#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf71	118461	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	10	50533936	50533936	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr10:50533936G>A	ENST00000374144.3	+	3	3634	c.3346G>A	c.(3346-3348)Gcc>Acc	p.A1116T	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1116										endometrium(1)	1						CCTGACCCACGCCCTCGTGTG	0.657																																						.											0													19.0	24.0	23.0					10																	50533936		692	1591	2283	SO:0001583	missense	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3346G>A	10.37:g.50533936G>A	ENSP00000363259:p.Ala1116Thr		A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284061	0.80803	.	.	ENSG00000177354	ENST00000374144	T	0.04970	3.52	5.38	3.52	0.40303	.	0.647217	0.12708	N	0.445729	T	0.05960	0.0155	L	0.27053	0.805	0.09310	N	0.999991	.	.	.	.	.	.	T	0.39502	-0.9611	8	0.45353	T	0.12	.	5.1637	0.15075	0.2522:0.164:0.5838:0.0	.	.	.	.	T	1116	ENSP00000363259:A1116T	ENSP00000363259:A1116T	A	+	1	0	C10orf71	50203942	0.688000	0.27680	0.115000	0.21578	0.504000	0.33889	1.462000	0.35266	0.651000	0.30788	0.491000	0.48974	GCC		0.657	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
MYPN	84665	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	69881358	69881358	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr10:69881358G>A	ENST00000358913.5	+	2	651	c.163G>A	c.(163-165)Gga>Aga	p.G55R	MYPN_ENST00000540630.1_Missense_Mutation_p.G55R|MYPN_ENST00000373675.3_Missense_Mutation_p.G55R|MYPN_ENST00000354393.2_Intron	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	55	Interaction with CARP.|Poly-Gly.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TGAAGGAGGCGGAGGCCAAGA	0.527																																						.											0													54.0	53.0	53.0					10																	69881358		2203	4300	6503	SO:0001583	missense	84665			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.163G>A	10.37:g.69881358G>A	ENSP00000351790:p.Gly55Arg		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	6.927	0.540685	0.13250	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.60920	0.52;0.5;0.15	6.03	5.12	0.69794	.	0.388870	0.27886	N	0.017449	T	0.37999	0.1024	N	0.16478	0.41	0.09310	N	1	B;B	0.21381	0.055;0.033	B;B	0.12156	0.007;0.003	T	0.11060	-1.0603	9	.	.	.	.	11.0662	0.47976	0.0689:0.1304:0.8007:0.0	.	55;55	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	R	55	ENSP00000351790:G55R;ENSP00000441668:G55R;ENSP00000362779:G55R	.	G	+	1	0	MYPN	69551364	0.999000	0.42202	0.999000	0.59377	0.682000	0.39822	3.009000	0.49552	2.861000	0.98227	0.655000	0.94253	GGA		0.527	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
TET1	80312	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	10	70426913	70426913	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr10:70426913A>G	ENST00000373644.4	+	7	4782	c.4573A>G	c.(4573-4575)Atc>Gtc	p.I1525V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1525					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTGGGATGGCATCCCTCTTCC	0.502																																						.											0													118.0	97.0	104.0					10																	70426913		2203	4300	6503	SO:0001583	missense	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4573A>G	10.37:g.70426913A>G	ENSP00000362748:p.Ile1525Val		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.045305	0.55110	.	.	ENSG00000138336	ENST00000373644	T	0.33654	1.4	5.21	2.83	0.33086	TET cysteine-rich domain (1);	0.062135	0.64402	D	0.000005	T	0.45597	0.1350	L	0.39326	1.205	0.33750	D	0.620563	D	0.63046	0.992	D	0.80764	0.994	T	0.56517	-0.7966	10	0.87932	D	0	.	7.197	0.25858	0.7982:0.0:0.0714:0.1304	.	1525	Q8NFU7	TET1_HUMAN	V	1525	ENSP00000362748:I1525V	ENSP00000362748:I1525V	I	+	1	0	TET1	70096919	1.000000	0.71417	0.527000	0.27925	0.429000	0.31625	4.491000	0.60326	0.366000	0.24427	0.477000	0.44152	ATC		0.502	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
SEC24C	9632	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	10	75519464	75519464	+	Silent	SNP	G	G	A	rs375764899		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr10:75519464G>A	ENST00000339365.2	+	5	555	c.393G>A	c.(391-393)ccG>ccA	p.P131P	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_5'UTR|SEC24C_ENST00000546025.1_5'UTR|SEC24C_ENST00000345254.4_Silent_p.P131P|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	131					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GCCCTCCCCCGACAAGTGCAC	0.617																																						.											0								G	,	1,4405	2.1+/-5.4	0,1,2202	52.0	47.0	49.0		393,393	-7.4	0.5	10		49	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SEC24C	NM_004922.3,NM_198597.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	131/1095,131/1095	75519464	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9632			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.393G>A	10.37:g.75519464G>A			B4DZT4|Q8WV25	Silent	SNP	ENST00000339365.2	37	CCDS7332.1																																																																																				0.617	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
PTPRE	5791	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	10	129866455	129866455	+	Silent	SNP	C	C	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr10:129866455C>T	ENST00000254667.3	+	12	1191	c.912C>T	c.(910-912)ttC>ttT	p.F304F	PTPRE_ENST00000430713.2_3'UTR|PTPRE_ENST00000419012.2_Silent_p.F304F|PTPRE_ENST00000306042.5_Silent_p.F246F	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	304	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.F304F(1)|p.F246F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GGCCCGACTTCGGAGTGCCTT	0.622																																					Colon(52;977 1184 20575 41685)	.											2	Substitution - coding silent(2)	prostate(2)											58.0	56.0	57.0					10																	129866455		2203	4300	6503	SO:0001819	synonymous_variant	5791			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.912C>T	10.37:g.129866455C>T			Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1																																																																																				0.622	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
OR5F1	338674	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	55762021	55762021	+	Silent	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr11:55762021G>A	ENST00000278409.1	-	1	80	c.81C>T	c.(79-81)ctC>ctT	p.L27L		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	27					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AAAACAAAAAGAGGATAATCT	0.378																																						.											0													62.0	62.0	62.0					11																	55762021		2201	4296	6497	SO:0001819	synonymous_variant	338674			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.81C>T	11.37:g.55762021G>A			Q495D1|Q6IFB9	Silent	SNP	ENST00000278409.1	37	CCDS31515.1																																																																																				0.378	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
FOLR2	2350	hgsc.bcm.edu;mdanderson.org	37	11	71932761	71932761	+	Silent	SNP	C	C	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr11:71932761C>T	ENST00000298223.6	+	5	910	c.723C>T	c.(721-723)ctC>ctT	p.L241L	FOLR2_ENST00000449475.2_Silent_p.L237L|FOLR2_ENST00000454954.2_Silent_p.L200L	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	241					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	CTGGGGGTCTCCTGCTCAGTC	0.582																																						.											0													63.0	64.0	64.0					11																	71932761		2200	4293	6493	SO:0001819	synonymous_variant	2350			AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.723C>T	11.37:g.71932761C>T			Q05CA5|Q6GTE8	Silent	SNP	ENST00000298223.6	37	CCDS8212.1																																																																																				0.582	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
SORL1	6653	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	121444978	121444978	+	Missense_Mutation	SNP	G	G	C	rs200656084		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr11:121444978G>C	ENST00000260197.7	+	24	3495	c.3366G>C	c.(3364-3366)caG>caC	p.Q1122H	SORL1_ENST00000534286.1_5'Flank|SORL1_ENST00000525532.1_Missense_Mutation_p.Q66H|SORL1_ENST00000532694.1_5'Flank	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1122	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TGGACACCCAGTTTCGTTGCC	0.438																																						.											0													224.0	196.0	205.0					11																	121444978		2203	4299	6502	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3366G>C	11.37:g.121444978G>C	ENSP00000260197:p.Gln1122His		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.920831	0.73213	.	.	ENSG00000137642	ENST00000260197;ENST00000525532	D;D	0.95821	-3.82;-3.82	5.72	4.81	0.61882	.	0.058304	0.64402	D	0.000001	D	0.96494	0.8856	L	0.55834	1.745	0.80722	D	1	D	0.67145	0.996	D	0.68192	0.956	D	0.95860	0.8882	10	0.39692	T	0.17	.	14.7022	0.69164	0.0692:0.0:0.9308:0.0	.	1122	Q92673	SORL_HUMAN	H	1122;66	ENSP00000260197:Q1122H;ENSP00000434634:Q66H	ENSP00000260197:Q1122H	Q	+	3	2	SORL1	120950188	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.267000	0.78462	1.419000	0.47118	0.655000	0.94253	CAG		0.438	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
RBFOX3	146713	hgsc.bcm.edu	37	17	77111769	77111772	+	Frame_Shift_Del	DEL	TACT	TACT	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	TACT	TACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr17:77111769_77111772delTACT	ENST00000453134.2	-	5	538_541	c.26_29delAGTA	c.(25-30)cagtacfs	p.QY9fs	RBFOX3_ENST00000584778.1_Frame_Shift_Del_p.QY9fs|RBFOX3_ENST00000583458.1_Frame_Shift_Del_p.QY9fs|RBFOX3_ENST00000415831.1_Frame_Shift_Del_p.QY9fs|RBFOX3_ENST00000580155.1_Frame_Shift_Del_p.QY9fs|RBFOX3_ENST00000582043.1_Frame_Shift_Del_p.QY9fs			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	9	Pro-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Q9P(1)		endometrium(2)	2						CGGAGGGGGGTACTGGGCGGGGGG	0.681																																						.											1	Substitution - Missense(1)	skin(1)																																								SO:0001589	frameshift_variant	146713				CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.26_29delAGTA	17.37:g.77111769_77111772delTACT	ENSP00000393262:p.Gln9fs		B4DEG6|B4DF29	Frame_Shift_Del	DEL	ENST00000453134.2	37	CCDS45805.1																																																																																				0.681	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437658.1	NM_001082575	
ZNF136	7695	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	12296934	12296934	+	Missense_Mutation	SNP	A	A	C	rs536989294		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr19:12296934A>C	ENST00000343979.4	+	3	276	c.136A>C	c.(136-138)Aaa>Caa	p.K46Q	ZNF136_ENST00000398616.2_5'UTR	NM_003437.3	NP_003428.1	P52737	ZN136_HUMAN	zinc finger protein 136	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|biliary_tract(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	18						TTTAGGGAAAAAATGGAAGGA	0.343																																						.											0													37.0	36.0	36.0					19																	12296934		2202	4299	6501	SO:0001583	missense	7695			U09367	CCDS32916.1	19p13.2	2013-01-08	2006-06-13		ENSG00000196646	ENSG00000196646		"""Zinc fingers, C2H2-type"", ""-"""	12920	protein-coding gene	gene with protein product		604078	"""zinc finger protein 136 (clone pHZ-20)"""			7557990	Standard	NM_003437		Approved	pHZ-20	uc002mti.3	P52737	OTTHUMG00000156429	ENST00000343979.4:c.136A>C	19.37:g.12296934A>C	ENSP00000344162:p.Lys46Gln			Missense_Mutation	SNP	ENST00000343979.4	37	CCDS32916.1	.	.	.	.	.	.	.	.	.	.	A	9.230	1.035503	0.19590	.	.	ENSG00000196646	ENST00000425827;ENST00000343979;ENST00000418338	T;T;T	0.44881	1.79;5.69;0.91	1.93	0.672	0.17935	Krueppel-associated box (3);	.	.	.	.	T	0.17874	0.0429	N	0.16066	0.365	0.18873	N	0.999988	B	0.29862	0.259	B	0.19666	0.026	T	0.15178	-1.0446	9	0.18710	T	0.47	.	2.3354	0.04246	0.4933:0.3087:0.198:0.0	.	46	P52737	ZN136_HUMAN	Q	14;46;14	ENSP00000403707:K14Q;ENSP00000344162:K46Q;ENSP00000397176:K14Q	ENSP00000344162:K46Q	K	+	1	0	ZNF136	12157934	0.115000	0.22152	0.003000	0.11579	0.127000	0.20565	2.578000	0.46051	0.888000	0.36160	0.533000	0.62120	AAA		0.343	ZNF136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344151.2	NM_003437	
SLC7A10	56301	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	33702229	33702229	+	Silent	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr19:33702229G>A	ENST00000253188.4	-	7	1064	c.918C>T	c.(916-918)ttC>ttT	p.F306F		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	306					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GCTTCTCCCCGAAGGTCTGGG	0.622																																						.											0													60.0	56.0	57.0					19																	33702229		2203	4300	6503	SO:0001819	synonymous_variant	56301			AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.918C>T	19.37:g.33702229G>A			B2RE84	Silent	SNP	ENST00000253188.4	37	CCDS12431.1																																																																																				0.622	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
CTNNBL1	56259	broad.mit.edu;hgsc.bcm.edu	37	20	36470751	36470752	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:36470751_36470752insA	ENST00000361383.6	+	13	1439_1440	c.1322_1323insA	c.(1321-1326)ctaatgfs	p.M442fs	CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000373473.1_Frame_Shift_Ins_p.M255fs|CTNNBL1_ENST00000373469.1_Frame_Shift_Ins_p.M190fs|CTNNBL1_ENST00000405275.2_Frame_Shift_Ins_p.M415fs	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	442					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GTTGACAGACTAATGGAGTTGC	0.46																																					Ovarian(184;582 2038 3273 4106 42608)	.											0																																										SO:0001589	frameshift_variant	56259			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1324dupA	20.37:g.36470753_36470753dupA	ENSP00000355050:p.Met442fs		B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Frame_Shift_Ins	INS	ENST00000361383.6	37	CCDS13298.1																																																																																				0.460	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
NTSR1	4923	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	20	61386087	61386087	+	Silent	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:61386087G>T	ENST00000370501.3	+	2	1136	c.765G>T	c.(763-765)ctG>ctT	p.L255L		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	255					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TCTCGGTCCTGAACACCATCA	0.607																																					GBM(37;400 780 6403 19663 35669)	.											0													162.0	134.0	144.0					20																	61386087		2203	4300	6503	SO:0001819	synonymous_variant	4923				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.765G>T	20.37:g.61386087G>T			Q9H4H1|Q9H4T5	Silent	SNP	ENST00000370501.3	37	CCDS13502.1																																																																																				0.607	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080061.1		
DNAH6	1768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	84928427	84928427	+	Silent	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr2:84928427G>T	ENST00000237449.6	+	48	8033	c.8025G>T	c.(8023-8025)ctG>ctT	p.L2675L	DNAH6_ENST00000389394.3_Silent_p.L2675L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2675					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ATCTTTACCTGTCTATGCTGT	0.423																																						.											0													138.0	114.0	121.0					2																	84928427		692	1591	2283	SO:0001819	synonymous_variant	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8025G>T	2.37:g.84928427G>T			A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																				0.423	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CEP72	55722	hgsc.bcm.edu	37	5	612536	612536	+	Silent	SNP	C	C	T	rs545143344	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr5:612536C>T	ENST00000264935.5	+	1	150	c.60C>T	c.(58-60)ggC>ggT	p.G20G	CEP72_ENST00000444221.1_Silent_p.G20G|RP11-310P5.1_ENST00000506629.1_RNA	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	20					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			CGAAGAGCGGCTTAGGGCCTC	0.771													C|||	27	0.00539137	0.0197	0.0014	5008	,	,		5075	0.0		0.0	False		,,,				2504	0.0					.											0													4.0	4.0	4.0					5																	612536		1488	2785	4273	SO:0001819	synonymous_variant	55722			BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.60C>T	5.37:g.612536C>T			B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Silent	SNP	ENST00000264935.5	37	CCDS34126.1																																																																																				0.771	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365967.3	NM_018140	
LRRTM2	26045	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	138209476	138209476	+	Silent	SNP	T	T	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr5:138209476T>G	ENST00000274711.6	-	2	1152	c.774A>C	c.(772-774)ctA>ctC	p.L258L	LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000518825.1_Intron|LRRTM2_ENST00000521094.2_Intron|CTNNA1_ENST00000540387.1_5'Flank	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	258					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CAGTCAGGTCTAGCTTTTCTA	0.438																																						.											0													311.0	303.0	306.0					5																	138209476		1926	4143	6069	SO:0001819	synonymous_variant	26045			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.774A>C	5.37:g.138209476T>G			A0AVL3|A8K4U9|B7ZLN8|Q7L770	Silent	SNP	ENST00000274711.6	37	CCDS47272.1																																																																																				0.438	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374043.2		
GTF2H4	2968	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	6	30879492	30879492	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr6:30879492T>A	ENST00000259895.4	+	9	996	c.773T>A	c.(772-774)cTg>cAg	p.L258Q	GTF2H4_ENST00000539324.1_Missense_Mutation_p.L202Q|VARS2_ENST00000542001.1_5'Flank|VARS2_ENST00000321897.5_5'Flank|VARS2_ENST00000541562.1_5'Flank|VARS2_ENST00000416670.2_5'Flank|GTF2H4_ENST00000376316.2_Missense_Mutation_p.L258Q	NM_001517.4	NP_001508.1	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4, 52kDa	258					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	ATP-dependent DNA helicase activity (GO:0004003)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						AGTGATTCTCTGTTGAACTTC	0.498								Nucleotide excision repair (NER)																														.											0													117.0	109.0	111.0					6																	30879492		1511	2709	4220	SO:0001583	missense	2968			Y07595	CCDS34386.1	6p21.3	2012-11-05	2002-08-29		ENSG00000213780	ENSG00000213780		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4658	protein-coding gene	gene with protein product		601760	"""general transcription factor IIH, polypeptide 4 (52kD subunit)"""			9118947	Standard	NM_001517		Approved	TFB2, TFIIH, P52	uc003nsa.1	Q92759	OTTHUMG00000031043	ENST00000259895.4:c.773T>A	6.37:g.30879492T>A	ENSP00000259895:p.Leu258Gln		B4DTJ5|Q76KU4	Missense_Mutation	SNP	ENST00000259895.4	37	CCDS34386.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.925877	0.52759	.	.	ENSG00000213780	ENST00000259895;ENST00000539324;ENST00000376316	T;T;T	0.35789	1.29;1.29;1.29	5.42	5.42	0.78866	.	0.000000	0.56097	U	0.000028	T	0.07728	0.0194	N	0.05230	-0.09	0.80722	D	1	P;P;P;P	0.40681	0.727;0.528;0.528;0.528	B;B;B;B	0.37601	0.254;0.214;0.214;0.214	T	0.11991	-1.0565	10	0.10377	T	0.69	0.0	13.4215	0.61001	0.0:0.0:0.0:1.0	.	264;202;258;258	B4DNU0;B4DTJ5;Q53HH3;Q92759	.;.;.;TF2H4_HUMAN	Q	258;202;258	ENSP00000259895:L258Q;ENSP00000442700:L202Q;ENSP00000365493:L258Q	ENSP00000259895:L258Q	L	+	2	0	GTF2H4	30987471	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.389000	0.79806	2.050000	0.60909	0.533000	0.62120	CTG		0.498	GTF2H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076044.3	NM_001517	
TMEM151B	441151	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	6	44243233	44243233	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr6:44243233C>A	ENST00000451188.2	+	3	947	c.670C>A	c.(670-672)Ctg>Atg	p.L224M	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	224						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						GCTGGTGGGGCTGGAGGGCGC	0.687																																						.											0													12.0	20.0	17.0					6																	44243233		690	1585	2275	SO:0001583	missense	441151			AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.670C>A	6.37:g.44243233C>A	ENSP00000393161:p.Leu224Met		Q5T9V7	Missense_Mutation	SNP	ENST00000451188.2	37	CCDS47437.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.438141	0.62955	.	.	ENSG00000178233	ENST00000451188	.	.	.	4.74	3.87	0.44632	.	0.000000	0.64402	D	0.000001	T	0.71434	0.3339	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.76583	-0.2906	9	0.87932	D	0	.	11.7936	0.52084	0.0:0.8513:0.0:0.1487	.	224	Q8IW70	T151B_HUMAN	M	224	.	ENSP00000393161:L224M	L	+	1	2	TMEM151B	44351211	0.992000	0.36948	1.000000	0.80357	0.939000	0.58152	0.598000	0.24074	1.353000	0.45828	-0.368000	0.07277	CTG		0.687	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
AHCYL2	23382	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	129037098	129037098	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr7:129037098G>T	ENST00000325006.3	+	5	810	c.756G>T	c.(754-756)caG>caT	p.Q252H	AHCYL2_ENST00000446544.2_Missense_Mutation_p.Q251H|AHCYL2_ENST00000472554.1_3'UTR|AHCYL2_ENST00000490911.1_Missense_Mutation_p.Q149H|AHCYL2_ENST00000531335.2_Missense_Mutation_p.Q171H|AHCYL2_ENST00000474594.1_Missense_Mutation_p.Q149H|AHCYL2_ENST00000446212.1_Missense_Mutation_p.Q150H	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	252					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						TGGGGGCCCAGTGCCGATGGG	0.493																																					Pancreas(160;1736 1964 29875 40941 45605)	.											0													97.0	95.0	96.0					7																	129037098		2203	4300	6503	SO:0001583	missense	23382			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.756G>T	7.37:g.129037098G>T	ENSP00000315931:p.Gln252His		B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.812740|4.812740	0.90707|0.90707	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993|ENST00000466924	T;T;T;T;T;T;T|.	0.77620|.	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.08|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83977|0.83977	0.5371|0.5371	M|M	0.89214|0.89214	3.015|3.015	0.58432|0.58432	D|D	0.999997|0.999997	P;P;P;P;P|.	0.52577|.	0.878;0.878;0.954;0.878;0.943|.	P;P;P;P;P|.	0.57009|.	0.71;0.71;0.811;0.71;0.713|.	D|D	0.86448|0.86448	0.1771|0.1771	10|5	0.87932|.	D|.	0|.	-9.8208|-9.8208	17.8185|17.8185	0.88643|0.88643	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	149;150;252;149;251|.	B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2|.	.;.;SAHH3_HUMAN;.;.|.	H|I	252;251;171;149;150;149;150|159	ENSP00000315931:Q252H;ENSP00000413639:Q251H;ENSP00000431787:Q171H;ENSP00000420459:Q149H;ENSP00000405267:Q150H;ENSP00000420801:Q149H;ENSP00000419608:Q150H|.	ENSP00000315931:Q252H|.	Q|S	+|+	3|2	2|0	AHCYL2|AHCYL2	128824334|128824334	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.386000|5.386000	0.66238|0.66238	2.631000|2.631000	0.89168|0.89168	0.650000|0.650000	0.86243|0.86243	CAG|AGT		0.493	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79324154	79324154	+	Silent	SNP	A	A	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr9:79324154A>T	ENST00000376718.3	-	8	3159	c.3036T>A	c.(3034-3036)ccT>ccA	p.P1012P	PRUNE2_ENST00000428286.1_Silent_p.P653P	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1012					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GCAGTGACTGAGGAGGAATGT	0.443																																						.											0													121.0	94.0	102.0					9																	79324154		1568	3582	5150	SO:0001819	synonymous_variant	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3036T>A	9.37:g.79324154A>T			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	A	8.946	0.967023	0.18659	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.94	-4.91	0.03085	.	.	.	.	.	T	0.19927	0.0479	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27262	-1.0079	4	.	.	.	-1.3206	4.1748	0.10346	0.1906:0.3724:0.3387:0.0983	.	.	.	.	T	334	.	.	S	-	1	0	PRUNE2	78513974	.	.	0.000000	0.03702	0.268000	0.26511	.	.	-1.189000	0.02702	0.459000	0.35465	TCA		0.443	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TLE4	7091	hgsc.bcm.edu	37	9	82191095	82191095	+	Intron	DEL	A	A	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr9:82191095delA	ENST00000376552.2	+	4	1270				TLE4_ENST00000376520.4_Intron|TLE4_ENST00000455913.1_Intron|TLE4_ENST00000376534.4_Intron|TLE4_ENST00000265284.6_Intron|TLE4_ENST00000376544.3_Intron|TLE4_ENST00000376537.4_Intron	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						ACAAGCAGGTAAGTTATTTCT	0.328																																						.											0													106.0	102.0	103.0					9																	82191095		1813	4077	5890	SO:0001627	intron_variant	7091			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.252+3A>-	9.37:g.82191095delA			F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Splice_Site	DEL	ENST00000376552.2	37	CCDS43837.1																																																																																				0.328	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
RBM10	8241	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	47041266	47041266	+	Splice_Site	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chrX:47041266G>A	ENST00000377604.3	+	15	2435		c.e15+1		RBM10_ENST00000345781.6_Splice_Site|RBM10_ENST00000329236.7_Splice_Site	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10						3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						AGCCAGTACCGTGAGTAGCCA	0.592																																					Melanoma(171;120 2705 19495 39241)	.											0													44.0	39.0	41.0					X																	47041266		2203	4300	6503	SO:0001630	splice_region_variant	8241			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1693+1G>A	X.37:g.47041266G>A			C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Splice_Site	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.293838	0.60086	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1129	0.53850	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM10	46926210	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.386000	0.66238	2.347000	0.79759	0.525000	0.51046	.		0.592	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	Intron
NCALD	83988	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	8	102705065	102705065	+	Silent	SNP	C	C	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr8:102705065C>T	ENST00000311028.3	-	6	816	c.438G>A	c.(436-438)gaG>gaA	p.E146E	NCALD_ENST00000395923.1_Silent_p.E146E|NCALD_ENST00000521599.1_Silent_p.E146E|NCALD_ENST00000519508.2_Silent_p.E146E|NCALD_ENST00000522951.1_Silent_p.E146E|NCALD_ENST00000220931.6_Silent_p.E146E	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	146	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			CTGTTCTTTTCTCTGGGGTTG	0.493																																						.											0													166.0	155.0	159.0					8																	102705065		2203	4300	6503	SO:0001819	synonymous_variant	83988			AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.438G>A	8.37:g.102705065C>T			P29554|Q8IYC3|Q9H0W2	Silent	SNP	ENST00000311028.3	37	CCDS6292.1																																																																																				0.493	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2		
CHIA	27159	broad.mit.edu;bcgsc.ca	37	1	111857960	111857960	+	Missense_Mutation	SNP	G	G	A	rs140031055		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:111857960G>A	ENST00000369740.1	+	6	486	c.383G>A	c.(382-384)cGc>cAc	p.R128H	CHIA_ENST00000343320.6_Missense_Mutation_p.R128H|CHIA_ENST00000451398.2_5'UTR|CHIA_ENST00000483391.1_Intron|CHIA_ENST00000430615.1_Missense_Mutation_p.R20H|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000353665.6_Intron	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	128					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		AAATTCCTGCGCCAGTATGAG	0.547																																						.											0								G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	110.0	106.0	107.0		59,383	1.8	0.9	1	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CHIA	NM_021797.2,NM_201653.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	20/369,128/477	111857960	1,13005	2203	4300	6503	SO:0001583	missense	27159			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.383G>A	1.37:g.111857960G>A	ENSP00000358755:p.Arg128His		Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	ENST00000369740.1	37	CCDS41368.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039601	0.55003	0.0	1.16E-4	ENSG00000134216	ENST00000422815;ENST00000369740;ENST00000343320;ENST00000430615	T;T;T;T	0.07114	3.22;3.22;3.22;3.22	4.72	1.77	0.24775	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.159070	0.41194	N	0.000933	T	0.05547	0.0146	M	0.79343	2.45	0.80722	D	1	P	0.38642	0.641	B	0.38296	0.27	T	0.10268	-1.0637	10	0.62326	D	0.03	-14.2335	8.9773	0.35944	0.2554:0.0:0.7446:0.0	.	128	Q9BZP6	CHIA_HUMAN	H	72;128;128;20	ENSP00000387671:R72H;ENSP00000358755:R128H;ENSP00000341828:R128H;ENSP00000391132:R20H	ENSP00000341828:R128H	R	+	2	0	CHIA	111659483	0.995000	0.38212	0.854000	0.33618	0.835000	0.47333	1.857000	0.39399	0.160000	0.19432	-0.123000	0.14984	CGC		0.547	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
NOTCH2	4853	broad.mit.edu	37	1	120539668	120539668	+	Missense_Mutation	SNP	T	T	A	rs200464440		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:120539668T>A	ENST00000256646.2	-	4	922	c.703A>T	c.(703-705)Acc>Tcc	p.T235S	NOTCH2_ENST00000602566.1_Missense_Mutation_p.T196S	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	235	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCCGACAGGTGCCTCCATTG	0.572			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													50.0	40.0	43.0					1																	120539668		2203	4299	6502	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.703A>T	1.37:g.120539668T>A	ENSP00000256646:p.Thr235Ser		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508758	0.85282	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	T	0.33438	1.41	5.83	5.83	0.93111	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38897	U	0.001527	T	0.42471	0.1204	L	0.58510	1.815	0.80722	D	1	P;D;D	0.71674	0.924;0.998;0.965	P;D;P	0.77004	0.585;0.989;0.834	T	0.25082	-1.0142	10	0.41790	T	0.15	.	15.3661	0.74523	0.0:0.0:0.0:1.0	.	196;235;235	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	S	235;196;208;196	ENSP00000256646:T235S	ENSP00000256646:T235S	T	-	1	0	NOTCH2	120341191	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.185000	0.72013	2.216000	0.71823	0.477000	0.44152	ACC		0.572	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
POLR3C	10623	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	145594109	145594109	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:145594109G>T	ENST00000334163.3	-	14	1613	c.1453C>A	c.(1453-1455)Caa>Aaa	p.Q485K	POLR3C_ENST00000369294.1_Intron	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	485					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			TCTATTTCTTGTAACTGTGCT	0.438																																						.											0													241.0	212.0	222.0					1																	145594109		2203	4300	6503	SO:0001583	missense	10623			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.1453C>A	1.37:g.145594109G>T	ENSP00000334564:p.Gln485Lys		O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	37	CCDS921.1	.	.	.	.	.	.	.	.	.	.	G	6.912	0.537952	0.13188	.	.	ENSG00000186141	ENST00000334163	T	0.40756	1.02	5.63	5.63	0.86233	.	0.124751	0.56097	D	0.000040	T	0.12944	0.0314	N	0.22421	0.69	0.80722	D	1	B;B	0.30326	0.2;0.276	B;B	0.22601	0.021;0.04	T	0.05068	-1.0908	10	0.08599	T	0.76	-14.2576	15.1849	0.72993	0.0:0.0:1.0:0.0	.	485;485	Q9BUI4;Q53F76	RPC3_HUMAN;.	K	485	ENSP00000334564:Q485K	ENSP00000334564:Q485K	Q	-	1	0	POLR3C	144305466	1.000000	0.71417	0.513000	0.27749	0.769000	0.43574	4.916000	0.63362	2.665000	0.90641	0.563000	0.77884	CAA		0.438	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
WNT5B	81029	broad.mit.edu;bcgsc.ca	37	12	1742019	1742019	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr12:1742019G>A	ENST00000397196.2	+	3	508	c.276G>A	c.(274-276)tgG>tgA	p.W92*	WNT5B_ENST00000537031.1_Nonsense_Mutation_p.W92*|WNT5B_ENST00000542408.1_Nonsense_Mutation_p.W92*|WNT5B_ENST00000310594.3_Nonsense_Mutation_p.W92*	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	92					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			AGCGGCGGTGGAATTGCAGCA	0.567																																						.											0													61.0	62.0	61.0					12																	1742019		2203	4300	6503	SO:0001587	stop_gained	81029			AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.276G>A	12.37:g.1742019G>A	ENSP00000380379:p.Trp92*		A8K315|D3DUP9|Q96S49|Q9BV04	Nonsense_Mutation	SNP	ENST00000397196.2	37	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	G	41	8.843801	0.98974	.	.	ENSG00000111186	ENST00000539198;ENST00000545811;ENST00000537031;ENST00000310594;ENST00000397196;ENST00000543071;ENST00000542408	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.931	0.92566	0.0:0.0:1.0:0.0	.	.	.	.	X	92	.	ENSP00000308887:W92X	W	+	3	0	WNT5B	1612280	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.751000	0.98889	2.540000	0.85666	0.644000	0.83932	TGG		0.567	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206747.2		
VAMP1	6843	broad.mit.edu	37	12	6574085	6574085	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr12:6574085A>G	ENST00000396308.3	-	4	456	c.311T>C	c.(310-312)aTc>aCc	p.I104T	VAMP1_ENST00000400911.3_Missense_Mutation_p.I104T|VAMP1_ENST00000544432.1_5'UTR|VAMP1_ENST00000361716.3_Missense_Mutation_p.I104T|TAPBPL_ENST00000545700.1_Intron|VAMP1_ENST00000535180.1_Missense_Mutation_p.I104T	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)	104					neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	GATGGCACAGATGGCTCCCAG	0.488																																						.											0													228.0	197.0	207.0					12																	6574085		2203	4300	6503	SO:0001583	missense	6843				CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.311T>C	12.37:g.6574085A>G	ENSP00000379602:p.Ile104Thr		A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Missense_Mutation	SNP	ENST00000396308.3	37	CCDS41740.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.020662	0.75275	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000396308;ENST00000396943	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.73	5.73	0.89815	Synaptobrevin (2);	0.057713	0.64402	D	0.000002	T	0.57902	0.2085	M	0.78456	2.415	0.80722	D	1	P;B;P	0.46512	0.782;0.283;0.879	P;B;P	0.46076	0.503;0.324;0.503	T	0.65364	-0.6186	10	0.87932	D	0	.	16.0174	0.80450	1.0:0.0:0.0:0.0	.	104;104;104	P23763-3;P23763;P23763-2	.;VAMP1_HUMAN;.	T	104	ENSP00000383702:I104T;ENSP00000355122:I104T;ENSP00000444181:I104T;ENSP00000379602:I104T	ENSP00000355122:I104T	I	-	2	0	VAMP1	6444346	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.186000	0.69663	0.533000	0.62120	ATC		0.488	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		
STRAP	11171	broad.mit.edu	37	12	16047015	16047015	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr12:16047015delA	ENST00000419869.2	+	5	751	c.438delA	c.(436-438)atafs	p.I146fs	STRAP_ENST00000538352.1_Frame_Shift_Del_p.I52fs|STRAP_ENST00000025399.6_Frame_Shift_Del_p.I159fs	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	146					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				CTTCTGGTATAAAAAAAGCTC	0.294																																						.											0													103.0	116.0	112.0					12																	16047015		2203	4300	6503	SO:0001589	frameshift_variant	11171			AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.438delA	12.37:g.16047015delA	ENSP00000392270:p.Ile146fs		B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Frame_Shift_Del	DEL	ENST00000419869.2	37	CCDS8676.1																																																																																				0.294	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401114.1	NM_007178	
ASIC1	41	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	50472361	50472361	+	Splice_Site	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr12:50472361G>A	ENST00000447966.2	+	6	1223		c.e6+1		ASIC1_ENST00000552438.1_Splice_Site|ASIC1_ENST00000228468.4_Splice_Site	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1						associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	CACATGCCAGGTCAGGCCTGG	0.597																																						.											0													118.0	118.0	118.0					12																	50472361		2203	4300	6503	SO:0001630	splice_region_variant	41			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.994+1G>A	12.37:g.50472361G>A			A3KN86|E5KBL7|P78349|Q96CV2	Splice_Site	SNP	ENST00000447966.2	37	CCDS44876.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935661	0.73442	.	.	ENSG00000110881	ENST00000228468;ENST00000447966;ENST00000453327;ENST00000552438	.	.	.	3.82	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0278	0.86452	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACCN2	48758628	1.000000	0.71417	0.996000	0.52242	0.924000	0.55760	9.584000	0.98220	2.414000	0.81942	0.462000	0.41574	.		0.597	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039	Intron
SOS2	6655	broad.mit.edu;mdanderson.org;bcgsc.ca	37	14	50619875	50619875	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr14:50619875G>A	ENST00000216373.5	-	13	2348	c.2074C>T	c.(2074-2076)Cgg>Tgg	p.R692W	SOS2_ENST00000555794.1_5'Flank|SOS2_ENST00000543680.1_Missense_Mutation_p.R659W	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	692	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					ACCCAATGCCGAAATACATTT	0.313																																						.											0													90.0	94.0	93.0					14																	50619875		2202	4297	6499	SO:0001583	missense	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2074C>T	14.37:g.50619875G>A	ENSP00000216373:p.Arg692Trp		B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017239	0.93404	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.52754	0.65;0.65	5.96	5.96	0.96718	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.78207	0.4247	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.82277	-0.0537	10	0.87932	D	0	.	20.4192	0.99033	0.0:0.0:1.0:0.0	.	659;692	B7ZKT6;Q07890	.;SOS2_HUMAN	W	692;659	ENSP00000216373:R692W;ENSP00000445328:R659W	ENSP00000216373:R692W	R	-	1	2	SOS2	49689625	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.831000	0.97527	0.650000	0.86243	CGG		0.313	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
UNC13C	440279	broad.mit.edu	37	15	54557616	54557616	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr15:54557616T>C	ENST00000260323.11	+	9	3740	c.3740T>C	c.(3739-3741)gTt>gCt	p.V1247A	UNC13C_ENST00000537900.1_Missense_Mutation_p.V1245A|UNC13C_ENST00000545554.1_Missense_Mutation_p.V1247A	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1247	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TATGTTACAGTTCAAGTTGGA	0.328																																						.											0													56.0	52.0	53.0					15																	54557616		1802	4065	5867	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3740T>C	15.37:g.54557616T>C	ENSP00000260323:p.Val1247Ala		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241956	0.79912	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.73897	-0.79;-0.79;-0.79	5.04	5.04	0.67666	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	L	0.54908	1.71	0.58432	D	0.999993	P;D	0.76494	0.833;0.999	P;D	0.87578	0.83;0.998	T	0.83086	-0.0135	10	0.48119	T	0.1	.	14.2363	0.65929	0.0:0.0:0.0:1.0	.	1247;1247	F5H090;Q8NB66	.;UN13C_HUMAN	A	1247;1247;1245	ENSP00000260323:V1247A;ENSP00000438156:V1247A;ENSP00000442569:V1245A	ENSP00000260323:V1247A	V	+	2	0	UNC13C	52344908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.982000	0.88131	2.011000	0.59026	0.482000	0.46254	GTT		0.328	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
CEACAM5	1048	broad.mit.edu	37	19	42219764	42219764	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr19:42219764A>G	ENST00000221992.6	+	4	1013	c.899A>G	c.(898-900)cAa>cGa	p.Q300R	CEACAM5_ENST00000398599.4_Missense_Mutation_p.Q300R|CEACAM5_ENST00000405816.1_Missense_Mutation_p.Q300R|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	300	Ig-like 3.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		TATACGTGCCAAGCCCATAAC	0.473																																						.											0													128.0	107.0	114.0					19																	42219764		2203	4300	6503	SO:0001583	missense	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.899A>G	19.37:g.42219764A>G	ENSP00000221992:p.Gln300Arg		H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	-	1.424	-0.572155	0.03882	.	.	ENSG00000105388	ENST00000221992;ENST00000405816	T;T	0.10763	2.84;2.84	3.12	0.291	0.15732	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07503	0.0189	N	0.16037	0.36	0.09310	N	1	B;B	0.21688	0.027;0.059	B;B	0.36335	0.161;0.222	T	0.49560	-0.8927	9	0.25106	T	0.35	.	6.413	0.21702	0.5553:0.0:0.0:0.4447	.	300;300	P06731;Q53G30	CEAM5_HUMAN;.	R	300	ENSP00000221992:Q300R;ENSP00000385072:Q300R	ENSP00000221992:Q300R	Q	+	2	0	CEACAM5	46911604	0.000000	0.05858	0.009000	0.14445	0.278000	0.26855	-1.272000	0.02826	-0.559000	0.06110	0.172000	0.16884	CAA		0.473	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
LCT	3938	broad.mit.edu	37	2	136555689	136555689	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr2:136555689G>A	ENST00000264162.2	-	13	4896	c.4886C>T	c.(4885-4887)gCa>gTa	p.A1629V		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1629	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AATAGGATGTGCAAACCAGCC	0.567											OREG0014998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													99.0	90.0	93.0					2																	136555689		2203	4300	6503	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4886C>T	2.37:g.136555689G>A	ENSP00000264162:p.Ala1629Val	1626	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	33	5.275201	0.95459	.	.	ENSG00000115850	ENST00000264162	T	0.56275	0.47	5.76	5.76	0.90799	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.051426	0.85682	D	0.000000	T	0.65512	0.2698	M	0.80422	2.495	0.80722	D	1	P	0.38535	0.635	B	0.43536	0.423	T	0.69312	-0.5178	10	0.72032	D	0.01	-9.126	19.9759	0.97304	0.0:0.0:1.0:0.0	.	1629	P09848	LPH_HUMAN	V	1629	ENSP00000264162:A1629V	ENSP00000264162:A1629V	A	-	2	0	LCT	136272159	1.000000	0.71417	0.997000	0.53966	0.886000	0.51366	9.859000	0.99545	2.713000	0.92767	0.655000	0.94253	GCA		0.567	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
FZD7	8324	broad.mit.edu	37	2	202901005	202901005	+	Silent	SNP	C	C	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr2:202901005C>T	ENST00000286201.1	+	1	1696	c.1635C>T	c.(1633-1635)ggC>ggT	p.G545G	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	545					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TCACCACTGGCTTCTGGATCT	0.637											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													56.0	58.0	57.0					2																	202901005		2203	4299	6502	SO:0001819	synonymous_variant	8324			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1635C>T	2.37:g.202901005C>T		2133	O94816|Q53S59|Q96B74	Silent	SNP	ENST00000286201.1	37	CCDS2351.1																																																																																				0.637	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																						.											15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)											64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																				0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
CP	1356	broad.mit.edu	37	3	148939579	148939579	+	Start_Codon_Del	DEL	T	T	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr3:148939579delT	ENST00000264613.6	-	0	263					NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)						cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	AAAATCTTCATTTTTTTCCCC	0.343																																						.											0													49.0	49.0	49.0					3																	148939579		2203	4299	6502	SO:0001582	initiator_codon_variant	1356			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563		3.37:g.148939579delT			Q14063|Q2PP18|Q9UKS4	Nonsense_Mutation	DEL	ENST00000264613.6	37	CCDS3141.1																																																																																				0.343	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
WDFY3	23001	broad.mit.edu	37	4	85630103	85630103	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr4:85630103A>G	ENST00000295888.4	-	53	8583	c.8176T>C	c.(8176-8178)Tat>Cat	p.Y2726H	WDFY3_ENST00000322366.6_Missense_Mutation_p.Y2709H	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2726	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAGACAGGATACTGCATGAGA	0.338																																						.											0													102.0	104.0	103.0					4																	85630103		2203	4300	6503	SO:0001583	missense	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8176T>C	4.37:g.85630103A>G	ENSP00000295888:p.Tyr2726His		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.629736	0.87660	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	D;D;D	0.90955	-2.76;-2.76;-2.76	5.41	5.41	0.78517	BEACH domain (4);	0.114190	0.64402	D	0.000008	D	0.94456	0.8216	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.94834	0.7999	10	0.66056	D	0.02	.	15.6304	0.76904	1.0:0.0:0.0:0.0	.	2726	Q8IZQ1	WDFY3_HUMAN	H	2709;2726;329	ENSP00000318466:Y2709H;ENSP00000295888:Y2726H;ENSP00000424987:Y329H	ENSP00000295888:Y2726H	Y	-	1	0	WDFY3	85849127	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.083000	0.94067	2.279000	0.76181	0.528000	0.53228	TAT		0.338	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
RXFP3	51289	broad.mit.edu	37	5	33937368	33937368	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr5:33937368G>A	ENST00000330120.3	+	1	878	c.523G>A	c.(523-525)Gcc>Acc	p.A175T		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	175					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CTTCCTCACTGCCATGAGTGT	0.617																																						.											0													92.0	88.0	89.0					5																	33937368		2203	4300	6503	SO:0001583	missense	51289			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.523G>A	5.37:g.33937368G>A	ENSP00000328708:p.Ala175Thr		Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315132	0.81358	.	.	ENSG00000182631	ENST00000330120	T	0.19806	2.12	5.53	1.51	0.23008	GPCR, rhodopsin-like superfamily (1);	0.161807	0.53938	D	0.000044	T	0.42787	0.1218	M	0.85462	2.755	0.41941	D	0.990619	P	0.38250	0.624	P	0.52758	0.708	T	0.33879	-0.9851	10	0.37606	T	0.19	-20.1582	13.2994	0.60315	0.0:0.0959:0.7683:0.1358	.	175	Q9NSD7	RL3R1_HUMAN	T	175	ENSP00000328708:A175T	ENSP00000328708:A175T	A	+	1	0	RXFP3	33973125	1.000000	0.71417	0.685000	0.30070	0.955000	0.61496	3.155000	0.50700	-0.026000	0.13895	0.650000	0.86243	GCC		0.617	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	GCC	GCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022					.											2	Deletion - In frame(2)	central_nervous_system(2)							,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del		Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																				0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
DDX56	54606	broad.mit.edu	37	7	44611269	44611269	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr7:44611269A>G	ENST00000258772.5	-	6	818	c.712T>C	c.(712-714)Tgt>Cgt	p.C238R	DDX56_ENST00000431640.1_Missense_Mutation_p.C238R|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	238	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						TCAGTCTCACAGACCACCTGA	0.522																																						.											0													81.0	70.0	73.0					7																	44611269		2203	4300	6503	SO:0001583	missense	54606			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.712T>C	7.37:g.44611269A>G	ENSP00000258772:p.Cys238Arg		A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	23.3	4.403569	0.83230	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.04119	3.7;3.75	5.82	5.82	0.92795	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.19525	0.0469	M	0.76938	2.355	0.80722	D	1	D;D	0.69078	0.985;0.997	D;P	0.64237	0.923;0.887	T	0.00391	-1.1769	10	0.41790	T	0.15	-11.8194	14.1208	0.65186	1.0:0.0:0.0:0.0	.	238;238	C9JV95;Q9NY93	.;DDX56_HUMAN	R	238	ENSP00000258772:C238R;ENSP00000393488:C238R	ENSP00000258772:C238R	C	-	1	0	DDX56	44577794	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.718000	0.74713	2.214000	0.71695	0.460000	0.39030	TGT		0.522	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
ASB4	51666	broad.mit.edu	37	7	95166910	95166910	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr7:95166910T>C	ENST00000325885.5	+	5	1191	c.1120T>C	c.(1120-1122)Ttt>Ctt	p.F374L		NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	374	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			CCACTCTCTCTTTACTGTGTG	0.398																																						.											0													166.0	156.0	160.0					7																	95166910		2203	4300	6503	SO:0001583	missense	51666			AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.1120T>C	7.37:g.95166910T>C	ENSP00000321388:p.Phe374Leu		A4D1H6|O14586|Q14D68|Q8TBT2	Missense_Mutation	SNP	ENST00000325885.5	37	CCDS5641.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518046	0.64634	.	.	ENSG00000005981	ENST00000325885	T	0.27256	1.68	5.05	5.05	0.67936	.	0.120873	0.64402	D	0.000010	T	0.32436	0.0829	L	0.39514	1.22	0.80722	D	1	P	0.51147	0.942	P	0.51016	0.656	T	0.03221	-1.1059	10	0.46703	T	0.11	-31.2114	15.1364	0.72569	0.0:0.0:0.0:1.0	.	374	Q9Y574	ASB4_HUMAN	L	374	ENSP00000321388:F374L	ENSP00000321388:F374L	F	+	1	0	ASB4	95004846	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.071000	0.71229	2.039000	0.60335	0.533000	0.62120	TTT		0.398	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2	NM_016116	
EBF2	64641	broad.mit.edu	37	8	25744302	25744302	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr8:25744302G>T	ENST00000520164.1	-	10	1515	c.978C>A	c.(976-978)tgC>tgA	p.C326*	EBF2_ENST00000535548.1_Nonsense_Mutation_p.C57*|EBF2_ENST00000408929.3_Nonsense_Mutation_p.C178*	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	326	IPT/TIG.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GGGCTCCTTTGCAGAACTGTT	0.493																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											0													100.0	96.0	98.0					8																	25744302		1860	4106	5966	SO:0001587	stop_gained	64641			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.978C>A	8.37:g.25744302G>T	ENSP00000430241:p.Cys326*		A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Nonsense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	G	41	9.069919	0.99055	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.803	19.5831	0.95478	0.0:0.0:1.0:0.0	.	.	.	.	X	326;178;57	.	ENSP00000386178:C178X	C	-	3	2	EBF2	25800219	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.479000	0.66813	2.641000	0.89580	0.563000	0.77884	TGC		0.493	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
RDH10	157506	broad.mit.edu	37	8	74235228	74235228	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr8:74235228G>A	ENST00000240285.5	+	6	1661	c.983G>A	c.(982-984)aGa>aAa	p.R328K	RP11-434I12.2_ENST00000514599.1_RNA|RP11-434I12.2_ENST00000517475.1_RNA|RDH10_ENST00000519380.1_Missense_Mutation_p.R163K	NM_172037.4	NP_742034.1	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10 (all-trans)	328					bud elongation involved in lung branching (GO:0060449)|ear development (GO:0043583)|embryonic camera-type eye development (GO:0031076)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|gonad development (GO:0008406)|in utero embryonic development (GO:0001701)|metanephros development (GO:0001656)|neural crest cell development (GO:0014032)|nose development (GO:0043584)|phototransduction, visible light (GO:0007603)|primary lung bud formation (GO:0060431)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	11	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			ATTGCTCAAAGAAAGCAAGCC	0.383																																						.											0													65.0	59.0	61.0					8																	74235228		2203	4300	6503	SO:0001583	missense	157506			AF456765	CCDS6213.1	8q21.11	2011-09-20			ENSG00000121039	ENSG00000121039	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	19975	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 4"""	607599				12407145, 19027726	Standard	NM_172037		Approved	SDR16C4	uc003xzi.3	Q8IZV5	OTTHUMG00000164492	ENST00000240285.5:c.983G>A	8.37:g.74235228G>A	ENSP00000240285:p.Arg328Lys			Missense_Mutation	SNP	ENST00000240285.5	37	CCDS6213.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600327	0.28534	.	.	ENSG00000121039	ENST00000240285;ENST00000519380	D;T	0.83837	-1.77;0.03	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.69602	0.3129	N	0.16201	0.385	0.49389	D	0.999784	B	0.18166	0.026	B	0.12837	0.008	T	0.65541	-0.6143	10	0.02654	T	1	.	19.7069	0.96076	0.0:0.0:1.0:0.0	.	328	Q8IZV5	RDH10_HUMAN	K	328;163	ENSP00000240285:R328K;ENSP00000428132:R163K	ENSP00000240285:R328K	R	+	2	0	RDH10	74397782	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	7.743000	0.85020	2.894000	0.99253	0.591000	0.81541	AGA		0.383	RDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378982.1		
PTPN3	5774	broad.mit.edu	37	9	112219611	112219612	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr9:112219611_112219612delAT	ENST00000374541.2	-	3	310_311	c.206_207delAT	c.(205-207)tatfs	p.Y69fs	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	69	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GTAAACCAAAATATTCCTTTTC	0.401																																						.											0																																										SO:0001589	frameshift_variant	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.206_207delAT	9.37:g.112219613_112219614delAT	ENSP00000363667:p.Tyr69fs		A0AUW9|E7EN99|E9PGU7	Frame_Shift_Del	DEL	ENST00000374541.2	37	CCDS6776.1																																																																																				0.401	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
USP9X	8239	broad.mit.edu	37	X	41010226	41010226	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chrX:41010226G>T	ENST00000324545.8	+	13	2312	c.1679G>T	c.(1678-1680)cGc>cTc	p.R560L	USP9X_ENST00000378308.2_Missense_Mutation_p.R560L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	560					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GAAGAACTTCGCACAAATGAC	0.338																																					Ovarian(172;1807 2695 35459 49286)	.											0													49.0	44.0	46.0					X																	41010226		2165	4277	6442	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1679G>T	X.37:g.41010226G>T	ENSP00000316357:p.Arg560Leu		O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281499	0.59758	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.02974	4.1;4.09	5.19	5.19	0.71726	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.04952	0.0133	L	0.31664	0.95	0.80722	D	1	P;P	0.48640	0.913;0.858	P;B	0.47044	0.535;0.334	T	0.55952	-0.8059	10	0.37606	T	0.19	.	17.8627	0.88786	0.0:0.0:1.0:0.0	.	560;560	Q93008-1;Q93008	.;USP9X_HUMAN	L	560	ENSP00000367558:R560L;ENSP00000316357:R560L	ENSP00000316357:R560L	R	+	2	0	USP9X	40895170	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.357000	0.97099	2.151000	0.67156	0.468000	0.43344	CGC		0.338	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
MLLT6	4302	broad.mit.edu	37	17	36873792	36873793	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr17:36873792_36873793insC	ENST00000325718.7	+	11	1850_1851	c.1759_1760insC	c.(1759-1761)gccfs	p.A587fs	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	587					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					AGGGACCTCGGCCCTGCCCCGC	0.663			T	MLL	AL																																	.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	0																																										SO:0001589	frameshift_variant	4302				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.1762dupC	17.37:g.36873795_36873795dupC	ENSP00000316426:p.Ala587fs		Q59F28|Q96IU3|Q9H5F6|Q9UF49	Frame_Shift_Ins	INS	ENST00000325718.7	37	CCDS11327.1																																																																																				0.663	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
BIRC6	57448	ucsc.edu	37	2	32617105	32617105	+	Splice_Site	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr2:32617105A>G	ENST00000421745.2	+	5	973		c.e5-1			NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6						apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GTTTACTTTTAGATCACTGAT	0.378																																					Pancreas(94;175 1509 16028 18060 45422)	.											0													48.0	46.0	47.0					2																	32617105		2199	4298	6497	SO:0001630	splice_region_variant	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.840-1A>G	2.37:g.32617105A>G			Q9ULD1	Splice_Site	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089774	0.76756	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3766	0.83401	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BIRC6	32470609	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.180000	0.94867	2.263000	0.75096	0.533000	0.62120	.		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	Intron
CRAMP1L	57585	ucsc.edu	37	16	1706144	1706144	+	Silent	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr16:1706144A>G	ENST00000397412.3	+	10	1485	c.1386A>G	c.(1384-1386)aaA>aaG	p.K462K	CRAMP1L_ENST00000436138.3_Silent_p.K459K|LA16c-431H6.6_ENST00000454337.1_Intron|CRAMP1L_ENST00000262317.4_Intron|CRAMP1L_ENST00000293925.5_Silent_p.K462K			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	462						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						GCCAGGTGAAATGCCCGCGGA	0.726																																						.											0													8.0	11.0	11.0					16																	1706144		1859	4028	5887	SO:0001819	synonymous_variant	57585			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.1386A>G	16.37:g.1706144A>G			A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	ENST00000397412.3	37	CCDS10440.2																																																																																				0.726	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
HELZ2	85441	ucsc.edu	37	20	62196705	62196705	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:62196705A>G	ENST00000467148.1	-	8	3539	c.3470T>C	c.(3469-3471)gTc>gCc	p.V1157A	HELZ2_ENST00000427522.2_Missense_Mutation_p.V588A	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1157					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCGGCCCCTGACCTGGATGGG	0.711																																						.											0													9.0	10.0	9.0					20																	62196705		2164	4260	6424	SO:0001583	missense	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3470T>C	20.37:g.62196705A>G	ENSP00000417401:p.Val1157Ala		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	A	11.49	1.653072	0.29336	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.28069	1.63;1.63	4.63	4.63	0.57726	.	0.946184	0.08776	N	0.895455	T	0.31638	0.0803	L	0.44542	1.39	0.33592	D	0.601212	P;P	0.42692	0.682;0.787	B;B	0.39258	0.218;0.295	T	0.45644	-0.9247	10	0.87932	D	0	-24.4941	14.036	0.64644	1.0:0.0:0.0:0.0	.	1157;588	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	A	588;1157	ENSP00000393257:V588A;ENSP00000417401:V1157A	ENSP00000393257:V588A	V	-	2	0	RP4-697K14.7	61667149	1.000000	0.71417	0.505000	0.27651	0.119000	0.20118	5.905000	0.69893	1.724000	0.51502	0.402000	0.26972	GTC		0.711	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
SMPD1	6609	ucsc.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V|SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																						.											0													11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	6609			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	11.37:g.6411941C>T	ENSP00000340409:p.Ala38Val		A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
ANKRD30BL	554226	mdanderson.org	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A			B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
DPYS	1807	mdanderson.org	37	8	105478933	105478933	+	Silent	SNP	G	G	A	rs2298840	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr8:105478933G>A	ENST00000351513.2	-	1	348	c.216C>T	c.(214-216)ttC>ttT	p.F72F		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	72					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CCATGAAGGGGAACTGCATGT	0.736													G|||	1160	0.231629	0.2867	0.2133	5008	,	,		9267	0.3085		0.175	False		,,,				2504	0.1493					.											0								G		728,2942		64,600,1171	18.0	11.0	14.0		216	3.0	1.0	8	dbSNP_100	14	1026,5972		73,880,2546	no	coding-synonymous	DPYS	NM_001385.2		137,1480,3717	AA,AG,GG		14.6613,19.8365,16.4417		72/520	105478933	1754,8914	1835	3499	5334	SO:0001819	synonymous_variant	1807			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.216C>T	8.37:g.105478933G>A				Silent	SNP	ENST00000351513.2	37	CCDS6302.1																																																																																				0.736	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
F2RL3	9002	mdanderson.org	37	19	17000632	17000632	+	Missense_Mutation	SNP	G	G	A	rs773902	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr19:17000632G>A	ENST00000248076.3	+	2	688	c.358G>A	c.(358-360)Gct>Act	p.A120T	F2RL3_ENST00000599210.1_3'UTR	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	120			A -> T (in dbSNP:rs773902). {ECO:0000269|PubMed:9618465, ECO:0000269|PubMed:9716134, ECO:0000269|PubMed:9722561}.		blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						GAACCTCGCGGCTGCTGACCT	0.741													G|||	1713	0.342053	0.615	0.2911	5008	,	,		14611	0.2371		0.2058	False		,,,				2504	0.2577					.											0								G	THR/ALA	2354,1990		672,1010,490	11.0	10.0	11.0		358	0.9	0.0	19	dbSNP_86	11	1691,6781		190,1311,2735	yes	missense	F2RL3	NM_003950.2	58	862,2321,3225	AA,AG,GG		19.9599,45.8103,31.5621	benign	120/386	17000632	4045,8771	2172	4236	6408	SO:0001583	missense	9002			AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0		ENST00000248076.3:c.358G>A	19.37:g.17000632G>A	ENSP00000248076:p.Ala120Thr		O76067|Q6DK42	Missense_Mutation	SNP	ENST00000248076.3	37	CCDS12350.1	647	0.29624542124542125	263	0.5345528455284553	108	0.2983425414364641	130	0.22727272727272727	146	0.19261213720316622	G	8.642	0.896247	0.17686	0.541897	0.199599	ENSG00000127533	ENST00000248076	T	0.37752	1.18	4.3	0.917	0.19380	GPCR, rhodopsin-like superfamily (1);	0.571113	0.15977	U	0.235519	T	0.00012	0.0000	L	0.50333	1.59	0.80722	P	0.0	B	0.33135	0.399	B	0.40782	0.34	T	0.45920	-0.9228	9	0.36615	T	0.2	.	5.4574	0.16598	0.244:0.0:0.6162:0.1398	rs773902;rs936378;rs58632682;rs773902	120	Q96RI0	PAR4_HUMAN	T	120	ENSP00000248076:A120T	ENSP00000248076:A120T	A	+	1	0	F2RL3	16861632	0.002000	0.14202	0.001000	0.08648	0.142000	0.21351	1.267000	0.33050	0.003000	0.14656	-0.336000	0.08194	GCT		0.741	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462875.1		
FLG	2312	mdanderson.org	37	1	152280597	152280597	+	Silent	SNP	A	A	G	rs3126077		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:152280597A>G	ENST00000368799.1	-	3	6800	c.6765T>C	c.(6763-6765)gaT>gaC	p.D2255D	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2255	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTCTCAGAATCTTCTGAGT	0.582									Ichthyosis																													.											0													197.0	197.0	197.0					1																	152280597		2203	4300	6503	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6765T>C	1.37:g.152280597A>G			Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
HBQ1	3049	mdanderson.org	37	16	230578	230578	+	Silent	SNP	A	A	G	rs11863726	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr16:230578A>G	ENST00000199708.2	+	1	127	c.93A>G	c.(91-93)gaA>gaG	p.E31E	Y_RNA_ENST00000384514.1_RNA	NM_005331.4	NP_005322.1	P09105	HBAT_HUMAN	hemoglobin, theta 1	31					oxygen transport (GO:0015671)	hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			large_intestine(1)	1		all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				AGGCCCTGGAAAGGTGCGGCA	0.736													G|||	1021	0.203874	0.5522	0.1081	5008	,	,		7023	0.004		0.0974	False		,,,				2504	0.1166					.											0								G		1020,2422		86,848,787	2.0	3.0	3.0		93	2.5	1.0	16	dbSNP_120	3	483,6397		14,455,2971	no	coding-synonymous	HBQ1	NM_005331.4		100,1303,3758	GG,GA,AA		7.0203,29.6339,14.5611		31/143	230578	1503,8819	1721	3440	5161	SO:0001819	synonymous_variant	3049			BC056686	CCDS10400.1	16p13.3	2014-05-19			ENSG00000086506	ENSG00000086506			4833	protein-coding gene	gene with protein product		142240				2649166	Standard	NM_005331		Approved	HBQ	uc002cfz.3	P09105	OTTHUMG00000060727	ENST00000199708.2:c.93A>G	16.37:g.230578A>G			Q13723|Q1W6G5	Silent	SNP	ENST00000199708.2	37	CCDS10400.1																																																																																				0.736	HBQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134226.1	NM_005331	
HERC2	8924	mdanderson.org	37	15	28482158	28482158	+	Silent	SNP	C	C	G	rs3881419		TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr15:28482158C>G	ENST00000261609.7	-	26	4062	c.3954G>C	c.(3952-3954)tcG>tcC	p.S1318S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTGCCAAATACGAAGCGTGTA	0.453																																						.											0													106.0	95.0	99.0					15																	28482158		2202	4299	6501	SO:0001819	synonymous_variant	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3954G>C	15.37:g.28482158C>G				Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																				0.453	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
MUC4	4585	mdanderson.org	37	3	195508903	195508903	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr3:195508903G>A	ENST00000463781.3	-	2	10007	c.9548C>T	c.(9547-9549)aCg>aTg	p.T3183M	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3183M	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3183I(1)|p.T3183M(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.592																																						.											2	Substitution - Missense(2)	NS(2)											3.0	2.0	2.0					3																	195508903		442	957	1399	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9548C>T	3.37:g.195508903G>A	ENSP00000417498:p.Thr3183Met		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	1.721	-0.496684	0.04291	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38887	1.11;1.23	.	.	.	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.55615	0.78	T	0.16247	-1.0409	7	.	.	.	.	4.5608	0.12160	0.0:0.4156:0.5844:0.0	.	3055	E7ESK3	.	M	3183	ENSP00000417498:T3183M;ENSP00000420243:T3183M	.	T	-	2	0	MUC4	196993682	0.001000	0.12720	0.010000	0.14722	0.010000	0.07245	0.267000	0.18552	0.073000	0.16731	0.074000	0.15403	ACG		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
POM121	9883	mdanderson.org	37	7	72419207	72419207	+	IGR	SNP	G	G	A	rs2353055	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr7:72419207G>A	ENST00000434423.2	+	0	3750				NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000395270.1_3'UTR			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACTCACTCACGTCGGCATCTC	0.587													.|||	170	0.0339457	0.0688	0.0043	5008	,	,		18634	0.0585		0.003	False		,,,				2504	0.0143					.											0													64.0	59.0	61.0					7																	72419207		2202	4296	6498	SO:0001628	intergenic_variant	260294			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72419207G>A			A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000434423.2	37																																																																																					0.587	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
PAK2	5062	mdanderson.org	37	3	196529982	196529982	+	Missense_Mutation	SNP	A	A	G	rs78043821	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr3:196529982A>G	ENST00000327134.3	+	4	705	c.383A>G	c.(382-384)aAg>aGg	p.K128R		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	128	Autoregulatory region. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GATGTCCTAAAGTTCTACGAC	0.463																																						.											0													107.0	95.0	99.0					3																	196529982		2203	4300	6503	SO:0001583	missense	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.383A>G	3.37:g.196529982A>G	ENSP00000314067:p.Lys128Arg		Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.176399	0.78564	.	.	ENSG00000180370	ENST00000327134	D	0.86230	-2.09	5.27	5.27	0.74061	PAK-box/P21-Rho-binding (1);	0.000000	0.85682	D	0.000000	D	0.86990	0.6066	L	0.55743	1.74	0.80722	D	1	P	0.37015	0.578	B	0.43155	0.41	D	0.86926	0.2070	10	0.48119	T	0.1	.	14.3609	0.66771	1.0:0.0:0.0:0.0	.	128	Q13177	PAK2_HUMAN	R	128	ENSP00000314067:K128R	ENSP00000314067:K128R	K	+	2	0	PAK2	198014379	1.000000	0.71417	0.990000	0.47175	0.859000	0.49053	6.986000	0.76200	2.002000	0.58637	0.460000	0.39030	AAG		0.463	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PAX1	5075	mdanderson.org	37	20	21695347	21695347	+	Missense_Mutation	SNP	C	C	T	rs17861061	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:21695347C>T	ENST00000398485.2	+	5	1565	c.1511C>T	c.(1510-1512)cCa>cTa	p.P504L	PAX1_ENST00000444366.2_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	504			P -> L (in dbSNP:rs17861061). {ECO:0000269|Ref.2}.		bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						GGTGCACGCCCAGCCAGCCCC	0.682													C|||	36	0.0071885	0.0008	0.0058	5008	,	,		12098	0.0		0.0199	False		,,,				2504	0.0112					.											0								C	LEU/PRO	13,4389	19.1+/-41.9	0,13,2188	40.0	38.0	38.0		1511	-6.6	0.0	20	dbSNP_123	38	162,8436	73.8+/-136.5	3,156,4140	no	missense	PAX1	NM_006192.3	98	3,169,6328	TT,TC,CC		1.8842,0.2953,1.3462	probably-damaging	504/535	21695347	175,12825	2201	4299	6500	SO:0001583	missense	5075				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1511C>T	20.37:g.21695347C>T	ENSP00000381499:p.Pro504Leu		B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	18	0.008241758241758242	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	13	0.017150395778364115	C	4.886	0.164741	0.09287	0.002953	0.018842	ENSG00000125813	ENST00000398485	D	0.97575	-4.44	3.31	-6.62	0.01813	.	.	.	.	.	D	0.84401	0.5464	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.78033	-0.2362	9	0.87932	D	0	.	8.4104	0.32640	0.0:0.2143:0.5872:0.1985	rs17861061	504	P15863	PAX1_HUMAN	L	504	ENSP00000381499:P504L	ENSP00000381499:P504L	P	+	2	0	PAX1	21643347	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.001000	0.03690	-1.400000	0.02061	-1.365000	0.01206	CCA		0.682	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
RBMXL1	494115	mdanderson.org	37	1	89449135	89449135	+	Silent	SNP	T	T	C			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:89449135T>C	ENST00000321792.5	-	2	802	c.375A>G	c.(373-375)cgA>cgG	p.R125R	RBMXL1_ENST00000413769.1_5'UTR|RBMXL1_ENST00000399794.2_Silent_p.R125R|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	125					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										TGTGTCCTCCTCGTGAAGGAG	0.527																																						.											0													110.0	118.0	116.0					1																	89449135		2203	4300	6503	SO:0001819	synonymous_variant	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.375A>G	1.37:g.89449135T>C				Silent	SNP	ENST00000321792.5	37	CCDS716.1																																																																																				0.527	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
SLC35G6	643664	mdanderson.org	37	17	7386234	7386234	+	Missense_Mutation	SNP	G	G	A	rs200251320	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr17:7386234G>A	ENST00000412468.2	+	2	1046	c.931G>A	c.(931-933)Gtg>Atg	p.V311M	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000322644.6_5'Flank|POLR2A_ENST00000572844.1_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	311	EamA 2.					integral component of membrane (GO:0016021)		p.V311M(1)									TTCTGACATCGTGGGGGCAGG	0.572																																						.											1	Substitution - Missense(1)	skin(1)											119.0	108.0	112.0					17																	7386234		2203	4300	6503	SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.931G>A	17.37:g.7386234G>A	ENSP00000396523:p.Val311Met			Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.304956	0.01353	.	.	ENSG00000181222	ENST00000412468	T	0.53857	0.6	4.38	3.29	0.37713	.	.	.	.	.	T	0.31670	0.0804	N	0.14661	0.345	0.23581	N	0.997368	B	0.06786	0.001	B	0.04013	0.001	T	0.19516	-1.0303	9	0.13108	T	0.6	-2.3468	9.3381	0.38062	0.911:0.0:0.089:0.0	.	311	P0C7Q6	S35G6_HUMAN	M	311	ENSP00000396523:V311M	ENSP00000396523:V311M	V	+	1	0	SLC35G6	7326958	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	1.343000	0.33930	0.645000	0.30675	-0.383000	0.06682	GTG		0.572	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SRRM2	23524	mdanderson.org	37	16	2813441	2813441	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr16:2813441G>T	ENST00000301740.8	+	11	3461	c.2912G>T	c.(2911-2913)gGg>gTg	p.G971V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	971	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTCATTCTGGGTCCTCCTCA	0.493																																						.											0													132.0	131.0	131.0					16																	2813441		2198	4300	6498	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2912G>T	16.37:g.2813441G>T	ENSP00000301740:p.Gly971Val		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	6.263	0.416561	0.11870	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.24151	1.87	5.61	5.61	0.85477	.	0.171178	0.41294	D	0.000918	T	0.22475	0.0542	L	0.29908	0.895	0.43824	D	0.996394	B	0.19583	0.037	B	0.20384	0.029	T	0.02208	-1.1195	10	0.37606	T	0.19	-3.6856	17.1288	0.86721	0.0:0.0:1.0:0.0	.	971	Q9UQ35	SRRM2_HUMAN	V	971;971;223;936	ENSP00000301740:G971V	ENSP00000301740:G971V	G	+	2	0	SRRM2	2753442	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.416000	0.66417	2.656000	0.90262	0.655000	0.94253	GGG		0.493	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
HNRNPCL1	343069	bcgsc.ca	37	1	12907358	12907358	+	Missense_Mutation	SNP	T	T	C	rs74587302|rs559905244	byFrequency	TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr1:12907358T>C	ENST00000317869.6	-	2	1010	c.785A>G	c.(784-786)cAg>cGg	p.Q262R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	262						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GTCATCCCCCTGATCTTCATT	0.498																																						.											0													143.0	157.0	152.0					1																	12907358		2203	4300	6503	SO:0001583	missense	343069			BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.785A>G	1.37:g.12907358T>C	ENSP00000365370:p.Gln262Arg		B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.089806	0.00367	.	.	ENSG00000179172	ENST00000317869	T	0.09445	2.98	0.343	-0.686	0.11324	.	2.239460	0.02976	N	0.145045	T	0.04724	0.0128	N	0.02830	-0.485	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33650	-0.9860	10	0.33940	T	0.23	.	3.9448	0.09344	0.0:0.3889:0.0:0.6111	.	262	O60812	HNRCL_HUMAN	R	262	ENSP00000365370:Q262R	ENSP00000365370:Q262R	Q	-	2	0	HNRNPCL1	12829945	0.213000	0.23551	0.005000	0.12908	0.003000	0.03518	0.096000	0.15147	-0.605000	0.05753	-0.620000	0.04034	CAG		0.498	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
PTPN3	5774	bcgsc.ca	37	9	112219612	112219613	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr9:112219612_112219613delAT	ENST00000374541.2	-	3	309_310	c.205_206delAT	c.(205-207)attfs	p.I69fs	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	69	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TAAACCAAAATATTCCTTTTCA	0.406																																						.											0																																										SO:0001589	frameshift_variant	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.205_206delAT	9.37:g.112219612_112219613delAT	ENSP00000363667:p.Ile69fs		A0AUW9|E7EN99|E9PGU7	Frame_Shift_Del	DEL	ENST00000374541.2	37	CCDS6776.1																																																																																				0.406	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
CTNNBL1	56259	bcgsc.ca	37	20	36470752	36470753	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KM-8477-01A-11D-2310-10	TCGA-KM-8477-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4ecbfd89-393f-4126-aa1c-951a2c23ef89	685b8712-1fe3-49fc-8f73-a1d25a089282	g.chr20:36470752_36470753insA	ENST00000361383.6	+	13	1440_1441	c.1323_1324insA	c.(1324-1326)atgfs	p.M442fs	CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000373473.1_Frame_Shift_Ins_p.M255fs|CTNNBL1_ENST00000373469.1_Frame_Shift_Ins_p.M190fs|CTNNBL1_ENST00000405275.2_Frame_Shift_Ins_p.M415fs	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	442					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TTGACAGACTAATGGAGTTGCA	0.455																																					Ovarian(184;582 2038 3273 4106 42608)	.											0																																										SO:0001589	frameshift_variant	56259			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1324dupA	20.37:g.36470753_36470753dupA	ENSP00000355050:p.Met442fs		B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Frame_Shift_Ins	INS	ENST00000361383.6	37	CCDS13298.1																																																																																				0.455	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
