000	0.35691	1.000000	0.80357	0.573000	0.36030	4.247000	0.58750	2.304000	0.77564	0.528000	0.53228	CTC	.		0.522	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
KRT27	342574	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	38938378	38938378	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:38938378A>G	ENST00000301656.3	-	1	408	c.368T>C	c.(367-369)tTt>tCt	p.F123S		NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				ACCAGGTCCAAATTTCTCATA	0.498																																					p.F123S		.											.	KRT27-90	0			c.T368C						.						154.0	135.0	141.0					17																	38938378		2203	4300	6503	SO:0001583	missense	342574	exon1			GGTCCAAATTTCT	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.368T>C	17.37:g.38938378A>G	ENSP00000301656:p.Phe123Ser	129	0		190	10	NM_181537	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301656.3	37	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	A	6.807	0.517981	0.13005	.	.	ENSG00000171446	ENST00000301656	D	0.87729	-2.29	5.66	1.89	0.25635	Filament (1);	0.279078	0.31290	N	0.007902	T	0.74030	0.3663	N	0.12182	0.205	0.30019	N	0.814529	B	0.13145	0.007	B	0.15870	0.014	T	0.67496	-0.5656	10	0.49607	T	0.09	.	10.0469	0.42192	0.5272:0.0:0.0:0.4728	.	123	Q7Z3Y8	K1C27_HUMAN	S	123	ENSP00000301656:F123S	ENSP00000301656:F123S	F	-	2	0	KRT27	36191904	0.001000	0.12720	0.987000	0.45799	0.444000	0.32077	0.662000	0.25038	0.449000	0.26747	-0.344000	0.07964	TTT	.		0.498	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
COL1A1	1277	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	48275830	48275830	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:48275830C>G	ENST00000225964.5	-	6	625	c.507G>C	c.(505-507)gaG>gaC	p.E169D		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	169	Nonhelical region (N-terminal).				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CGGTTGATTTCTCATCATAGC	0.512			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta				OREG0024560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E169D		.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1-986	0			c.G507C						.						52.0	49.0	50.0					17																	48275830		2203	4300	6503	SO:0001583	missense	1277	exon6			TGATTTCTCATCA	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.507G>C	17.37:g.48275830C>G	ENSP00000225964:p.Glu169Asp	50	1	953	69	21	NM_000088	0	0	13	15	2	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.206410	0.39003	.	.	ENSG00000108821	ENST00000225964	D	0.89810	-2.57	5.36	3.34	0.38264	.	0.066795	0.64402	D	0.000020	T	0.79197	0.4405	N	0.25957	0.775	0.42720	D	0.993676	B	0.09022	0.002	B	0.10450	0.005	T	0.67189	-0.5733	10	0.13470	T	0.59	.	9.4551	0.38750	0.0:0.7658:0.0:0.2342	.	169	P02452	CO1A1_HUMAN	D	169	ENSP00000225964:E169D	ENSP00000225964:E169D	E	-	3	2	COL1A1	45630829	0.992000	0.36948	1.000000	0.80357	0.977000	0.68977	0.324000	0.19610	0.625000	0.30304	0.650000	0.86243	GAG	.		0.512	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
DYNLL2	140735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56164457	56164457	+	Silent	SNP	T	T	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:56164457T>A	ENST00000579991.2	+	2	284	c.6T>A	c.(4-6)tcT>tcA	p.S2S		NM_080677.2	NP_542408.1	Q96FJ2	DYL2_HUMAN	dynein, light chain, LC8-type 2	2					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|microtubule-based process (GO:0007017)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|synaptic target recognition (GO:0008039)|transport (GO:0006810)	centrosome (GO:0005813)|cytosol (GO:0005829)|dynein complex (GO:0030286)|membrane (GO:0016020)|microtubule (GO:0005874)|myosin complex (GO:0016459)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	motor activity (GO:0003774)			lung(3)	3						ACACCATGTCTGACCGGAAGG	0.532																																					p.S2S		.											.	DYNLL2-90	0			c.T6A						.						90.0	77.0	81.0					17																	56164457		2203	4300	6503	SO:0001819	synonymous_variant	140735	exon2			CATGTCTGACCGG	AF112997	CCDS11601.1	17q23.2	2009-11-18				ENSG00000264364		"""Cytoplasmic dyneins"""	24596	protein-coding gene	gene with protein product	"""radial spoke 22 homolog (Chlamydomonas)"""	608942				16260502	Standard	NM_080677		Approved	MGC17810, Dlc2, DNCL1B, RSPH22	uc010wnn.1	Q96FJ2		ENST00000579991.2:c.6T>A	17.37:g.56164457T>A		75	1		90	62	NM_080677	0	0	101	311	210	B2R5B4	Silent	SNP	ENST00000579991.2	37	CCDS11601.1																																																																																			.		0.532	DYNLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443338.2	NM_080677	
HEXDC	284004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80382347	80382347	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:80382347T>C	ENST00000327949.9	+	2	173	c.162T>C	c.(160-162)ccT>ccC	p.P54P	HEXDC_ENST00000577944.1_Silent_p.P54P|HEXDC_ENST00000337014.6_Silent_p.P54P			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	54					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			ACGAGGGCCCTCTGAGGCTGC	0.612																																					p.P54P		.											.	HEXDC-92	0			c.T162C						.						97.0	92.0	94.0					17																	80382347		1940	4131	6071	SO:0001819	synonymous_variant	284004	exon3			GGGCCCTCTGAGG	AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.162T>C	17.37:g.80382347T>C		115	0		139	38	NM_173620	0	0	22	42	20	B7UUP6|Q8IYN4|Q8TE81	Silent	SNP	ENST00000327949.9	37																																																																																				.		0.612	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1	NM_173620	
ZNF521	25925	broad.mit.edu	37	18	22902006	22902006	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr18:22902006G>C	ENST00000361524.3	-	3	334	c.186C>G	c.(184-186)atC>atG	p.I62M	ZNF521_ENST00000538137.2_Missense_Mutation_p.I62M|ZNF521_ENST00000584787.1_De_novo_Start_InFrame|ZNF521_ENST00000579111.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	62					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGTGTTCTGTGATATCGCTCA	0.418			T	PAX5	ALL																																p.I62M				Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521-275	0			c.C186G						.						141.0	125.0	131.0					18																	22902006		2203	4300	6503	SO:0001583	missense	25925	exon3			TTCTGTGATATCG	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.186C>G	18.37:g.22902006G>C	ENSP00000354794:p.Ile62Met	114	0		102	3	NM_015461	0	0	0	0	0	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889596	0.33348	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.28895	1.59;1.59	6.06	5.19	0.71726	Zinc finger, C2H2-like (1);	0.073305	0.56097	D	0.000033	T	0.23926	0.0579	N	0.14661	0.345	0.30187	N	0.799882	P	0.47034	0.889	P	0.44860	0.462	T	0.11470	-1.0586	10	0.87932	D	0	-31.4656	13.5532	0.61745	0.0716:0.0:0.9284:0.0	.	62	Q96K83	ZN521_HUMAN	M	62;96;62	ENSP00000354794:I62M;ENSP00000382352:I62M	ENSP00000354794:I62M	I	-	3	3	ZNF521	21156004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.711000	0.54868	1.555000	0.49500	0.655000	0.94253	ATC	.		0.418	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
TIMM21	29090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	71816322	71816322	+	Silent	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr18:71816322C>G	ENST00000169551.6	+	1	577	c.279C>G	c.(277-279)acC>acG	p.T93T	FBXO15_ENST00000419743.2_5'Flank|TIMM21_ENST00000580087.1_Silent_p.T93T|FBXO15_ENST00000269500.5_5'Flank	NM_014177.2	NP_054896.2	Q9BVV7	TIM21_HUMAN	translocase of inner mitochondrial membrane 21 homolog (yeast)	93					cellular protein metabolic process (GO:0044267)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane presequence translocase complex (GO:0005744)											GAGGGGGAACCGCCGTCCCAA	0.498																																					p.T93T		.											.	.	0			c.C279G						.						57.0	58.0	58.0					18																	71816322		2203	4300	6503	SO:0001819	synonymous_variant	29090	exon1			GGGAACCGCCGTC	BC000892	CCDS12003.1	18q22.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000075336	ENSG00000075336			25010	protein-coding gene	gene with protein product		615180	"""chromosome 18 open reading frame 55"""	C18orf55		11042152	Standard	NM_014177		Approved	HSPC154, TIM21	uc010dqr.1	Q9BVV7	OTTHUMG00000132844	ENST00000169551.6:c.279C>G	18.37:g.71816322C>G		72	0		67	32	NM_014177	0	0	25	42	17	Q9P010	Silent	SNP	ENST00000169551.6	37	CCDS12003.1																																																																																			.		0.498	TIMM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256318.1	NM_014177	
STXBP2	6813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7712265	7712265	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:7712265A>T	ENST00000221283.5	+	18	1595	c.1564A>T	c.(1564-1566)Aac>Tac	p.N522Y	STXBP2_ENST00000414284.2_Missense_Mutation_p.N519Y|STXBP2_ENST00000602355.1_Missense_Mutation_p.N57Y|STXBP2_ENST00000441779.2_Missense_Mutation_p.N533Y	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	522					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CTGGCACAAGAACAAGGCTGG	0.662																																					p.N533Y		.											.	STXBP2-91	0			c.A1597T						.						24.0	33.0	30.0					19																	7712265		2192	4284	6476	SO:0001583	missense	6813	exon18			CACAAGAACAAGG	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1564A>T	19.37:g.7712265A>T	ENSP00000221283:p.Asn522Tyr	57	0		52	21	NM_001272034	0	1	3	154	150	B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	37	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.846916	0.71603	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.80480	-1.38;-1.38;-1.38	5.26	4.18	0.49190	.	0.112112	0.64402	D	0.000017	D	0.82761	0.5107	L	0.55481	1.735	0.44611	D	0.997588	P;P;P;P	0.48407	0.91;0.91;0.889;0.91	P;P;P;P	0.55161	0.689;0.77;0.562;0.689	D	0.84034	0.0361	10	0.72032	D	0.01	-1.3267	10.063	0.42286	0.8312:0.1688:0.0:0.0	.	533;488;519;522	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	Y	522;519;533;522	ENSP00000221283:N522Y;ENSP00000409471:N519Y;ENSP00000413606:N533Y	ENSP00000221283:N522Y	N	+	1	0	STXBP2	7618265	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	5.775000	0.68915	2.003000	0.58678	0.454000	0.30748	AAC	.		0.662	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949	
DOCK6	57572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	11312640	11312640	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:11312640C>A	ENST00000294618.7	-	44	5624	c.5613G>T	c.(5611-5613)aaG>aaT	p.K1871N	CTC-510F12.2_ENST00000588634.1_RNA|DOCK6_ENST00000319867.7_Missense_Mutation_p.K1210N|DOCK6_ENST00000586702.1_5'UTR	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1871	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCGTCTTACGCTTGTGTTGCT	0.637																																					p.K1871N		.											.	DOCK6-93	0			c.G5613T						.						75.0	82.0	80.0					19																	11312640		2150	4243	6393	SO:0001583	missense	57572	exon44			CTTACGCTTGTGT		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5613G>T	19.37:g.11312640C>A	ENSP00000294618:p.Lys1871Asn	16	0		20	11	NM_020812	0	0	30	45	15	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205580	0.79127	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.20200	2.09;2.09	4.98	2.85	0.33270	.	0.000000	0.85682	D	0.000000	T	0.48750	0.1517	M	0.90082	3.085	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.988;0.99;0.997	T	0.49153	-0.8969	10	0.87932	D	0	-31.2742	7.885	0.29644	0.0:0.7188:0.0:0.2812	.	1210;1871;1210	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	N	1871;1210	ENSP00000294618:K1871N;ENSP00000321556:K1210N	ENSP00000294618:K1871N	K	-	3	2	DOCK6	11173640	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.212000	0.32394	0.478000	0.27488	0.491000	0.48974	AAG	.		0.637	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
DOCK6	57572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11312680	11312680	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:11312680G>C	ENST00000294618.7	-	44	5584	c.5573C>G	c.(5572-5574)cCg>cGg	p.P1858R	CTC-510F12.2_ENST00000588634.1_RNA|DOCK6_ENST00000319867.7_Missense_Mutation_p.P1197R|DOCK6_ENST00000586702.1_5'UTR	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1858	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCGCCCATCCGGCGTGAACGG	0.597																																					p.P1858R		.											.	DOCK6-93	0			c.C5573G						.						85.0	91.0	89.0					19																	11312680		2135	4244	6379	SO:0001583	missense	57572	exon44			CCATCCGGCGTGA		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5573C>G	19.37:g.11312680G>C	ENSP00000294618:p.Pro1858Arg	42	0		35	10	NM_020812	0	0	14	24	10	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	4.448	0.083033	0.08533	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.16457	2.34;2.34	4.84	3.8	0.43715	.	0.164262	0.43747	D	0.000521	T	0.09686	0.0238	N	0.20986	0.625	0.34097	D	0.661381	B;B;B	0.23058	0.026;0.079;0.055	B;B;B	0.32149	0.017;0.141;0.064	T	0.19063	-1.0317	10	0.07325	T	0.83	-15.5866	5.6208	0.17455	0.2773:0.0:0.7227:0.0	.	1197;1858;1197	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	R	1858;1197	ENSP00000294618:P1858R;ENSP00000321556:P1197R	ENSP00000294618:P1858R	P	-	2	0	DOCK6	11173680	1.000000	0.71417	0.710000	0.30468	0.153000	0.21895	5.138000	0.64795	2.213000	0.71641	0.491000	0.48974	CCG	.		0.597	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
OR7A17	26333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14991895	14991895	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:14991895G>A	ENST00000327462.2	-	1	369	c.273C>T	c.(271-273)gtC>gtT	p.V91V		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					CATAGGTGATGACTCTGCTCT	0.468																																					p.V91V		.											.	OR7A17-68	0			c.C273T						.						151.0	131.0	138.0					19																	14991895		2203	4300	6503	SO:0001819	synonymous_variant	26333	exon1			GGTGATGACTCTG	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.273C>T	19.37:g.14991895G>A		95	0		126	59	NM_030901	0	0	0	0	0	Q6IFQ6|Q96R98	Silent	SNP	ENST00000327462.2	37	CCDS12319.1																																																																																			.		0.468	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901	
USHBP1	83878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17362478	17362478	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:17362478C>G	ENST00000252597.3	-	12	2008	c.1835G>C	c.(1834-1836)cGc>cCc	p.R612P	AC010646.3_ENST00000594059.1_5'UTR|USHBP1_ENST00000431146.2_Missense_Mutation_p.R548P	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						CAGCTCCCTGCGCAGAGACTG	0.602																																					p.R612P		.											.	USHBP1-91	0			c.G1835C						.						75.0	74.0	74.0					19																	17362478		2203	4300	6503	SO:0001583	missense	83878	exon12			TCCCTGCGCAGAG	AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1835G>C	19.37:g.17362478C>G	ENSP00000252597:p.Arg612Pro	96	0		104	48	NM_031941	0	0	3	4	1		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	C	5.320	0.244414	0.10077	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.19250	2.17;2.16	4.28	1.98	0.26296	.	0.610995	0.13794	N	0.362329	T	0.19927	0.0479	L	0.57536	1.79	0.09310	N	1	P;P	0.45240	0.854;0.854	B;B	0.43301	0.415;0.415	T	0.13845	-1.0494	10	0.49607	T	0.09	-11.2307	4.0967	0.09995	0.234:0.6445:0.0:0.1215	.	548;612	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	P	612;548	ENSP00000252597:R612P;ENSP00000407902:R548P	ENSP00000252597:R612P	R	-	2	0	USHBP1	17223478	0.000000	0.05858	0.005000	0.12908	0.023000	0.10783	0.206000	0.17375	2.108000	0.64289	0.561000	0.74099	CGC	.		0.602	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	
CRTC1	23373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18876245	18876245	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:18876245C>G	ENST00000321949.8	+	9	944	c.918C>G	c.(916-918)caC>caG	p.H306Q	CRTC1_ENST00000594658.1_Missense_Mutation_p.H265Q|CRTC1_ENST00000338797.6_Missense_Mutation_p.H322Q|CRTC1_ENST00000601916.1_Missense_Mutation_p.H231Q	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1										CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						CTCCACAGCACCGCCCAGCTG	0.622																																					p.H322Q		.											.	CRTC1-1361	0			c.C966G						.						131.0	128.0	129.0					19																	18876245		2203	4300	6503	SO:0001583	missense	23373	exon10			ACAGCACCGCCCA	AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.918C>G	19.37:g.18876245C>G	ENSP00000323332:p.His306Gln	199	0		180	66	NM_001098482	0	0	19	25	6		Missense_Mutation	SNP	ENST00000321949.8	37	CCDS32963.1	.	.	.	.	.	.	.	.	.	.	C	4.850	0.158062	0.09236	.	.	ENSG00000105662	ENST00000262813;ENST00000338797;ENST00000321949	T;T	0.11495	2.77;2.77	4.23	3.18	0.36537	.	0.533386	0.19393	N	0.115375	T	0.07548	0.0190	L	0.46157	1.445	0.41761	D	0.989719	P;B;B	0.35348	0.496;0.284;0.112	B;B;B	0.27608	0.081;0.071;0.037	T	0.22208	-1.0223	10	0.17832	T	0.49	-19.0333	7.3343	0.26601	0.0:0.7971:0.0:0.2029	.	306;322;306	Q6UUV9-3;Q6UUV9-2;Q6UUV9	.;.;CRTC1_HUMAN	Q	306;322;306	ENSP00000345001:H322Q;ENSP00000323332:H306Q	ENSP00000262813:H306Q	H	+	3	2	CRTC1	18737245	0.713000	0.27926	0.992000	0.48379	0.498000	0.33706	0.107000	0.15375	2.077000	0.62373	0.561000	0.74099	CAC	.		0.622	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
ZNF253	56242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	20003291	20003291	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:20003291C>T	ENST00000589717.1	+	4	1327	c.1235C>T	c.(1234-1236)tCc>tTc	p.S412F	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.S336F|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	412				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCAATCCTCTCCAAACATAAA	0.388																																					p.S412F		.											.	ZNF253-90	0			c.C1235T						.						39.0	43.0	42.0					19																	20003291		2087	4250	6337	SO:0001583	missense	56242	exon4			TCCTCTCCAAACA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1235C>T	19.37:g.20003291C>T	ENSP00000468720:p.Ser412Phe	37	0		38	19	NM_021047	0	0	13	25	12	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	c	3.372	-0.128115	0.06753	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25938	0.0632	L	0.35542	1.07	0.09310	N	1	P	0.34562	0.457	B	0.39299	0.296	T	0.21415	-1.0246	7	.	.	.	.	3.9875	0.09522	0.409:0.591:0.0:0.0	.	412	O75346	ZN253_HUMAN	F	412	.	.	S	+	2	0	ZNF253	19864291	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	0.021000	0.13489	0.293000	0.22520	0.298000	0.19748	TCC	.		0.388	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
KIR3DL2	3812	bcgsc.ca	37	19	55362679	55362679	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:55362679C>A	ENST00000326321.3	+	2	72	c.39C>A	c.(37-39)ttC>ttA	p.F13L	KIR3DL1_ENST00000402254.2_Intron|KIR2DS4_ENST00000339924.8_RNA|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.F13L	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	13					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		TTCCAGGGTTCTTCTTGCTGC	0.557																																					p.F13L													.	KIR3DL2-92	0			c.C39A						.						53.0	70.0	65.0					19																	55362679		1241	3127	4368	SO:0001583	missense	3812	exon2			AGGGTTCTTCTTG	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.39C>A	19.37:g.55362679C>A	ENSP00000325525:p.Phe13Leu	280	3		309	18	NM_001242867	0	0	0	0	0	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	c	8.766	0.924679	0.18056	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.00448	7.4;7.38	0.847	0.847	0.18961	.	.	.	.	.	T	0.00271	0.0008	L	0.28400	0.85	0.23784	N	0.996854	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.002	T	0.34700	-0.9818	9	0.42905	T	0.14	.	5.0537	0.14522	0.0:1.0:0.0:0.0	.	13;13	Q95366;P43630	.;KI3L2_HUMAN	L	13	ENSP00000325525:F13L;ENSP00000270442:F13L	ENSP00000270442:F13L	F	+	3	2	KIR3DL2	60054491	0.000000	0.05858	0.401000	0.26359	0.048000	0.14542	-0.428000	0.06991	0.764000	0.33197	0.184000	0.17185	TTC	.		0.557	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
ZNF471	57573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57037192	57037192	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:57037192T>C	ENST00000308031.5	+	5	1889	c.1756T>C	c.(1756-1758)Tgt>Cgt	p.C586R	ZNF471_ENST00000593197.1_3'UTR|ZNF471_ENST00000591537.1_3'UTR	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		TAGCTCATCCTGTGCTCAGCA	0.408																																					p.C586R	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	.											.	ZNF471-154	0			c.T1756C						.						78.0	74.0	75.0					19																	57037192		2203	4300	6503	SO:0001583	missense	57573	exon5			TCATCCTGTGCTC	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1756T>C	19.37:g.57037192T>C	ENSP00000309161:p.Cys586Arg	62	0		76	33	NM_020813	0	0	0	0	0	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	37	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	T	4.114	0.019231	0.08006	.	.	ENSG00000196263	ENST00000308031	T	0.00949	5.51	3.68	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00724	0.0024	N	0.11789	0.175	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.45498	-0.9257	9	0.87932	D	0	.	9.1979	0.37240	0.0:0.4048:0.0:0.5952	.	586	Q9BX82	ZN471_HUMAN	R	586	ENSP00000309161:C586R	ENSP00000309161:C586R	C	+	1	0	ZNF471	61729004	0.000000	0.05858	0.017000	0.16124	0.514000	0.34195	-1.549000	0.02182	-0.322000	0.08615	-0.464000	0.05259	TGT	.		0.408	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ZNF514	84874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95815880	95815880	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:95815880C>T	ENST00000295208.2	-	5	812	c.350G>A	c.(349-351)tGc>tAc	p.C117Y	ZNF514_ENST00000411425.1_Missense_Mutation_p.C117Y|MRPS5_ENST00000475040.1_5'Flank	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(6)|urinary_tract(1)	11						ATCACAACCGCAGGCTGCTTT	0.438																																					p.C117Y		.											.	ZNF514-90	0			c.G350A						.						121.0	120.0	120.0					2																	95815880		2203	4300	6503	SO:0001583	missense	84874	exon5			CAACCGCAGGCTG	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.350G>A	2.37:g.95815880C>T	ENSP00000295208:p.Cys117Tyr	154	1		152	63	NM_032788	0	0	14	21	7	Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	C	0.252	-1.006088	0.02112	.	.	ENSG00000144026	ENST00000295208;ENST00000411425	T;T	0.05025	3.51;3.51	3.18	0.178	0.15058	.	.	.	.	.	T	0.04497	0.0123	L	0.43152	1.355	0.09310	N	1	P	0.42785	0.79	B	0.32289	0.143	T	0.41413	-0.9510	9	0.29301	T	0.29	.	6.8351	0.23931	0.0:0.3742:0.5135:0.1122	.	117	Q96K75	ZN514_HUMAN	Y	117	ENSP00000295208:C117Y;ENSP00000405509:C117Y	ENSP00000295208:C117Y	C	-	2	0	ZNF514	95179607	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.114000	0.15520	0.020000	0.15106	0.655000	0.94253	TGC	.		0.438	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788	
SULT1C4	27233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109002781	109002781	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:109002781T>C	ENST00000272452.2	+	6	1075	c.749T>C	c.(748-750)aTt>aCt	p.I250T	SULT1C4_ENST00000409309.3_Missense_Mutation_p.I175T	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	250					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						TATTCATCGATTCCTGCTGAA	0.299																																					p.I250T		.											.	SULT1C4-22	0			c.T749C						.						92.0	89.0	90.0					2																	109002781		2203	4300	6503	SO:0001583	missense	27233	exon6			CATCGATTCCTGC	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.749T>C	2.37:g.109002781T>C	ENSP00000272452:p.Ile250Thr	111	0		119	59	NM_006588	0	0	193	394	201	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	37	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502652	0.26949	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	D;D	0.82344	-1.6;-1.6	4.69	3.51	0.40186	Sulfotransferase domain (1);	0.823783	0.10424	N	0.676268	T	0.81034	0.4739	L	0.39147	1.195	0.09310	N	1	P;B	0.39480	0.675;0.05	P;B	0.47603	0.551;0.131	T	0.69650	-0.5088	10	0.54805	T	0.06	.	6.7246	0.23348	0.1598:0.0:0.1461:0.6941	.	175;250	Q08AS5;O75897	.;ST1C4_HUMAN	T	250;175	ENSP00000272452:I250T;ENSP00000387225:I175T	ENSP00000272452:I250T	I	+	2	0	SULT1C4	108369213	0.086000	0.21541	0.001000	0.08648	0.087000	0.18053	3.039000	0.49791	0.904000	0.36572	0.496000	0.49642	ATT	.		0.299	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu	37	2	109370389	109370389	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:109370389A>T	ENST00000283195.6	+	15	2290	c.2164A>T	c.(2164-2166)Ata>Tta	p.I722L		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	722					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AATAAAGATTATAGATGACAG	0.378																																					p.I722L		.											.	RANBP2-675	0			c.A2164T						.						67.0	80.0	76.0					2																	109370389		2181	4289	6470	SO:0001583	missense	5903	exon15			AAGATTATAGATG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2164A>T	2.37:g.109370389A>T	ENSP00000283195:p.Ile722Leu	442	0		353	114	NM_006267	0	0	9	17	8	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	2.546	-0.305085	0.05495	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.20069	2.1	5.09	-2.11	0.07187	.	.	.	.	.	T	0.06554	0.0168	N	0.04508	-0.205	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.39461	-0.9613	9	0.05833	T	0.94	4.0E-4	5.8231	0.18538	0.5189:0.1341:0.0:0.3471	.	722	P49792	RBP2_HUMAN	L	722	ENSP00000283195:I722L	ENSP00000283195:I722L	I	+	1	0	RANBP2	108736821	0.325000	0.24660	0.968000	0.41197	0.973000	0.67179	-0.324000	0.07986	-0.548000	0.06199	-1.802000	0.00618	ATA	.		0.378	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RPRM	56475	broad.mit.edu;bcgsc.ca	37	2	154334999	154334999	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:154334999C>T	ENST00000325926.3	-	1	323	c.81G>A	c.(79-81)gtG>gtA	p.V27V	AC012501.2_ENST00000424322.1_RNA	NM_019845.2	NP_062819.1	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependent G2 arrest mediator candidate	27					cell cycle arrest (GO:0007050)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)|prostate(1)	4						TGCAGCAGCGCACGGCTCGCT	0.701																																					p.V27V													.	RPRM-204	0			c.G81A						.						44.0	32.0	36.0					2																	154334999		2202	4299	6501	SO:0001819	synonymous_variant	56475	exon1			GCAGCGCACGGCT	AK074808	CCDS2198.1	2q24.1	2011-01-26	2005-12-01		ENSG00000177519	ENSG00000177519			24201	protein-coding gene	gene with protein product	"""candidate mediator of the p53 dependent G2 arrest"", ""REPRIMO"""	612171	"""reprimo, TP53 dependant G2 arrest mediator candidate"""			10930422	Standard	NM_019845		Approved	FLJ90327, REPRIMO	uc002tyq.1	Q9NS64	OTTHUMG00000131905	ENST00000325926.3:c.81G>A	2.37:g.154334999C>T		40	0		19	9	NM_019845	0	0	0	0	0	B2R4V1	Silent	SNP	ENST00000325926.3	37	CCDS2198.1																																																																																			.		0.701	RPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254856.1	NM_019845	
BAZ2B	29994	ucsc.edu	37	2	160295143	160295143	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:160295143C>T	ENST00000392783.2	-	8	1459	c.964G>A	c.(964-966)Gaa>Aaa	p.E322K	BAZ2B_ENST00000355831.2_Missense_Mutation_p.E322K|BAZ2B_ENST00000343439.5_Missense_Mutation_p.E320K|BAZ2B_ENST00000392782.1_Missense_Mutation_p.E320K	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ATTCTTTTTTCCTGGGCTTTT	0.428																																					p.E322K													.	BAZ2B-94	0			c.G964A						.						173.0	174.0	173.0					2																	160295143		1836	4105	5941	SO:0001583	missense	29994	exon8			TTTTTTCCTGGGC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.964G>A	2.37:g.160295143C>T	ENSP00000376534:p.Glu322Lys	239	6		243	3	NM_013450	0	0	14	15	1	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938406	0.73557	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	5.05	5.05	0.67936	.	0.000000	0.38058	U	0.001839	T	0.27169	0.0666	L	0.57536	1.79	0.52099	D	0.999944	D;D;P;P;P	0.61697	0.99;0.99;0.827;0.827;0.734	D;D;B;B;B	0.72982	0.979;0.979;0.345;0.442;0.257	T	0.00587	-1.1657	10	0.62326	D	0.03	-19.7068	18.7769	0.91915	0.0:1.0:0.0:0.0	.	320;322;320;320;322	Q6MZK7;Q9UIF8-3;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	K	320;322;322;320;259	ENSP00000376533:E320K;ENSP00000376534:E322K;ENSP00000348087:E322K;ENSP00000339670:E320K	ENSP00000339670:E320K	E	-	1	0	BAZ2B	160003389	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.934000	0.70138	2.485000	0.83878	0.650000	0.86243	GAA	.		0.428	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
MYO3B	140469	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	171375969	171375969	+	Missense_Mutation	SNP	G	G	A	rs372050798		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:171375969G>A	ENST00000408978.4	+	30	3637	c.3494G>A	c.(3493-3495)cGt>cAt	p.R1165H	MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000334231.6_Missense_Mutation_p.R1174H|MYO3B_ENST00000409044.3_Missense_Mutation_p.R1138H	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	1165			R -> C (in dbSNP:rs56052422). {ECO:0000269|PubMed:17344846}.		peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TCTGTACATCGTAGGAGCCAT	0.468													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17494	0.0		0.0	False		,,,				2504	0.0				p.R1165H													.	MYO3B-530	0			c.G3494A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	2,3826		0,2,1912	78.0	79.0	78.0		3413,3494,3494	-6.1	0.0	2		78	0,8252		0,0,4126	no	missense,missense,missense	MYO3B	NM_001083615.2,NM_001171642.1,NM_138995.3	29,29,29	0,2,6038	AA,AG,GG		0.0,0.0522,0.0166	benign,benign,benign	1138/1315,1165/1276,1165/1342	171375969	2,12078	1914	4126	6040	SO:0001583	missense	140469	exon30			TACATCGTAGGAG		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3494G>A	2.37:g.171375969G>A	ENSP00000386213:p.Arg1165His	93	0		68	24	NM_138995	0	0	0	0	0	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	g	7.696	0.692180	0.15039	5.22E-4	0.0	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000334231	T;T;T	0.77877	-1.13;-1.12;-1.12	3.82	-6.05	0.02172	.	1.065760	0.07515	N	0.909616	T	0.42944	0.1225	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.21177	-1.0253	10	0.33940	T	0.23	.	1.306	0.02088	0.2439:0.3051:0.3014:0.1496	.	1165;1138;1165	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	H	1138;1165;1164;1174	ENSP00000386497:R1138H;ENSP00000386213:R1165H;ENSP00000335100:R1174H	ENSP00000314213:R1164H	R	+	2	0	MYO3B	171084215	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.898000	0.04105	-0.977000	0.03537	-0.537000	0.04273	CGT	.		0.468	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:178098803C>A	ENST00000397062.3	-	2	796	c.242G>T	c.(241-243)gGt>gTt	p.G81V	NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65V|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65V|NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65V|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65V	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.G81V		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2-90	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)	c.G242T						.						143.0	142.0	142.0					2																	178098803		1901	4105	6006	SO:0001583	missense	4780	exon2			AATTCACCTGTCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>T	2.37:g.178098803C>A	ENSP00000380252:p.Gly81Val	68	0		98	51	NM_006164	0	0	98	175	77	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.883817|4.883817	0.91814|0.91814	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.52983	.|1.19;1.19;1.19;0.64;0.64;1.19	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75110	.|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	.|T	.|0.78563	.|-0.2156	.|10	.|0.87932	.|D	.|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|V	-1|65;81;65;65;65;65	.|ENSP00000380253:G65V;ENSP00000380252:G81V;ENSP00000411575:G65V;ENSP00000400073:G65V;ENSP00000412191:G65V;ENSP00000410015:G65V	.|ENSP00000380252:G81V	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
COPS7B	64708	hgsc.bcm.edu;broad.mit.edu	37	2	232663673	232663673	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:232663673A>G	ENST00000350033.3	+	6	776	c.635A>G	c.(634-636)gAg>gGg	p.E212G	COPS7B_ENST00000373608.3_Splice_Site_p.E212G|COPS7B_ENST00000410024.1_Splice_Site_p.E212G|COPS7B_ENST00000410017.1_Splice_Site_p.E212G|COPS7B_ENST00000409295.1_Splice_Site_p.E178G|COPS7B_ENST00000409091.1_Splice_Site_p.E105G	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B	212					cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTAGAAGCAGAGGTAAGGAAG	0.448																																					p.E212G		.											.	COPS7B-228	0			c.A635G						.						114.0	86.0	96.0					2																	232663673		2203	4300	6503	SO:0001630	splice_region_variant	64708	exon6			AAGCAGAGGTAAG	AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000350033.3:c.636+1A>G	2.37:g.232663673A>G		23	0		21	9	NM_022730	0	0	0	0	0	Q53S22|Q5BJG3|Q9H7V6	Missense_Mutation	SNP	ENST00000350033.3	37	CCDS2488.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.141236	0.77775	.	.	ENSG00000144524	ENST00000410024;ENST00000409295;ENST00000409091;ENST00000350033;ENST00000410017;ENST00000373608;ENST00000537799;ENST00000449174	T;T;T;T;T;T;T	0.52295	1.17;1.17;1.17;1.17;0.7;0.67;1.17	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	M	0.69185	2.1	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.998	D;D;D	0.83275	0.996;0.921;0.968	T	0.70124	-0.4958	10	0.66056	D	0.02	-1.6914	14.6136	0.68531	1.0:0.0:0.0:0.0	.	212;212;212	Q53GQ2;Q9H9Q2-3;Q9H9Q2	.;.;CSN7B_HUMAN	G	212;178;105;212;212;212;105;76	ENSP00000386567:E212G;ENSP00000386438:E178G;ENSP00000386527:E105G;ENSP00000272995:E212G;ENSP00000386880:E212G;ENSP00000362710:E212G;ENSP00000403300:E76G	ENSP00000272995:E212G	E	+	2	0	COPS7B	232371917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.777000	0.91781	2.044000	0.60594	0.533000	0.62120	GAG	.		0.448	COPS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256964.2	NM_022730	Missense_Mutation
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	41100970	41100970	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr20:41100970G>A	ENST00000373187.1	-	8	1385	c.1386C>T	c.(1384-1386)ctC>ctT	p.L462L	PTPRT_ENST00000356100.2_Silent_p.L462L|PTPRT_ENST00000373201.1_Silent_p.L462L|PTPRT_ENST00000373198.4_Silent_p.L462L|PTPRT_ENST00000373193.3_Silent_p.L462L|PTPRT_ENST00000373184.1_Silent_p.L462L|PTPRT_ENST00000373190.1_Silent_p.L462L			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	462	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGACAGCAAGAGTCGCAGCC	0.612																																					p.L462L		.											.	PTPRT-664	0			c.C1386T						.						57.0	62.0	60.0					20																	41100970		2134	4245	6379	SO:0001819	synonymous_variant	11122	exon8			CAGCAAGAGTCGC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1386C>T	20.37:g.41100970G>A		103	0		147	51	NM_007050	0	0	0	0	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																			.		0.612	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
ZGPAT	84619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62366823	62366823	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr20:62366823T>C	ENST00000328969.5	+	6	1491	c.1364T>C	c.(1363-1365)cTg>cCg	p.L455P	ZGPAT_ENST00000448100.2_Missense_Mutation_p.L435P|ZGPAT_ENST00000357119.4_Missense_Mutation_p.L426P|ZGPAT_ENST00000369967.3_Missense_Mutation_p.L435P|LIME1_ENST00000309546.3_5'Flank|RP4-583P15.15_ENST00000490623.2_Nonstop_Mutation_p.*341R|ZGPAT_ENST00000355969.6_Missense_Mutation_p.L435P|RP4-583P15.14_ENST00000467211.1_5'Flank	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	455					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					AAGCGGGCCCTGAGCCTGCGG	0.667																																					p.L455P		.											.	ZGPAT-90	0			c.T1364C						.						23.0	27.0	26.0					20																	62366823		2200	4300	6500	SO:0001583	missense	84619	exon6			GGGCCCTGAGCCT	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.1364T>C	20.37:g.62366823T>C	ENSP00000332013:p.Leu455Pro	32	0		51	30	NM_032527	0	0	14	52	38	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234362	0.79800	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.32988	1.45;1.45;1.47;1.45;1.43	5.69	4.57	0.56435	.	0.072010	0.56097	D	0.000022	T	0.53738	0.1815	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.54490	-0.8286	10	0.52906	T	0.07	-25.847	11.8041	0.52143	0.1318:0.0:0.0:0.8682	.	426;455;435	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	P	435;435;426;435;455	ENSP00000391176:L435P;ENSP00000348242:L435P;ENSP00000349634:L426P;ENSP00000358984:L435P;ENSP00000332013:L455P	ENSP00000332013:L455P	L	+	2	0	ZGPAT	61837267	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.891000	0.69782	0.955000	0.37878	0.460000	0.39030	CTG	.		0.667	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
SFI1	9814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	32002357	32002357	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:32002357G>C	ENST00000400288.2	+	21	2203	c.2098G>C	c.(2098-2100)Gat>Cat	p.D700H	SFI1_ENST00000432498.1_Missense_Mutation_p.D669H|SFI1_ENST00000540643.1_Missense_Mutation_p.D645H|SFI1_ENST00000443326.1_Missense_Mutation_p.D618H|SFI1_ENST00000400289.1_Missense_Mutation_p.D618H|SFI1_ENST00000443011.1_Missense_Mutation_p.D547H|SFI1_ENST00000414585.1_Missense_Mutation_p.D547H	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	700					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGCCCGAGTGGATGAAGCCAA	0.517																																					p.D700H		.											.	SFI1-90	0			c.G2098C						.						88.0	88.0	88.0					22																	32002357		2023	4185	6208	SO:0001583	missense	9814	exon21			CGAGTGGATGAAG	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2098G>C	22.37:g.32002357G>C	ENSP00000383145:p.Asp700His	61	0		63	25	NM_001007467	0	0	8	20	12	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	G	8.780	0.928003	0.18131	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.14266	3.1;3.1;2.94;2.93;2.93;2.94;3.1;2.52	5.06	0.509	0.16977	.	0.751926	0.13001	N	0.421651	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	P;P;P;P;P	0.42757	0.789;0.603;0.603;0.789;0.573	P;B;B;P;B	0.49922	0.626;0.366;0.277;0.626;0.366	T	0.28364	-1.0046	10	0.40728	T	0.16	.	6.8814	0.24174	0.4019:0.0:0.5981:0.0	.	645;618;618;669;700	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	H	669;645;618;547;547;618;700;283	ENSP00000402679:D669H;ENSP00000443025:D645H;ENSP00000416469:D618H;ENSP00000397148:D547H;ENSP00000401199:D547H;ENSP00000383146:D618H;ENSP00000383145:D700H;ENSP00000398871:D283H	ENSP00000383145:D700H	D	+	1	0	SFI1	30332357	0.001000	0.12720	0.033000	0.17914	0.025000	0.11179	0.187000	0.16998	0.237000	0.21200	-0.995000	0.02519	GAT	.		0.517	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
C1QTNF6	114904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37578251	37578251	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:37578251G>C	ENST00000337843.2	-	3	889	c.814C>G	c.(814-816)Ctc>Gtc	p.L272V	RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000255836.6_Missense_Mutation_p.L148V|C1QTNF6_ENST00000397110.2_Missense_Mutation_p.L272V|C1QTNF6_ENST00000470655.1_5'UTR	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	253					protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						GCCTTGATGAGGTGGCCGCTG	0.657																																					p.L272V		.											.	C1QTNF6-90	0			c.C814G						.						61.0	57.0	58.0					22																	37578251		2203	4300	6503	SO:0001583	missense	114904	exon3			TGATGAGGTGGCC	AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.814C>G	22.37:g.37578251G>C	ENSP00000338812:p.Leu272Val	48	0		35	18	NM_182486	0	0	6	8	2	Q5H9G8|Q6ZRM7	Missense_Mutation	SNP	ENST00000337843.2	37	CCDS13943.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981527	0.74474	.	.	ENSG00000133466	ENST00000397110;ENST00000337843;ENST00000255836	T;T;T	0.51574	0.7;0.7;0.7	4.84	4.84	0.62591	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.64402	D	0.000001	T	0.78444	0.4284	H	0.97265	3.97	0.58432	D	0.999997	D;D	0.76494	0.999;0.998	D;D	0.72075	0.976;0.971	D	0.85842	0.1398	10	0.87932	D	0	.	13.3544	0.60619	0.0787:0.0:0.9213:0.0	.	272;253	Q9BXI9-2;Q9BXI9	.;C1QT6_HUMAN	V	272;272;148	ENSP00000380299:L272V;ENSP00000338812:L272V;ENSP00000255836:L148V	ENSP00000255836:L148V	L	-	1	0	C1QTNF6	35908197	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.704000	0.68347	2.238000	0.73509	0.491000	0.48974	CTC	.		0.657	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318807.1	NM_182486	
ARFGAP3	26286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	43213794	43213794	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:43213794A>G	ENST00000263245.5	-	10	1101	c.882T>C	c.(880-882)atT>atC	p.I294I	ARFGAP3_ENST00000429508.2_Silent_p.I222I|ARFGAP3_ENST00000437119.2_Silent_p.I250I	NM_001142293.1|NM_014570.4	NP_001135765.1|NP_055385.3	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating protein 3	294					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|protein secretion (GO:0009306)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	11						TTTTGCCACtaatgttcatct	0.348																																					p.I294I	GBM(58;544 1030 21460 27159 48838)	.											.	ARFGAP3-153	0			c.T882C						.						296.0	266.0	276.0					22																	43213794		2203	4300	6503	SO:0001819	synonymous_variant	26286	exon10			GCCACTAATGTTC	AK002083	CCDS14042.1, CCDS46722.1	22q13.2	2009-11-30	2002-08-20	2002-08-23	ENSG00000242247	ENSG00000242247		"""ADP-ribosylation factor GTPase activating proteins"""	661	protein-coding gene	gene with protein product		612439	"""ADP-ribosylation factor GTPase activating protein 1"""	ARFGAP1		10704287, 11172815	Standard	NM_014570		Approved		uc003bdd.2	Q9NP61	OTTHUMG00000150718	ENST00000263245.5:c.882T>C	22.37:g.43213794A>G		174	0		139	63	NM_014570	0	0	22	46	24	E9PB03|Q9BSC6|Q9H9J0|Q9NT10|Q9NUP5|Q9Y4V3|Q9Y4V4	Silent	SNP	ENST00000263245.5	37	CCDS14042.1	.	.	.	.	.	.	.	.	.	.	A	7.151	0.583739	0.13749	.	.	ENSG00000242247	ENST00000453516	.	.	.	5.35	-2.94	0.05581	.	.	.	.	.	.	.	.	.	.	.	0.32559	N	0.531383	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1118	4.5685	0.12198	0.2139:0.5126:0.1904:0.0831	.	.	.	.	Q	141	.	.	X	-	1	0	ARFGAP3	41543738	0.000000	0.05858	0.062000	0.19696	0.849000	0.48306	-0.717000	0.04986	-0.307000	0.08804	-0.291000	0.09656	TAG	.		0.348	ARFGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319747.2	NM_014570	
SLC22A13	9390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38317429	38317429	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:38317429T>C	ENST00000311856.4	+	7	1128	c.1079T>C	c.(1078-1080)cTg>cCg	p.L360P	SLC22A13_ENST00000450935.2_3'UTR	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	360					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		GACTTCGGCCTGGACGTCTAT	0.572																																					p.L360P		.											.	SLC22A13-91	0			c.T1079C						.						80.0	77.0	78.0					3																	38317429		2203	4300	6503	SO:0001583	missense	9390	exon7			TCGGCCTGGACGT	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.1079T>C	3.37:g.38317429T>C	ENSP00000310241:p.Leu360Pro	77	0		77	29	NM_004256	0	0	0	0	0	B2RCV9|Q8IYG1	Missense_Mutation	SNP	ENST00000311856.4	37	CCDS2676.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652783	0.67472	.	.	ENSG00000172940	ENST00000311856	T	0.62639	0.01	5.04	5.04	0.67666	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	T	0.81408	0.4816	M	0.91196	3.185	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.70227	0.945;0.968	T	0.82623	-0.0366	10	0.28530	T	0.3	.	14.2827	0.66224	0.0:0.0:0.0:1.0	.	360;360	Q9Y226-2;Q9Y226	.;S22AD_HUMAN	P	360	ENSP00000310241:L360P	ENSP00000310241:L360P	L	+	2	0	SLC22A13	38292433	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	5.806000	0.69150	2.040000	0.60383	0.533000	0.62120	CTG	.		0.572	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253746.2	NM_004256	
SACM1L	22908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45773632	45773632	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:45773632A>T	ENST00000389061.5	+	13	1293	c.1089A>T	c.(1087-1089)caA>caT	p.Q363H	SACM1L_ENST00000541314.1_Missense_Mutation_p.Q302H|SACM1L_ENST00000418611.1_Missense_Mutation_p.Q260H	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	363	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		CAGAAATGCAAGATGAATTAA	0.338																																					p.Q363H		.											.	SACM1L-91	0			c.A1089T						.						105.0	115.0	112.0					3																	45773632		2203	4299	6502	SO:0001583	missense	22908	exon13			AATGCAAGATGAA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.1089A>T	3.37:g.45773632A>T	ENSP00000373713:p.Gln363His	151	0		146	69	NM_014016	0	0	0	0	0	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	37	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391717	0.42410	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314;ENST00000433336	T;T;T;T	0.43294	0.95;0.95;0.95;1.53	5.99	-5.27	0.02763	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.88031	2.925	0.52501	D	0.999958	D;D	0.76494	0.999;0.998	D;D	0.65987	0.94;0.912	T	0.68716	-0.5335	10	0.36615	T	0.2	-3.4019	15.7038	0.77563	0.4825:0.0:0.5175:0.0	.	302;363	B4DK71;Q9NTJ5	.;SAC1_HUMAN	H	260;363;302;40	ENSP00000396387:Q260H;ENSP00000373713:Q363H;ENSP00000443373:Q302H;ENSP00000412883:Q40H	ENSP00000373713:Q363H	Q	+	3	2	SACM1L	45748636	0.993000	0.37304	0.874000	0.34290	0.998000	0.95712	0.423000	0.21313	-1.249000	0.02500	0.533000	0.62120	CAA	.		0.338	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
SLC38A3	10991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50252997	50252997	+	RNA	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:50252997T>C	ENST00000420502.1	+	0	548									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TATGAGCAGCTGGGCTACCGT	0.622																																					p.L132P		.											.	SLC38A3-67	0			c.T395C						.						47.0	51.0	50.0					3																	50252997		2095	4216	6311			10991	exon6			AGCAGCTGGGCTA	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50252997T>C		85	0		65	29	NM_006841	0	0	0	0	0		Missense_Mutation	SNP	ENST00000420502.1	37																																																																																				.		0.622	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
PPM1M	132160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52282683	52282683	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:52282683C>T	ENST00000296487.4	+	7	866	c.462C>T	c.(460-462)ctC>ctT	p.L154L	PPM1M_ENST00000457351.2_Silent_p.L315L|PPM1M_ENST00000409502.3_Silent_p.L103L|PPM1M_ENST00000323588.4_Silent_p.L154L			Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1M	154	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			prostate(1)|urinary_tract(1)	2				BRCA - Breast invasive adenocarcinoma(193;2.4e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)		AATCGGATCTCAAGTACCCAC	0.572																																					p.L315L	NSCLC(151;810 2688 34365 49863)	.											.	.	0			c.C945T						.						156.0	139.0	145.0					3																	52282683		2203	4300	6503	SO:0001819	synonymous_variant	132160	exon7			GGATCTCAAGTAC	AK096681	CCDS46840.1	3p21.31	2012-04-17	2010-03-05		ENSG00000164088	ENSG00000164088		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26506	protein-coding gene	gene with protein product	"""protein phosphatase 2C eta"""	608979	"""protein phosphatase 1M (PP2C domain containing)"""			12477932	Standard	NM_001122870		Approved	PP2Ceta, FLJ32332	uc011bed.2	Q96MI6	OTTHUMG00000153046	ENST00000296487.4:c.462C>T	3.37:g.52282683C>T		140	0		150	70	NM_144641	0	0	17	29	12	Q8N8J9|Q96DB8	Silent	SNP	ENST00000296487.4	37		.	.	.	.	.	.	.	.	.	.	C	9.454	1.091407	0.20471	.	.	ENSG00000164088	ENST00000457454	.	.	.	4.78	3.9	0.45041	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54957	-0.8215	4	.	.	.	.	8.0844	0.30762	0.0:0.7542:0.1611:0.0848	.	.	.	.	L	210	.	.	S	+	2	0	PPM1M	52257723	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.991000	0.29654	1.205000	0.43262	0.561000	0.74099	TCA	.		0.572	PPM1M-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000329230.2	NM_144641	
SLMAP	7871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	57827089	57827089	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:57827089T>C	ENST00000428312.1	+	3	504	c.410T>C	c.(409-411)cTc>cCc	p.L137P	SLMAP_ENST00000295951.3_Missense_Mutation_p.L137P|SLMAP_ENST00000295952.3_Missense_Mutation_p.L137P|SLMAP_ENST00000449503.2_Missense_Mutation_p.L137P|SLMAP_ENST00000383718.3_Missense_Mutation_p.L137P|SLMAP_ENST00000416870.1_5'UTR			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	137	Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GAAGCCCGGCTCCGCTCAGAG	0.338																																					p.L137P		.											.	SLMAP-90	0			c.T410C						.						67.0	70.0	69.0					3																	57827089		2203	4300	6503	SO:0001583	missense	7871	exon3			CCCGGCTCCGCTC	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.410T>C	3.37:g.57827089T>C	ENSP00000398661:p.Leu137Pro	73	0		81	39	NM_007159	0	0	0	0	0	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	ENST00000428312.1	37		.	.	.	.	.	.	.	.	.	.	T	11.27	1.589587	0.28357	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	T;T;T;T;T	0.47177	1.45;1.45;0.85;1.44;1.49	4.85	4.85	0.62838	.	0.259220	0.31438	N	0.007646	T	0.24586	0.0596	N	0.01874	-0.695	0.80722	D	1	P;P;P;B	0.50369	0.816;0.934;0.898;0.002	P;B;B;B	0.45712	0.491;0.418;0.434;0.005	T	0.11299	-1.0593	10	0.26408	T	0.33	-2.0339	10.587	0.45288	0.0:0.0:0.1615:0.8385	.	137;137;137;137	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	P	137	ENSP00000295951:L137P;ENSP00000295952:L137P;ENSP00000373224:L137P;ENSP00000398661:L137P;ENSP00000412945:L137P	ENSP00000295951:L137P	L	+	2	0	SLMAP	57802129	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.864000	0.69575	1.799000	0.52666	0.533000	0.62120	CTC	.		0.338	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
KIAA1524	57650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108282018	108282018	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:108282018C>A	ENST00000295746.8	-	13	1665	c.1589G>T	c.(1588-1590)aGa>aTa	p.R530I	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.R371I	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	530					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R530T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAATAATATTCTCAGTCCAGA	0.393																																					p.R530I		.											.	KIAA1524-92	1	Substitution - Missense(1)	ovary(1)	c.G1589T						.						154.0	159.0	158.0					3																	108282018		2203	4300	6503	SO:0001583	missense	57650	exon13			AATATTCTCAGTC	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1589G>T	3.37:g.108282018C>A	ENSP00000295746:p.Arg530Ile	252	0		204	74	NM_020890	0	0	3	6	3	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770678	0.69992	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.35048	1.33;1.33	5.3	4.43	0.53597	.	0.494865	0.23127	N	0.051633	T	0.40067	0.1102	L	0.53249	1.67	0.53005	D	0.999964	P	0.46706	0.883	P	0.46172	0.506	T	0.31024	-0.9958	10	0.62326	D	0.03	-4.6479	11.7182	0.51666	0.0:0.8541:0.0:0.1459	.	530	Q8TCG1	CIP2A_HUMAN	I	371;530	ENSP00000419487:R371I;ENSP00000295746:R530I	ENSP00000295746:R530I	R	-	2	0	KIAA1524	109764708	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.617000	0.46385	1.237000	0.43756	0.563000	0.77884	AGA	.		0.393	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	
PLXND1	23129	hgsc.bcm.edu;broad.mit.edu	37	3	129290142	129290142	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:129290142C>G	ENST00000324093.4	-	18	3519	c.3341G>C	c.(3340-3342)tGc>tCc	p.C1114S	PLXND1_ENST00000393239.1_Missense_Mutation_p.C1114S	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1114	IPT/TIG 3.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GAGAACCTTGCAGAGCTGGTG	0.637																																					p.C1114S	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1-90	0			c.G3341C						.						15.0	17.0	16.0					3																	129290142		2179	4277	6456	SO:0001583	missense	23129	exon18			ACCTTGCAGAGCT	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3341G>C	3.37:g.129290142C>G	ENSP00000317128:p.Cys1114Ser	15	0		21	8	NM_015103	0	0	2	2	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143494	0.57044	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.60171	0.21;0.21	4.91	4.91	0.64330	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.134947	0.50627	D	0.000119	T	0.61800	0.2376	M	0.83603	2.65	0.80722	D	1	P	0.34934	0.476	B	0.32393	0.145	T	0.69540	-0.5118	10	0.66056	D	0.02	.	16.2882	0.82736	0.0:1.0:0.0:0.0	.	1114	Q9Y4D7	PLXD1_HUMAN	S	1114	ENSP00000317128:C1114S;ENSP00000376931:C1114S	ENSP00000317128:C1114S	C	-	2	0	PLXND1	130772832	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	6.510000	0.73729	2.279000	0.76181	0.313000	0.20887	TGC	.		0.637	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
ZNF721	170960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	436019	436019	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:436019A>C	ENST00000338977.5	-	2	2249	c.2201T>G	c.(2200-2202)aTt>aGt	p.I734S	ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.I746S|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	734					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TCCAGTATGAATTTTCTTATA	0.378																																					p.T746R		.											.	ZNF721-47	0			c.C2237G						.						31.0	33.0	32.0					4																	436019		1990	4173	6163	SO:0001583	missense	170960	exon3			GTATGAATTTTCT	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2201T>G	4.37:g.436019A>C	ENSP00000340524:p.Ile734Ser	29	0		33	12	NM_133474	0	0	5	13	8	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	A	10.61	1.397775	0.25205	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.00949	5.51;5.51	1.28	-0.782	0.10961	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01558	0.0050	L	0.52266	1.64	0.09310	N	1	P;P;P	0.41569	0.65;0.755;0.711	P;B;B	0.47102	0.537;0.239;0.154	T	0.44651	-0.9314	9	0.56958	D	0.05	.	4.9522	0.14021	0.6885:0.3115:0.0:0.0	.	734;746;746	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	S	734;746	ENSP00000340524:I734S;ENSP00000428878:I746S	ENSP00000340524:I734S	I	-	2	0	ZNF721	426019	0.000000	0.05858	0.003000	0.11579	0.055000	0.15305	0.796000	0.26986	-0.422000	0.07405	0.155000	0.16302	ATT	.		0.378	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
NSUN7	79730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	40778094	40778094	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:40778094C>A	ENST00000381782.2	+	7	1349	c.854C>A	c.(853-855)tCt>tAt	p.S285Y	NSUN7_ENST00000316607.5_Missense_Mutation_p.S285Y|NSUN7_ENST00000463952.1_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	285							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GCTGTCCATTCTGTAAAGGCT	0.333																																					p.S285Y		.											.	NSUN7-90	0			c.C854A						.						92.0	92.0	92.0					4																	40778094		2202	4298	6500	SO:0001583	missense	79730	exon7			TCCATTCTGTAAA	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.854C>A	4.37:g.40778094C>A	ENSP00000371201:p.Ser285Tyr	52	0		41	19	NM_024677	0	0	4	7	3	C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	ENST00000381782.2	37	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318911	0.81469	.	.	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.09163	3.01;3.01	5.61	5.61	0.85477	.	0.180007	0.49305	D	0.000151	T	0.31918	0.0812	L	0.59436	1.845	0.51767	D	0.999938	D;D	0.71674	0.997;0.998	D;D	0.72075	0.931;0.976	T	0.00666	-1.1619	10	0.66056	D	0.02	-20.3807	19.2661	0.93985	0.0:1.0:0.0:0.0	.	285;285	Q8NE18;Q8NE18-2	NSUN7_HUMAN;.	Y	285	ENSP00000371201:S285Y;ENSP00000319127:S285Y	ENSP00000319127:S285Y	S	+	2	0	NSUN7	40472851	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.610000	0.67668	2.643000	0.89663	0.557000	0.71058	TCT	.		0.333	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57861558	57861558	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:57861558C>A	ENST00000381227.1	+	7	1131	c.718C>A	c.(718-720)Ctg>Atg	p.L240M	POLR2B_ENST00000314595.5_Missense_Mutation_p.L240M|POLR2B_ENST00000441246.2_Missense_Mutation_p.L233M|POLR2B_ENST00000431623.2_Missense_Mutation_p.L165M|snoU13_ENST00000459266.1_RNA			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	240					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GGTTAGCATGCTGGCAAGAGG	0.408																																					p.L240M		.											.	POLR2B-92	0			c.C718A						.						121.0	125.0	123.0					4																	57861558		2203	4300	6503	SO:0001583	missense	5431	exon6			AGCATGCTGGCAA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.718C>A	4.37:g.57861558C>A	ENSP00000370625:p.Leu240Met	147	1		122	55	NM_000938	0	0	55	109	54	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	C	8.067	0.769398	0.15983	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	4.84	3.1	0.35709	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.055810	0.64402	D	0.000001	T	0.46795	0.1411	L	0.28115	0.83	0.58432	D	0.999992	B;B	0.17268	0.021;0.012	B;B	0.27262	0.078;0.078	T	0.19516	-1.0303	10	0.16420	T	0.52	.	10.8237	0.46620	0.0:0.8452:0.0:0.1548	.	165;240	C9J4M6;P30876	.;RPB2_HUMAN	M	240;165;233;240	ENSP00000370625:L240M;ENSP00000391096:L165M;ENSP00000391452:L233M;ENSP00000312735:L240M	ENSP00000312735:L240M	L	+	1	2	POLR2B	57556315	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.904000	0.56325	0.565000	0.29255	0.563000	0.77884	CTG	.		0.408	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57891054	57891054	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:57891054A>G	ENST00000381227.1	+	23	3380	c.2967A>G	c.(2965-2967)gtA>gtG	p.V989V	POLR2B_ENST00000314595.5_Silent_p.V989V|POLR2B_ENST00000441246.2_Silent_p.V982V|POLR2B_ENST00000431623.2_Silent_p.V914V			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	989					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TTTAAAAGGTATCGGCTAACA	0.313																																					p.V989V		.											.	POLR2B-92	0			c.A2967G						.						118.0	119.0	119.0					4																	57891054		2203	4300	6503	SO:0001819	synonymous_variant	5431	exon22			AAAGGTATCGGCT		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2967A>G	4.37:g.57891054A>G		91	0		86	38	NM_000938	0	0	0	0	0	A8K1A8|Q8IZ61	Silent	SNP	ENST00000381227.1	37	CCDS3511.1																																																																																			.		0.313	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
DHX29	54505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	54591351	54591351	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:54591351A>G	ENST00000251636.5	-	5	655	c.507T>C	c.(505-507)gaT>gaC	p.D169D	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	169						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CAGGAAGTGCATCTTAAAATA	0.348																																					p.D169D		.											.	DHX29-229	0			c.T507C						.						73.0	74.0	74.0					5																	54591351		2203	4300	6503	SO:0001630	splice_region_variant	54505	exon5			AAGTGCATCTTAA	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.506-1T>C	5.37:g.54591351A>G		67	0		58	24	NM_019030	0	0	0	0	0	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781171	0.31502	.	.	ENSG00000067248	ENST00000508346	.	.	.	5.95	3.44	0.39384	.	.	.	.	.	T	0.57873	0.2083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53746	-0.8395	4	.	.	.	.	8.1903	0.31363	0.7953:0.1348:0.07:0.0	.	.	.	.	R	134	.	.	C	-	1	0	DHX29	54627108	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.848000	0.39309	1.075000	0.40932	0.528000	0.53228	TGC	.		0.348	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	Silent
MAST4	375449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	66448594	66448594	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:66448594T>C	ENST00000403625.2	+	25	3720	c.3425T>C	c.(3424-3426)aTt>aCt	p.I1142T	MAST4_ENST00000261569.7_Missense_Mutation_p.I948T|MAST4_ENST00000403666.1_Missense_Mutation_p.I953T|MAST4_ENST00000404260.3_Missense_Mutation_p.I1145T|MAST4_ENST00000405643.1_Missense_Mutation_p.I963T	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1145						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CATCAGCCGATTGTGATCCAC	0.542																																					p.I1142T		.											.	MAST4-647	0			c.T3425C						.						97.0	97.0	97.0					5																	66448594		1969	4170	6139	SO:0001583	missense	375449	exon25			AGCCGATTGTGAT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3425T>C	5.37:g.66448594T>C	ENSP00000385727:p.Ile1142Thr	131	1		150	78	NM_001164664	1	0	26	38	11	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.688980	0.88735	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	6.17	6.17	0.99709	PDZ/DHR/GLGF (2);	0.305290	0.35708	N	0.003034	T	0.56140	0.1965	L	0.47190	1.495	0.53688	D	0.999975	D;P	0.53619	0.961;0.921	P;P	0.59825	0.864;0.662	T	0.56798	-0.7919	10	0.72032	D	0.01	-6.8421	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1145;953	O15021;O15021-3	MAST4_HUMAN;.	T	1145;1142;953;963;963;948;881	ENSP00000385048:I1145T;ENSP00000385727:I1142T;ENSP00000384313:I953T;ENSP00000384099:I963T;ENSP00000261569:I948T	ENSP00000261569:I948T	I	+	2	0	MAST4	66484350	0.998000	0.40836	0.949000	0.38748	0.731000	0.41821	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	ATT	.		0.542	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
BDP1	55814	ucsc.edu	37	5	70858261	70858261	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:70858261G>A	ENST00000358731.4	+	38	7920	c.7657G>A	c.(7657-7659)Gaa>Aaa	p.E2553K	BDP1_ENST00000380675.2_3'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2553					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGAAAGCCAGGAAAAAAATCG	0.368																																					p.E2553K													.	BDP1-92	0			c.G7657A						.						80.0	74.0	76.0					5																	70858261		1821	4085	5906	SO:0001583	missense	55814	exon38			AGCCAGGAAAAAA	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.7657G>A	5.37:g.70858261G>A	ENSP00000351575:p.Glu2553Lys	89	0		74	1	NM_018429	0	0	8	9	1	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	4.258	0.046834	0.08243	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.02345	4.33	5.87	-2.58	0.06228	.	0.923345	0.09237	N	0.829799	T	0.00608	0.0020	N	0.00128	-2.045	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50415	-0.8831	10	0.02654	T	1	.	6.4772	0.22043	0.4318:0.145:0.4233:0.0	.	2553	A6H8Y1	BDP1_HUMAN	K	2553;2101	ENSP00000351575:E2553K	ENSP00000351575:E2553K	E	+	1	0	BDP1	70894017	0.059000	0.20769	0.602000	0.28890	0.782000	0.44232	-0.052000	0.11865	-0.680000	0.05211	-0.247000	0.11927	GAA	.		0.368	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
CTNNA1	1495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138268291	138268291	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:138268291G>A	ENST00000302763.7	+	17	2413	c.2323G>A	c.(2323-2325)Gac>Aac	p.D775N	CTNNA1_ENST00000518825.1_Missense_Mutation_p.D775N|CTNNA1_ENST00000355078.5_Missense_Mutation_p.D672N|CTNNA1_ENST00000540387.1_Missense_Mutation_p.D405N	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	775					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTGCAAGCAGGACCTGCTGGC	0.607																																					p.D775N		.											.	CTNNA1-671	0			c.G2323A						.						53.0	46.0	49.0					5																	138268291		2203	4300	6503	SO:0001583	missense	1495	exon17			AAGCAGGACCTGC	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2323G>A	5.37:g.138268291G>A	ENSP00000304669:p.Asp775Asn	43	0		34	19	NM_001903	0	0	586	1185	599	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	G	35	5.472975	0.96274	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	M	0.65677	2.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.977	D;D;P	0.87578	0.996;0.998;0.893	T	0.45614	-0.9249	10	0.13108	T	0.6	-22.7863	19.2223	0.93803	0.0:0.0:1.0:0.0	.	775;652;775	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	N	672;775;775;760;775;405	ENSP00000347190:D672N;ENSP00000304669:D775N;ENSP00000427821:D775N;ENSP00000438476:D405N	ENSP00000304669:D775N	D	+	1	0	CTNNA1	138296190	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.635000	0.98437	2.873000	0.98535	0.563000	0.77884	GAC	.		0.607	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	139864824	139864824	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:139864824T>C	ENST00000360839.2	+	12	2143	c.1989T>C	c.(1987-1989)caT>caC	p.H663H	ANKHD1_ENST00000297183.6_Silent_p.H663H|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.H663H	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	663						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTACTCATCGACTCAAGG	0.498																																					p.H663H		.											.	ANKHD1-185	0			c.T1989C						.						85.0	75.0	78.0					5																	139864824		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon12			TACTCATCGACTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.1989T>C	5.37:g.139864824T>C		49	0		46	18	NM_017747	0	0	0	0	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	T	9.851	1.193672	0.22037	.	.	ENSG00000131503	ENST00000246149	.	.	.	5.29	2.6	0.31112	.	.	.	.	.	T	0.58864	0.2152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54807	-0.8238	4	.	.	.	.	9.6999	0.40180	0.0:0.2399:0.0:0.7601	.	.	.	.	T	158	.	.	I	+	2	0	ANKHD1	139845008	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.439000	0.44846	0.939000	0.37446	0.459000	0.35465	ATC	.		0.498	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
TMCO6	55374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140021512	140021512	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:140021512G>A	ENST00000394671.3	+	4	473	c.372G>A	c.(370-372)ctG>ctA	p.L124L	TMCO6_ENST00000252100.6_Silent_p.L124L|TMCO6_ENST00000537378.1_Intron|TMCO6_ENST00000511410.1_3'UTR|NDUFA2_ENST00000510680.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	124					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCCCTGCTGCAGCTTGAGG	0.622																																					p.L124L		.											.	TMCO6-90	0			c.G372A						.						40.0	45.0	44.0					5																	140021512		2033	4188	6221	SO:0001819	synonymous_variant	55374	exon4			CCTGCTGCAGCTT	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.372G>A	5.37:g.140021512G>A		88	0		89	37	NM_018502	0	0	12	28	16	Q9BUU0|Q9P198	Silent	SNP	ENST00000394671.3	37	CCDS4233.2																																																																																			.		0.622	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251666.2	NM_018502	
C6orf47	57827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31627425	31627425	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:31627425A>G	ENST00000375911.1	-	1	1124	c.300T>C	c.(298-300)acT>acC	p.T100T	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	100						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						CAGACTCTTGAGTGCTAGAGA	0.577																																					p.T100T		.											.	C6orf47-91	0			c.T300C						.						61.0	65.0	64.0					6																	31627425		1510	2708	4218	SO:0001819	synonymous_variant	57827	exon1			CTCTTGAGTGCTA	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.300T>C	6.37:g.31627425A>G		83	0		86	35	NM_021184	0	0	44	86	42	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Silent	SNP	ENST00000375911.1	37	CCDS34399.1																																																																																			.		0.577	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184	
PHF1	5252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33380325	33380325	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:33380325A>T	ENST00000374516.3	+	3	471	c.200A>T	c.(199-201)gAt>gTt	p.D67V	PHF1_ENST00000374512.3_Missense_Mutation_p.D67V|PHF1_ENST00000459809.1_3'UTR	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	67	Tudor.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				CAGTTTGAGGATGATTCGCAG	0.478																																					p.D67V		.											.	PHF1-226	0			c.A200T						.						166.0	162.0	163.0					6																	33380325		2203	4300	6503	SO:0001583	missense	5252	exon3			TTGAGGATGATTC	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.200A>T	6.37:g.33380325A>T	ENSP00000363640:p.Asp67Val	146	0		114	45	NM_024165	0	0	32	63	31	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	37	CCDS4777.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967657	0.74131	.	.	ENSG00000112511	ENST00000427004;ENST00000428274;ENST00000374512;ENST00000374516	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.58	4.58	0.56647	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.73651	0.3614	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.99	T	0.77910	-0.2411	10	0.87932	D	0	-21.3302	11.944	0.52918	1.0:0.0:0.0:0.0	.	67;67	O43189-2;O43189	.;PHF1_HUMAN	V	67	ENSP00000410494:D67V;ENSP00000392697:D67V;ENSP00000363636:D67V;ENSP00000363640:D67V	ENSP00000363636:D67V	D	+	2	0	PHF1	33488303	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	8.976000	0.93442	1.928000	0.55862	0.460000	0.39030	GAT	.		0.478	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3		
NCR2	9436	broad.mit.edu	37	6	41303624	41303624	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:41303624C>T	ENST00000373089.5	+	1	98	c.10C>T	c.(10-12)Cga>Tga	p.R4*	NCR2_ENST00000373083.4_Nonsense_Mutation_p.R4*|NCR2_ENST00000373086.3_Nonsense_Mutation_p.R4*	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	4					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					CATGGCCTGGCGAGCCCTACA	0.627																																					p.R4X													.	NCR2-91	0			c.C10T						.						54.0	46.0	49.0					6																	41303624		2199	4291	6490	SO:0001587	stop_gained	9436	exon1			GCCTGGCGAGCCC	AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.10C>T	6.37:g.41303624C>T	ENSP00000362181:p.Arg4*	9	0		5	3	NM_004828	0	0	0	0	0	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Nonsense_Mutation	SNP	ENST00000373089.5	37	CCDS4855.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.913031	0.72983	.	.	ENSG00000096264	ENST00000373083;ENST00000373089;ENST00000373086	.	.	.	3.72	-1.29	0.09288	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.5174	0.11943	0.6015:0.1817:0.2169:0.0	.	.	.	.	X	4	.	ENSP00000362175:R4X	R	+	1	2	NCR2	41411602	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.551000	0.06027	-0.099000	0.12263	-1.081000	0.02215	CGA	.		0.627	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3		
GUCA1B	2979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	42152609	42152609	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:42152609C>A	ENST00000230361.3	-	4	642	c.547G>T	c.(547-549)Gac>Tac	p.D183Y		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	183					body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			GGATTCATGTCCATCTGCAGC	0.587																																					p.D183Y		.											.	GUCA1B-92	0			c.G547T						.						131.0	112.0	118.0					6																	42152609		2203	4300	6503	SO:0001583	missense	2979	exon4			TCATGTCCATCTG	AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.547G>T	6.37:g.42152609C>A	ENSP00000230361:p.Asp183Tyr	112	0		89	46	NM_002098	0	0	0	0	0	Q9NU15	Missense_Mutation	SNP	ENST00000230361.3	37	CCDS4865.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274245	0.80580	.	.	ENSG00000112599	ENST00000230361	T	0.53640	0.61	4.36	4.36	0.52297	EF-hand-like domain (1);	0.102162	0.64402	D	0.000004	T	0.38719	0.1051	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.52711	-0.8539	10	0.54805	T	0.06	.	15.1849	0.72993	0.0:1.0:0.0:0.0	.	183	Q9UMX6	GUC1B_HUMAN	Y	183	ENSP00000230361:D183Y	ENSP00000230361:D183Y	D	-	1	0	GUCA1B	42260587	1.000000	0.71417	0.992000	0.48379	0.874000	0.50279	5.791000	0.69045	2.361000	0.80049	0.655000	0.94253	GAC	.		0.587	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040550.1	NM_002098	
SYNJ2	8871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	158450005	158450005	+	Silent	SNP	C	C	T	rs372960799		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:158450005C>T	ENST00000355585.4	+	3	507	c.432C>T	c.(430-432)gtC>gtT	p.V144V	SYNJ2_ENST00000367121.3_Silent_p.V144V|SYNJ2_ENST00000449859.2_Silent_p.V93V|SYNJ2_ENST00000367122.2_Silent_p.V144V	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	144	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		ACCTGACTGTCCGCACGCAGA	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16943	0.0		0.0	False		,,,				2504	0.0				p.V144V		.											.	SYNJ2-227	0			c.C432T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	65.0	67.0	66.0		,432	-0.5	0.7	6		66	0,8600		0,0,4300	no	utr-5,coding-synonymous	SYNJ2	NM_001178088.1,NM_003898.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	,144/1497	158450005	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8871	exon3			GACTGTCCGCACG	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.432C>T	6.37:g.158450005C>T		76	0		89	34	NM_003898	0	0	10	15	5	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	C	0.979	-0.697726	0.03279	2.27E-4	0.0	ENSG00000078269	ENST00000367113	.	.	.	4.62	-0.532	0.11890	.	.	.	.	.	T	0.45875	0.1364	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51857	-0.8652	4	.	.	.	.	11.4359	0.50068	0.0:0.2478:0.6114:0.1408	.	.	.	.	F	119	.	.	S	+	2	0	SYNJ2	158369993	0.753000	0.28349	0.672000	0.29872	0.084000	0.17831	0.009000	0.13219	1.108000	0.41662	0.655000	0.94253	TCC	.		0.582	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
DNAH11	8701	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	21678590	21678590	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:21678590C>A	ENST00000409508.3	+	28	4882	c.4851C>A	c.(4849-4851)taC>taA	p.Y1617*	DNAH11_ENST00000328843.6_Nonsense_Mutation_p.Y1622*	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1622	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TCGCTGAATACCTGGAAACCA	0.388									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						167.0	165.0	166.0					7																	21678590		1865	4096	5961	SO:0001587	stop_gained	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TGAATACCTGGAA	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4851C>A	7.37:g.21678590C>A	ENSP00000475939:p.Tyr1617*	145	1		174	45	.	0	0	0	0	0	Q9UJ82	Nonsense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	44	11.195013	0.99529	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.78	3.99	0.46301	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.878	0.35356	0.0:0.7691:0.0:0.2309	.	.	.	.	X	1622	.	ENSP00000330671:Y1622X	Y	+	3	2	DNAH11	21645115	0.893000	0.30496	1.000000	0.80357	0.601000	0.36947	0.076000	0.14712	0.800000	0.34041	0.650000	0.86243	TAC	.		0.388	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
OR2AE1	81392	broad.mit.edu	37	7	99474253	99474253	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:99474253A>G	ENST00000316368.2	-	1	427	c.404T>C	c.(403-405)cTc>cCc	p.L135P		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CTTGTTCATGAGCACAGCATA	0.483																																					p.L135P													.	OR2AE1-90	0			c.T404C						.						132.0	122.0	125.0					7																	99474253		2203	4300	6503	SO:0001583	missense	81392	exon1			TTCATGAGCACAG	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.404T>C	7.37:g.99474253A>G	ENSP00000313936:p.Leu135Pro	86	0		109	3	NM_001005276	0	0	2	2	0	B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	37	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.746641	0.30955	.	.	ENSG00000244623	ENST00000316368	T	0.33654	1.4	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.220932	0.23137	N	0.051518	T	0.66436	0.2789	M	0.93328	3.405	0.45439	D	0.998412	D	0.76494	0.999	D	0.85130	0.997	T	0.74150	-0.3758	10	0.87932	D	0	.	10.6046	0.45386	1.0:0.0:0.0:0.0	.	135	Q8NHA4	O2AE1_HUMAN	P	135	ENSP00000313936:L135P	ENSP00000313936:L135P	L	-	2	0	OR2AE1	99312189	0.009000	0.17119	0.955000	0.39395	0.142000	0.21351	2.152000	0.42272	1.826000	0.53198	0.321000	0.21382	CTC	.		0.483	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1		
ARMC10	83787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102724230	102724230	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:102724230A>G	ENST00000323716.3	+	3	738	c.346A>G	c.(346-348)Aga>Gga	p.R116G	ARMC10_ENST00000441711.2_Missense_Mutation_p.R81G|ARMC10_ENST00000454559.1_Missense_Mutation_p.R81G|ARMC10_ENST00000425331.1_Missense_Mutation_p.R81G|ARMC10_ENST00000541300.1_Missense_Mutation_p.R81G|ARMC10_ENST00000428183.2_Missense_Mutation_p.R116G	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	116					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						AATTATTGAAAGAGCTTTGAT	0.398																																					p.R116G		.											.	ARMC10-91	0			c.A346G						.						94.0	96.0	95.0					7																	102724230		2203	4300	6503	SO:0001583	missense	83787	exon3			ATTGAAAGAGCTT	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.346A>G	7.37:g.102724230A>G	ENSP00000319412:p.Arg116Gly	76	0		98	32	NM_031905	0	0	62	89	27	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	37	CCDS5728.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017384	0.54576	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153	T;T;T;T;T;T;T	0.47869	1.5;1.6;1.5;1.6;1.5;1.6;0.83	5.28	4.11	0.48088	Armadillo-like helical (1);Armadillo-type fold (1);	0.413848	0.28209	N	0.016195	T	0.54464	0.1860	L	0.59436	1.845	0.23809	N	0.996789	P;B;B;D;P;P	0.58268	0.741;0.039;0.096;0.982;0.852;0.863	P;B;B;P;B;P	0.54889	0.497;0.05;0.073;0.763;0.436;0.627	T	0.47799	-0.9089	10	0.49607	T	0.09	-8.0575	9.962	0.41701	0.6711:0.3289:0.0:0.0	.	81;81;81;116;81;116	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	G	116;116;81;81;81;81;116	ENSP00000319412:R116G;ENSP00000396654:R116G;ENSP00000413619:R81G;ENSP00000405612:R81G;ENSP00000397969:R81G;ENSP00000440463:R81G;ENSP00000398201:R116G	ENSP00000319412:R116G	R	+	1	2	ARMC10	102511466	0.988000	0.35896	0.991000	0.47740	0.941000	0.58515	1.811000	0.38942	0.948000	0.37687	0.456000	0.33151	AGA	.		0.398	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905	
ZNF862	643641	broad.mit.edu	37	7	149559260	149559260	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:149559260C>A	ENST00000223210.4	+	7	3256	c.3011C>A	c.(3010-3012)cCg>cAg	p.P1004Q	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	1004					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						CAGCACCTCCCGTTCTCCATG	0.597																																					p.P1004Q													.	ZNF862-69	0			c.C3011A						.						46.0	53.0	50.0					7																	149559260		2080	4203	6283	SO:0001583	missense	643641	exon7			ACCTCCCGTTCTC	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.3011C>A	7.37:g.149559260C>A	ENSP00000223210:p.Pro1004Gln	75	1		107	5	NM_001099220	0	0	0	0	0	A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	37	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130134	0.37630	.	.	ENSG00000106479	ENST00000223210	T	0.01043	5.41	5.39	4.5	0.54988	HAT dimerisation (1);	0.000000	0.53938	D	0.000055	T	0.03959	0.0111	L	0.51422	1.61	0.20873	N	0.999839	D	0.76494	0.999	D	0.76071	0.987	T	0.38134	-0.9675	10	0.34782	T	0.22	.	10.511	0.44862	0.0:0.9097:0.0:0.0903	.	1004	O60290	ZN862_HUMAN	Q	1004	ENSP00000223210:P1004Q	ENSP00000223210:P1004Q	P	+	2	0	ZNF862	149190193	0.301000	0.24444	0.549000	0.28204	0.816000	0.46133	1.681000	0.37618	1.253000	0.44018	0.655000	0.94253	CCG	.		0.597	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	55534829	55534829	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:55534829A>G	ENST00000220676.1	+	3	916	c.768A>G	c.(766-768)gcA>gcG	p.A256A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	256					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGGGAAATGCAAAGTCAGAAA	0.403																																					p.A256A	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1-102	0			c.A768G						.						78.0	80.0	80.0					8																	55534829		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon3			AAATGCAAAGTCA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.768A>G	8.37:g.55534829A>G		51	0		51	18	NM_006269	0	0	0	0	0		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																			.		0.403	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
POP1	10940	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	99152324	99152324	+	Nonsense_Mutation	SNP	G	G	T	rs184169115		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:99152324G>T	ENST00000401707.2	+	10	1462	c.1381G>T	c.(1381-1383)Gag>Tag	p.E461*	POP1_ENST00000349693.3_Nonsense_Mutation_p.E461*	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	461					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GGACACAGAGGAGACACCTCA	0.448																																					p.E461X		.											.	POP1-154	0			c.G1381T						.						90.0	92.0	92.0					8																	99152324		2203	4300	6503	SO:0001587	stop_gained	10940	exon10			ACAGAGGAGACAC	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1381G>T	8.37:g.99152324G>T	ENSP00000385787:p.Glu461*	54	1		59	25	NM_001145860	0	0	4	4	0	A8K5W9|Q15037	Nonsense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926907	0.92319	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	.	.	.	4.95	0.063	0.14346	.	1.014390	0.07865	N	0.966905	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-11.2415	5.3727	0.16148	0.3376:0.0:0.5049:0.1575	.	.	.	.	X	461	.	ENSP00000339529:E461X	E	+	1	0	POP1	99221500	0.969000	0.33509	0.995000	0.50966	0.424000	0.31475	1.393000	0.34497	0.052000	0.16007	-0.484000	0.04775	GAG	G|0.999;A|0.000		0.448	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
SLC45A4	57210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	142238284	142238284	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:142238284G>A	ENST00000024061.3	-	1	389	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	SLC45A4_ENST00000519067.1_Nonsense_Mutation_p.Q28*|SLC45A4_ENST00000433583.2_Intron|SLC45A4_ENST00000517878.1_Intron	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TAACCTTTCTGAAGACTCCAT	0.537																																					p.Q28X		.											.	SLC45A4-70	0			c.C82T						.						191.0	177.0	181.0					8																	142238284		2203	4300	6503	SO:0001587	stop_gained	57210	exon1			CTTTCTGAAGACT	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.82C>T	8.37:g.142238284G>A	ENSP00000024061:p.Gln28*	217	0		187	83	NM_001080431	0	0	0	0	0	Q6ZRI2|Q9ULU3	Nonsense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134082	0.77662	.	.	ENSG00000022567	ENST00000519067;ENST00000024061	.	.	.	1.79	-1.83	0.07833	.	0.589005	0.15260	U	0.271852	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	4.245	0.10667	0.1675:0.4643:0.3682:0.0	.	.	.	.	X	28	.	ENSP00000024061:Q28X	Q	-	1	0	SLC45A4	142307466	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.632000	0.02024	-0.542000	0.06249	0.556000	0.70494	CAG	.		0.537	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SYN1	6853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47432308	47432308	+	Silent	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:47432308G>C	ENST00000295987.7	-	13	2197	c.2073C>G	c.(2071-2073)acC>acG	p.T691T	SYN1_ENST00000340666.4_3'UTR	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	691	E.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GGCTGCGGATGGTCTCAGCTT	0.582																																					p.T691T		.											.	SYN1-131	0			c.C2073G						.						108.0	91.0	97.0					X																	47432308		2203	4300	6503	SO:0001819	synonymous_variant	6853	exon13			GCGGATGGTCTCA		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.2073C>G	X.37:g.47432308G>C		74	0		58	56	NM_006950	0	0	0	0	0	B1AJQ1|O75825|Q5H9A9	Silent	SNP	ENST00000295987.7	37	CCDS14280.1																																																																																			.		0.582	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
RRAGB	10325	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	55744773	55744773	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:55744773G>A	ENST00000262850.7	+	1	456	c.13G>A	c.(13-15)Gac>Aac	p.D5N	RRAGB_ENST00000374941.4_Missense_Mutation_p.D5N	NM_016656.3	NP_057740.2			Ras-related GTP binding B											breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						GGAAGAATCTGACTCTGAGAA	0.463											OREG0019812	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D5N													.	RRAGB-130	0			c.G13A						.						75.0	70.0	72.0					X																	55744773		2203	4300	6503	SO:0001583	missense	10325	exon1			GAATCTGACTCTG	X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.13G>A	X.37:g.55744773G>A	ENSP00000262850:p.Asp5Asn	14	0	1010	11	10	NM_016656	0	0	1	43	42		Missense_Mutation	SNP	ENST00000262850.7	37	CCDS14372.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211068	0.58343	.	.	ENSG00000083750	ENST00000374941;ENST00000262850	T	0.67865	-0.29	4.34	3.45	0.39498	.	0.285164	0.25355	N	0.031261	T	0.47021	0.1423	N	0.19112	0.55	0.28194	N	0.927647	B;B	0.13145	0.007;0.004	B;B	0.16289	0.015;0.007	T	0.30909	-0.9962	10	0.22706	T	0.39	-3.0781	9.0206	0.36198	0.0:0.2192:0.7808:0.0	.	5;5	Q5VZM2-2;Q5VZM2	.;RRAGB_HUMAN	N	5	ENSP00000364077:D5N	ENSP00000262850:D5N	D	+	1	0	RRAGB	55761498	0.999000	0.42202	0.999000	0.59377	0.981000	0.71138	1.371000	0.34250	1.138000	0.42230	0.600000	0.82982	GAC	.		0.463	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056878.1	NM_016656	
HEPH	9843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	65390505	65390505	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:65390505C>T	ENST00000343002.2	+	1	757	c.93C>T	c.(91-93)ggC>ggT	p.G31G	HEPH_ENST00000336279.5_Intron|HEPH_ENST00000374727.3_Silent_p.G34G|HEPH_ENST00000441993.2_Silent_p.G34G|HEPH_ENST00000519389.1_Silent_p.G85G|HEPH_ENST00000419594.1_Silent_p.G34G			Q9BQS7	HEPH_HUMAN	hephaestin	31	Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ACTACCTGGGCATCCGGGATG	0.527																																					p.G85G		.											.	HEPH-135	0			c.C255T						.						94.0	64.0	74.0					X																	65390505		2203	4300	6503	SO:0001819	synonymous_variant	9843	exon2			CCTGGGCATCCGG	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.93C>T	X.37:g.65390505C>T		25	0		23	19	NM_138737	0	0	1	1	0	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	ENST00000343002.2	37																																																																																				.		0.527	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
ARHGAP36	158763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	130215818	130215818	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:130215818G>A	ENST00000276211.5	+	2	524	c.179G>A	c.(178-180)cGt>cAt	p.R60H	ARHGAP36_ENST00000370921.1_5'Flank|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R48H	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	60					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R60H(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAGCTGGAGCGTCTGAAGCTG	0.532																																					p.R60H		.											.	ARHGAP36-133	1	Substitution - Missense(1)	large_intestine(1)	c.G179A						.						125.0	107.0	113.0					X																	130215818		2203	4300	6503	SO:0001583	missense	158763	exon2			TGGAGCGTCTGAA		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.179G>A	X.37:g.130215818G>A	ENSP00000276211:p.Arg60His	127	0		96	87	NM_144967	0	0	0	0	0	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358508	0.82243	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.28666	1.6;1.61;1.68	4.16	4.16	0.48862	.	0.000000	0.47455	D	0.000238	T	0.40886	0.1135	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.994	T	0.30387	-0.9980	10	0.87932	D	0	.	10.8111	0.46547	0.0:0.0:1.0:0.0	.	29;48;60	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	H	60;48;12;29	ENSP00000276211:R60H;ENSP00000359960:R48H;ENSP00000408515:R29H	ENSP00000276211:R60H	R	+	2	0	ARHGAP36	130043499	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.627000	0.67784	2.315000	0.78130	0.544000	0.68410	CGT	.		0.532	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
MFN2	9927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	12061548	12061549	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:12061548_12061549delTT	ENST00000235329.5	+	9	1229_1230	c.907_908delTT	c.(907-909)tttfs	p.F303fs	MFN2_ENST00000444836.1_Frame_Shift_Del_p.F303fs	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	303	Dynamin-type G.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CCGCATCTTCTTTGTGTCTGCT	0.574																																					p.303_303del		.											.	MFN2-91	0			c.907_908del						.																																			SO:0001589	frameshift_variant	9927	exon9			.	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.907_908delTT	1.37:g.12061548_12061549delTT	ENSP00000235329:p.Phe303fs	48	0		47	26	NM_014874	0	0	0	0	0	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Frame_Shift_Del	DEL	ENST00000235329.5	37	CCDS30587.1																																																																																			.		0.574	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
SF3B2	10992	hgsc.bcm.edu	37	11	65819834	65819859	+	Start_Codon_Del	DEL	CGCGCGCCTTCCTGCGGCTAAGATGG	CGCGCGCCTTCCTGCGGCTAAGATGG	-	rs553967166|rs370381998		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CGCGCGCCTTCCTGCGGCTAAGATGG	CGCGCGCCTTCCTGCGGCTAAGATGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:65819834_65819859delCGCGCGCCTTCCTGCGGCTAAGATGG	ENST00000322535.6	+	0	28_53				SF3B2_ENST00000534307.1_3'UTR|snoU13_ENST00000459530.1_RNA|SF3B2_ENST00000528302.1_Start_Codon_Del	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						CCGGGTTGGTCGCGCGCCTTCCTGCGGCTAAGATGGCGACGGAGCA	0.681																																							.											.	SF3B2-92	0									.																																			SO:0001582	initiator_codon_variant	10992	wholegene			.	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751		11.37:g.65819834_65819859delCGCGCGCCTTCCTGCGGCTAAGATGG		45	0		47	10	NM_006842	0	0	0	0	0	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Frame_Shift_Del	DEL	ENST00000322535.6	37	CCDS31612.1																																																																																			.		0.681	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
PAK1	5058	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	77047284	77047284	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:77047284delT	ENST00000356341.3	-	13	1791	c.1260delA	c.(1258-1260)aaafs	p.K420fs	PAK1_ENST00000278568.4_Frame_Shift_Del_p.K420fs|PAK1_ENST00000530617.1_Frame_Shift_Del_p.K420fs|PAK1_ENST00000528203.1_Frame_Shift_Del_p.K322fs|PAK1_ENST00000525542.1_5'UTR	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	420	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					TGGTGCTCCGTTTGCTCTGCT	0.473																																					p.K420fs		.											.	PAK1-957	0			c.1260delA						.						148.0	145.0	146.0					11																	77047284		2200	4292	6492	SO:0001589	frameshift_variant	5058	exon13			.	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1260delA	11.37:g.77047284delT	ENSP00000348696:p.Lys420fs	121	0		104	43	NM_001128620	0	0	0	0	0	O75561|Q13567|Q32M53|Q32M54|Q86W79	Frame_Shift_Del	DEL	ENST00000356341.3	37	CCDS8250.1																																																																																			.		0.473	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu	37	12	43823478	43823478	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:43823478delA	ENST00000389420.3	-	24	3430	c.3431delT	c.(3430-3432)ttafs	p.L1145fs	ADAMTS20_ENST00000553158.1_Frame_Shift_Del_p.L1145fs|ADAMTS20_ENST00000395541.2_Intron	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1145					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGTTGGTAATAAAGCGGTCTC	0.343																																					p.L1144fs		.											.	ADAMTS20-795	0			c.3431delT						.						60.0	56.0	57.0					12																	43823478		2203	4298	6501	SO:0001589	frameshift_variant	80070	exon24			.	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3431delT	12.37:g.43823478delA	ENSP00000374071:p.Leu1145fs	19	0		27	12	NM_025003	0	0	0	0	0	A6NNC9|J3QT00	Frame_Shift_Del	DEL	ENST00000389420.3	37	CCDS31778.2																																																																																			.		0.343	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
KBTBD6	89890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	41705610	41705612	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr13:41705610_41705612delCAC	ENST00000379485.1	-	1	1270_1272	c.1036_1038delGTG	c.(1036-1038)gtgdel	p.V346del	KBTBD6_ENST00000499385.2_In_Frame_Del_p.V280del	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	346										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CAAAGAAGATCACCATCTCCTTG	0.527																																					p.346_346del		.											.	KBTBD6-92	0			c.1036_1038del						.																																			SO:0001651	inframe_deletion	89890	exon1			.	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1036_1038delGTG	13.37:g.41705610_41705612delCAC	ENSP00000368799:p.Val346del	152	0		94	29	NM_152903	0	0	0	0	0	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	In_Frame_Del	DEL	ENST00000379485.1	37	CCDS9376.1																																																																																			.		0.527	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
COX5A	9377	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	75221461	75221461	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:75221461delA	ENST00000322347.6	-	2	366	c.213delT	c.(211-213)cgtfs	p.R71fs	COX5A_ENST00000562233.1_Frame_Shift_Del_p.R71fs|COX5A_ENST00000568517.1_5'UTR|COX5A_ENST00000564811.1_Frame_Shift_Del_p.R71fs|COX5A_ENST00000567270.1_Intron|COX5A_ENST00000568783.1_Frame_Shift_Del_p.R71fs	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	71					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						AATTACCTTTACGCAATTCCC	0.413																																					p.R71fs		.											.	COX5A-90	0			c.213delT						.						140.0	129.0	133.0					15																	75221461		2197	4295	6492	SO:0001589	frameshift_variant	9377	exon2			.	M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.213delT	15.37:g.75221461delA	ENSP00000317780:p.Arg71fs	174	0		108	34	NM_004255	0	0	0	0	0	P30045|Q8TB65	Frame_Shift_Del	DEL	ENST00000322347.6	37	CCDS10273.1																																																																																			.		0.413	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286417.1	NM_004255	
SLC46A1	113235	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	26731859	26731859	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:26731859delC	ENST00000440501.1	-	2	951	c.856delG	c.(856-858)gacfs	p.D286fs	SLC46A1_ENST00000584729.1_5'UTR|CTD-2350C19.1_ENST00000583956.1_RNA|CTD-2350C19.2_ENST00000580714.1_RNA|SLC46A1_ENST00000321666.5_Frame_Shift_Del_p.D286fs	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1	286					cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	GTTAAGATGTCCTGGGCCCCA	0.542																																					p.D286fs		.											.	SLC46A1-22	0			c.856delG						.						109.0	118.0	115.0					17																	26731859		2022	4180	6202	SO:0001589	frameshift_variant	113235	exon2			.	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.856delG	17.37:g.26731859delC	ENSP00000395653:p.Asp286fs	88	0		112	70	NM_001242366	0	0	0	0	0	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Frame_Shift_Del	DEL	ENST00000440501.1	37																																																																																				.		0.542	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
ADAMTS9	56999	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	64536694	64536703	+	Frame_Shift_Del	DEL	CACCACCTTG	CACCACCTTG	-	rs17071010|rs146412036|rs138988394	byFrequency	TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CACCACCTTG	CACCACCTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:64536694_64536703delCACCACCTTG	ENST00000498707.1	-	31	5076_5085	c.4734_4743delCAAGGTGGTG	c.(4732-4743)cgcaaggtggtgfs	p.RKVV1578fs	ADAMTS9_ENST00000295903.4_Frame_Shift_Del_p.RKVV1550fs	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1578	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1581M(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CATCCACACACACCACCTTGCGGTACCTGG	0.5																																					p.1578_1581del		.											.	ADAMTS9-230	1	Substitution - Missense(1)	large_intestine(1)	c.4734_4743del						.																																			SO:0001589	frameshift_variant	56999	exon31			.	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4734_4743delCAAGGTGGTG	3.37:g.64536694_64536703delCACCACCTTG	ENSP00000418735:p.Arg1578fs	237	0		135	26	NM_182920	0	0	0	0	0	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Frame_Shift_Del	DEL	ENST00000498707.1	37	CCDS2903.1																																																																																			.		0.500	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151880116	151880116	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:151880116delA	ENST00000262189.6	-	35	5426	c.5208delT	c.(5206-5208)tttfs	p.F1736fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.F1736fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1736	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAGGATCTTTAAAAAGCTCCG	0.343																																					p.F1736fs		.											.	MLL3-1398	0			c.5208delT						.						216.0	218.0	217.0					7																	151880116		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon35			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5208delT	7.37:g.151880116delA	ENSP00000262189:p.Phe1736fs	340	0		463	289	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MATN2	4147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	98943606	98943609	+	Frame_Shift_Del	DEL	CTAA	CTAA	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CTAA	CTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:98943606_98943609delCTAA	ENST00000520016.1	+	2	692_695	c.568_571delCTAA	c.(568-573)ctaatcfs	p.LI190fs	MATN2_ENST00000521689.1_Frame_Shift_Del_p.LI190fs|MATN2_ENST00000524308.1_Frame_Shift_Del_p.LI190fs|MATN2_ENST00000522025.2_Intron|MATN2_ENST00000254898.5_Frame_Shift_Del_p.LI190fs			O00339	MATN2_HUMAN	matrilin 2	190	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CACGGGCATCCTAATCTTTGCCAT	0.559																																					p.190_191del		.											.	MATN2-24	0			c.568_571del						.																																			SO:0001589	frameshift_variant	4147	exon3			.	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.568_571delCTAA	8.37:g.98943606_98943609delCTAA	ENSP00000430487:p.Leu190fs	53	0		44	19	NM_002380	0	0	0	0	0	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Frame_Shift_Del	DEL	ENST00000520016.1	37	CCDS55264.1																																																																																			.		0.559	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49435198	49435199	+	Frame_Shift_Ins	INS	-	-	G	rs377392943	byFrequency	TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:49435198_49435199insG	ENST00000301067.7	-	31	6353_6354	c.6354_6355insC	c.(6352-6357)cccgctfs	p.A2119fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2119	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A2119fs*36(1)|p.A1849fs*36(1)									GGGGCAGCAGCGGGGGGCGGGC	0.688																																					p.A2119fs		.											.	MLL2-612	2	Insertion - Frameshift(2)	central_nervous_system(2)	c.6355_6356insC						.																																			SO:0001589	frameshift_variant	8085	exon31			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6355dupC	12.37:g.49435204_49435204dupG	ENSP00000301067:p.Ala2119fs	42	0		38	19	NM_003482	0	0	0	0	0	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.688	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
TCERG1	10915	broad.mit.edu	37	5	145886722	145886723	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:145886722_145886723insA	ENST00000296702.5	+	19	2900_2901	c.2862_2863insA	c.(2863-2865)aaafs	p.K955fs	TCERG1_ENST00000394421.2_Frame_Shift_Ins_p.K934fs	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	955	FF 5.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGCACTTACCAAAAAAAAGAG	0.376																																					p.T954fs													.	TCERG1-92	0			c.2862_2863insA						.																																			SO:0001589	frameshift_variant	10915	exon19			ACTTACCAAAAAA	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2870dupA	5.37:g.145886730_145886730dupA	ENSP00000296702:p.Lys955fs	86	0		89	7	NM_006706	0	0	0	0	0	Q2NKN2|Q59EA1	Frame_Shift_Ins	INS	ENST00000296702.5	37	CCDS4282.1																																																																																			.		0.376	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
