#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ECHS1	1892	hgsc.bcm.edu	37	10	135186806	135186806	+	Missense_Mutation	SNP	A	A	G	rs10466126	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr10:135186806A>G	ENST00000368547.3	-	1	387	c.32T>C	c.(31-33)gTc>gCc	p.V11A	MIR3944_ENST00000581277.1_RNA	NM_004092.3	NP_004083.3	P30084	ECHM_HUMAN	enoyl CoA hydratase, short chain, 1, mitochondrial	11			V -> A (in dbSNP:rs10466126). {ECO:0000269|PubMed:8012501, ECO:0000269|PubMed:9073515}.		cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)	p.V11A(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	10		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		CGGGCCGCGGACGCAGGACAG	0.731													a|||	3385	0.675919	0.2829	0.6988	5008	,	,		4830	0.9355		0.7674	False		,,,				2504	0.8292				GBM(132;1720 1771 5373 10277 21402)	.											1	Substitution - Missense(1)	NS(1)							ALA/VAL	1391,2679		274,843,918	9.0	14.0	12.0		32	-2.2	0.0	10	dbSNP_119	12	5886,2076		2263,1360,358	yes	missense	ECHS1	NM_004092.3	64	2537,2203,1276	GG,GA,AA		26.0739,34.1769,39.5196	benign	11/291	135186806	7277,4755	2035	3981	6016	SO:0001583	missense	1892				CCDS7681.1	10q26.2-q26.3	2010-05-04	2010-04-30		ENSG00000127884	ENSG00000127884	4.2.1.17		3151	protein-coding gene	gene with protein product		602292	"""enoyl Coenzyme A hydratase, short chain, 1, mitochondrial"""			8012501	Standard	NM_004092		Approved	SCEH	uc001lmu.3	P30084	OTTHUMG00000019320	ENST00000368547.3:c.32T>C	10.37:g.135186806A>G	ENSP00000357535:p.Val11Ala		O00739|Q5VWY1|Q96H54	Missense_Mutation	SNP	ENST00000368547.3	37	CCDS7681.1	1504	0.6886446886446886	143	0.29065040650406504	246	0.6795580110497238	528	0.9230769230769231	587	0.7744063324538258	a	3.615	-0.078697	0.07141	0.341769	0.739261	ENSG00000127884	ENST00000368547	T	0.61980	0.06	3.77	-2.17	0.07059	.	7.595850	0.03474	N	0.214060	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30387	-0.9980	9	0.08179	T	0.78	.	5.2902	0.15723	0.257:0.3372:0.4058:0.0	rs10466126;rs11542964;rs17348892	11	P30084	ECHM_HUMAN	A	11	ENSP00000357535:V11A	ENSP00000357535:V11A	V	-	2	0	ECHS1	135036796	0.001000	0.12720	0.002000	0.10522	0.007000	0.05969	-0.071000	0.11505	-0.255000	0.09486	-0.857000	0.03018	GTC		0.731	ECHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051156.1		
FMN2	56776	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	240371393	240371393	+	Missense_Mutation	SNP	C	C	T	rs201701711		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:240371393C>T	ENST00000319653.9	+	5	3511	c.3281C>T	c.(3280-3282)gCg>gTg	p.A1094V		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1094	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTACCCGGAGCGGGCATACCC	0.731																																						.											0								C	VAL/ALA	2,3774		0,2,1886	5.0	7.0	6.0		3281	-1.0	0.0	1		6	15,7769		0,15,3877	no	missense	FMN2	NM_020066.4	64	0,17,5763	TT,TC,CC		0.1927,0.053,0.1471	benign	1094/1723	240371393	17,11543	1888	3892	5780	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3281C>T	1.37:g.240371393C>T	ENSP00000318884:p.Ala1094Val		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	c	8.534	0.871605	0.17322	5.3E-4	0.001927	ENSG00000155816	ENST00000319653	T	0.58940	0.3	3.16	-1.05	0.10036	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	2.671950	0.01759	N	0.030419	T	0.45196	0.1330	L	0.41573	1.285	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06144	-1.0843	9	.	.	.	.	3.0177	0.06065	0.364:0.3658:0.0:0.2702	.	1094	Q9NZ56	FMN2_HUMAN	V	1094	ENSP00000318884:A1094V	.	A	+	2	0	FMN2	238438016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.328000	0.01112	-0.352000	0.08237	-0.350000	0.07774	GCG		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
WNT3	7473	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	44847153	44847153	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr17:44847153C>T	ENST00000225512.5	-	3	746	c.584G>A	c.(583-585)cGc>cAc	p.R195H		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	195					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GCTCACCGTGCGGCCCGCCTC	0.701																																						.											0													30.0	29.0	29.0					17																	44847153		2201	4299	6500	SO:0001583	missense	7473			AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.584G>A	17.37:g.44847153C>T	ENSP00000225512:p.Arg195His		Q2M237|Q9H1J9	Missense_Mutation	SNP	ENST00000225512.5	37	CCDS11505.1	.	.	.	.	.	.	.	.	.	.	C	35	5.452269	0.96223	.	.	ENSG00000108379	ENST00000225512	D	0.81739	-1.53	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	D	0.93048	0.7787	H	0.97465	4.01	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	D	0.95710	0.8757	10	0.87932	D	0	.	17.3636	0.87358	0.0:1.0:0.0:0.0	.	195	P56703	WNT3_HUMAN	H	195	ENSP00000225512:R195H	ENSP00000225512:R195H	R	-	2	0	WNT3	42202321	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.608000	0.82898	2.330000	0.79161	0.561000	0.74099	CGC		0.701	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
GDF5	8200	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	34021967	34021967	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr20:34021967C>T	ENST00000374372.1	-	4	1749	c.1246G>A	c.(1246-1248)Gac>Aac	p.D416N	GDF5OS_ENST00000374375.1_Missense_Mutation_p.S4L|GDF5_ENST00000374369.3_Missense_Mutation_p.D416N			P43026	GDF5_HUMAN	growth differentiation factor 5	416					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			ATGATCCAGTCGTCCCAGCCC	0.602																																						.											0													127.0	110.0	116.0					20																	34021967		2203	4300	6503	SO:0001583	missense	8200			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1246G>A	20.37:g.34021967C>T	ENSP00000363492:p.Asp416Asn		E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.7|25.7	4.664367|4.664367	0.88251|0.88251	.|.	.|.	ENSG00000125965|ENSG00000204183	ENST00000374369;ENST00000374372|ENST00000374375	D;D|.	0.89343|.	-2.5;-2.5|.	4.4|4.4	4.4|4.4	0.53042|0.53042	Transforming growth factor-beta, C-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74604|0.74604	0.3738|0.3738	M|M	0.69248|0.69248	2.105|2.105	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.78909|0.78909	-0.2018|-0.2018	10|6	0.87932|0.87932	D|D	0|0	.|.	17.1668|17.1668	0.86818|0.86818	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	416;416|.	F1T0J1;P43026|.	.;GDF5_HUMAN|.	N|L	416|4	ENSP00000363489:D416N;ENSP00000363492:D416N|.	ENSP00000363489:D416N|ENSP00000363495:S4L	D|S	-|+	1|2	0|0	GDF5|GDF5OS	33485381|33485381	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.997000|0.997000	0.91878|0.91878	7.651000|7.651000	0.83577|0.83577	2.266000|2.266000	0.75297|0.75297	0.462000|0.462000	0.41574|0.41574	GAC|TCG		0.602	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
DUSP11	8446	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	74007178	74007178	+	Missense_Mutation	SNP	G	G	A	rs574278061	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr2:74007178G>A	ENST00000272444.3	-	1	106	c.65C>T	c.(64-66)tCt>tTt	p.S22F	DUSP11_ENST00000377706.4_5'UTR|DUSP11_ENST00000443070.1_Missense_Mutation_p.S22F|DUSP11_ENST00000480948.1_5'Flank	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	0					peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						GCCAGGATAAGACCCTAAACA	0.637											OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0015	0.0	5008	,	,		17848	0.0		0.0	False		,,,				2504	0.0					.											0													30.0	40.0	37.0					2																	74007178		692	1591	2283	SO:0001583	missense	8446			AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.65C>T	2.37:g.74007178G>A	ENSP00000272444:p.Ser22Phe	1149	B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638396	0.47153	.	.	ENSG00000144048	ENST00000272444;ENST00000443070	T	0.36699	1.24	3.97	0.177	0.15054	.	.	.	.	.	T	0.15046	0.0363	N	0.08118	0	0.20196	N	0.999924	B	0.10296	0.003	B	0.06405	0.002	T	0.32745	-0.9895	9	0.12103	T	0.63	.	6.2359	0.20762	0.4426:0.0:0.5574:0.0	.	22	C9JYA6	.	F	22	ENSP00000413444:S22F	ENSP00000272444:S22F	S	-	2	0	DUSP11	73860686	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.512000	0.22755	0.011000	0.14865	-0.258000	0.10820	TCT		0.637	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		
KCMF1	56888	broad.mit.edu;hgsc.bcm.edu	37	2	85262268	85262268	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr2:85262268delC	ENST00000409785.4	+	3	673	c.314delC	c.(313-315)tcafs	p.S105fs		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	105							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						GCAGAAACATCAACAGAAGTG	0.373																																						.											0													81.0	70.0	73.0					2																	85262268		1876	4123	5999	SO:0001589	frameshift_variant	56888			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.314delC	2.37:g.85262268delC	ENSP00000386738:p.Ser105fs		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Frame_Shift_Del	DEL	ENST00000409785.4	37	CCDS46350.1																																																																																				0.373	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122	
EYA4	2070	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	133789819	133789819	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:133789819C>A	ENST00000367895.5	+	11	1384	c.920C>A	c.(919-921)aCc>aAc	p.T307N	EYA4_ENST00000452339.2_Missense_Mutation_p.T253N|EYA4_ENST00000531901.1_Missense_Mutation_p.T307N|EYA4_ENST00000430974.2_Missense_Mutation_p.T253N|EYA4_ENST00000355167.3_Missense_Mutation_p.T307N|EYA4_ENST00000431403.2_Missense_Mutation_p.T307N|EYA4_ENST00000355286.6_Missense_Mutation_p.T284N|EYA4_ENST00000525849.1_Missense_Mutation_p.T284N	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	307					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CCCTCTTCAACCTCTACTTAT	0.428																																					Melanoma(57;398 1237 3528 4702 7415)	.											0													144.0	134.0	137.0					6																	133789819		2203	4300	6503	SO:0001583	missense	2070			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.920C>A	6.37:g.133789819C>A	ENSP00000356870:p.Thr307Asn		B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	C	9.714	1.157769	0.21454	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	T;T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	5.73	5.73	0.89815	.	0.362558	0.29348	N	0.012408	T	0.64843	0.2635	L	0.29908	0.895	0.40010	D	0.975276	B;B;B;B;B;B	0.26845	0.001;0.001;0.161;0.05;0.004;0.0	B;B;B;B;B;B	0.29176	0.004;0.007;0.099;0.067;0.011;0.004	T	0.61197	-0.7111	10	0.24483	T	0.36	0.0301	20.27	0.98469	0.0:1.0:0.0:0.0	.	307;253;253;284;307;307	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	N	253;253;307;307;284;307;284;307	ENSP00000395916:T253N;ENSP00000388670:T253N;ENSP00000356870:T307N;ENSP00000347294:T307N;ENSP00000347434:T284N;ENSP00000432770:T307N;ENSP00000433219:T284N;ENSP00000404558:T307N	ENSP00000347294:T307N	T	+	2	0	EYA4	133831512	0.982000	0.34865	0.257000	0.24404	0.034000	0.12701	5.675000	0.68123	2.854000	0.98071	0.655000	0.94253	ACC		0.428	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
COL16A1	1307	broad.mit.edu;hgsc.bcm.edu	37	1	32149324	32149324	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:32149324C>T	ENST00000373672.3	-	34	2879	c.2363G>A	c.(2362-2364)gGa>gAa	p.G788E	COL16A1_ENST00000373668.3_Missense_Mutation_p.G788E|COL16A1_ENST00000271069.6_Missense_Mutation_p.G787E	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	788	Collagen-like 4.|Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCCCTGGACTCCCCTTCCTGG	0.607																																					Colon(143;498 1786 21362 25193 36625)	.											0													74.0	93.0	87.0					1																	32149324		1980	4153	6133	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2363G>A	1.37:g.32149324C>T	ENSP00000362776:p.Gly788Glu		Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360954	0.41801	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000458715;ENST00000373668	D;D;D;D	0.99353	-5.77;-5.77;-5.52;-5.77	5.17	2.28	0.28536	.	0.126713	0.51477	D	0.000088	D	0.99042	0.9672	H	0.98333	4.205	0.23978	N	0.996285	B;B;B	0.15473	0.013;0.003;0.002	B;B;B	0.23419	0.046;0.013;0.008	D	0.99838	1.1059	10	0.72032	D	0.01	.	7.1895	0.25818	0.0:0.7033:0.1397:0.157	.	788;788;788	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	E	788;787;9;788	ENSP00000362776:G788E;ENSP00000271069:G787E;ENSP00000411457:G9E;ENSP00000362772:G788E	ENSP00000271069:G787E	G	-	2	0	COL16A1	31921911	0.001000	0.12720	0.028000	0.17463	0.897000	0.52465	0.032000	0.13732	0.414000	0.25790	-0.191000	0.12829	GGA		0.607	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
LAMA3	3909	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	18	21404467	21404467	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr18:21404467G>T	ENST00000313654.9	+	21	2750	c.2509G>T	c.(2509-2511)Gac>Tac	p.D837Y	LAMA3_ENST00000399516.3_Missense_Mutation_p.D837Y	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	837	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.D837N(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TGGTTTTGCAGACCCATTTTC	0.458																																						.											1	Substitution - Missense(1)	lung(1)											128.0	127.0	127.0					18																	21404467		1909	4116	6025	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2509G>T	18.37:g.21404467G>T	ENSP00000324532:p.Asp837Tyr		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981565	0.53827	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.18502	2.22;2.21	5.95	4.13	0.48395	.	.	.	.	.	T	0.16557	0.0398	L	0.36672	1.1	0.80722	D	1	P;P	0.46706	0.818;0.883	B;B	0.39876	0.23;0.312	T	0.01416	-1.1360	9	0.87932	D	0	.	16.6665	0.85254	0.0:0.2449:0.7551:0.0	.	837;837	Q6VU67;Q16787	.;LAMA3_HUMAN	Y	837;837;835	ENSP00000324532:D837Y;ENSP00000382432:D837Y	ENSP00000324532:D837Y	D	+	1	0	LAMA3	19658465	1.000000	0.71417	0.707000	0.30419	0.968000	0.65278	4.162000	0.58177	0.814000	0.34374	0.655000	0.94253	GAC		0.458	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
PCDHA5	56143	hgsc.bcm.edu	37	5	140201458	140201458	+	Missense_Mutation	SNP	C	C	T	rs144627570		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr5:140201458C>T	ENST00000529859.1	+	1	98	c.98C>T	c.(97-99)tCg>tTg	p.S33L	PCDHA5_ENST00000529619.1_Missense_Mutation_p.S33L|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.S33L|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	33	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCACTACTCGATCCCGGAG	0.647																																						.											0								C	,,,,LEU/SER,,LEU/SER	1,4405	2.1+/-5.4	0,1,2202	53.0	60.0	58.0		,,,,98,,98	3.9	1.0	5	dbSNP_134	58	0,8600		0,0,4300	no	intron,intron,intron,intron,missense,intron,missense	PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_031411.1,NM_031501.1	,,,,145,,145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,,,	,,,,33/937,,33/817	140201458	1,13005	2203	4300	6503	SO:0001583	missense	56143			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.98C>T	5.37:g.140201458C>T	ENSP00000436557:p.Ser33Leu		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669759	0.47677	2.27E-4	0.0	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.36340	1.26;1.26;1.26	3.87	3.87	0.44632	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.48150	0.1484	H	0.96111	3.77	0.25383	N	0.988592	B;P;B	0.36599	0.287;0.56;0.374	B;B;B	0.27608	0.081;0.06;0.07	T	0.57562	-0.7790	9	0.66056	D	0.02	.	9.9783	0.41797	0.0:0.9042:0.0:0.0958	.	33;33;33	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	L	33	ENSP00000433416:S33L;ENSP00000436557:S33L;ENSP00000367366:S33L	ENSP00000367366:S33L	S	+	2	0	PCDHA5	140181642	0.998000	0.40836	0.995000	0.50966	0.957000	0.61999	4.077000	0.57598	1.858000	0.53909	0.585000	0.79938	TCG		0.647	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
NBPF10	100132406	broad.mit.edu	37	1	145299779	145299779	+	Silent	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:145299779C>T	ENST00000369338.1	+	2	205	c.15C>T	c.(13-15)gcC>gcT	p.A5A	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_Silent_p.A276A			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	276						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGTATCAGCCGGCCCTTTGT	0.498																																						.											0													3.0	2.0	2.0					1																	145299779		615	1282	1897	SO:0001819	synonymous_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369338.1:c.15C>T	1.37:g.145299779C>T			Q5RHC0|Q9NWN6	Silent	SNP	ENST00000369338.1	37																																																																																					0.498	NBPF10-003	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038552.1	NM_001039703	
HSPA14	51182	broad.mit.edu	37	10	14890641	14890641	+	Silent	SNP	G	G	A	rs550196167	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr10:14890641G>A	ENST00000378372.3	+	4	494	c.255G>A	c.(253-255)gcG>gcA	p.A85A		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	85			A -> V (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AATACATCGCGGAAAGTAAAT	0.328													G|||	4	0.000798722	0.0	0.0	5008	,	,		15226	0.0		0.0	False		,,,				2504	0.0041					.											0													107.0	94.0	99.0					10																	14890641		2203	4299	6502	SO:0001819	synonymous_variant	51182			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.255G>A	10.37:g.14890641G>A			A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Silent	SNP	ENST00000378372.3	37	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	G	7.783	0.710013	0.15239	.	.	ENSG00000187522	ENST00000441647	.	.	.	5.89	-1.69	0.08186	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.43885	D	0.996505	.	.	.	.	.	.	T	0.28776	-1.0033	4	.	.	.	1.9634	1.2653	0.02010	0.47:0.1264:0.1488:0.2548	.	.	.	.	Q	74	.	.	R	+	2	0	HSPA14	14930647	0.001000	0.12720	0.105000	0.21289	0.995000	0.86356	-0.269000	0.08596	-0.193000	0.10415	0.655000	0.94253	CGG		0.328	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
TUB	7275	broad.mit.edu;mdanderson.org;bcgsc.ca	37	11	8120345	8120345	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr11:8120345G>A	ENST00000299506.2	+	9	1188	c.1039G>A	c.(1039-1041)Gga>Aga	p.G347R	TUB_ENST00000305253.4_Missense_Mutation_p.G402R|TUB_ENST00000534099.1_Missense_Mutation_p.G353R	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	347					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		TTATGACAATGGAGTCAACCC	0.517											OREG0020732	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													167.0	148.0	155.0					11																	8120345		2201	4296	6497	SO:0001583	missense	7275			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1039G>A	11.37:g.8120345G>A	ENSP00000299506:p.Gly347Arg	646	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	ENST00000299506.2	37	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884132	0.91814	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.96587	-4.06;-4.06;-4.06	5.12	5.12	0.69794	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	D	0.99264	1.0891	10	0.72032	D	0.01	0.6721	18.9192	0.92518	0.0:0.0:1.0:0.0	.	353;347;402	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	R	353;402;347	ENSP00000434400:G353R;ENSP00000305426:G402R;ENSP00000299506:G347R	ENSP00000299506:G347R	G	+	1	0	TUB	8076921	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.523000	0.85059	0.555000	0.69702	GGA		0.517	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320	
HNRNPKP3	399881	broad.mit.edu	37	11	43283606	43283606	+	RNA	DEL	A	A	-	rs377012965		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr11:43283606delA	ENST00000511537.1	-	0	1329					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		AAGCAAATGTAAAAAAAAAAA	0.388																																						.											0																																												399881					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283606delA				RNA	DEL	ENST00000511537.1	37																																																																																					0.388	HNRNPKP3-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390385.1	NR_033868	
OR5M10	390167	broad.mit.edu	37	11	56344713	56344713	+	Missense_Mutation	SNP	A	A	T	rs140389540	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr11:56344713A>T	ENST00000526812.2	-	1	550	c.485T>A	c.(484-486)cTg>cAg	p.L162Q		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						GTGAAAGGTCAGCAGTGTCTG	0.468													A|||	9	0.00179712	0.0068	0.0	5008	,	,		20628	0.0		0.0	False		,,,				2504	0.0					.											0								A	GLN/LEU	60,3982		0,60,1961	141.0	137.0	139.0		485	4.0	0.4	11	dbSNP_134	139	1,8375		0,1,4187	yes	missense	OR5M10	NM_001004741.1	113	0,61,6148	TT,TA,AA		0.0119,1.4844,0.4912	probably-damaging	162/316	56344713	61,12357	2021	4188	6209	SO:0001583	missense	390167			BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.485T>A	11.37:g.56344713A>T	ENSP00000436004:p.Leu162Gln		B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	A	14.64	2.594840	0.46318	0.014844	1.19E-4	ENSG00000254834	ENST00000526812	T	0.00202	8.56	4.04	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00328	0.0010	M	0.70842	2.15	0.26437	N	0.97585	D	0.76494	0.999	D	0.78314	0.991	T	0.55159	-0.8184	9	0.32370	T	0.25	.	7.7792	0.29056	0.7875:0.2125:0.0:0.0	.	162	Q6IEU7	OR5MA_HUMAN	Q	162	ENSP00000436004:L162Q	ENSP00000436004:L162Q	L	-	2	0	OR5M10	56101289	0.000000	0.05858	0.364000	0.25888	0.012000	0.07955	0.260000	0.18424	1.816000	0.52996	0.514000	0.50259	CTG		0.468	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
MS4A14	84689	broad.mit.edu	37	11	60165391	60165391	+	Missense_Mutation	SNP	G	G	A	rs368053345		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr11:60165391G>A	ENST00000300187.6	+	2	482	c.205G>A	c.(205-207)Ggt>Agt	p.G69S	MS4A14_ENST00000395005.2_Missense_Mutation_p.G69S|MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000531783.1_Missense_Mutation_p.G69S|MS4A14_ENST00000395001.1_5'UTR	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	69						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						TAATTACATCGGTTTCTCCCA	0.433													c|||	1	0.000199681	0.0	0.0	5008	,	,		20648	0.001		0.0	False		,,,				2504	0.0					.											0													172.0	155.0	161.0					11																	60165391		2203	4300	6503	SO:0001583	missense	84689			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.205G>A	11.37:g.60165391G>A	ENSP00000300187:p.Gly69Ser		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	c	14.63	2.593541	0.46214	.	.	ENSG00000166928	ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783	T;T;T;T	0.28255	4.66;1.62;4.66;4.66	4.73	-9.46	0.00597	.	2.873630	0.00892	N	0.002244	T	0.08758	0.0217	N	0.01874	-0.695	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.01281	0.0;0.0	T	0.23332	-1.0191	10	0.21014	T	0.42	7.4637	2.2494	0.04040	0.1554:0.43:0.1417:0.2729	.	69;69	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	S	69	ENSP00000300187:G69S;ENSP00000378453:G69S;ENSP00000435764:G69S;ENSP00000433761:G69S	ENSP00000300187:G69S	G	+	1	0	MS4A14	59921967	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.184000	0.01254	-2.949000	0.00294	-2.276000	0.00273	GGT		0.433	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
GOLGA3	2802	broad.mit.edu	37	12	133357472	133357472	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr12:133357472T>C	ENST00000450791.2	-	17	3677	c.3494A>G	c.(3493-3495)gAg>gGg	p.E1165G	GOLGA3_ENST00000456883.2_Missense_Mutation_p.E1165G|GOLGA3_ENST00000204726.3_Missense_Mutation_p.E1165G			Q08378	GOGA3_HUMAN	golgin A3	1165					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCGATCCTCCTCTTCTTTGCG	0.542																																						.											0													159.0	127.0	138.0					12																	133357472		2203	4300	6503	SO:0001583	missense	2802			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3494A>G	12.37:g.133357472T>C	ENSP00000410378:p.Glu1165Gly		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.938390	0.92526	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.31769	1.48;1.48;1.48	5.61	5.61	0.85477	.	0.044464	0.85682	D	0.000000	T	0.54431	0.1858	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.55811	-0.8082	10	0.54805	T	0.06	.	15.4487	0.75257	0.0:0.0:0.0:1.0	.	1165;1165	Q08378-2;Q08378	.;GOGA3_HUMAN	G	1165	ENSP00000204726:E1165G;ENSP00000410378:E1165G;ENSP00000409303:E1165G	ENSP00000204726:E1165G	E	-	2	0	GOLGA3	131867545	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.487000	0.81328	2.123000	0.65237	0.523000	0.50628	GAG		0.542	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
TPP2	7174	broad.mit.edu	37	13	103328696	103328696	+	Silent	SNP	A	A	G			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr13:103328696A>G	ENST00000376065.4	+	28	3627	c.3591A>G	c.(3589-3591)agA>agG	p.R1197R	TPP2_ENST00000376052.3_Silent_p.R1210R|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1197					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGTATGGGAGAGGCCTTAAAT	0.264																																						.											0													61.0	62.0	62.0					13																	103328696		2200	4296	6496	SO:0001819	synonymous_variant	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3591A>G	13.37:g.103328696A>G			Q5VZU8	Silent	SNP	ENST00000376065.4	37	CCDS9502.1																																																																																				0.264	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
ZNF629	23361	broad.mit.edu;mdanderson.org;bcgsc.ca	37	16	30794552	30794552	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr16:30794552C>T	ENST00000262525.4	-	3	1304	c.1097G>A	c.(1096-1098)cGg>cAg	p.R366Q		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CAGGTGAGTCCGCTGGTGCTT	0.662																																						.											0													33.0	34.0	34.0					16																	30794552		2197	4300	6497	SO:0001583	missense	23361			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1097G>A	16.37:g.30794552C>T	ENSP00000262525:p.Arg366Gln		Q15938	Missense_Mutation	SNP	ENST00000262525.4	37	CCDS45463.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883279	0.72410	.	.	ENSG00000102870	ENST00000262525	T	0.24723	1.84	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42294	D	0.000729	T	0.50650	0.1628	M	0.67397	2.05	0.35010	D	0.756778	D	0.76494	0.999	D	0.69479	0.964	T	0.61515	-0.7047	10	0.72032	D	0.01	-41.13	18.352	0.90342	0.0:1.0:0.0:0.0	.	366	Q9UEG4	ZN629_HUMAN	Q	366	ENSP00000262525:R366Q	ENSP00000262525:R366Q	R	-	2	0	ZNF629	30702053	0.000000	0.05858	0.991000	0.47740	0.994000	0.84299	0.578000	0.23773	2.629000	0.89072	0.561000	0.74099	CGG		0.662	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
CHST6	4166	broad.mit.edu	37	16	75512651	75512651	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr16:75512651C>T	ENST00000332272.4	-	3	1255	c.1076G>A	c.(1075-1077)cGg>cAg	p.R359Q	CHST6_ENST00000390664.2_Missense_Mutation_p.R359Q|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	359					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTACACAGGCCGGTAGCCCAG	0.662																																						.											0													53.0	52.0	52.0					16																	75512651		2198	4300	6498	SO:0001583	missense	4166			AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.1076G>A	16.37:g.75512651C>T	ENSP00000328983:p.Arg359Gln		D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	37	CCDS10918.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643316	0.29246	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.99741	-6.6;-6.6	4.8	3.85	0.44370	.	0.286130	0.34676	N	0.003771	D	0.98080	0.9367	L	0.50919	1.6	0.32964	D	0.521424	P	0.35411	0.5	B	0.23150	0.044	D	0.99974	1.2126	10	0.26408	T	0.33	.	7.3925	0.26917	0.0:0.8004:0.0:0.1996	.	359	Q9GZX3	CHST6_HUMAN	Q	359	ENSP00000328983:R359Q;ENSP00000375079:R359Q	ENSP00000328983:R359Q	R	-	2	0	CHST6	74070152	0.978000	0.34361	0.995000	0.50966	0.593000	0.36681	1.106000	0.31098	1.021000	0.39600	0.591000	0.81541	CGG		0.662	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615	
TSHZ1	10194	broad.mit.edu	37	18	72997839	72997839	+	Silent	SNP	A	A	C			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr18:72997839A>C	ENST00000580243.1	+	2	825	c.477A>C	c.(475-477)acA>acC	p.T159T	TSHZ1_ENST00000322038.5_Silent_p.T114T			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	159	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ccacccccacaccccccacct	0.642																																						.											0													8.0	9.0	9.0					18																	72997839		2191	4276	6467	SO:0001819	synonymous_variant	10194			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.477A>C	18.37:g.72997839A>C			O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	37																																																																																					0.642	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
EPT1	85465	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	26608003	26608003	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr2:26608003G>A	ENST00000260585.7	+	8	1027	c.908G>A	c.(907-909)aGt>aAt	p.S303N		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	303					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										TTTGCCAACAGTACAGTAAGA	0.284																																						.											0													60.0	51.0	54.0					2																	26608003		1802	4063	5865	SO:0001583	missense	85465				CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.908G>A	2.37:g.26608003G>A	ENSP00000260585:p.Ser303Asn		Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068278	0.36470	.	.	ENSG00000138018	ENST00000260585;ENST00000447170	T	0.45668	0.89	5.97	-8.32	0.00996	.	0.347133	0.32901	N	0.005501	T	0.27134	0.0665	L	0.33339	1.005	0.21445	N	0.999682	B	0.13594	0.008	B	0.09377	0.004	T	0.02498	-1.1150	10	0.72032	D	0.01	-11.6859	16.1861	0.81955	0.092:0.0:0.6776:0.2304	.	303	Q9C0D9	EPT1_HUMAN	N	303;179	ENSP00000260585:S303N	ENSP00000260585:S303N	S	+	2	0	EPT1	26461507	1.000000	0.71417	0.052000	0.19188	0.946000	0.59487	1.312000	0.33574	-1.757000	0.01316	-0.275000	0.10095	AGT		0.284	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000324484.3	NM_033505.2	
MUC4	4585	broad.mit.edu	37	3	195513758	195513758	+	Missense_Mutation	SNP	G	G	C	rs202045385	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr3:195513758G>C	ENST00000463781.3	-	2	5152	c.4693C>G	c.(4693-4695)Cac>Gac	p.H1565D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1565D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H1565D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTGACCTGTGGAT	0.572													.|||	11	0.00219649	0.0053	0.0014	5008	,	,		12530	0.002		0.001	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4693C>G	3.37:g.195513758G>C	ENSP00000417498:p.His1565Asp		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.677435	0.00751	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.53	.	.	.	.	.	.	.	.	T	0.13286	0.0322	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22836	-1.0205	7	.	.	.	.	2.1349	0.03759	0.3255:0.3453:0.3292:0.0	.	1565	E7ESK3	.	D	1565	ENSP00000417498:H1565D;ENSP00000420243:H1565D	.	H	-	1	0	MUC4	196998153	0.001000	0.12720	0.012000	0.15200	0.012000	0.07955	-0.789000	0.04609	-1.943000	0.01039	-1.898000	0.00530	CAC		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LRBA	987	broad.mit.edu	37	4	151842427	151842427	+	Silent	SNP	A	A	G			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr4:151842427A>G	ENST00000357115.3	-	5	811	c.568T>C	c.(568-570)Ttg>Ctg	p.L190L	LRBA_ENST00000510413.1_Silent_p.L190L|LRBA_ENST00000507224.1_Silent_p.L190L|LRBA_ENST00000535741.1_Silent_p.L190L	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	190						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					ACAGACAGCAACTTCCCAGCA	0.338																																						.											0													130.0	126.0	127.0					4																	151842427		2203	4300	6503	SO:0001819	synonymous_variant	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.568T>C	4.37:g.151842427A>G			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	CCDS3773.1																																																																																				0.338	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
ATAT1	79969	broad.mit.edu	37	6	30610646	30610646	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:30610646delT	ENST00000376485.4	+	10	856	c.826delT	c.(826-828)tcafs	p.S276fs	ATAT1_ENST00000376478.2_Frame_Shift_Del_p.S253fs|ATAT1_ENST00000376483.4_Frame_Shift_Del_p.S276fs|ATAT1_ENST00000330083.5_Frame_Shift_Del_p.S264fs|ATAT1_ENST00000468713.1_Intron|ATAT1_ENST00000318999.7_Frame_Shift_Del_p.S253fs|ATAT1_ENST00000319027.5_Frame_Shift_Del_p.S253fs|ATAT1_ENST00000329992.8_Frame_Shift_Del_p.S276fs					alpha tubulin acetyltransferase 1											cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	9						CCTGGGAAACTCACCAGAACG	0.682																																						.											0													25.0	20.0	22.0					6																	30610646		2201	4298	6499	SO:0001589	frameshift_variant	79969			AK023220	CCDS4683.2, CCDS54978.1, CCDS59002.1	6p21.32	2014-06-17	2010-10-11	2010-10-11	ENSG00000137343	ENSG00000137343	2.3.1.108		21186	protein-coding gene	gene with protein product	"""alpha-tubulin N-acetyltransferase"""	615556	"""chromosome 6 open reading frame 134"""	C6orf134		20829795	Standard	NM_024909		Approved	FLJ13158, Em:AB023049.7, MEC17	uc003nqv.3	Q5SQI0	OTTHUMG00000031219	ENST00000376485.4:c.826delT	6.37:g.30610646delT	ENSP00000365668:p.Ser276fs			Frame_Shift_Del	DEL	ENST00000376485.4	37																																																																																					0.682	ATAT1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076449.2	NM_024909	
CALU	813	broad.mit.edu	37	7	128407599	128407599	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr7:128407599C>T	ENST00000249364.4	+	6	835	c.733C>T	c.(733-735)Cgt>Tgt	p.R245C	CALU_ENST00000535011.2_Intron|CALU_ENST00000538546.1_Missense_Mutation_p.R94C|CALU_ENST00000542996.2_Missense_Mutation_p.R253C|CALU_ENST00000449187.2_Missense_Mutation_p.R245C|CALU_ENST00000535623.1_3'UTR|CALU_ENST00000479257.1_Missense_Mutation_p.R253C	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin	245	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						GGATAAGAACCGTGATGGGAA	0.488																																						.											0													192.0	179.0	183.0					7																	128407599		2203	4300	6503	SO:0001583	missense	813			AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.733C>T	7.37:g.128407599C>T	ENSP00000249364:p.Arg245Cys		B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	ENST00000249364.4	37	CCDS5805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.88|15.88	2.964695|2.964695	0.53507|0.53507	.|.	.|.	ENSG00000128595|ENSG00000128595	ENST00000493278|ENST00000542996;ENST00000538546;ENST00000249364;ENST00000449187;ENST00000479257	.|T;T;T;T;T	.|0.56103	.|0.48;0.48;0.48;0.48;0.48	5.44|5.44	4.56|4.56	0.56223|0.56223	.|EF-hand-like domain (1);	.|0.267158	.|0.39759	.|N	.|0.001271	T|T	0.48519|0.48519	0.1504|0.1504	L|L	0.34521|0.34521	1.04|1.04	0.49798|0.49798	D|D	0.99982|0.99982	.|B;P	.|0.41102	.|0.002;0.738	.|B;P	.|0.44860	.|0.001;0.462	T|T	0.51826|0.51826	-0.8656|-0.8656	5|10	.|0.62326	.|D	.|0.03	-2.8562|-2.8562	13.5218|13.5218	0.61572|0.61572	0.1568:0.8432:0.0:0.0|0.1568:0.8432:0.0:0.0	.|.	.|253;245	.|D6QS48;O43852	.|.;CALU_HUMAN	L|C	76|253;94;245;245;253	.|ENSP00000438248:R253C;ENSP00000438994:R94C;ENSP00000249364:R245C;ENSP00000408838:R245C;ENSP00000420381:R253C	.|ENSP00000249364:R245C	P|R	+|+	2|1	0|0	CALU|CALU	128194835|128194835	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.613000|2.613000	0.46351|0.46351	1.287000|1.287000	0.44583|0.44583	0.563000|0.563000	0.77884|0.77884	CCG|CGT		0.488	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350533.1	NM_001219	
CNTLN	54875	broad.mit.edu	37	9	17409364	17409364	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr9:17409364A>G	ENST00000380647.3	+	16	2773	c.2689A>G	c.(2689-2691)Acg>Gcg	p.T897A	CNTLN_ENST00000425824.1_Missense_Mutation_p.T897A|CNTLN_ENST00000262360.5_Missense_Mutation_p.T897A			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	897					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AATAAGTCCTACGGAAGATGG	0.358																																						.											0													114.0	114.0	114.0					9																	17409364		1817	4080	5897	SO:0001583	missense	54875			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2689A>G	9.37:g.17409364A>G	ENSP00000370021:p.Thr897Ala		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	A	5.196	0.221771	0.09863	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.17854	2.25;2.25;2.51	5.39	-0.865	0.10662	.	.	.	.	.	T	0.11665	0.0284	L	0.40543	1.245	0.09310	N	1	B;B;B	0.22604	0.072;0.0;0.0	B;B;B	0.24541	0.054;0.001;0.001	T	0.43163	-0.9408	9	0.08837	T	0.75	.	8.7416	0.34560	0.5684:0.0:0.4316:0.0	.	897;897;897	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	A	897	ENSP00000370021:T897A;ENSP00000392798:T897A;ENSP00000262360:T897A	ENSP00000262360:T897A	T	+	1	0	CNTLN	17399364	0.014000	0.17966	0.056000	0.19401	0.994000	0.84299	0.053000	0.14184	-0.319000	0.08652	0.482000	0.46254	ACG		0.358	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
WIPF3	644150	broad.mit.edu	37	7	29924113	29924114	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr7:29924113_29924114insC	ENST00000409290.1	+	4	1003_1004	c.1003_1004insC	c.(1003-1005)gccfs	p.A335fs	WIPF3_ENST00000242140.5_Frame_Shift_Ins_p.A335fs|WIPF3_ENST00000409123.1_Frame_Shift_Ins_p.A335fs	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	335					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)				breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						CAGCTTCCAGGCCCCACCGCAG	0.668																																						.											0																																										SO:0001589	frameshift_variant	644150			AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.1007dupC	7.37:g.29924117_29924117dupC	ENSP00000386878:p.Ala335fs		B8ZZV2	Frame_Shift_Ins	INS	ENST00000409290.1	37	CCDS56472.1																																																																																				0.668	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327705.1		
TNRC18	84629	ucsc.edu	37	7	5401630	5401630	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr7:5401630T>C	ENST00000430969.1	-	13	4778	c.4430A>G	c.(4429-4431)gAc>gGc	p.D1477G	TNRC18_ENST00000399537.4_Missense_Mutation_p.D1477G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1477							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTCCAGGGCGTCCATGTCCTC	0.657																																						.											0													27.0	30.0	29.0					7																	5401630		2077	4195	6272	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4430A>G	7.37:g.5401630T>C	ENSP00000395538:p.Asp1477Gly		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001004	0.74818	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.26067	1.91;1.91;1.76	5.52	4.36	0.52297	.	0.146929	0.31734	N	0.007157	T	0.30854	0.0778	M	0.78637	2.42	0.58432	D	0.999996	B	0.22541	0.071	B	0.17722	0.019	T	0.08493	-1.0719	10	0.54805	T	0.06	.	11.2443	0.48987	0.0:0.072:0.0:0.928	.	1477	O15417	TNC18_HUMAN	G	1477;1477;532;10	ENSP00000382452:D1477G;ENSP00000395538:D1477G;ENSP00000395990:D10G	ENSP00000382452:D1477G	D	-	2	0	TNRC18	5368156	1.000000	0.71417	0.948000	0.38648	0.829000	0.46940	3.427000	0.52785	0.933000	0.37291	0.459000	0.35465	GAC		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
IRF5	3663	ucsc.edu	37	7	128586594	128586594	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr7:128586594A>G	ENST00000402030.2	+	4	497	c.425A>G	c.(424-426)gAg>gGg	p.E142G	IRF5_ENST00000477535.1_Missense_Mutation_p.E142G|IRF5_ENST00000357234.5_Missense_Mutation_p.E142G|IRF5_ENST00000473745.1_Missense_Mutation_p.E142G|IRF5_ENST00000249375.4_Missense_Mutation_p.E142G	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	142	Poly-Glu.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GGTGCAGGAGAGGAGGAGGAA	0.577																																						.											0													54.0	46.0	49.0					7																	128586594		2203	4300	6503	SO:0001583	missense	3663				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.425A>G	7.37:g.128586594A>G	ENSP00000385352:p.Glu142Gly		A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	ENST00000402030.2	37	CCDS5808.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.200015	0.58126	.	.	ENSG00000128604	ENST00000489702;ENST00000357234;ENST00000477535;ENST00000430204;ENST00000402030;ENST00000249375;ENST00000453794;ENST00000473745;ENST00000412326	D;D;D;D;D;D	0.98192	-4.78;-4.45;-4.48;-4.41;-4.41;-4.41	5.31	5.31	0.75309	.	1.083730	0.07191	N	0.855684	D	0.98570	0.9522	L	0.56769	1.78	0.35070	D	0.762351	B;D;B;D;D;B	0.76494	0.049;0.999;0.013;0.998;0.998;0.007	B;D;B;D;D;B	0.78314	0.039;0.991;0.01;0.991;0.979;0.006	D	0.95955	0.8957	10	0.37606	T	0.19	2.376	11.9478	0.52938	1.0:0.0:0.0:0.0	.	142;142;142;142;142;142	B4DLN8;F5H3H8;E7EW54;E9PC81;Q13568;Q13568-2	.;.;.;.;IRF5_HUMAN;.	G	142	ENSP00000418037:E142G;ENSP00000349770:E142G;ENSP00000419950:E142G;ENSP00000385352:E142G;ENSP00000249375:E142G;ENSP00000419149:E142G	ENSP00000249375:E142G	E	+	2	0	IRF5	128373830	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.674000	0.37544	2.134000	0.65973	0.533000	0.62120	GAG		0.577	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
UPF1	5976	ucsc.edu	37	19	18976950	18976950	+	Missense_Mutation	SNP	T	T	G			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr19:18976950T>G	ENST00000599848.1	+	23	3577	c.3368T>G	c.(3367-3369)gTg>gGg	p.V1123G	UPF1_ENST00000262803.5_Missense_Mutation_p.V1112G			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	1123	Gln/Ser-rich.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CATGGCGGGGTGACGGGGCTG	0.617																																						.											0													38.0	34.0	35.0					19																	18976950		2203	4300	6503	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.3368T>G	19.37:g.18976950T>G	ENSP00000470142:p.Val1123Gly		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	t	19.56	3.850660	0.71719	.	.	ENSG00000005007	ENST00000262803	D	0.90676	-2.71	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.79811	0.4510	N	0.08118	0	0.80722	D	1	P;P	0.38167	0.487;0.621	B;B	0.34385	0.088;0.181	T	0.80790	-0.1225	10	0.34782	T	0.22	-33.7285	13.4981	0.61438	0.0:0.0:0.0:1.0	.	1123;1112	Q92900;Q92900-2	RENT1_HUMAN;.	G	1112	ENSP00000262803:V1112G	ENSP00000262803:V1112G	V	+	2	0	UPF1	18837950	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	7.680000	0.84062	1.883000	0.54544	0.398000	0.26397	GTG		0.617	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
CYP2W1	54905	mdanderson.org	37	7	1023013	1023013	+	Silent	SNP	C	C	T	rs2272375	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr7:1023013C>T	ENST00000308919.7	+	1	179	c.166C>T	c.(166-168)Ctg>Ttg	p.L56L	CYP2W1_ENST00000340150.6_5'UTR	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	56					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGACCGGTCCCTGATGGAGGT	0.711													C|||	1804	0.360224	0.5098	0.3343	5008	,	,		12799	0.3115		0.2744	False		,,,				2504	0.3149					.											0								C		1532,2094		347,838,628	11.0	10.0	10.0		166	4.5	0.8	7	dbSNP_100	10	1881,5021		306,1269,1876	no	coding-synonymous	CYP2W1	NM_017781.2		653,2107,2504	TT,TC,CC		27.253,42.2504,32.4183		56/491	1023013	3413,7115	1813	3451	5264	SO:0001819	synonymous_variant	54905			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.166C>T	7.37:g.1023013C>T				Silent	SNP	ENST00000308919.7	37	CCDS5319.2																																																																																				0.711	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781	
DND1	373863	mdanderson.org	37	5	140052407	140052407	+	Missense_Mutation	SNP	G	G	A	rs72800920		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr5:140052407G>A	ENST00000542735.1	-	3	270	c.227C>T	c.(226-228)cCg>cTg	p.P76L		NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	76	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)	p.P76L(1)		central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGAACAGCGGGATAAGCTG	0.667																																						.											1	Substitution - Missense(1)	prostate(1)											13.0	20.0	17.0					5																	140052407		2184	4291	6475	SO:0001583	missense	373863			AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.227C>T	5.37:g.140052407G>A	ENSP00000445366:p.Pro76Leu			Missense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250143	0.80024	.	.	ENSG00000256453	ENST00000542735	T	0.15718	2.4	5.35	5.35	0.76521	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000003	T	0.51058	0.1652	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60403	-0.7270	10	0.87932	D	0	-9.8139	18.6578	0.91460	0.0:0.0:1.0:0.0	.	76	Q8IYX4	DND1_HUMAN	L	76	ENSP00000445366:P76L	ENSP00000445366:P76L	P	-	2	0	DND1	140032591	1.000000	0.71417	1.000000	0.80357	0.232000	0.25224	9.637000	0.98443	2.499000	0.84300	0.467000	0.42956	CCG		0.667	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251669.2	NM_194249	
FAM8A1	51439	mdanderson.org	37	6	17602863	17602863	+	Missense_Mutation	SNP	C	C	T	rs80120441	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:17602863C>T	ENST00000259963.3	+	2	810	c.755C>T	c.(754-756)gCa>gTa	p.A252V		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	252	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			AGATTTATGGCAGAGATGGTG	0.348																																						.											0													137.0	138.0	138.0					6																	17602863		2203	4299	6502	SO:0001583	missense	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.755C>T	6.37:g.17602863C>T	ENSP00000259963:p.Ala252Val		B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	C	32	5.151658	0.94645	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.1	5.1	0.69264	RDD (1);	0.058285	0.64402	D	0.000002	T	0.81341	0.4802	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84502	0.0617	9	0.87932	D	0	-6.6518	18.5673	0.91121	0.0:1.0:0.0:0.0	.	252	Q9UBU6	FA8A1_HUMAN	V	2;252	.	ENSP00000259963:A252V	A	+	2	0	FAM8A1	17710842	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.481000	0.81124	2.356000	0.79943	0.644000	0.83932	GCA		0.348	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FAM8A1	51439	mdanderson.org	37	6	17602895	17602895	+	Missense_Mutation	SNP	A	A	G	rs79412549	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:17602895A>G	ENST00000259963.3	+	2	842	c.787A>G	c.(787-789)Ata>Gta	p.I263V		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	263	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TCTCTTCTTTATAAAAGCAAC	0.333																																						.											0													126.0	129.0	128.0					6																	17602895		2203	4299	6502	SO:0001583	missense	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.787A>G	6.37:g.17602895A>G	ENSP00000259963:p.Ile263Val		B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607815	0.28623	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.14	3.99	0.46301	RDD (1);	0.111766	0.64402	D	0.000020	T	0.15435	0.0372	N	0.11560	0.145	0.50467	D	0.999878	B	0.26577	0.153	B	0.20577	0.03	T	0.06752	-1.0809	9	0.27082	T	0.32	-7.5971	10.2614	0.43430	0.9218:0.0:0.0782:0.0	.	263	Q9UBU6	FA8A1_HUMAN	V	13;263	.	ENSP00000259963:I263V	I	+	1	0	FAM8A1	17710874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.699000	0.54778	1.912000	0.55364	0.528000	0.53228	ATA		0.333	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FAM8A1	51439	mdanderson.org	37	6	17602910	17602910	+	Missense_Mutation	SNP	G	G	A	rs144013791	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:17602910G>A	ENST00000259963.3	+	2	857	c.802G>A	c.(802-804)Gtc>Atc	p.V268I		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	268	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			AGCAACCATTGTCTTAAGCAT	0.343																																						.											0													129.0	131.0	130.0					6																	17602910		2203	4299	6502	SO:0001583	missense	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.802G>A	6.37:g.17602910G>A	ENSP00000259963:p.Val268Ile		B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129586	0.56721	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.14	5.14	0.70334	RDD (1);	0.294262	0.32068	N	0.006636	T	0.14657	0.0354	N	0.12746	0.255	0.38313	D	0.943307	P	0.44776	0.843	B	0.40659	0.336	T	0.03619	-1.1019	9	0.17832	T	0.49	-14.4303	10.2941	0.43613	0.1541:0.0:0.8459:0.0	.	268	Q9UBU6	FA8A1_HUMAN	I	18;268	.	ENSP00000259963:V268I	V	+	1	0	FAM8A1	17710889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.361000	0.52306	2.361000	0.80049	0.650000	0.86243	GTC		0.343	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FAM8A1	51439	mdanderson.org	37	6	17606205	17606205	+	Missense_Mutation	SNP	G	G	A	rs79642714		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:17606205G>A	ENST00000259963.3	+	4	1113	c.1058G>A	c.(1057-1059)cGg>cAg	p.R353Q		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	353	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			GCACCAAGTCGGGTTTTAGTG	0.398																																						.											0													139.0	121.0	127.0					6																	17606205		2203	4300	6503	SO:0001583	missense	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.1058G>A	6.37:g.17606205G>A	ENSP00000259963:p.Arg353Gln		B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223301	0.95139	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.53	4.66	0.58398	RDD (1);	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.75988	-0.3123	9	0.66056	D	0.02	-12.6679	14.7574	0.69576	0.0709:0.0:0.9291:0.0	.	353	Q9UBU6	FA8A1_HUMAN	Q	103;353	.	ENSP00000259963:R353Q	R	+	2	0	FAM8A1	17714184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.407000	0.97325	2.587000	0.87381	0.650000	0.86243	CGG		0.398	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FAM26F	441168	mdanderson.org	37	6	116783330	116783330	+	Missense_Mutation	SNP	G	G	A	rs1057192	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:116783330G>A	ENST00000368605.1	+	2	333	c.238G>A	c.(238-240)Gga>Aga	p.G80R	RP1-93H18.6_ENST00000476099.1_RNA|FAM26F_ENST00000368606.3_Intron	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	80			G -> R (in dbSNP:rs1057192).		ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		CCTGCTCACCGGATGCTGCTC	0.721													G|||	1200	0.239617	0.0628	0.17	5008	,	,		13100	0.3651		0.2485	False		,,,				2504	0.3896					.											0								G	ARG/GLY	285,3437		11,263,1587	4.0	4.0	4.0		238	4.2	1.0	6	dbSNP_86	4	1331,5787		122,1087,2350	yes	missense	FAM26F	NM_001010919.1	125	133,1350,3937	AA,AG,GG		18.6991,7.6572,14.9077	probably-damaging	80/316	116783330	1616,9224	1861	3559	5420	SO:0001583	missense	441168			AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.238G>A	6.37:g.116783330G>A	ENSP00000357594:p.Gly80Arg		B9EJB0|Q5R3K4	Missense_Mutation	SNP	ENST00000368605.1	37	CCDS34519.1	492	0.22527472527472528	23	0.046747967479674794	64	0.17679558011049723	209	0.36538461538461536	196	0.25857519788918204	G	19.26	3.793370	0.70452	0.076572	0.186991	ENSG00000188820	ENST00000368605	T	0.24908	1.83	5.1	4.22	0.49857	.	0.060943	0.64402	D	0.000004	T	0.45498	0.1345	M	0.83223	2.63	0.09310	P	0.999999384292	D	0.89917	1.0	D	0.79784	0.993	T	0.59150	-0.7508	9	0.87932	D	0	-20.7189	15.7243	0.77743	0.0:0.137:0.863:0.0	rs1057192;rs3173147	80	Q5R3K3	FA26F_HUMAN	R	80	ENSP00000357594:G80R	ENSP00000357594:G80R	G	+	1	0	FAM26F	116890023	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	4.925000	0.63425	1.372000	0.46190	0.491000	0.48974	GGA		0.721	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041946.1	NM_001010919	
FLG	2312	mdanderson.org	37	1	152284576	152284576	+	Missense_Mutation	SNP	C	C	A	rs143382793	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:152284576C>A	ENST00000368799.1	-	3	2821	c.2786G>T	c.(2785-2787)gGc>gTc	p.G929V	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	929	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCCTGGCCTGCCTGTGA	0.557									Ichthyosis																													.											0													327.0	313.0	318.0					1																	152284576		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2786G>T	1.37:g.152284576C>A	ENSP00000357789:p.Gly929Val		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	1.719	-0.497190	0.04291	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.06528	3.29	1.17	0.0422	0.14216	.	.	.	.	.	T	0.06142	0.0159	M	0.77820	2.39	0.09310	N	1	D	0.67145	0.996	P	0.58970	0.849	T	0.24977	-1.0145	9	0.21014	T	0.42	.	4.8967	0.13753	0.0:0.6064:0.3936:0.0	.	929	P20930	FILA_HUMAN	V	929;136	ENSP00000357789:G929V	ENSP00000357789:G929V	G	-	2	0	FLG	150551200	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.167000	0.09940	0.033000	0.15463	0.479000	0.44913	GGC		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FMN2	56776	mdanderson.org	37	1	240370995	240370995	+	Silent	SNP	G	G	A	rs201866430	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:240370995G>A	ENST00000319653.9	+	5	3113	c.2883G>A	c.(2881-2883)ggG>ggA	p.G961G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	961	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCTTCCCGGGGCAGGCATAC	0.692																																						.											0													20.0	23.0	22.0					1																	240370995		2199	4297	6496	SO:0001819	synonymous_variant	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2883G>A	1.37:g.240370995G>A			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																				0.692	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
GUCY2D	3000	mdanderson.org	37	17	7906519	7906519	+	Missense_Mutation	SNP	G	G	T	rs61749665	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr17:7906519G>T	ENST00000254854.4	+	2	304	c.154G>T	c.(154-156)Gcc>Tcc	p.A52S		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	52			A -> S (in LCA1; unknown pathological significance; dbSNP:rs61749665). {ECO:0000269|PubMed:21602930, ECO:0000269|PubMed:8944027}.		intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				cgccctctccgccgTGTTCAC	0.776													G|||	2083	0.415935	0.1369	0.4107	5008	,	,		7307	0.6935		0.327	False		,,,				2504	0.6022					.											0								G	SER/ALA	396,2736		31,334,1201	2.0	2.0	2.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	154	0.2	0.0	17	dbSNP_129	2	1601,4981		200,1201,1890	no	missense	GUCY2D	NM_000180.3	99	231,1535,3091	TT,TG,GG		24.3239,12.6437,20.558	benign	52/1104	7906519	1997,7717	1566	3291	4857	SO:0001583	missense	3000			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.154G>T	17.37:g.7906519G>T	ENSP00000254854:p.Ala52Ser		Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	823	0.3768315018315018	61	0.12398373983739837	132	0.36464088397790057	383	0.6695804195804196	247	0.3258575197889182	G	10.96	1.499163	0.26861	0.126437	0.243239	ENSG00000132518	ENST00000254854	D	0.83075	-1.68	4.65	0.187	0.15109	.	0.608923	0.13562	N	0.378720	T	0.00012	0.0000	M	0.65498	2.005	0.80722	P	0.0	B	0.27117	0.168	B	0.21546	0.035	T	0.48681	-0.9014	9	0.09590	T	0.72	.	3.8844	0.09091	0.2473:0.0:0.4661:0.2866	rs61749665	52	Q02846	GUC2D_HUMAN	S	52	ENSP00000254854:A52S	ENSP00000254854:A52S	A	+	1	0	GUCY2D	7847244	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.039000	0.12124	-0.193000	0.10415	-0.188000	0.12872	GCC		0.776	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
GH2	2689	mdanderson.org	37	17	61959155	61959155	+	Missense_Mutation	SNP	C	C	T	rs148779841		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr17:61959155C>T	ENST00000423893.2	-	1	68	c.7G>A	c.(7-9)Gca>Aca	p.A3T	GH2_ENST00000449787.2_Missense_Mutation_p.A3T|GH2_ENST00000456543.2_Missense_Mutation_p.A3T|GH2_ENST00000332800.7_Missense_Mutation_p.A3T			P01242	SOM2_HUMAN	growth hormone 2	3					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.A3T(2)		breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CGCTTACCTGCAGCCATTGCC	0.597																																						.											2	Substitution - Missense(2)	lung(2)											77.0	77.0	77.0					17																	61959155		2203	4298	6501	SO:0001583	missense	2689			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.7G>A	17.37:g.61959155C>T	ENSP00000409294:p.Ala3Thr		B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.	.	.	.	.	.	.	.	.	.	c	14.11	2.437770	0.43326	.	.	ENSG00000136487	ENST00000332800;ENST00000456543;ENST00000423893;ENST00000449787	D;D;D;D	0.87966	-2.27;-2.32;-2.29;-2.27	2.81	0.324	0.15898	.	2.162650	0.02469	N	0.087359	D	0.84419	0.5468	M	0.61703	1.905	0.19775	N	0.999958	B;B;B;B;B	0.24317	0.001;0.0;0.005;0.101;0.001	B;B;B;B;B	0.23574	0.004;0.002;0.007;0.047;0.004	T	0.65520	-0.6148	10	0.48119	T	0.1	.	3.8655	0.09015	0.0:0.5946:0.2501:0.1553	.	3;3;3;3;3	P01242;O14643;O14644;B1A4H7;B1A4H5	SOM2_HUMAN;.;.;.;.	T	3	ENSP00000333157:A3T;ENSP00000394122:A3T;ENSP00000409294:A3T;ENSP00000410618:A3T	ENSP00000333157:A3T	A	-	1	0	GH2	59312887	0.465000	0.25815	0.996000	0.52242	0.174000	0.22865	-0.755000	0.04782	0.463000	0.27118	0.313000	0.20887	GCA		0.597	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
KISS1	3814	mdanderson.org	37	1	204159787	204159787	+	Missense_Mutation	SNP	G	G	C	rs4889	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:204159787G>C	ENST00000367194.4	-	3	390	c.242C>G	c.(241-243)cCc>cGc	p.P81R		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	81			P -> R (in dbSNP:rs4889). {ECO:0000269|PubMed:15598687, ECO:0000269|PubMed:9806840, ECO:0000269|Ref.4}.		cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CGGCTGCTGGGGGCTCCCGGA	0.731													G|||	1652	0.329872	0.4009	0.3156	5008	,	,		8959	0.4216		0.2545	False		,,,				2504	0.227					.											0								G	ARG/PRO	673,1913		94,485,714	3.0	5.0	4.0		242	0.6	0.0	1	dbSNP_52	4	1170,5064		125,920,2072	no	missense	KISS1	NM_002256.3	103	219,1405,2786	CC,CG,GG		18.768,26.0247,20.8957	probably-damaging	81/139	204159787	1843,6977	1293	3117	4410	SO:0001583	missense	3814			U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.242C>G	1.37:g.204159787G>C	ENSP00000356162:p.Pro81Arg		A8K6N0|Q9HBP1	Missense_Mutation	SNP	ENST00000367194.4	37	CCDS41454.1	717	0.3282967032967033	196	0.3983739837398374	99	0.27348066298342544	230	0.4020979020979021	192	0.2532981530343008	G	11.85	1.760696	0.31137	0.260247	0.18768	ENSG00000170498	ENST00000367194	T	0.80653	-1.4	4.91	0.555	0.17247	.	0.163973	0.29799	N	0.011175	T	0.00012	0.0000	N	0.12961	0.28	0.80722	P	0.0	P	0.35844	0.524	B	0.35550	0.205	T	0.32322	-0.9911	9	0.02654	T	1	-5.226	2.4672	0.04555	0.0963:0.1644:0.4016:0.3376	rs4889;rs1132315;rs3192998	81	Q15726	KISS1_HUMAN	R	81	ENSP00000356162:P81R	ENSP00000356162:P81R	P	-	2	0	KISS1	202426410	0.450000	0.25697	0.017000	0.16124	0.061000	0.15899	1.748000	0.38308	0.119000	0.18210	0.655000	0.94253	CCC		0.731	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087892.1	NM_002256	
MUC21	394263	mdanderson.org	37	6	30955201	30955201	+	Missense_Mutation	SNP	G	G	A	rs2508018	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr6:30955201G>A	ENST00000376296.3	+	2	1490	c.1249G>A	c.(1249-1251)Gcc>Acc	p.A417T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	417	28 X 15 AA approximate tandem repeats.|Ser-rich.			A -> I (in Ref. 3; AAQ88781 and 4; CAQ08321). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GTCCAGTGGGGCCAGCACTGC	0.627													g|||	404	0.0806709	0.0749	0.1427	5008	,	,		20374	0.0556		0.0805	False		,,,				2504	0.0706					.											0													140.0	136.0	137.0					6																	30955201		2203	4300	6503	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1249G>A	6.37:g.30955201G>A	ENSP00000365473:p.Ala417Thr		B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	217	0.09935897435897435	48	0.0975609756097561	60	0.16574585635359115	55	0.09615384615384616	54	0.0712401055408971	g	0.076	-1.192559	0.01607	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.01287	5.05	3.58	-7.16	0.01516	.	.	.	.	.	T	0.00178	0.0005	N	0.04508	-0.205	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.45026	-0.9289	9	0.06625	T	0.88	-0.4275	6.7193	0.23321	0.1341:0.0:0.3783:0.4876	rs2508018;rs2508018	417	Q5SSG8	MUC21_HUMAN	T	267;417	ENSP00000365473:A417T	ENSP00000365473:A417T	A	+	1	0	MUC21	31063180	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.607000	0.02070	-2.884000	0.00318	0.586000	0.80456	GCC		0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC4	4585	mdanderson.org	37	3	195511403	195511403	+	Missense_Mutation	SNP	C	C	T	rs78846267|rs71627021		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr3:195511403C>T	ENST00000463781.3	-	2	7507	c.7048G>A	c.(7048-7050)Gcc>Acc	p.A2350T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2350T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.587																																						.											0													11.0	12.0	12.0					3																	195511403		651	1555	2206	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7048G>A	3.37:g.195511403C>T	ENSP00000417498:p.Ala2350Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	5.465	0.270947	0.10349	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.46;1.47	.	.	.	.	.	.	.	.	T	0.11665	0.0284	N	0.19112	0.55	0.09310	N	1	P	0.52463	0.953	B	0.34536	0.185	T	0.16512	-1.0400	7	.	.	.	.	2.1665	0.03838	0.3282:0.3412:0.3306:0.0	.	2350	E7ESK3	.	T	2350	ENSP00000417498:A2350T;ENSP00000420243:A2350T	.	A	-	1	0	MUC4	196995798	0.000000	0.05858	0.017000	0.16124	0.071000	0.16799	-2.347000	0.01095	-0.833000	0.04245	0.064000	0.15345	GCC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511412	195511412	+	Missense_Mutation	SNP	T	T	A	rs199878638		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr3:195511412T>A	ENST00000463781.3	-	2	7498	c.7039A>T	c.(7039-7041)Aca>Tca	p.T2347S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2347S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGTGACCTGTGGATGCTGAG	0.587																																						.											0													8.0	10.0	9.0					3																	195511412		608	1542	2150	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7039A>T	3.37:g.195511412T>A	ENSP00000417498:p.Thr2347Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	5.227	0.227355	0.09916	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.37;1.33	.	.	.	.	.	.	.	.	T	0.16727	0.0402	N	0.19112	0.55	0.09310	N	1	B	0.28820	0.224	B	0.18263	0.021	T	0.18429	-1.0337	7	.	.	.	.	2.6594	0.05021	0.0:0.4962:0.0:0.5038	.	2347	E7ESK3	.	S	2347	ENSP00000417498:T2347S;ENSP00000420243:T2347S	.	T	-	1	0	MUC4	196995807	0.011000	0.17503	0.023000	0.16930	0.050000	0.14768	0.288000	0.18939	0.056000	0.16144	0.055000	0.15244	ACA		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515126	195515126	+	Missense_Mutation	SNP	C	C	T	rs529638482	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr3:195515126C>T	ENST00000463781.3	-	2	3784	c.3325G>A	c.(3325-3327)Gac>Aac	p.D1109N	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1109N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	540					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.577																																						.											0													9.0	6.0	7.0					3																	195515126		654	1463	2117	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3325G>A	3.37:g.195515126C>T	ENSP00000417498:p.Asp1109Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.524	0.869503	0.17322	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.49;1.48	0.814	-1.63	0.08345	.	.	.	.	.	T	0.13372	0.0324	N	0.19112	0.55	0.09310	N	1	B	0.32203	0.36	B	0.17722	0.019	T	0.18999	-1.0319	8	.	.	.	.	5.2224	0.15375	0.0:0.4002:0.0:0.5998	.	1109	E7ESK3	.	N	1109	ENSP00000417498:D1109N;ENSP00000420243:D1109N	.	D	-	1	0	MUC4	196999521	0.000000	0.05858	0.001000	0.08648	0.296000	0.27459	-0.592000	0.05747	-0.657000	0.05373	0.064000	0.15345	GAC		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NCOR1	9611	mdanderson.org	37	17	16097825	16097825	+	Missense_Mutation	SNP	T	T	G	rs73281920	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr17:16097825T>G	ENST00000268712.3	-	2	316	c.59A>C	c.(58-60)tAt>tCt	p.Y20S	NCOR1_ENST00000395848.1_Missense_Mutation_p.Y20S|RN7SL442P_ENST00000473804.2_RNA|NCOR1_ENST00000395851.1_Missense_Mutation_p.Y20S	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	20	Interaction with ZBTB33 and HEXIM1.			Y -> S (in Ref. 2; AAO32942). {ECO:0000305}.	CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.Y20F(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTGAGGAGGATAACGACTTTG	0.428																																						.											1	Substitution - Missense(1)	lung(1)											215.0	146.0	169.0					17																	16097825		2203	4300	6503	SO:0001583	missense	9611			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.59A>C	17.37:g.16097825T>G	ENSP00000268712:p.Tyr20Ser		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906660	0.33628	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828;ENST00000430577	T;T;T	0.60548	0.21;0.79;0.18	5.24	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.72220	0.3433	M	0.69823	2.125	0.80722	D	1	D;D;D;D;P;D;P	0.89917	1.0;1.0;1.0;1.0;0.745;0.992;0.739	D;D;D;D;B;D;P	0.91635	0.999;0.999;0.997;0.999;0.265;0.988;0.453	T	0.73285	-0.4031	10	0.87932	D	0	.	9.9889	0.41858	0.0:0.08:0.0:0.92	.	20;20;20;20;20;20;20	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	S	20	ENSP00000268712:Y20S;ENSP00000379192:Y20S;ENSP00000379189:Y20S	ENSP00000268712:Y20S	Y	-	2	0	NCOR1	16038550	1.000000	0.71417	0.570000	0.28473	0.981000	0.71138	5.149000	0.64863	0.829000	0.34733	0.455000	0.32223	TAT		0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
NCOR1	9611	mdanderson.org	37	17	16097870	16097870	+	Missense_Mutation	SNP	C	C	A	rs76145228		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr17:16097870C>A	ENST00000268712.3	-	2	271	c.14G>T	c.(13-15)gGt>gTt	p.G5V	NCOR1_ENST00000395848.1_Missense_Mutation_p.G5V|RN7SL442P_ENST00000473804.2_RNA|NCOR1_ENST00000395851.1_Missense_Mutation_p.G5V	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	5	Interaction with ZBTB33 and HEXIM1.			G -> V (in Ref. 2; AAO32942). {ECO:0000305}.	CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGGAGGATAACCTGAACTTGA	0.443																																						.											0													156.0	106.0	123.0					17																	16097870		2203	4300	6503	SO:0001583	missense	9611			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.14G>T	17.37:g.16097870C>A	ENSP00000268712:p.Gly5Val		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591450	0.46214	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828;ENST00000430577	T;T;T	0.74315	0.72;1.36;-0.83	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.83330	0.5231	L	0.51422	1.61	0.80722	D	1	P;P;D;P;D;D;D	0.89917	0.907;0.82;1.0;0.82;1.0;0.983;1.0	B;B;D;B;D;P;D	0.97110	0.421;0.256;1.0;0.256;0.998;0.833;0.999	D	0.84033	0.0360	10	0.54805	T	0.06	.	17.7962	0.88572	0.0:1.0:0.0:0.0	.	5;5;5;5;5;5;5	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	V	5	ENSP00000268712:G5V;ENSP00000379192:G5V;ENSP00000379189:G5V	ENSP00000268712:G5V	G	-	2	0	NCOR1	16038595	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.636000	0.74299	2.429000	0.82318	0.557000	0.71058	GGT		0.443	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
PKDREJ	10343	mdanderson.org;bcgsc.ca	37	22	46656278	46656278	+	Missense_Mutation	SNP	G	G	A	rs117787407	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr22:46656278G>A	ENST00000253255.5	-	1	2941	c.2942C>T	c.(2941-2943)aCg>aTg	p.T981M		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	981					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CCCACCTGTCGTCTTCTTCAA	0.483													G|||	3	0.000599042	0.0	0.0	5008	,	,		22339	0.0		0.003	False		,,,				2504	0.0					.											0								G	MET/THR	0,4406		0,0,2203	148.0	143.0	145.0		2942	5.2	0.1	22	dbSNP_132	145	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PKDREJ	NM_006071.1	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	981/2254	46656278	1,13005	2203	4300	6503	SO:0001583	missense	10343			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2942C>T	22.37:g.46656278G>A	ENSP00000253255:p.Thr981Met		B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	19.28	3.796581	0.70567	0.0	1.16E-4	ENSG00000130943	ENST00000253255	T	0.54279	0.58	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000006	T	0.71600	0.3359	M	0.65498	2.005	0.34984	D	0.754398	D	0.89917	1.0	D	0.77004	0.989	T	0.79455	-0.1796	10	0.66056	D	0.02	-18.7004	18.0551	0.89362	0.0:0.0:1.0:0.0	.	981	Q9NTG1	PKDRE_HUMAN	M	981	ENSP00000253255:T981M	ENSP00000253255:T981M	T	-	2	0	PKDREJ	45034942	0.993000	0.37304	0.108000	0.21378	0.082000	0.17680	3.927000	0.56499	2.598000	0.87819	0.655000	0.94253	ACG		0.483	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
PLCB3	5331	mdanderson.org	37	11	64026685	64026685	+	Silent	SNP	C	C	T	rs28395882	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr11:64026685C>T	ENST00000540288.1	+	13	1597	c.1494C>T	c.(1492-1494)tcC>tcT	p.S498S	PLCB3_ENST00000279230.6_Silent_p.S498S|PLCB3_ENST00000325234.5_Silent_p.S431S	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	498					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						GCGAGAGCTCCGCGGCCACCG	0.706													C|||	865	0.172724	0.0234	0.147	5008	,	,		12937	0.1339		0.3012	False		,,,				2504	0.3006					.											0								C	,	242,4066		8,226,1920	9.0	11.0	11.0		1494,1293	-9.8	0.0	11	dbSNP_126	11	2553,5907		423,1707,2100	no	coding-synonymous,coding-synonymous	PLCB3	NM_000932.2,NM_001184883.1	,	431,1933,4020	TT,TC,CC		30.1773,5.6175,21.8907	,	498/1235,431/1168	64026685	2795,9973	2154	4230	6384	SO:0001819	synonymous_variant	5331			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.1494C>T	11.37:g.64026685C>T			A5PKZ6|G5E960|Q8N1A4	Silent	SNP	ENST00000540288.1	37	CCDS8064.1																																																																																				0.706	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
POTEE	445582	mdanderson.org	37	2	132021475	132021475	+	Missense_Mutation	SNP	G	G	A	rs11546936		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr2:132021475G>A	ENST00000356920.5	+	15	2541	c.2447G>A	c.(2446-2448)cGc>cAc	p.R816H	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	816	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AAGGCCAACCGCGAGAAGATG	0.607																																						.											0													78.0	80.0	79.0					2																	132021475		2127	4190	6317	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2447G>A	2.37:g.132021475G>A	ENSP00000439189:p.Arg816His		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	18.42	3.621132	0.66787	.	.	ENSG00000188219	ENST00000356920	D	0.97066	-4.23	.	.	.	Actin/actin-like conserved site (1);	.	.	.	.	D	0.98817	0.9601	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.96667	0.9493	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	rs11546936	816	Q6S8J3	POTEE_HUMAN	H	816	ENSP00000439189:R816H	ENSP00000439189:R816H	R	+	2	0	AC131180.1	131737945	1.000000	0.71417	0.216000	0.23742	0.219000	0.24729	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	CGC		0.607	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
RSBN1	54665	mdanderson.org	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000418238.1_RNA|RP5-1073O3.2_ENST00000429398.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971					.											0								T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665			AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C			A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																				0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
SOX12	6666	mdanderson.org	37	20	307249	307249	+	Silent	SNP	G	G	A	rs147752920|rs532036846	byFrequency	TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr20:307249G>A	ENST00000342665.2	+	1	1011	c.681G>A	c.(679-681)ccG>ccA	p.P227P	RP5-1103G7.4_ENST00000442637.1_RNA|SOX12_ENST00000544632.1_Silent_p.P227P|RP5-1103G7.4_ENST00000414676.1_RNA	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	227	Asp/Glu-rich (acidic).|Poly-Glu.				cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			acgaggagccggaggaagagg	0.756													G|||	11	0.00219649	0.0	0.0	5008	,	,		9459	0.0		0.0109	False		,,,				2504	0.0					.											0													8.0	6.0	7.0					20																	307249		1920	3767	5687	SO:0001819	synonymous_variant	6666			U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.681G>A	20.37:g.307249G>A			Q5D038|Q9NUD4	Silent	SNP	ENST00000342665.2	37	CCDS12995.1																																																																																				0.756	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077435.2	NM_006943	
DNAH14	127602	bcgsc.ca	37	1	225428443	225428443	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr1:225428443C>T	ENST00000445597.2	+	30	5386	c.5386C>T	c.(5386-5388)Ctt>Ttt	p.L1796F	DNAH14_ENST00000430092.1_Missense_Mutation_p.L2201F|DNAH14_ENST00000439375.2_Missense_Mutation_p.L2201F			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1796					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTGTCCCAGTCTTGAACCTGA	0.348																																						.											0													125.0	112.0	116.0					1																	225428443		692	1591	2283	SO:0001583	missense	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.5386C>T	1.37:g.225428443C>T	ENSP00000409472:p.Leu1796Phe		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	N	0.124	-1.122248	0.01785	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.27890	1.64;1.64;1.64	5.79	-0.154	0.13399	.	.	.	.	.	T	0.11024	0.0269	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33701	-0.9858	9	0.10111	T	0.7	.	2.5008	0.04633	0.1171:0.3353:0.1206:0.4271	.	2201	Q0VDD8-4	.	F	1796;2201;2201	ENSP00000409472:L1796F;ENSP00000414402:L2201F;ENSP00000392061:L2201F	ENSP00000414402:L2201F	L	+	1	0	DNAH14	223495066	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.091000	0.15046	-0.006000	0.14370	-1.101000	0.02118	CTT		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
KCMF1	56888	bcgsc.ca	37	2	85262269	85262269	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr2:85262269delC	ENST00000409785.4	+	3	674	c.315delC	c.(313-315)tccfs	p.S105fs		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	105							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						CAGAAACATCAACAGAAGTGG	0.373																																						.											0													79.0	68.0	71.0					2																	85262269		1875	4123	5998	SO:0001589	frameshift_variant	56888			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.315delC	2.37:g.85262269delC	ENSP00000386738:p.Ser105fs		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Frame_Shift_Del	DEL	ENST00000409785.4	37	CCDS46350.1																																																																																				0.373	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122	
APEH	327	bcgsc.ca	37	3	49721606	49721606	+	IGR	SNP	G	G	A	rs138238101		TCGA-KM-8439-01A-11D-2310-10	TCGA-KM-8439-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9d3b0b87-5fc5-4d09-9c63-4d5fc4bc46d0	1f433ac7-b321-46a9-87ac-c72ad5b1b4e5	g.chr3:49721606G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|MST1_ENST00000449682.2_Missense_Mutation_p.P678L|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P664L(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCAGGCAAGTGGGCCCCCGTA	0.562																																						.											1	Substitution - Missense(1)	large_intestine(1)											27.0	25.0	25.0					3																	49721606		2203	4300	6503	SO:0001628	intergenic_variant	4485			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49721606G>A			Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778691	0.90195	.	.	ENSG00000173531	ENST00000449682	D	0.98684	-5.07	5.44	5.44	0.79542	.	0.000000	0.42053	D	0.000775	D	0.99579	0.9848	H	0.98849	4.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97649	1.0153	10	0.87932	D	0	.	19.2477	0.93909	0.0:0.0:1.0:0.0	.	678	G3XAK1	.	L	678	ENSP00000414287:P678L	ENSP00000414287:P678L	P	-	2	0	MST1	49696610	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.295000	0.96095	2.544000	0.85801	0.655000	0.94253	CCA		0.562	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
