#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPS6KA1	6195	ucsc.edu	37	1	26873742	26873742	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:26873742G>A	ENST00000374168.2	+	4	442	c.288G>A	c.(286-288)ctG>ctA	p.L96L	RPS6KA1_ENST00000374166.4_Silent_p.L96L|RPS6KA1_ENST00000374162.2_Silent_p.L4L|RPS6KA1_ENST00000526792.1_Silent_p.L4L|RPS6KA1_ENST00000531382.1_Silent_p.L105L|RPS6KA1_ENST00000530003.1_Silent_p.L80L	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	96	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		TGAAGGTGCTGAAGAAGGCAA	0.597																																					p.L105L													.	RPS6KA1-510	0			c.G315A						.						70.0	62.0	65.0					1																	26873742		2203	4300	6503	SO:0001819	synonymous_variant	6195	exon3			GGTGCTGAAGAAG	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.288G>A	1.37:g.26873742G>A		76	0		61	3	NM_001006665	1	0	15	23	7	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			.		0.597	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
TRIM62	55223	broad.mit.edu	37	1	33625315	33625315	+	Silent	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:33625315C>T	ENST00000291416.5	-	3	968	c.735G>A	c.(733-735)ctG>ctA	p.L245L	TRIM62_ENST00000543586.1_Silent_p.L124L|TRIM62_ENST00000485148.1_5'UTR	NM_018207.2	NP_060677.2	Q9BVG3	TRI62_HUMAN	tripartite motif containing 62	245					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)				CCACCCCAGCCAGGAAGGTGT	0.682																																					p.L245L													.	TRIM62-226	0			c.G735A						.						32.0	34.0	33.0					1																	33625315		2203	4300	6503	SO:0001819	synonymous_variant	55223	exon3			CCCAGCCAGGAAG	BC007999	CCDS376.1	1p35.1	2013-10-11	2011-01-25		ENSG00000116525	ENSG00000116525		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	25574	protein-coding gene	gene with protein product	"""ductal epithelium-associated RING Chromosome 1"""		"""tripartite motif-containing 62"""			19536326	Standard	NM_018207		Approved	FLJ10759, DEAR1	uc001bxb.3	Q9BVG3	OTTHUMG00000004132	ENST00000291416.5:c.735G>A	1.37:g.33625315C>T		38	0		18	3	NM_018207	0	0	0	0	0	B3KVH5|B4DTE4|D3DPR1|Q9NVG0	Silent	SNP	ENST00000291416.5	37	CCDS376.1																																																																																			.		0.682	TRIM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011890.1	NM_018207	
FHL3	2275	broad.mit.edu	37	1	38463363	38463363	+	Silent	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:38463363G>T	ENST00000373016.3	-	5	849	c.681C>A	c.(679-681)ccC>ccA	p.P227P	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	227	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CACCTACGATGGGGCGCTTGC	0.592																																					p.P227P													.	FHL3-90	0			c.C681A						.						90.0	84.0	86.0					1																	38463363		2203	4300	6503	SO:0001819	synonymous_variant	2275	exon5			TACGATGGGGCGC	BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.681C>A	1.37:g.38463363G>T		79	0		60	4	NM_004468	0	0	3	3	0	D3DPT6|Q6I9T0|Q9BVA2	Silent	SNP	ENST00000373016.3	37	CCDS30678.1																																																																																			.		0.592	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
LPAR3	23566	broad.mit.edu	37	1	85331710	85331710	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:85331710T>G	ENST00000440886.1	-	1	132	c.94A>C	c.(94-96)Att>Ctt	p.I32L	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_Missense_Mutation_p.I32L			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	32					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						CACAAAACAATCACAAGCTTT	0.383																																					p.I32L													.	LPAR3-502	0			c.A94C						.						114.0	122.0	119.0					1																	85331710		2203	4300	6503	SO:0001583	missense	23566	exon2			AAACAATCACAAG	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.94A>C	1.37:g.85331710T>G	ENSP00000395389:p.Ile32Leu	364	1		317	7	NM_012152	0	0	0	0	0	A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	37	CCDS700.1	.	.	.	.	.	.	.	.	.	.	T	2.940	-0.219154	0.06101	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.35236	1.32;1.32	5.58	5.58	0.84498	.	0.864598	0.08979	U	0.866129	T	0.09905	0.0243	N	0.21142	0.635	0.34287	D	0.682867	B	0.02656	0.0	B	0.04013	0.001	T	0.09729	-1.0661	10	0.07990	T	0.79	.	10.4572	0.44557	0.0:0.082:0.0:0.918	.	32	Q9UBY5	LPAR3_HUMAN	L	32	ENSP00000395389:I32L;ENSP00000359643:I32L	ENSP00000359643:I32L	I	-	1	0	LPAR3	85104298	0.867000	0.29959	0.964000	0.40570	0.801000	0.45260	2.523000	0.45580	2.118000	0.64928	0.383000	0.25322	ATT	.		0.383	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152	
CTTNBP2NL	55917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	112999075	112999075	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:112999075A>G	ENST00000271277.6	+	6	1186	c.961A>G	c.(961-963)Aga>Gga	p.R321G		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	321					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAGCAGAAAGAACCCATGG	0.483																																					p.R321G		.											.	CTTNBP2NL-92	0			c.A961G						.						136.0	140.0	138.0					1																	112999075		2203	4300	6503	SO:0001583	missense	55917	exon6			GCAGAAAGAACCC	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.961A>G	1.37:g.112999075A>G	ENSP00000271277:p.Arg321Gly	145	0		118	20	NM_018704	0	0	2	3	1	B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	37	CCDS845.1	.	.	.	.	.	.	.	.	.	.	A	2.835	-0.241767	0.05906	.	.	ENSG00000143079	ENST00000271277	T	0.22945	1.93	5.88	4.73	0.59995	.	0.247257	0.38778	N	0.001578	T	0.08714	0.0216	L	0.44542	1.39	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.22208	-1.0223	10	0.22109	T	0.4	-12.5708	12.215	0.54402	0.8572:0.1428:0.0:0.0	.	321	Q9P2B4	CT2NL_HUMAN	G	321	ENSP00000271277:R321G	ENSP00000271277:R321G	R	+	1	2	CTTNBP2NL	112800598	0.600000	0.26899	0.921000	0.36526	0.055000	0.15305	1.467000	0.35321	1.017000	0.39495	0.533000	0.62120	AGA	.		0.483	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145561841	145561841	+	Missense_Mutation	SNP	G	G	A	rs201815402		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:145561841G>A	ENST00000355594.4	+	10	1616	c.1529G>A	c.(1528-1530)cGg>cAg	p.R510Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	510										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GATGCTGCCCGGGGGGCTTTG	0.632																																					p.R510Q	Melanoma(9;127 754 22988 51047)	.											.	ANKRD35-95	0			c.G1529A						.						87.0	104.0	98.0					1																	145561841		2201	4300	6501	SO:0001583	missense	148741	exon10			CTGCCCGGGGGGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1529G>A	1.37:g.145561841G>A	ENSP00000347802:p.Arg510Gln	115	0		96	11	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	g	13.79	2.341545	0.41498	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.67865	-0.29	5.23	4.31	0.51392	.	0.342769	0.20873	N	0.084127	T	0.46756	0.1409	M	0.70595	2.14	0.80722	D	1	B	0.32324	0.364	B	0.24006	0.05	T	0.51364	-0.8715	10	0.34782	T	0.22	-6.7716	11.0303	0.47769	0.0:0.0:0.8146:0.1853	.	510	Q8N283	ANR35_HUMAN	Q	419;510	ENSP00000347802:R510Q	ENSP00000347802:R510Q	R	+	2	0	ANKRD35	144273198	0.749000	0.28305	0.965000	0.40720	0.652000	0.38707	1.901000	0.39838	1.405000	0.46838	0.651000	0.88453	CGG	G|0.999;T|0.000		0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
DENND4B	9909	hgsc.bcm.edu;ucsc.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001				p.Q904Q		.											.	DENND4B-69	0			c.G2712A						.						28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	1.37:g.153907297C>T		39	0		38	12	NM_014856	1	0	223	230	6	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
PEAR1	375033	broad.mit.edu	37	1	156879832	156879832	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:156879832G>A	ENST00000338302.3	+	14	1835	c.1610G>A	c.(1609-1611)tGt>tAt	p.C537Y	PEAR1_ENST00000292357.7_Missense_Mutation_p.C537Y			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	537					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCCAGTCGCTGTGACTGTGAC	0.627																																					p.C537Y													.	PEAR1-71	0			c.G1610A						.						139.0	119.0	126.0					1																	156879832		2203	4300	6503	SO:0001583	missense	375033	exon13			GTCGCTGTGACTG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1610G>A	1.37:g.156879832G>A	ENSP00000344465:p.Cys537Tyr	30	0		22	3	NM_001080471	0	0	4	5	1	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073667	0.76415	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.72835	-0.69;-0.69	4.71	4.71	0.59529	EGF-like, laminin (1);	0.000000	0.53938	D	0.000048	D	0.87410	0.6170	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90879	0.4752	10	0.72032	D	0.01	.	15.1995	0.73122	0.0:0.0:1.0:0.0	.	537	Q5VY43	PEAR1_HUMAN	Y	537	ENSP00000344465:C537Y;ENSP00000292357:C537Y	ENSP00000292357:C537Y	C	+	2	0	PEAR1	155146456	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.844000	0.92147	2.447000	0.82792	0.561000	0.74099	TGT	.		0.627	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
DDR2	4921	broad.mit.edu	37	1	162688920	162688920	+	Missense_Mutation	SNP	G	G	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:162688920G>C	ENST00000367922.3	+	4	505	c.67G>C	c.(67-69)Gct>Cct	p.A23P	DDR2_ENST00000367921.3_Missense_Mutation_p.A23P	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	23					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TTCTGCAAAAGCTCAGGTTAA	0.453																																					p.A23P	NSCLC(161;314 2006 8283 19651 23192)												.	DDR2-1464	0			c.G67C						.						176.0	152.0	160.0					1																	162688920		2203	4300	6503	SO:0001583	missense	4921	exon4			GCAAAAGCTCAGG	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.67G>C	1.37:g.162688920G>C	ENSP00000356899:p.Ala23Pro	92	0		61	3	NM_001014796	0	0	0	0	0	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115339	0.37339	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.97976	-4.37;-4.64;-1.84;-1.84	4.25	4.25	0.50352	.	0.636214	0.14742	N	0.301137	D	0.91379	0.7280	N	0.21448	0.665	0.34326	D	0.687194	B	0.06786	0.001	B	0.13407	0.009	D	0.87367	0.2348	9	0.41790	T	0.15	.	12.3368	0.55071	0.0:0.0:1.0:0.0	.	23	Q16832	DDR2_HUMAN	P	23	ENSP00000400309:A23P;ENSP00000391310:A23P;ENSP00000356899:A23P;ENSP00000356898:A23P	ENSP00000356898:A23P	A	+	1	0	DDR2	160955544	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.311000	0.59147	2.364000	0.80123	0.467000	0.42956	GCT	.		0.453	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
ILDR2	387597	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	166890003	166890003	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:166890003C>T	ENST00000271417.3	-	9	1880	c.1825G>A	c.(1825-1827)Gac>Aac	p.D609N	ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.D550N|ILDR2_ENST00000526687.1_Missense_Mutation_p.D501N|ILDR2_ENST00000525740.1_Missense_Mutation_p.D482N|ILDR2_ENST00000529071.1_Missense_Mutation_p.D590N|ILDR2_ENST00000529387.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	609					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						TAGGGCAGGTCGCGGCCGCGG	0.687																																					p.D609N		.											.	ILDR2-91	0			c.G1825A						.						6.0	9.0	8.0					1																	166890003		2076	4108	6184	SO:0001583	missense	387597	exon9			GCAGGTCGCGGCC	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1825G>A	1.37:g.166890003C>T	ENSP00000271417:p.Asp609Asn	36	0		31	7	NM_199351	0	0	0	0	0		Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069172	0.76301	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.77750	0.5;-1.12;0.5;-1.12;-0.12	4.76	4.76	0.60689	.	3.853080	0.00892	N	0.002254	T	0.64638	0.2616	L	0.56769	1.78	0.35061	D	0.761595	P	0.49358	0.923	B	0.36030	0.216	T	0.57464	-0.7807	9	0.62326	D	0.03	.	12.8493	0.57848	0.1631:0.8369:0.0:0.0	.	609	Q71H61	ILDR2_HUMAN	N	609;482;590;501;550	ENSP00000271417:D609N;ENSP00000436120:D482N;ENSP00000436882:D590N;ENSP00000434273:D501N;ENSP00000432750:D550N	ENSP00000271417:D609N	D	-	1	0	ILDR2	165156627	1.000000	0.71417	0.997000	0.53966	0.735000	0.41995	4.789000	0.62446	2.171000	0.68590	0.561000	0.74099	GAC	.		0.687	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
TPR	7175	hgsc.bcm.edu;broad.mit.edu	37	1	186316562	186316562	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:186316562A>G	ENST00000367478.4	-	22	3101	c.2805T>C	c.(2803-2805)gaT>gaC	p.D935D		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	935					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCACAAGATCATCCACATCTT	0.368			T	NTRK1	papillary thyroid																																p.D935D		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR-228	0			c.T2805C						.						213.0	200.0	204.0					1																	186316562		1964	4159	6123	SO:0001819	synonymous_variant	7175	exon22			AAGATCATCCACA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2805T>C	1.37:g.186316562A>G		108	0		70	4	NM_003292	0	0	3	4	1	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																			.		0.368	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	197072290	197072290	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:197072290A>G	ENST00000367409.4	-	18	6347	c.6091T>C	c.(6091-6093)Tat>Cat	p.Y2031H	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2031	IQ 14. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATACCACGATAAGCTGACTGT	0.328																																					p.Y2031H		.											.	ASPM-615	0			c.T6091C						.						94.0	99.0	97.0					1																	197072290		2203	4298	6501	SO:0001583	missense	259266	exon18			CACGATAAGCTGA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6091T>C	1.37:g.197072290A>G	ENSP00000356379:p.Tyr2031His	155	0		100	17	NM_018136	0	0	1	1	0	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	a	19.52	3.842459	0.71488	.	.	ENSG00000066279	ENST00000367409	T	0.27557	1.66	5.6	4.46	0.54185	.	0.174809	0.40302	N	0.001123	T	0.59959	0.2232	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63541	-0.6614	10	0.41790	T	0.15	.	11.3347	0.49496	0.8639:0.0:0.0:0.1361	.	2031	Q8IZT6	ASPM_HUMAN	H	2031	ENSP00000356379:Y2031H	ENSP00000356379:Y2031H	Y	-	1	0	ASPM	195338913	1.000000	0.71417	0.632000	0.29296	0.972000	0.66771	7.212000	0.77941	0.930000	0.37217	0.524000	0.50904	TAT	.		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
CR1L	1379	broad.mit.edu	37	1	207890832	207890832	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:207890832G>T	ENST00000508064.2	+	11	1498	c.1438G>T	c.(1438-1440)Gct>Tct	p.A480S		NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	480	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AAATCCTCCAGCTATCCTTAA	0.413																																					p.A480S													.	CR1L-46	0			c.G1438T						.						94.0	87.0	89.0					1																	207890832		1819	4074	5893	SO:0001583	missense	1379	exon11			CCTCCAGCTATCC	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1438G>T	1.37:g.207890832G>T	ENSP00000421736:p.Ala480Ser	275	0		200	6	NM_175710	0	0	5	5	0	Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	.	1.011	-0.687807	0.03328	.	.	ENSG00000197721	ENST00000508064	T	0.62941	-0.01	2.9	-5.8	0.02347	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.33294	0.0858	N	0.16862	0.45	0.09310	N	1	B	0.21071	0.051	B	0.28305	0.088	T	0.33777	-0.9855	9	0.10636	T	0.68	.	0.2712	0.00232	0.3235:0.2626:0.1505:0.2635	.	480	Q2VPA4	CR1L_HUMAN	S	480	ENSP00000421736:A480S	ENSP00000421736:A480S	A	+	1	0	CR1L	205957455	0.000000	0.05858	0.000000	0.03702	0.336000	0.28762	-0.640000	0.05440	-2.312000	0.00648	0.305000	0.20034	GCT	.		0.413	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													.	CSGALNACT2-69	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	177	1		132	4	NM_018590	0	0	9	9	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
IFIT5	24138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	91177012	91177012	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr10:91177012A>G	ENST00000371795.4	+	2	269	c.56A>G	c.(55-57)cAt>cGt	p.H19R	IFIT5_ENST00000416601.1_Missense_Mutation_p.H19R|LIPA_ENST00000371837.1_5'Flank	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	19					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						TTAGAATGTCATTTTACATGG	0.318																																					p.H19R		.											.	IFIT5-90	0			c.A56G						.						69.0	71.0	70.0					10																	91177012		2203	4300	6503	SO:0001583	missense	24138	exon2			AATGTCATTTTAC	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.56A>G	10.37:g.91177012A>G	ENSP00000360860:p.His19Arg	148	0		125	16	NM_012420	0	0	3	3	0	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	37	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.890598	0.72524	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	T;T	0.60797	0.16;0.16	6.16	6.16	0.99307	.	0.045911	0.85682	D	0.000000	T	0.77253	0.4103	M	0.80847	2.515	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.80284	-0.1447	10	0.87932	D	0	-13.583	15.9872	0.80168	1.0:0.0:0.0:0.0	.	19;19	Q13325;B4DDV1	IFIT5_HUMAN;.	R	19	ENSP00000360860:H19R;ENSP00000414042:H19R	ENSP00000360860:H19R	H	+	2	0	IFIT5	91166992	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.666000	0.68059	2.367000	0.80283	0.528000	0.53228	CAT	.		0.318	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
XPNPEP1	7511	broad.mit.edu	37	10	111642221	111642221	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr10:111642221G>A	ENST00000502935.1	-	10	1129	c.1010C>T	c.(1009-1011)gCc>gTc	p.A337V	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.A223V|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.A294V|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.A337V|XPNPEP1_ENST00000430337.1_5'Flank					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AGCATAGCTGGCCTTGTCACT	0.567																																					p.A337V													.	XPNPEP1-94	0			c.C1010T						.						129.0	106.0	114.0					10																	111642221		2203	4300	6503	SO:0001583	missense	7511	exon10			TAGCTGGCCTTGT		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1010C>T	10.37:g.111642221G>A	ENSP00000421566:p.Ala337Val	78	0		62	3	NM_001167604	0	0	25	25	0		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520589	0.85495	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680;ENST00000403138	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	L	0.37561	1.115	0.80722	D	1	B;D;P	0.55605	0.296;0.972;0.898	B;B;B	0.40982	0.017;0.345;0.144	T	0.27872	-1.0061	9	0.15952	T	0.53	-17.9818	18.2859	0.90114	0.0:0.0:1.0:0.0	.	337;337;294	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	V	337;223;337;294;294	.	ENSP00000324011:A337V	A	-	2	0	XPNPEP1	111632211	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.864000	0.92294	2.757000	0.94681	0.655000	0.94253	GCC	.		0.567	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
OR52B2	255725	broad.mit.edu	37	11	6191110	6191110	+	Silent	SNP	G	G	A	rs369907116		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:6191110G>A	ENST00000530810.1	-	1	528	c.447C>T	c.(445-447)gcC>gcT	p.A149A	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGTGATGACGGCCAGAGCAA	0.517																																					p.A149A	NSCLC(5;186 261 1778 7098 14207)												.	.	0			c.C447T						.	G		0,4304		0,0,2152	60.0	61.0	61.0		447	4.3	1.0	11		61	1,8527		0,1,4263	no	coding-synonymous	OR52B2	NM_001004052.1		0,1,6415	AA,AG,GG		0.0117,0.0,0.0078		149/324	6191110	1,12831	2152	4264	6416	SO:0001819	synonymous_variant	255725	exon1			GATGACGGCCAGA	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.447C>T	11.37:g.6191110G>A		80	0		55	4	NM_001004052	0	0	0	0	0	Q8NGM7	Silent	SNP	ENST00000530810.1	37	CCDS53598.1																																																																																			.		0.517	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052	
OR10A5	144124	broad.mit.edu	37	11	6867462	6867462	+	Silent	SNP	G	G	A	rs543931840		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:6867462G>A	ENST00000299454.4	+	1	580	c.549G>A	c.(547-549)ccG>ccA	p.P183P	OR10A5_ENST00000379831.2_Silent_p.P187P			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	183					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													A|||	1	0.000199681	0.0	0.0	5008	,	,		23000	0.001		0.0	False		,,,				2504	0.0				p.P183P	Pancreas(44;21 1072 25662 28041 45559)												.	OR10A5-71	2	Substitution - coding silent(2)	kidney(2)	c.G549A						.						180.0	152.0	161.0					11																	6867462		2201	4296	6497	SO:0001819	synonymous_variant	144124	exon1			CAGCCCGCCTGTG	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.549G>A	11.37:g.6867462G>A		119	0		115	4	NM_178168	0	0	0	0	0	O95223|Q52M66|Q96R21|Q96R22	Silent	SNP	ENST00000299454.4	37	CCDS7773.1																																																																																			.		0.527	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
USH1C	10083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17542471	17542471	+	Missense_Mutation	SNP	A	A	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:17542471A>C	ENST00000318024.4	-	14	1264	c.1156T>G	c.(1156-1158)Ttg>Gtg	p.L386V	USH1C_ENST00000005226.7_Missense_Mutation_p.L386V|USH1C_ENST00000527720.1_Missense_Mutation_p.L355V|USH1C_ENST00000527020.1_Missense_Mutation_p.L367V	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	386					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GTTTTAGGCAAGAGTAGCTGT	0.488																																					p.L386V		.											.	USH1C-91	0			c.T1156G						.						457.0	438.0	444.0					11																	17542471		2200	4293	6493	SO:0001583	missense	10083	exon14			TAGGCAAGAGTAG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1156T>G	11.37:g.17542471A>C	ENSP00000317018:p.Leu386Val	134	0		87	9	NM_005709	0	0	60	118	58	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	9.184	1.024225	0.19433	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.63913	1.77;1.77;2.01;-0.07	5.7	-8.8	0.00817	.	0.781295	0.12318	N	0.479554	T	0.26159	0.0638	N	0.08118	0	0.09310	N	1	B;B;B	0.14438	0.01;0.006;0.0	B;B;B	0.15870	0.014;0.006;0.001	T	0.28554	-1.0040	10	0.11485	T	0.65	.	3.9214	0.09245	0.2554:0.0946:0.4467:0.2034	.	367;386;386	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	V	386;355;367;386	ENSP00000317018:L386V;ENSP00000432944:L355V;ENSP00000436934:L367V;ENSP00000005226:L386V	ENSP00000005226:L386V	L	-	1	2	USH1C	17499047	0.000000	0.05858	0.002000	0.10522	0.642000	0.38348	-1.114000	0.03293	-1.238000	0.02535	-1.039000	0.02377	TTG	.		0.488	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
OR5M3	219482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56237348	56237348	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:56237348A>T	ENST00000312240.2	-	1	666	c.626T>A	c.(625-627)cTg>cAg	p.L209Q		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					AATTACAGTCAGGGAATATGT	0.438																																					p.L209Q		.											.	OR5M3-70	0			c.T626A						.						111.0	109.0	110.0					11																	56237348		2201	4296	6497	SO:0001583	missense	219482	exon1			ACAGTCAGGGAAT	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.626T>A	11.37:g.56237348A>T	ENSP00000312208:p.Leu209Gln	206	0		173	20	NM_001004742	0	0	0	0	0	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	A	7.810	0.715500	0.15306	.	.	ENSG00000174937	ENST00000312240	T	0.49432	0.78	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33854	N	0.004500	T	0.71753	0.3377	H	0.97240	3.965	0.09310	N	1	B	0.19445	0.036	B	0.40038	0.317	T	0.68884	-0.5291	10	0.72032	D	0.01	-8.3442	12.8019	0.57591	1.0:0.0:0.0:0.0	.	209	Q8NGP4	OR5M3_HUMAN	Q	209	ENSP00000312208:L209Q	ENSP00000312208:L209Q	L	-	2	0	OR5M3	55993924	0.207000	0.23482	0.002000	0.10522	0.005000	0.04900	4.573000	0.60893	1.897000	0.54924	0.448000	0.29417	CTG	.		0.438	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
OR5M3	219482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56237358	56237358	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:56237358T>A	ENST00000312240.2	-	1	656	c.616A>T	c.(616-618)Aca>Tca	p.T206S		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					AGGGAATATGTGAAGTTAATG	0.428																																					p.T206S		.											.	OR5M3-70	0			c.A616T						.						120.0	118.0	119.0					11																	56237358		2201	4296	6497	SO:0001583	missense	219482	exon1			AATATGTGAAGTT	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.616A>T	11.37:g.56237358T>A	ENSP00000312208:p.Thr206Ser	205	0		172	20	NM_001004742	0	0	0	0	0	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	T	3.617	-0.078287	0.07184	.	.	ENSG00000174937	ENST00000312240	T	0.37058	1.22	5.08	-0.403	0.12400	GPCR, rhodopsin-like superfamily (1);	0.993240	0.08161	N	0.988433	T	0.16981	0.0408	N	0.11255	0.115	0.09310	N	1	B	0.14012	0.009	B	0.23150	0.044	T	0.31194	-0.9952	10	0.22706	T	0.39	-3.9091	3.5764	0.07936	0.2773:0.1679:0.0:0.5548	.	206	Q8NGP4	OR5M3_HUMAN	S	206	ENSP00000312208:T206S	ENSP00000312208:T206S	T	-	1	0	OR5M3	55993934	0.000000	0.05858	0.552000	0.28243	0.327000	0.28475	-0.845000	0.04340	0.248000	0.21435	0.448000	0.29417	ACA	.		0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
SSRP1	6749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57100282	57100282	+	Silent	SNP	C	C	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:57100282C>A	ENST00000278412.2	-	6	851	c.585G>T	c.(583-585)acG>acT	p.T195T		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	195					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						TGGCATCTCCCGTGGCCTGGA	0.562																																					p.T195T	Colon(89;1000 1340 6884 23013 41819)	.											.	SSRP1-228	0			c.G585T						.						65.0	63.0	64.0					11																	57100282		2201	4296	6497	SO:0001819	synonymous_variant	6749	exon6			ATCTCCCGTGGCC	M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.585G>T	11.37:g.57100282C>A		98	0		72	15	NM_003146	0	0	32	44	12	Q5BJG8	Silent	SNP	ENST00000278412.2	37	CCDS7952.1																																																																																			.		0.562	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
FRMD8	83786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65168213	65168213	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:65168213C>T	ENST00000317568.5	+	9	1109	c.946C>T	c.(946-948)Cgc>Tgc	p.R316C	FRMD8_ENST00000416776.2_Missense_Mutation_p.R282C|FRMD8_ENST00000355991.5_Missense_Mutation_p.R260C	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	316	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GCTGGGCCTGCGCTTCCAGGA	0.657																																					p.R316C		.											.	FRMD8-227	0			c.C946T						.						48.0	38.0	41.0					11																	65168213		2201	4296	6497	SO:0001583	missense	83786	exon9			GGCCTGCGCTTCC	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.946C>T	11.37:g.65168213C>T	ENSP00000319726:p.Arg316Cys	76	0		82	13	NM_031904	0	0	4	5	1	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	37	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609302	0.46527	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.84223	-1.81;-1.22;-1.82	4.49	3.56	0.40772	FERM domain (1);	0.572355	0.18795	N	0.130960	D	0.84813	0.5555	.	.	.	0.48452	D	0.999659	B;B;D	0.71674	0.041;0.175;0.998	B;B;P	0.48654	0.01;0.028;0.585	D	0.83999	0.0342	9	0.56958	D	0.05	-14.6802	9.9641	0.41715	0.3682:0.6317:0.0:0.0	.	282;260;316	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	C	316;260;282	ENSP00000319726:R316C;ENSP00000348270:R260C;ENSP00000392111:R282C	ENSP00000319726:R316C	R	+	1	0	FRMD8	64924789	0.940000	0.31905	1.000000	0.80357	0.991000	0.79684	1.023000	0.30065	0.998000	0.38996	0.549000	0.68633	CGC	.		0.657	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
MUS81	80198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65631192	65631192	+	Splice_Site	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:65631192G>A	ENST00000308110.4	+	9	1310	c.961G>A	c.(961-963)Gca>Aca	p.A321T	MUS81_ENST00000533035.1_Splice_Site_p.A246T|CFL1_ENST00000534769.1_5'Flank|EFEMP2_ENST00000532648.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	321	ERCC4.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		TAGAGACCCAGGTGAAGGGCC	0.637								Homologous recombination																													p.A321T		.											.	MUS81-227	0			c.G961A						.						59.0	64.0	63.0					11																	65631192		2201	4296	6497	SO:0001630	splice_region_variant	80198	exon9			GACCCAGGTGAAG		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.961+1G>A	11.37:g.65631192G>A		132	0		110	21	NM_025128	0	0	2	4	2	Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	37	CCDS8115.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.03|11.03	1.519664|1.519664	0.27211|0.27211	.|.	.|.	ENSG00000172732|ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855|ENST00000529374	T;T|.	0.22945|.	1.93;1.93|.	5.14|5.14	3.2|3.2	0.36748|0.36748	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);ERCC4 domain (2);|.	0.343384|.	0.32430|.	N|.	0.006119|.	T|T	0.43656|0.43656	0.1257|0.1257	L|L	0.35288|0.35288	1.05|1.05	0.36284|0.36284	D|D	0.855981|0.855981	B|.	0.29805|.	0.257|.	B|.	0.31442|.	0.13|.	T|T	0.46317|0.46317	-0.9200|-0.9200	10|5	0.13470|.	T|.	0.59|.	-1.6633|-1.6633	6.6325|6.6325	0.22865|0.22865	0.0927:0.0:0.7303:0.177|0.0927:0.0:0.7303:0.177	.|.	321|.	Q96NY9|.	MUS81_HUMAN|.	T|N	246;321;321|245	ENSP00000432287:A246T;ENSP00000307853:A321T|.	ENSP00000307853:A321T|.	A|S	+|+	1|2	0|0	MUS81|MUS81	65387768|65387768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.034000|0.034000	0.12701|0.12701	3.588000|3.588000	0.53964|0.53964	1.370000|1.370000	0.46153|0.46153	0.563000|0.563000	0.77884|0.77884	GCA|AGC	.		0.637	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128	Missense_Mutation
TCIRG1	10312	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67811752	67811752	+	Missense_Mutation	SNP	G	G	A	rs372690969		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:67811752G>A	ENST00000265686.3	+	9	1069	c.961G>A	c.(961-963)Gag>Aag	p.E321K	TCIRG1_ENST00000532635.1_Missense_Mutation_p.E105K	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	321					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CCTCATTGCCGAGGCCTGGTG	0.697																																					p.E321K													.	TCIRG1-227	0			c.G961A						.	G	LYS/GLU,LYS/GLU	0,4388		0,0,2194	31.0	28.0	29.0		961,313	4.5	1.0	11		29	1,8581		0,1,4290	no	missense,missense	TCIRG1	NM_006019.3,NM_006053.3	56,56	0,1,6484	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging,probably-damaging	321/831,105/615	67811752	1,12969	2194	4291	6485	SO:0001583	missense	10312	exon9			ATTGCCGAGGCCT	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.961G>A	11.37:g.67811752G>A	ENSP00000265686:p.Glu321Lys	33	0		55	7	NM_006019	0	0	33	34	1	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.390688|4.390688	0.82902|0.82902	0.0|0.0	1.17E-4|1.17E-4	ENSG00000110719|ENSG00000110719	ENST00000265686;ENST00000532635|ENST00000529364	D;D|.	0.87650|.	-2.28;-2.28|.	5.44|5.44	4.53|4.53	0.55603|0.55603	.|.	0.103326|.	0.64402|.	D|.	0.000004|.	T|T	0.75788|0.75788	0.3897|0.3897	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.71414|.	0.973|.	T|T	0.77765|0.77765	-0.2465|-0.2465	10|5	0.87932|.	D|.	0|.	-18.098|-18.098	12.3719|12.3719	0.55260|0.55260	0.0826:0.0:0.9174:0.0|0.0826:0.0:0.9174:0.0	.|.	321|.	Q13488|.	VPP3_HUMAN|.	K|Q	321;105|154	ENSP00000265686:E321K;ENSP00000434407:E105K|.	ENSP00000265686:E321K|.	E|R	+|+	1|2	0|0	TCIRG1|TCIRG1	67568328|67568328	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.202000|0.202000	0.24057|0.24057	7.852000|7.852000	0.86927|0.86927	2.554000|2.554000	0.86153|0.86153	0.462000|0.462000	0.41574|0.41574	GAG|CGA	.		0.697	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	
INPPL1	3636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71948603	71948603	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:71948603A>G	ENST00000298229.2	+	26	3519	c.3315A>G	c.(3313-3315)ccA>ccG	p.P1105P	INPPL1_ENST00000541756.1_Silent_p.P863P|PHOX2A_ENST00000544057.1_5'Flank|INPPL1_ENST00000538751.1_Silent_p.P863P	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1105	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GCCCCTCACCAGCCAGCACTT	0.692																																					p.P1105P		.											.	INPPL1-660	0			c.A3315G						.						19.0	21.0	20.0					11																	71948603		2108	4155	6263	SO:0001819	synonymous_variant	3636	exon26			CTCACCAGCCAGC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3315A>G	11.37:g.71948603A>G		93	0		72	17	NM_001567	0	0	40	56	16	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	37	CCDS8213.1																																																																																			.		0.692	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
ARAP1	116985	broad.mit.edu;ucsc.edu	37	11	72423580	72423580	+	Missense_Mutation	SNP	C	C	G	rs558010391		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:72423580C>G	ENST00000393609.3	-	6	983	c.781G>C	c.(781-783)Gtg>Ctg	p.V261L	ARAP1_ENST00000393605.3_Missense_Mutation_p.V21L|ARAP1_ENST00000334211.8_Missense_Mutation_p.V16L|ARAP1_ENST00000455638.2_Missense_Mutation_p.V261L|ARAP1_ENST00000429686.1_Missense_Mutation_p.V16L|ARAP1_ENST00000359373.5_Missense_Mutation_p.V261L|ARAP1_ENST00000426523.1_Missense_Mutation_p.V16L	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	261					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GCCACGCGCACGGCCCGTGGG	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12493	0.0		0.0	False		,,,				2504	0.0				p.V261L	Ovarian(102;1198 1520 13195 17913 37529)												.	ARAP1-91	0			c.G781C						.						146.0	121.0	130.0					11																	72423580		2200	4293	6493	SO:0001583	missense	116985	exon6			CGCGCACGGCCCG	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.781G>C	11.37:g.72423580C>G	ENSP00000377233:p.Val261Leu	69	0		54	3	NM_001040118	0	0	18	26	8	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223925	0.79576	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	T;T;T;T;T;T;T	0.08458	3.2;3.2;3.18;3.23;3.2;3.24;3.09	4.34	4.34	0.51931	.	0.240731	0.28322	N	0.015777	T	0.16599	0.0399	L	0.29908	0.895	0.30306	N	0.789	P;P;D;P;D	0.53312	0.931;0.931;0.959;0.931;0.959	P;P;D;D;D	0.68621	0.872;0.872;0.959;0.911;0.94	T	0.00773	-1.1572	10	0.62326	D	0.03	.	12.2025	0.54335	0.0:1.0:0.0:0.0	.	16;16;261;261;21	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	L	261;261;21;16;261;16;16;50	ENSP00000352332:V261L;ENSP00000390461:V261L;ENSP00000377230:V21L;ENSP00000335506:V16L;ENSP00000377233:V261L;ENSP00000392264:V16L;ENSP00000403127:V16L	ENSP00000335506:V16L	V	-	1	0	ARAP1	72101228	0.982000	0.34865	0.998000	0.56505	0.906000	0.53458	3.800000	0.55537	2.250000	0.74265	0.561000	0.74099	GTG	.		0.667	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	73796809	73796809	+	Missense_Mutation	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:73796809C>G	ENST00000334126.7	-	21	3990	c.3764G>C	c.(3763-3765)tGt>tCt	p.C1255S	C2CD3_ENST00000313663.7_Missense_Mutation_p.C1255S			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1255	C2 1.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GCAGAAAGAACAGGCCACAGG	0.547																																					p.C1255S		.											.	C2CD3-75	0			c.G3764C						.						86.0	75.0	79.0					11																	73796809		2200	4293	6493	SO:0001583	missense	26005	exon21			AAAGAACAGGCCA	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3764G>C	11.37:g.73796809C>G	ENSP00000334379:p.Cys1255Ser	140	0		132	19	NM_015531	0	0	2	4	2	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	20.1	3.935426	0.73442	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.37411	1.2;1.2;1.2	5.8	4.88	0.63580	.	0.169348	0.50627	D	0.000102	T	0.27241	0.0668	L	0.29908	0.895	0.42377	D	0.992478	P	0.47910	0.902	B	0.40066	0.318	T	0.03008	-1.1083	10	0.37606	T	0.19	-9.4621	13.9561	0.64150	0.0:0.9267:0.0:0.0733	.	1255	Q4AC94-1	.	S	1255;1255;1255;63	ENSP00000334379:C1255S;ENSP00000323339:C1255S;ENSP00000388750:C63S	ENSP00000323339:C1255S	C	-	2	0	C2CD3	73474457	0.998000	0.40836	1.000000	0.80357	0.951000	0.60555	3.590000	0.53979	2.742000	0.94016	0.655000	0.94253	TGT	.		0.547	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
C11orf30	56946	broad.mit.edu	37	11	76183839	76183839	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:76183839G>T	ENST00000529032.1	+	7	1063	c.1063G>T	c.(1063-1065)Gtg>Ttg	p.V355L	C11orf30_ENST00000343878.3_Missense_Mutation_p.V355L|C11orf30_ENST00000533248.1_Missense_Mutation_p.V369L|C11orf30_ENST00000524767.1_Missense_Mutation_p.V370L|C11orf30_ENST00000524490.1_Missense_Mutation_p.V356L|C11orf30_ENST00000525038.1_Missense_Mutation_p.V370L|C11orf30_ENST00000525919.1_Missense_Mutation_p.V356L|C11orf30_ENST00000334736.3_Missense_Mutation_p.V355L			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	355	Interaction with BRCA2.|Ser-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						AGTAACAGCTGTGGTGTCCTC	0.433																																					p.V355L													.	C11orf30-232	0			c.G1063T						.						150.0	122.0	132.0					11																	76183839		2200	4292	6492	SO:0001583	missense	56946	exon8			ACAGCTGTGGTGT	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1063G>T	11.37:g.76183839G>T	ENSP00000432327:p.Val355Leu	124	0		106	3	NM_020193	0	0	1	1	0	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490244	0.84962	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.67581	0.2908	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D;D	0.67145	0.994;0.994;0.994;0.996;0.996;0.994;0.994;0.994	D;D;D;D;D;D;D;D	0.76071	0.97;0.97;0.97;0.987;0.987;0.97;0.97;0.97	T	0.60047	-0.7339	9	0.26408	T	0.33	-5.3729	20.8794	0.99867	0.0:0.0:1.0:0.0	.	369;370;370;355;305;356;356;355	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;.;EMSY_HUMAN	L	356;355;355;305;370;369;356;370;355	.	ENSP00000334130:V355L	V	+	1	0	C11orf30	75861487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GTG	.		0.433	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
MAML2	84441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q596Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	kidney(1)	c.G1788A						.						28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		90	0		95	11	NM_032427	1	0	223	230	6	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.250;T|0.750		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
YAP1	10413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102100555	102100555	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:102100555G>T	ENST00000282441.5	+	9	1787	c.1399G>T	c.(1399-1401)Gga>Tga	p.G467*	YAP1_ENST00000528834.1_3'UTR|YAP1_ENST00000531439.1_Nonsense_Mutation_p.G451*|YAP1_ENST00000526343.1_Nonsense_Mutation_p.G413*|YAP1_ENST00000537274.1_Nonsense_Mutation_p.G455*|RP11-864G5.3_ENST00000526310.1_RNA|YAP1_ENST00000524575.1_Nonsense_Mutation_p.G289*|YAP1_ENST00000345877.2_Nonsense_Mutation_p.G417*	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	467	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		GAACATAGAAGGAGAGGAGCT	0.483																																					p.G467X	Colon(50;247 1103 7861 28956)	.											.	YAP1-659	0			c.G1399T						.						131.0	123.0	126.0					11																	102100555		2203	4299	6502	SO:0001587	stop_gained	10413	exon9			ATAGAAGGAGAGG		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1399G>T	11.37:g.102100555G>T	ENSP00000282441:p.Gly467*	128	0		94	15	NM_001130145	0	0	4	6	2	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Nonsense_Mutation	SNP	ENST00000282441.5	37	CCDS44716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.303129|8.303129	0.98750|0.98750	.|.	.|.	ENSG00000137693|ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575|ENST00000529029	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.77638	.|0.4160	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73658	.|-0.3913	.|4	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	413;467;455;417;384;451;289|220	.|.	ENSP00000282441:G467X|.	G|K	+|+	1|3	0|2	YAP1|YAP1	101605765|101605765	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	9.441000|9.441000	0.97557|0.97557	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGA|AAG	.		0.483	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1	NM_006106	
ARHGAP32	9743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	128933815	128933815	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:128933815A>G	ENST00000310343.9	-	8	824	c.825T>C	c.(823-825)ccT>ccC	p.P275P	ARHGAP32_ENST00000524655.1_Silent_p.P201P	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	275	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TCAGTTCGTCAGGGGCCCGAG	0.433																																					p.P275P		.											.	ARHGAP32-231	0			c.T825C						.						162.0	158.0	160.0					11																	128933815		1566	3579	5145	SO:0001819	synonymous_variant	9743	exon8			TTCGTCAGGGGCC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.825T>C	11.37:g.128933815A>G		158	0		139	24	NM_001142685	0	0	0	0	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	CCDS44769.1																																																																																			.		0.433	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
CLSTN3	9746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7302198	7302198	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr12:7302198T>C	ENST00000266546.6	+	14	2604	c.2154T>C	c.(2152-2154)gaT>gaC	p.D718D	CLSTN3_ENST00000537408.1_Silent_p.D730D	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	718					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ATGACCTGGATCCCGAGCGGG	0.572																																					p.D718D		.											.	CLSTN3-153	0			c.T2154C						.						86.0	78.0	80.0					12																	7302198		2203	4300	6503	SO:0001819	synonymous_variant	9746	exon14			CCTGGATCCCGAG	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2154T>C	12.37:g.7302198T>C		110	0		67	21	NM_014718	0	0	27	61	34	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																			.		0.572	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
MON2	23041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	62954577	62954577	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr12:62954577T>A	ENST00000393632.2	+	26	4107	c.3716T>A	c.(3715-3717)cTa>cAa	p.L1239Q	MON2_ENST00000552738.1_Missense_Mutation_p.L1216Q|MON2_ENST00000393629.2_Missense_Mutation_p.L1239Q|MON2_ENST00000393630.3_Missense_Mutation_p.L1240Q|MON2_ENST00000546600.1_Missense_Mutation_p.L1239Q|MON2_ENST00000280379.6_Missense_Mutation_p.L1240Q	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1239					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GATTTGAATCTATGGTGGGCT	0.393																																					p.L1239Q		.											.	MON2-514	0			c.T3716A						.						92.0	90.0	91.0					12																	62954577		2203	4300	6503	SO:0001583	missense	23041	exon26			TGAATCTATGGTG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3716T>A	12.37:g.62954577T>A	ENSP00000377252:p.Leu1239Gln	116	0		99	22	NM_015026	0	0	2	4	2	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.100011	0.76983	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.79857	0.4518	L	0.52759	1.655	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.979;1.0;1.0	D;P;P;D;D	0.83275	0.99;0.861;0.793;0.994;0.996	T	0.79308	-0.1857	9	.	.	.	-5.6366	15.0609	0.71951	0.0:0.0:0.0:1.0	.	1239;1216;1239;114;1239	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	Q	1239;1240;1240;1239;1216;1239	ENSP00000377252:L1239Q;ENSP00000377250:L1240Q;ENSP00000280379:L1240Q;ENSP00000447407:L1239Q;ENSP00000449215:L1216Q;ENSP00000377249:L1239Q	.	L	+	2	0	MON2	61240844	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.787000	0.85759	2.031000	0.59945	0.377000	0.23210	CTA	.		0.393	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
FZD10	11211	broad.mit.edu	37	12	130647553	130647553	+	Missense_Mutation	SNP	C	C	A	rs200800452		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr12:130647553C>A	ENST00000229030.4	+	1	550	c.66C>A	c.(64-66)agC>agA	p.S22R	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_5'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	22					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S22R(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CCGCCATCAGCTCCATGGACA	0.667																																					p.S22R													.	FZD10-658	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.C66A						.						11.0	11.0	11.0					12																	130647553		2191	4283	6474	SO:0001583	missense	11211	exon1			CATCAGCTCCATG	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.66C>A	12.37:g.130647553C>A	ENSP00000229030:p.Ser22Arg	76	3		82	11	NM_007197	0	0	0	0	0		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386995	0.25031	.	.	ENSG00000111432	ENST00000229030	T	0.76968	-1.06	3.43	-0.743	0.11105	.	1.117550	0.07024	U	0.827300	T	0.63698	0.2533	L	0.27053	0.805	0.50813	D	0.999897	B	0.10296	0.003	B	0.04013	0.001	T	0.44711	-0.9310	10	0.25106	T	0.35	.	8.7037	0.34340	0.0:0.6722:0.0:0.3278	.	22	Q9ULW2	FZD10_HUMAN	R	22	ENSP00000229030:S22R	ENSP00000229030:S22R	S	+	3	2	FZD10	129213506	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	2.073000	0.41519	-0.099000	0.12263	0.561000	0.74099	AGC	.		0.667	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MRPS31	10240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41323388	41323388	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr13:41323388A>T	ENST00000323563.6	-	6	880	c.844T>A	c.(844-846)Ttt>Att	p.F282I	MRPS31_ENST00000498078.1_5'UTR	NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	282						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		TGCTTAGCAAATTCCACATCC	0.368																																					p.F282I		.											.	MRPS31-226	0			c.T844A						.						103.0	90.0	94.0					13																	41323388		2203	4300	6503	SO:0001583	missense	10240	exon6			TAGCAAATTCCAC	Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.844T>A	13.37:g.41323388A>T	ENSP00000315397:p.Phe282Ile	122	0		88	8	NM_005830	0	0	8	19	11	B2RCS3|Q5VYC8|Q8WTV8	Missense_Mutation	SNP	ENST00000323563.6	37	CCDS9372.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196191	0.58126	.	.	ENSG00000102738	ENST00000323563	T	0.30182	1.54	5.17	5.17	0.71159	.	0.105571	0.64402	D	0.000003	T	0.50973	0.1647	M	0.80982	2.52	0.40731	D	0.982746	D	0.71674	0.998	D	0.65233	0.933	T	0.54255	-0.8321	10	0.37606	T	0.19	.	8.5691	0.33558	0.912:0.0:0.088:0.0	.	282	Q92665	RT31_HUMAN	I	282	ENSP00000315397:F282I	ENSP00000315397:F282I	F	-	1	0	MRPS31	40221388	1.000000	0.71417	0.995000	0.50966	0.613000	0.37349	2.868000	0.48436	1.947000	0.56498	0.524000	0.50904	TTT	.		0.368	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044640.2		
COL4A2	1284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	111117912	111117912	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr13:111117912T>A	ENST00000360467.5	+	25	2243	c.1937T>A	c.(1936-1938)tTc>tAc	p.F646Y	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	646	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCACCAGGCTTCCTGGGCCCT	0.597																																					p.F646Y		.											.	COL4A2-95	0			c.T1937A						.						29.0	34.0	32.0					13																	111117912		1873	4094	5967	SO:0001583	missense	1284	exon25			CAGGCTTCCTGGG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1937T>A	13.37:g.111117912T>A	ENSP00000353654:p.Phe646Tyr	158	0		124	14	NM_001846	0	0	49	60	11	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.456320	0.01071	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93247	-3.19	4.82	3.55	0.40652	.	0.654622	0.13725	N	0.367070	D	0.84942	0.5584	N	0.17674	0.51	0.09310	N	0.999999	B	0.23650	0.089	B	0.17098	0.017	T	0.72966	-0.4131	10	0.29301	T	0.29	.	5.8702	0.18799	0.1497:0.0841:0.0:0.7662	.	646	P08572	CO4A2_HUMAN	Y	646	ENSP00000353654:F646Y	ENSP00000257309:F646Y	F	+	2	0	COL4A2	109915913	0.000000	0.05858	0.103000	0.21229	0.102000	0.19082	0.319000	0.19522	1.802000	0.52723	0.379000	0.24179	TTC	.		0.597	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
GTF2A1	2957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	81659105	81659105	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr14:81659105T>A	ENST00000553612.1	-	7	1094	c.691A>T	c.(691-693)Aat>Tat	p.N231Y	GTF2A1_ENST00000434192.2_Missense_Mutation_p.N192Y	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	231					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		TGAGTCTTATTTCCTGTAAAT	0.502																																					p.N231Y		.											.	GTF2A1-153	0			c.A691T						.						174.0	172.0	173.0					14																	81659105		2203	4300	6503	SO:0001583	missense	2957	exon7			TCTTATTTCCTGT	X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.691A>T	14.37:g.81659105T>A	ENSP00000452454:p.Asn231Tyr	84	0		77	9	NM_015859	0	0	3	3	0	Q3KNQ9	Missense_Mutation	SNP	ENST00000553612.1	37	CCDS9873.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.444489	0.83993	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.44083	0.93;0.93	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.62588	0.2440	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.64723	-0.6340	10	0.52906	T	0.07	-21.9526	15.3673	0.74531	0.0:0.0:0.0:1.0	.	231	P52655	TF2AA_HUMAN	Y	231;192;192	ENSP00000452454:N231Y;ENSP00000409492:N192Y	ENSP00000298173:N231Y	N	-	1	0	GTF2A1	80728858	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.643000	0.83403	2.084000	0.62774	0.533000	0.62120	AAT	.		0.502	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1	NM_015859	
SETD3	84193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	99929881	99929881	+	Silent	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr14:99929881C>T	ENST00000331768.5	-	3	297	c.138G>A	c.(136-138)gaG>gaA	p.E46E	SETD3_ENST00000436070.2_Silent_p.E46E|SETD3_ENST00000453938.1_5'UTR|SETD3_ENST00000329331.3_Silent_p.E46E	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	46					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				ACTCTTCCCACTCTTTTCCTG	0.413																																					p.E46E		.											.	SETD3-514	0			c.G138A						.						84.0	71.0	76.0					14																	99929881		2203	4300	6503	SO:0001819	synonymous_variant	84193	exon3			TTCCCACTCTTTT	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.138G>A	14.37:g.99929881C>T		85	0		63	11	NM_032233	0	0	11	14	3	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	ENST00000331768.5	37	CCDS9951.1																																																																																			.		0.413	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
FAN1	22909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31197838	31197838	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:31197838T>G	ENST00000362065.4	+	2	1263	c.972T>G	c.(970-972)caT>caG	p.H324Q	FAN1_ENST00000561607.1_Missense_Mutation_p.H324Q|FAN1_ENST00000565466.1_Missense_Mutation_p.H324Q|FAN1_ENST00000561594.1_Missense_Mutation_p.H324Q	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	324					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						CAAAATCTCATAGTTCTGCAG	0.418								Direct reversal of damage																													p.H324Q		.											.	FAN1-90	0			c.T972G						.						71.0	67.0	68.0					15																	31197838		2202	4300	6502	SO:0001583	missense	22909	exon2			ATCTCATAGTTCT		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.972T>G	15.37:g.31197838T>G	ENSP00000354497:p.His324Gln	97	0		86	16	NM_001146095	0	0	1	1	0	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	37	CCDS32186.1	.	.	.	.	.	.	.	.	.	.	T	3.821	-0.037772	0.07497	.	.	ENSG00000198690	ENST00000362065	T	0.40756	1.02	5.46	-9.68	0.00528	.	2.519990	0.00901	N	0.002356	T	0.18299	0.0439	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.17228	-1.0376	10	0.12766	T	0.61	0.1551	2.0377	0.03543	0.2596:0.2533:0.3519:0.1352	.	324;324	Q9Y2M0;Q9Y2M0-2	FAN1_HUMAN;.	Q	324	ENSP00000354497:H324Q	ENSP00000354497:H324Q	H	+	3	2	FAN1	28985130	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-3.615000	0.00414	-2.231000	0.00718	-0.291000	0.09656	CAT	.		0.418	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967	
DMXL2	23312	broad.mit.edu	37	15	51828388	51828388	+	Silent	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:51828388T>G	ENST00000251076.5	-	12	2576	c.2289A>C	c.(2287-2289)ccA>ccC	p.P763P	DMXL2_ENST00000543779.2_Silent_p.P763P|DMXL2_ENST00000449909.3_Silent_p.P763P	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	763						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GAATGAGAGTTGGAAGCCAAG	0.358																																					p.P763P													.	DMXL2-99	0			c.A2289C						.						96.0	84.0	88.0					15																	51828388		2194	4292	6486	SO:0001819	synonymous_variant	23312	exon12			GAGAGTTGGAAGC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2289A>C	15.37:g.51828388T>G		109	3		92	5	NM_001174117	0	0	1	1	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	37	CCDS10141.1																																																																																			.		0.358	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
SIN3A	25942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75705130	75705130	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:75705130G>A	ENST00000394947.3	-	5	1044	c.730C>T	c.(730-732)Cag>Tag	p.Q244*	SIN3A_ENST00000360439.4_Nonsense_Mutation_p.Q244*|SIN3A_ENST00000394949.4_Nonsense_Mutation_p.Q244*	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GGTGggggctgaggagctggc	0.552																																					p.Q244X		.											.	SIN3A-230	0			c.C730T						.						81.0	75.0	77.0					15																	75705130		2197	4294	6491	SO:0001587	stop_gained	25942	exon5			GGGGCTGAGGAGC	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.730C>T	15.37:g.75705130G>A	ENSP00000378402:p.Gln244*	131	0		89	12	NM_001145358	0	0	3	3	0		Nonsense_Mutation	SNP	ENST00000394947.3	37	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	G	37	6.213995	0.97380	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	.	.	.	6.04	5.12	0.69794	.	0.098566	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-11.3013	14.2887	0.66263	0.0708:0.0:0.9292:0.0	.	.	.	.	X	244	.	ENSP00000353622:Q244X	Q	-	1	0	SIN3A	73492183	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.867000	0.99620	1.557000	0.49525	0.561000	0.74099	CAG	.		0.552	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	79350728	79350728	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:79350728A>T	ENST00000419573.3	-	3	753	c.479T>A	c.(478-480)cTt>cAt	p.L160H	RASGRF1_ENST00000558480.2_Missense_Mutation_p.L160H|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	160					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CTGCTGCCGAAGCTGCTTGGC	0.602																																					p.L160H		.											.	RASGRF1-662	0			c.T479A						.						124.0	101.0	109.0					15																	79350728		2196	4293	6489	SO:0001583	missense	5923	exon3			TGCCGAAGCTGCT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.479T>A	15.37:g.79350728A>T	ENSP00000405963:p.Leu160His	46	0		44	4	NM_001145648	0	0	0	0	0	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982389	0.74474	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.46819	0.86	4.59	4.59	0.56863	.	0.000000	0.64402	D	0.000005	T	0.62258	0.2413	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.85130	0.954;0.984;0.993;0.997	T	0.65492	-0.6155	10	0.87932	D	0	.	11.9588	0.52997	1.0:0.0:0.0:0.0	.	160;160;160;160	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	H	160	ENSP00000405963:L160H	ENSP00000378224:L160H	L	-	2	0	RASGRF1	77137783	1.000000	0.71417	0.997000	0.53966	0.677000	0.39632	8.730000	0.91510	1.917000	0.55516	0.443000	0.29094	CTT	.		0.602	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
GRIN2A	2903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	9858489	9858489	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:9858489T>C	ENST00000396573.2	-	14	3221	c.2912A>G	c.(2911-2913)cAg>cGg	p.Q971R	GRIN2A_ENST00000404927.2_Missense_Mutation_p.Q971R|GRIN2A_ENST00000562109.1_Missense_Mutation_p.Q971R|GRIN2A_ENST00000535259.1_Missense_Mutation_p.Q814R|GRIN2A_ENST00000330684.3_Missense_Mutation_p.Q971R|GRIN2A_ENST00000396575.2_Missense_Mutation_p.Q971R	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	971					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTATCCTTCTGCCGGTTGGC	0.468																																					p.Q971R		.											.	GRIN2A-349	0			c.A2912G						.						151.0	131.0	137.0					16																	9858489		2197	4300	6497	SO:0001583	missense	2903	exon14			TCCTTCTGCCGGT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2912A>G	16.37:g.9858489T>C	ENSP00000379818:p.Gln971Arg	96	0		84	27	NM_000833	0	0	0	0	0	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	T	5.637	0.302152	0.10678	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.11712	2.75;2.75;2.76;2.75;2.75	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.088776	0.85682	D	0.000000	T	0.08714	0.0216	L	0.27053	0.805	0.23293	N	0.997962	B;B;B	0.24317	0.034;0.101;0.005	B;B;B	0.29440	0.062;0.102;0.008	T	0.32428	-0.9907	9	.	.	.	.	10.6354	0.45563	0.0:0.0:0.1607:0.8393	.	814;971;971	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	R	971;971;814;971;971	ENSP00000379818:Q971R;ENSP00000385872:Q971R;ENSP00000441572:Q814R;ENSP00000332549:Q971R;ENSP00000379820:Q971R	.	Q	-	2	0	GRIN2A	9765990	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.691000	0.61738	2.016000	0.59253	0.533000	0.62120	CAG	.		0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31373395	31373395	+	Splice_Site	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:31373395G>A	ENST00000268296.4	+	11	1207		c.e11-1		ITGAX_ENST00000562522.1_Splice_Site	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TTTTCTCCCAGGATGGCCCCG	0.592																																					.		.											.	ITGAX-229	0			c.1087-1G>A						.						82.0	87.0	86.0					16																	31373395		2197	4300	6497	SO:0001630	splice_region_variant	3687	exon11			CTCCCAGGATGGC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1087-1G>A	16.37:g.31373395G>A		94	0		74	10	NM_000887	0	0	0	0	0	Q8IVA6	Splice_Site	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	g	13.52	2.262216	0.39995	.	.	ENSG00000140678	ENST00000268296	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4899	0.67645	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAX	31280896	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	5.608000	0.67654	2.217000	0.71921	0.580000	0.79431	.	.		0.592	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	Intron
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31383064	31383064	+	Missense_Mutation	SNP	G	G	A	rs368436373		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:31383064G>A	ENST00000268296.4	+	17	2240	c.2119G>A	c.(2119-2121)Ggg>Agg	p.G707R	ITGAX_ENST00000562522.1_Missense_Mutation_p.G707R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	707					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCGAGTCCTCGGGCTGAAGGC	0.652																																					p.G707R		.											.	ITGAX-229	0			c.G2119A						.	G	ARG/GLY	0,4394		0,0,2197	60.0	54.0	56.0		2119	4.4	0.0	16		56	2,8598	2.2+/-6.3	0,2,4298	no	missense	ITGAX	NM_000887.3	125	0,2,6495	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	707/1164	31383064	2,12992	2197	4300	6497	SO:0001583	missense	3687	exon17			GTCCTCGGGCTGA	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2119G>A	16.37:g.31383064G>A	ENSP00000268296:p.Gly707Arg	59	0		54	5	NM_000887	0	1	33	34	0	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741680	0.49151	0.0	2.33E-4	ENSG00000140678	ENST00000268296	T	0.44881	0.91	5.4	4.43	0.53597	Integrin alpha-2 (1);	.	.	.	.	T	0.51398	0.1672	L	0.55834	1.745	0.09310	N	1	D	0.59767	0.986	P	0.56514	0.8	T	0.38436	-0.9661	9	0.49607	T	0.09	.	10.5956	0.45336	0.0933:0.0:0.9067:0.0	.	707	P20702	ITAX_HUMAN	R	707	ENSP00000268296:G707R	ENSP00000268296:G707R	G	+	1	0	ITGAX	31290565	0.076000	0.21285	0.028000	0.17463	0.033000	0.12548	2.282000	0.43461	2.662000	0.90505	0.655000	0.94253	GGG	.		0.652	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
CLUH	23277	bcgsc.ca	37	17	2601710	2601710	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:2601710C>T	ENST00000570628.2	-	10	1432	c.1327G>A	c.(1327-1329)Gtg>Atg	p.V443M	CLUH_ENST00000435359.1_Missense_Mutation_p.V443M|CLUH_ENST00000538975.1_Missense_Mutation_p.V443M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	443					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TAGGCCGCCACGTCCCCCCCG	0.627																																					p.V443M													.	.	0			c.G1327A						.						45.0	52.0	50.0					17																	2601710		2123	4211	6334	SO:0001583	missense	23277	exon10			CCGCCACGTCCCC	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.1327G>A	17.37:g.2601710C>T	ENSP00000458986:p.Val443Met	106	0		108	5	NM_015229	0	0	26	26	0	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904464	0.52333	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.80393	-1.37;-1.37	5.41	5.41	0.78517	.	0.289374	0.39210	N	0.001425	T	0.76018	0.3929	N	0.14661	0.345	0.35837	D	0.825776	D;D	0.61697	0.99;0.981	P;P	0.56648	0.803;0.803	T	0.80061	-0.1540	10	0.38643	T	0.18	.	11.6201	0.51113	0.0:0.9191:0.0:0.0809	.	443;443	O75153;C9J6D7	K0664_HUMAN;.	M	443	ENSP00000388872:V443M;ENSP00000439628:V443M	ENSP00000320468:V443M	V	-	1	0	KIAA0664	2548460	0.996000	0.38824	0.998000	0.56505	0.297000	0.27493	2.506000	0.45433	2.532000	0.85374	0.655000	0.94253	GTG	.		0.627	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
MFAP4	4239	broad.mit.edu	37	17	19288499	19288499	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:19288499C>T	ENST00000299610.4	-	5	517	c.433G>A	c.(433-435)Gct>Act	p.A145T	MFAP4_ENST00000574313.2_5'Flank|MFAP4_ENST00000497081.2_Missense_Mutation_p.A170T|MFAP4_ENST00000395592.2_Missense_Mutation_p.A169T	NM_002404.2	NP_002395.1	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4	145	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cellular response to UV-B (GO:0071493)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|regulation of collagen metabolic process (GO:0010712)|UV protection (GO:0009650)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)				large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	10	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GAGAAGTCAGCGTACTTGGCA	0.577																																					p.A169T													.	MFAP4-514	0			c.G505A						.						184.0	131.0	149.0					17																	19288499		2203	4300	6503	SO:0001583	missense	4239	exon5			AGTCAGCGTACTT	L38486	CCDS11208.1, CCDS56023.1	17p11.2	2013-02-06			ENSG00000166482	ENSG00000166482		"""Fibrinogen C domain containing"""	7035	protein-coding gene	gene with protein product	"""microfibril-associated glycoprotein 4"""	600596				7633408	Standard	NM_001198695		Approved		uc002gvs.3	P55083	OTTHUMG00000059585	ENST00000299610.4:c.433G>A	17.37:g.19288499C>T	ENSP00000299610:p.Ala145Thr	125	0		109	5	NM_001198695	0	0	106	106	0	A8KAJ1|A8MVM2|B4E317|Q6P680	Missense_Mutation	SNP	ENST00000299610.4	37	CCDS11208.1	.	.	.	.	.	.	.	.	.	.	c	7.070	0.568193	0.13560	.	.	ENSG00000166482	ENST00000395592;ENST00000299610	T;T	0.20881	2.04;2.04	5.0	-0.0266	0.13930	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	1.423620	0.04430	N	0.369121	T	0.10680	0.0261	N	0.05608	-0.01	0.09310	N	1	B;B	0.16396	0.001;0.017	B;B	0.12837	0.003;0.008	T	0.29181	-1.0020	10	0.26408	T	0.33	.	5.4949	0.16797	0.0:0.5367:0.1482:0.3151	.	145;169	P55083;A8MVM2	MFAP4_HUMAN;.	T	169;145	ENSP00000378957:A169T;ENSP00000299610:A145T	ENSP00000299610:A145T	A	-	1	0	MFAP4	19229092	0.000000	0.05858	0.003000	0.11579	0.115000	0.19883	-0.283000	0.08433	0.158000	0.19367	0.550000	0.68814	GCT	.		0.577	MFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132493.2	NM_002404	
PSMD11	5717	broad.mit.edu	37	17	30771555	30771555	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:30771555C>T	ENST00000261712.3	+	1	277	c.14C>T	c.(13-15)gCg>gTg	p.A5V	PSMD11_ENST00000457654.2_Missense_Mutation_p.A5V	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gcggcggcggcggtggtggAG	0.701																																					p.A5V	Ovarian(130;1038 1716 9294 11987 19279)												.	PSMD11-91	0			c.C14T						.						18.0	18.0	18.0					17																	30771555		2186	4270	6456	SO:0001583	missense	5717	exon1			CGGCGGCGGTGGT	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.14C>T	17.37:g.30771555C>T	ENSP00000261712:p.Ala5Val	120	1		152	6	NM_002815	0	0	12	12	0	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	ENST00000261712.3	37	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999150	0.74818	.	.	ENSG00000108671	ENST00000261712	.	.	.	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.24928	0.0605	N	0.08118	0	0.53688	D	0.999975	P;B	0.37038	0.579;0.212	B;B	0.33392	0.163;0.049	T	0.08086	-1.0739	9	0.27785	T	0.31	-19.5166	11.4424	0.50105	0.0:0.9133:0.0:0.0867	.	5;5	B4DTS5;O00231	.;PSD11_HUMAN	V	5	.	ENSP00000261712:A5V	A	+	2	0	PSMD11	27795668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.945000	0.75947	1.455000	0.47813	0.558000	0.71614	GCG	.		0.701	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815	
SRSF1	6426	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	56083837	56083837	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:56083837G>T	ENST00000258962.4	-	2	454	c.246C>A	c.(244-246)taC>taA	p.Y82*	SRSF1_ENST00000581497.1_5'Flank|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000585096.1_Intron|SRSF1_ENST00000582730.2_Nonsense_Mutation_p.Y82*|SRSF1_ENST00000584773.1_Nonsense_Mutation_p.Y82*	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	82	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Y82*(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCCGCAGACGGTACCCATCGT	0.637																																					p.Y82X		.											.	SRSF1-290	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C246A						.						30.0	28.0	29.0					17																	56083837		2203	4298	6501	SO:0001587	stop_gained	6426	exon2			CAGACGGTACCCA		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.246C>A	17.37:g.56083837G>T	ENSP00000258962:p.Tyr82*	223	0		206	20	NM_006924	0	0	22	24	2	B2R6Z7|D3DTZ3|Q13809	Nonsense_Mutation	SNP	ENST00000258962.4	37	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149607	0.78001	.	.	ENSG00000136450	ENST00000258962	.	.	.	5.96	-2.82	0.05787	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	13.3631	0.60667	0.5712:0.0:0.4287:0.0	.	.	.	.	X	82	.	ENSP00000258962:Y82X	Y	-	3	2	SRSF1	53438836	1.000000	0.71417	0.931000	0.37212	0.911000	0.54048	0.912000	0.28597	-0.291000	0.09012	-0.794000	0.03295	TAC	.		0.637	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
NETO1	81832	hgsc.bcm.edu;bcgsc.ca	37	18	70450990	70450990	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr18:70450990A>T	ENST00000327305.6	-	7	1448	c.791T>A	c.(790-792)cTt>cAt	p.L264H	NETO1_ENST00000583169.1_Missense_Mutation_p.L264H|NETO1_ENST00000299430.2_Missense_Mutation_p.L263H	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	264	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATCACCCCAAGACCCGTGCG	0.478																																					p.L264H		.											.	NETO1-94	0			c.T791A						.						193.0	165.0	174.0					18																	70450990		2203	4300	6503	SO:0001583	missense	81832	exon7			ACCCCAAGACCCG	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.791T>A	18.37:g.70450990A>T	ENSP00000313088:p.Leu264His	74	0		88	7	NM_001201465	0	0	0	0	0	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.261669	0.80358	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.18174	2.23;2.23	5.27	5.27	0.74061	CUB (5);	0.000000	0.53938	D	0.000058	T	0.36082	0.0954	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.87578	0.998;0.957	T	0.08146	-1.0736	10	0.72032	D	0.01	-10.3986	15.5016	0.75703	1.0:0.0:0.0:0.0	.	263;264	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	H	264;263	ENSP00000313088:L264H;ENSP00000299430:L263H	ENSP00000299430:L263H	L	-	2	0	NETO1	68601970	1.000000	0.71417	0.058000	0.19502	0.790000	0.44656	9.287000	0.95975	2.102000	0.63906	0.528000	0.53228	CTT	.		0.478	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	2226194	2226194	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:2226194C>T	ENST00000398665.3	+	27	3710	c.3674C>T	c.(3673-3675)gCg>gTg	p.A1225V		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1225					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGGCTTGGCGGGAAGGAAG	0.677																																					p.A1225V		.											.	DOT1L-132	0			c.C3674T						.						12.0	16.0	15.0					19																	2226194		1920	4101	6021	SO:0001583	missense	84444	exon27			GCTTGGCGGGAAG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3674C>T	19.37:g.2226194C>T	ENSP00000381657:p.Ala1225Val	63	0		68	12	NM_032482	0	0	0	0	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379238	0.24944	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.30182	1.95;1.54	4.54	-0.654	0.11443	.	1.117080	0.06764	N	0.782394	T	0.21103	0.0508	L	0.31294	0.92	0.09310	N	1	B;B	0.16396	0.002;0.017	B;B	0.09377	0.001;0.004	T	0.32719	-0.9896	10	0.87932	D	0	-8.2664	5.1085	0.14796	0.0:0.5858:0.1604:0.2538	.	1225;1225	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	V	1225;1225;105	ENSP00000381657:A1225V;ENSP00000407411:A105V	ENSP00000221482:A1225V	A	+	2	0	DOT1L	2177194	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	0.096000	0.15147	-0.246000	0.09611	0.491000	0.48974	GCG	.		0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
SUGP1	57794	broad.mit.edu	37	19	19416711	19416711	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:19416711T>C	ENST00000247001.5	-	4	832	c.485A>G	c.(484-486)cAg>cGg	p.Q162R	SUGP1_ENST00000334782.5_Missense_Mutation_p.Q162R|SUGP1_ENST00000585763.1_5'UTR	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	162					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GTCAGGGGACTGGAAGACACT	0.662																																					p.Q162R													.	SUGP1-91	0			c.A485G						.						54.0	53.0	53.0					19																	19416711		2203	4300	6503	SO:0001583	missense	57794	exon4			GGGGACTGGAAGA	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.485A>G	19.37:g.19416711T>C	ENSP00000247001:p.Gln162Arg	67	0		47	3	NM_172231	0	0	7	7	0	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	ENST00000247001.5	37	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.697947	0.48307	.	.	ENSG00000105705	ENST00000247001;ENST00000535070;ENST00000334782	T	0.23348	1.91	4.44	4.44	0.53790	.	0.216607	0.44097	D	0.000485	T	0.22781	0.0550	L	0.59436	1.845	0.33038	D	0.531103	P	0.36199	0.543	B	0.31946	0.138	T	0.29488	-1.0010	10	0.17832	T	0.49	.	12.5289	0.56102	0.0:0.0:0.0:1.0	.	162	Q8IWZ8	SUGP1_HUMAN	R	162	ENSP00000247001:Q162R	ENSP00000247001:Q162R	Q	-	2	0	SUGP1	19277711	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	3.078000	0.50096	1.650000	0.50662	0.460000	0.39030	CAG	.		0.662	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460128.4	NM_021164	
PDCD2L	84306	broad.mit.edu	37	19	34895341	34895341	+	Silent	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:34895341G>T	ENST00000246535.3	+	1	53	c.6G>T	c.(4-6)gcG>gcT	p.A2A	PDCD2L_ENST00000587065.2_5'Flank|RP11-618P17.4_ENST00000606020.1_Intron	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	2					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CGGCCATGGCGGCCGTTCTGA	0.662																																					p.A2A													.	PDCD2L-91	0			c.G6T						.						3.0	4.0	4.0					19																	34895341		1697	3332	5029	SO:0001819	synonymous_variant	84306	exon1			CATGGCGGCCGTT	BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.6G>T	19.37:g.34895341G>T		80	1		73	3	NM_032346	0	0	0	0	0		Silent	SNP	ENST00000246535.3	37	CCDS12438.1																																																																																			.		0.662	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38948847	38948847	+	Nonsense_Mutation	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:38948847C>G	ENST00000359596.3	+	18	2082	c.2082C>G	c.(2080-2082)taC>taG	p.Y694*	RYR1_ENST00000360985.3_Nonsense_Mutation_p.Y694*|RYR1_ENST00000355481.4_Nonsense_Mutation_p.Y694*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	694	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACACCCCCTACCCTGGGGCCG	0.637																																					p.Y694X		.											.	RYR1-100	0			c.C2082G						.						52.0	51.0	51.0					19																	38948847		2203	4300	6503	SO:0001587	stop_gained	6261	exon18			CCCCTACCCTGGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2082C>G	19.37:g.38948847C>G	ENSP00000352608:p.Tyr694*	55	0		46	8	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	41	8.988435	0.99027	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	5.02	5.02	0.67125	.	0.000000	0.64402	U	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9369	0.58320	0.0:0.9196:0.0:0.0804	.	.	.	.	X	694	.	ENSP00000347667:Y694X	Y	+	3	2	RYR1	43640687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.109000	0.41863	2.623000	0.88846	0.549000	0.68633	TAC	.		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PSG5	5673	hgsc.bcm.edu;broad.mit.edu	37	19	43679366	43679366	+	Splice_Site	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:43679366C>T	ENST00000366175.3	-	4	1095		c.e4+1		PSG5_ENST00000599812.1_Splice_Site|PSG5_ENST00000407568.1_Intron|PSG5_ENST00000404580.1_Missense_Mutation_p.G322D|PSG5_ENST00000407356.1_Splice_Site|PSG5_ENST00000342951.6_Splice_Site			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				GATCCACTTACCAGAGACTTC	0.463																																					.		.											.	PSG5-93	0			c.964+1G>A						.						125.0	148.0	140.0					19																	43679366		2202	4292	6494	SO:0001630	splice_region_variant	5673	exon5			CACTTACCAGAGA		CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.964+1G>A	19.37:g.43679366C>T		153	0		114	12	NM_002781	0	0	0	0	0	Q15239|Q96QJ1|Q9UQ75	Splice_Site	SNP	ENST00000366175.3	37	CCDS12617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|c	5.814|5.814	0.334421|0.334421	0.11013|0.11013	.|.	.|.	ENSG00000204941|ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000342951|ENST00000404580	.|T	.|0.01252	.|5.1	1.25|1.25	1.25|1.25	0.21368|0.21368	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00967	.|0.0032	.|.	.|.	.|.	0.23661|0.23661	N|N	0.99718|0.99718	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49634	.|-0.8919	.|6	.|0.15499	.|T	.|0.54	.|.	5.8107|5.8107	0.18465|0.18465	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|D	-1|322	.|ENSP00000385250:G322D	.|ENSP00000385250:G322D	.|G	-|-	.|2	.|0	PSG5|PSG5	48371206|48371206	0.321000|0.321000	0.24625|0.24625	0.181000|0.181000	0.23098|0.23098	0.040000|0.040000	0.13550|0.13550	0.696000|0.696000	0.25541|0.25541	0.644000|0.644000	0.30656|0.30656	0.184000|0.184000	0.17185|0.17185	.|GGT	.		0.463	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1	NM_002781	Intron
NLRP8	126205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56487643	56487643	+	Silent	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:56487643C>T	ENST00000291971.3	+	8	2921	c.2850C>T	c.(2848-2850)aaC>aaT	p.N950N	NLRP8_ENST00000590542.1_Silent_p.N931N	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	950					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CCCTGAAGAACCCTGACTGTA	0.453																																					p.N950N		.											.	NLRP8-361	0			c.C2850T						.						139.0	135.0	136.0					19																	56487643		2203	4300	6503	SO:0001819	synonymous_variant	126205	exon8			GAAGAACCCTGAC	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2850C>T	19.37:g.56487643C>T		188	0		151	22	NM_176811	0	0	0	0	0	Q7RTR4	Silent	SNP	ENST00000291971.3	37	CCDS12937.1																																																																																			.		0.453	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
IFT172	26160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27702392	27702392	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:27702392T>A	ENST00000260570.3	-	10	1092	c.989A>T	c.(988-990)tAt>tTt	p.Y330F	IFT172_ENST00000359466.6_Missense_Mutation_p.Y330F|IFT172_ENST00000416524.2_Missense_Mutation_p.Y309F	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	330					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					AGGTCCCACATACGTCAACTC	0.507																																					p.Y330F		.											.	IFT172-154	0			c.A989T						.						164.0	142.0	150.0					2																	27702392		2203	4300	6503	SO:0001583	missense	26160	exon10			CCCACATACGTCA	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.989A>T	2.37:g.27702392T>A	ENSP00000260570:p.Tyr330Phe	71	0		97	12	NM_015662	0	0	4	4	0	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	37	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.547345	0.65311	.	.	ENSG00000138002	ENST00000260570;ENST00000359466;ENST00000416524	T;T;T	0.23147	1.92;1.92;1.92	5.64	5.64	0.86602	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	M	0.64404	1.975	0.80722	D	1	B;P;B;B	0.35821	0.394;0.523;0.394;0.322	B;B;B;B	0.38378	0.228;0.272;0.144;0.2	T	0.04320	-1.0960	10	0.25106	T	0.35	-9.0488	14.6686	0.68926	0.0:0.0:0.0:1.0	.	330;330;330;330	A5PKZ0;Q9UG01-2;E7EP25;Q9UG01	.;.;.;IF172_HUMAN	F	330;330;309	ENSP00000260570:Y330F;ENSP00000352443:Y330F;ENSP00000407408:Y309F	ENSP00000260570:Y330F	Y	-	2	0	IFT172	27555896	1.000000	0.71417	0.988000	0.46212	0.937000	0.57800	7.558000	0.82253	2.138000	0.66242	0.533000	0.62120	TAT	.		0.507	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
TCF7L1	83439	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	85361150	85361150	+	Silent	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:85361150C>G	ENST00000282111.3	+	2	536	c.261C>G	c.(259-261)cgC>cgG	p.R87R		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	87					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CGGAGAGGCGCCCGCAGCCCG	0.697																																					p.R87R		.											.	TCF7L1-585	0			c.C261G						.						19.0	25.0	23.0					2																	85361150		2200	4299	6499	SO:0001819	synonymous_variant	83439	exon2			GAGGCGCCCGCAG	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.261C>G	2.37:g.85361150C>G		90	0		117	19	NM_031283	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000282111.3	37	CCDS1971.1																																																																																			.		0.697	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
RNF103	7844	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	86832185	86832185	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:86832185A>G	ENST00000237455.4	-	4	1807	c.839T>C	c.(838-840)aTt>aCt	p.I280T	CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|AC015971.2_ENST00000597638.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	280					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						ATATATGCCAATATCTGTCAT	0.353																																					p.I280T		.											.	RNF103-226	0			c.T839C						.						45.0	48.0	47.0					2																	86832185		2203	4300	6503	SO:0001583	missense	7844	exon4			ATGCCAATATCTG	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.839T>C	2.37:g.86832185A>G	ENSP00000237455:p.Ile280Thr	133	0		133	8	NM_005667	0	0	6	6	0	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	37	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790231	0.31685	.	.	ENSG00000239305	ENST00000237455	T	0.48522	0.81	5.1	5.1	0.69264	.	0.052243	0.85682	D	0.000000	T	0.43033	0.1229	L	0.51422	1.61	0.53688	D	0.999973	B	0.20052	0.041	B	0.16289	0.015	T	0.28073	-1.0055	10	0.30078	T	0.28	-13.0155	14.881	0.70534	1.0:0.0:0.0:0.0	.	280	O00237	RN103_HUMAN	T	280	ENSP00000237455:I280T	ENSP00000237455:I280T	I	-	2	0	RNF103	86685696	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.953000	0.93041	1.937000	0.56155	0.377000	0.23210	ATT	.		0.353	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
MALL	7851	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	110873286	110873286	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:110873286G>A	ENST00000272462.2	-	1	857	c.84C>T	c.(82-84)ttC>ttT	p.F28F	MALL_ENST00000427178.1_Silent_p.F28F	NM_005434.4	NP_005425.1	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	28	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cholesterol homeostasis (GO:0042632)	clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	9				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		GGAAGAAGGCGAAAGGGATGG	0.726																																					p.F28F		.											.	MALL-92	0			c.C84T						.						21.0	22.0	21.0					2																	110873286		2184	4286	6470	SO:0001819	synonymous_variant	7851	exon1			GAAGGCGAAAGGG	U17077	CCDS2085.1	2q13	2008-02-05			ENSG00000144063	ENSG00000144063			6818	protein-coding gene	gene with protein product		602022				9326933	Standard	NM_005434		Approved	BENE	uc002tfk.3	Q13021	OTTHUMG00000131196	ENST00000272462.2:c.84C>T	2.37:g.110873286G>A		133	0		178	22	NM_005434	0	0	3	3	0	B3KWR6|Q9BTU0	Silent	SNP	ENST00000272462.2	37	CCDS2085.1																																																																																			.		0.726	MALL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253921.1	NM_005434	
SLC20A1	6574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	113418053	113418053	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:113418053T>C	ENST00000272542.3	+	9	2236	c.1697T>C	c.(1696-1698)cTc>cCc	p.L566P		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	566					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TGGCTTCTACTCTATGGTGGT	0.458																																					p.L566P		.											.	SLC20A1-92	0			c.T1697C						.						180.0	174.0	176.0					2																	113418053		2203	4300	6503	SO:0001583	missense	6574	exon9			TTCTACTCTATGG		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1697T>C	2.37:g.113418053T>C	ENSP00000272542:p.Leu566Pro	211	0		176	29	NM_005415	0	0	12	18	6	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	37	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.570460	0.86542	.	.	ENSG00000144136	ENST00000272542	D	0.91996	-2.95	5.81	5.81	0.92471	.	0.062816	0.64402	D	0.000004	D	0.95191	0.8441	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	D	0.95405	0.8493	10	0.66056	D	0.02	-33.1091	14.1127	0.65132	0.0:0.0:0.0:1.0	.	566;566	A7LNJ1;Q8WUM9	.;S20A1_HUMAN	P	566	ENSP00000272542:L566P	ENSP00000272542:L566P	L	+	2	0	SLC20A1	113134524	1.000000	0.71417	0.926000	0.36857	0.997000	0.91878	8.040000	0.89188	2.226000	0.72624	0.482000	0.46254	CTC	.		0.458	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
INHBB	3625	hgsc.bcm.edu	37	2	121106693	121106693	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:121106693G>A	ENST00000295228.3	+	2	513	c.467G>A	c.(466-468)cGg>cAg	p.R156Q		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	156					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)	p.R156Q(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				GCCTCCTCCCGGGTCCGCCTA	0.557																																					p.R156Q		.											.	INHBB-93	1	Substitution - Missense(1)	large_intestine(1)	c.G467A						.						53.0	58.0	56.0					2																	121106693		2203	4300	6503	SO:0001583	missense	3625	exon2			CCTCCCGGGTCCG		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.467G>A	2.37:g.121106693G>A	ENSP00000295228:p.Arg156Gln	133	0		96	5	NM_002193	0	0	3	3	0	Q53T31|Q8N1D3	Missense_Mutation	SNP	ENST00000295228.3	37	CCDS2132.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.497539	0.26861	.	.	ENSG00000163083	ENST00000295228	T	0.66995	-0.24	5.09	5.09	0.68999	Transforming growth factor-beta, N-terminal (1);	0.555848	0.17053	N	0.188863	T	0.53850	0.1822	L	0.31664	0.95	0.33909	D	0.639429	B	0.24823	0.112	B	0.26094	0.066	T	0.59316	-0.7477	10	0.30854	T	0.27	-3.725	11.2497	0.49017	0.0848:0.0:0.9151:0.0	.	156	P09529	INHBB_HUMAN	Q	156	ENSP00000295228:R156Q	ENSP00000295228:R156Q	R	+	2	0	INHBB	120823163	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.966000	0.70395	2.804000	0.96469	0.655000	0.94253	CGG	.		0.557	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
EEF1B2	1933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	207027278	207027278	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:207027278A>T	ENST00000392222.2	+	5	838	c.463A>T	c.(463-465)Atg>Ttg	p.M155L	SNORA41_ENST00000384675.1_RNA|EEF1B2_ENST00000392221.1_Missense_Mutation_p.M155L|NDUFS1_ENST00000233190.6_5'Flank|SNORD51_ENST00000384320.2_RNA|EEF1B2_ENST00000236957.5_Missense_Mutation_p.M155L	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	155					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TGAGACAGATATGGCGAAATT	0.388																																					p.M155L		.											.	EEF1B2-227	0			c.A463T						.						125.0	132.0	129.0					2																	207027278		2203	4300	6503	SO:0001583	missense	1933	exon6			ACAGATATGGCGA	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.463A>T	2.37:g.207027278A>T	ENSP00000376056:p.Met155Leu	206	0		209	28	NM_021121	1	0	640	769	128	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.990128	0.54041	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222	.	.	.	5.24	5.24	0.73138	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.071117	0.85682	D	0.000000	T	0.54902	0.1887	L	0.39245	1.2	0.80722	D	1	B	0.02656	0.0	B	0.20384	0.029	T	0.50651	-0.8803	9	0.33940	T	0.23	-16.9302	15.1403	0.72607	1.0:0.0:0.0:0.0	.	155	P24534	EF1B_HUMAN	L	155	.	ENSP00000236957:M155L	M	+	1	0	EEF1B2	206735523	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	9.237000	0.95368	1.984000	0.57885	0.533000	0.62120	ATG	.		0.388	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
COL4A3	1285	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228131751	228131751	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:228131751G>T	ENST00000396578.3	+	23	1613	c.1451G>T	c.(1450-1452)gGg>gTg	p.G484V	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	484	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TATATCCCAGGGCCTCCCGGT	0.468																																					p.G484V													.	COL4A3-132	0			c.G1451T						.						66.0	66.0	66.0					2																	228131751		1865	4098	5963	SO:0001583	missense	1285	exon23			TCCCAGGGCCTCC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.1451G>T	2.37:g.228131751G>T	ENSP00000379823:p.Gly484Val	56	1		74	14	NM_000091	0	0	0	1	1	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	37	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971284	0.34754	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.99353	-5.77	5.36	5.36	0.76844	.	0.000000	0.56097	D	0.000028	D	0.99579	0.9848	H	0.95365	3.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97996	1.0357	10	0.72032	D	0.01	.	14.5754	0.68243	0.0:0.0:1.0:0.0	.	484;484;484;484	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	V	484	ENSP00000379823:G484V	ENSP00000323334:G484V	G	+	2	0	COL4A3	227839995	1.000000	0.71417	0.778000	0.31720	0.010000	0.07245	4.981000	0.63819	2.515000	0.84797	0.655000	0.94253	GGG	.		0.468	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
RAB17	64284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238494741	238494741	+	Silent	SNP	C	C	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:238494741C>A	ENST00000264601.3	-	2	686	c.57G>T	c.(55-57)gtG>gtT	p.V19V	RAB17_ENST00000416106.1_5'UTR|RAB17_ENST00000409576.1_Intron|RAB17_ENST00000409822.1_Intron|RAB17_ENST00000538644.1_5'UTR	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	19			V -> A (in dbSNP:rs3751112). {ECO:0000269|Ref.3}.		cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		CCAGCTTGAACACACGGGGCT	0.597																																					p.V19V	Colon(56;987 1029 6466 13943 27336)	.											.	RAB17-227	0			c.G57T						.						57.0	57.0	57.0					2																	238494741		2203	4300	6503	SO:0001819	synonymous_variant	64284	exon2			CTTGAACACACGG	AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.57G>T	2.37:g.238494741C>A		116	0		120	18	NM_022449	0	0	24	37	13	Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Silent	SNP	ENST00000264601.3	37	CCDS2520.1	.	.	.	.	.	.	.	.	.	.	C	6.279	0.419620	0.11928	.	.	ENSG00000124839	ENST00000430445	.	.	.	4.69	-3.2	0.05156	.	.	.	.	.	T	0.49029	0.1533	.	.	.	0.58432	D	0.999991	.	.	.	.	.	.	T	0.40515	-0.9559	4	.	.	.	-6.0609	5.8207	0.18526	0.0869:0.4881:0.2678:0.1572	.	.	.	.	F	1	.	.	C	-	2	0	RAB17	238159480	0.001000	0.12720	0.004000	0.12327	0.070000	0.16714	-0.140000	0.10342	-0.948000	0.03668	-1.094000	0.02160	TGT	.		0.597	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257084.2		
HDLBP	3069	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242173343	242173343	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:242173343G>A	ENST00000391975.1	-	24	3407	c.3180C>T	c.(3178-3180)gaC>gaT	p.D1060D	HDLBP_ENST00000391976.2_Silent_p.D1060D|HDLBP_ENST00000427183.2_Silent_p.D1027D|HDLBP_ENST00000310931.4_Silent_p.D1060D	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	1060	KH 13. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GGTATTTGGGGTCTACAGTGA	0.468																																					p.D1060D													.	HDLBP-290	0			c.C3180T						.						159.0	146.0	151.0					2																	242173343		2203	4300	6503	SO:0001819	synonymous_variant	3069	exon24			TTTGGGGTCTACA		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.3180C>T	2.37:g.242173343G>A		124	0		90	5	NM_005336	0	0	90	123	33	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	37	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	G	9.945	1.218600	0.22373	.	.	ENSG00000115677	ENST00000373292	.	.	.	5.56	-0.0544	0.13813	.	.	.	.	.	T	0.59797	0.2220	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56685	-0.7938	4	.	.	.	-47.1969	12.584	0.56406	0.4388:0.0:0.5612:0.0	.	.	.	.	S	869	.	.	P	-	1	0	HDLBP	241822016	0.997000	0.39634	0.995000	0.50966	0.986000	0.74619	0.367000	0.20382	0.046000	0.15833	0.563000	0.77884	CCC	.		0.468	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
ACTR5	79913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	37383625	37383625	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr20:37383625T>C	ENST00000243903.4	+	4	838	c.801T>C	c.(799-801)gaT>gaC	p.D267D		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	267					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GGTGTCCTGATTATTATGAGA	0.418																																					p.D267D		.											.	ACTR5-90	0			c.T801C						.						67.0	71.0	70.0					20																	37383625		2203	4300	6503	SO:0001819	synonymous_variant	79913	exon4			TCCTGATTATTAT	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.801T>C	20.37:g.37383625T>C		245	0		256	56	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			.		0.418	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
PREX1	57580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47361658	47361658	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr20:47361658G>A	ENST00000371941.3	-	3	340	c.318C>T	c.(316-318)atC>atT	p.I106I	PREX1_ENST00000396220.1_Silent_p.I106I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	106	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GAACTTCCAGGATGTCTTCGA	0.473																																					p.I106I		.											.	PREX1-231	0			c.C318T						.						159.0	163.0	162.0					20																	47361658		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon3			TTCCAGGATGTCT	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.318C>T	20.37:g.47361658G>A		130	0		79	22	NM_020820	0	0	4	4	0	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																			.		0.473	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
GNAS	2778	broad.mit.edu	37	20	57429158	57429158	+	Missense_Mutation	SNP	G	G	A	rs542409237		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr20:57429158G>A	ENST00000371100.4	+	1	1390	c.838G>A	c.(838-840)Gcc>Acc	p.A280T	GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_Silent_p.A216A|GNAS_ENST00000371102.4_Missense_Mutation_p.A280T|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371099.2_Missense_Mutation_p.A280T|GNAS_ENST00000313949.7_Intron	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0			R -> G (in PHP1A). {ECO:0000269|PubMed:11926205}.|R -> K (in PHP1A). {ECO:0000269|PubMed:11788646}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GGTCCCAGGCGCCATCGGCAG	0.682			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)			G|||	1	0.000199681	0.0	0.0	5008	,	,		14006	0.001		0.0	False		,,,				2504	0.0				p.A280T	Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS-4767	0			c.G838A						.						13.0	15.0	15.0					20																	57429158		1827	4020	5847	SO:0001583	missense	2778	exon1			CCAGGCGCCATCG	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.838G>A	20.37:g.57429158G>A	ENSP00000360141:p.Ala280Thr	95	0		120	4	NM_080425	0	0	0	0	0	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	37	CCDS46622.1	.	.	.	.	.	.	.	.	.	.	G	7.769	0.707084	0.15239	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.90261	-2.64;-2.63	4.03	1.02	0.19986	.	12.416800	0.00751	N	0.001065	D	0.83275	0.5219	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.68618	-0.5361	10	0.27785	T	0.31	.	6.1229	0.20164	0.3301:0.0:0.6699:0.0	.	280	Q5JWF2	GNAS1_HUMAN	T	280	ENSP00000360141:A280T;ENSP00000360143:A280T	ENSP00000360140:A280T	A	+	1	0	GNAS	56862553	0.001000	0.12720	0.001000	0.08648	0.197000	0.23852	0.342000	0.19926	0.272000	0.22027	-0.254000	0.11334	GCC	.		0.682	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	NM_000516	
SLC25A1	6576	broad.mit.edu	37	22	19165669	19165669	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr22:19165669T>G	ENST00000215882.5	-	2	335	c.179A>C	c.(178-180)cAc>cCc	p.H60P	CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000461267.1_5'UTR|SLC25A1_ENST00000451283.1_5'UTR	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	60					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CCGCGGCGGGTGCGAGCGCTC	0.746																																					p.H67P													.	SLC25A1-90	0			c.A200C						.						7.0	8.0	7.0					22																	19165669		2051	4085	6136	SO:0001583	missense	6576	exon1			GGCGGGTGCGAGC	U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.179A>C	22.37:g.19165669T>G	ENSP00000215882:p.His60Pro	47	3		101	19	NM_001256534	0	0	29	30	1	A8K8E8|Q9BSK6	Missense_Mutation	SNP	ENST00000215882.5	37	CCDS13758.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874271	0.51695	.	.	ENSG00000100075	ENST00000215882	T	0.78364	-1.17	4.77	3.7	0.42460	Mitochondrial carrier domain (2);	0.321554	0.31233	N	0.008017	T	0.55497	0.1924	N	0.04655	-0.195	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43556	-0.9384	10	0.29301	T	0.29	-14.0182	11.3684	0.49686	0.0:0.0:0.1523:0.8477	.	60	P53007	TXTP_HUMAN	P	60	ENSP00000215882:H60P	ENSP00000215882:H60P	H	-	2	0	SLC25A1	17545669	1.000000	0.71417	0.407000	0.26434	0.997000	0.91878	5.920000	0.70017	0.638000	0.30545	0.448000	0.29417	CAC	.		0.746	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316441.1	NM_005984	
GSTT1	2952	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	24384206	24384206	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr22:24384206A>T	ENST00000248935.5	-	1	78	c.26T>A	c.(25-27)cTg>cAg	p.L9Q	GSTT1_ENST00000439996.2_5'UTR	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN		9	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	CTGGGACAGCAGGTCCAGGTA	0.592									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																												p.L9Q		.											.	GSTT1-91	0			c.T26A						.						77.0	72.0	74.0					22																	24384206		1700	3601	5301	SO:0001583	missense	2952	exon1	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML	GACAGCAGGTCCA																												ENST00000248935.5:c.26T>A	22.37:g.24384206A>T	ENSP00000248935:p.Leu9Gln	86	0		84	22	NM_000853	0	0	0	0	0	O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Missense_Mutation	SNP	ENST00000248935.5	37	CCDS13822.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.911220	0.92178	.	.	ENSG00000184674	ENST00000248935;ENST00000382792;ENST00000452369;ENST00000417870;ENST00000447865	T;T;T	0.64085	-0.08;-0.08;-0.08	5.31	5.31	0.75309	Glutathione S-transferase, N-terminal (1);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000006	T	0.77922	0.4203	M	0.80508	2.5	0.80722	D	1	D	0.63046	0.992	D	0.63957	0.92	T	0.81464	-0.0921	10	0.87932	D	0	-11.7318	13.568	0.61830	1.0:0.0:0.0:0.0	.	9	P30711	GSTT1_HUMAN	Q	9	ENSP00000248935:L9Q;ENSP00000406003:L9Q;ENSP00000397362:L9Q	ENSP00000248935:L9Q	L	-	2	0	GSTT1	22714206	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	8.005000	0.88553	2.163000	0.67991	0.451000	0.29950	CTG	.		0.592	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320184.2		
CCDC117	150275	broad.mit.edu;bcgsc.ca	37	22	29176936	29176936	+	Splice_Site	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr22:29176936T>A	ENST00000249064.4	+	3	416	c.240T>A	c.(238-240)gaT>gaA	p.D80E	CCDC117_ENST00000448492.2_Splice_Site_p.R62R|CCDC117_ENST00000443309.2_5'UTR|CCDC117_ENST00000421503.2_Intron	NM_001284263.1|NM_001284265.1|NM_173510.2	NP_001271192.1|NP_001271194.1|NP_775781.1	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117	80										breast(1)|kidney(1)|large_intestine(4)|upper_aerodigestive_tract(1)	7						TTTTTTTCAGTTGTCCAGTAA	0.338																																					p.D80E													.	CCDC117-91	0			c.T240A						.						47.0	44.0	45.0					22																	29176936		2203	4300	6503	SO:0001630	splice_region_variant	150275	exon3			TTTCAGTTGTCCA	AK091133	CCDS13846.1, CCDS63435.1, CCDS63436.1	22q12.1	2006-06-27			ENSG00000159873	ENSG00000159873			26599	protein-coding gene	gene with protein product						12477932	Standard	NM_001284263		Approved	FLJ33814	uc003aeb.3	Q8IWD4	OTTHUMG00000151091	ENST00000249064.4:c.240-1T>A	22.37:g.29176936T>A		149	1		102	10	NM_173510	0	0	0	0	0	A8K0F1|B7Z2V1|B7Z860|Q6ICA7|Q8N278	Missense_Mutation	SNP	ENST00000249064.4	37	CCDS13846.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.299486	0.23650	.	.	ENSG00000159873	ENST00000249064	T	0.17528	2.27	5.37	1.95	0.26073	.	0.365309	0.26757	N	0.022642	T	0.06735	0.0172	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.34601	-0.9822	9	.	.	.	.	2.228	0.03989	0.1453:0.0882:0.321:0.4454	.	80	Q8IWD4	CC117_HUMAN	E	80	ENSP00000249064:D80E	.	D	+	3	2	CCDC117	27506936	0.993000	0.37304	0.924000	0.36721	0.943000	0.58893	0.209000	0.17435	0.017000	0.15025	0.459000	0.35465	GAT	.		0.338	CCDC117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321258.1	NM_173510	Missense_Mutation
SLC6A6	6533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	14508107	14508107	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:14508107A>G	ENST00000454876.2	+	7	1145	c.816A>G	c.(814-816)gcA>gcG	p.A272A	SLC6A6_ENST00000360861.3_Silent_p.A272A			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	272				A -> R (in Ref. 1; CAA79481). {ECO:0000305}.	amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GCGCGGGCGCAGGCATCAAGT	0.632																																					p.A272A		.											.	SLC6A6-91	0			c.A816G						.						80.0	70.0	73.0					3																	14508107		2203	4300	6503	SO:0001819	synonymous_variant	6533	exon7			GGGCGCAGGCATC		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.816A>G	3.37:g.14508107A>G		60	0		64	9	NM_003043	0	0	4	4	0	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	ENST00000454876.2	37	CCDS33705.1																																																																																			.		0.632	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
TMEM115	11070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50396218	50396218	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:50396218A>G	ENST00000266025.3	-	1	823	c.277T>C	c.(277-279)Tgg>Cgg	p.W93R	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	93					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AAGGCCCCCCAGAGGGGCTCC	0.622																																					p.W93R		.											.	TMEM115-278	0			c.T277C						.						55.0	68.0	64.0					3																	50396218		2203	4300	6503	SO:0001583	missense	11070	exon1			CCCCCCAGAGGGG	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.277T>C	3.37:g.50396218A>G	ENSP00000266025:p.Trp93Arg	89	0		86	12	NM_007024	0	0	94	122	28	A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	ENST00000266025.3	37	CCDS2828.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371161	0.82573	.	.	ENSG00000126062	ENST00000266025	T	0.11712	2.75	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46555	-0.9183	10	0.87932	D	0	.	14.4388	0.67301	1.0:0.0:0.0:0.0	.	93	Q12893	TM115_HUMAN	R	93	ENSP00000266025:W93R	ENSP00000266025:W93R	W	-	1	0	TMEM115	50371222	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.943000	0.92975	2.110000	0.64415	0.460000	0.39030	TGG	.		0.622	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102784.3	NM_007024	
P2RY1	5028	hgsc.bcm.edu;broad.mit.edu	37	3	152554007	152554007	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:152554007A>G	ENST00000305097.3	+	1	1272	c.436A>G	c.(436-438)Agt>Ggt	p.S146G		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	146					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GACATGCATCAGTGCCCACCG	0.507																																					p.S146G		.											.	P2RY1-500	0			c.A436G						.						91.0	79.0	83.0					3																	152554007		2203	4300	6503	SO:0001583	missense	5028	exon1			TGCATCAGTGCCC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.436A>G	3.37:g.152554007A>G	ENSP00000304767:p.Ser146Gly	82	0		90	5	NM_002563	0	0	0	0	0		Missense_Mutation	SNP	ENST00000305097.3	37	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164790	0.78339	.	.	ENSG00000169860	ENST00000305097	T	0.80994	-1.44	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90844	0.7124	M	0.92122	3.275	0.58432	D	0.999999	D	0.63046	0.992	P	0.60012	0.867	D	0.92885	0.6326	10	0.72032	D	0.01	.	15.2728	0.73717	1.0:0.0:0.0:0.0	.	146	P47900	P2RY1_HUMAN	G	146	ENSP00000304767:S146G	ENSP00000304767:S146G	S	+	1	0	P2RY1	154036697	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.210000	0.95106	2.186000	0.69663	0.533000	0.62120	AGT	.		0.507	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1807653	1807653	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr4:1807653T>A	ENST00000260795.2	+	12	1924	c.1822T>A	c.(1822-1824)Ttg>Atg	p.L608M	FGFR3_ENST00000481110.2_Missense_Mutation_p.L609M|FGFR3_ENST00000352904.1_Missense_Mutation_p.L496M|FGFR3_ENST00000340107.4_Missense_Mutation_p.L610M|FGFR3_ENST00000412135.2_Missense_Mutation_p.L496M|FGFR3_ENST00000440486.2_Missense_Mutation_p.L608M			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	608	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CATGGAGTACTTGGCCTCCCA	0.662		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.L610M		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.T1828A						.						39.0	47.0	44.0					4																	1807653		2203	4299	6502	SO:0001583	missense	2261	exon13	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GAGTACTTGGCCT	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1822T>A	4.37:g.1807653T>A	ENSP00000260795:p.Leu608Met	57	0		55	17	NM_001163213	0	0	0	0	0	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	11.98	1.799537	0.31869	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	4.18	1.33	0.21861	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.95586	0.8565	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.998;0.991	D	0.94568	0.7768	10	0.87932	D	0	.	10.2771	0.43517	0.0:0.681:0.0:0.319	.	610;496;608;609	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	M	609;610;608;496;608;496	ENSP00000420533:L609M;ENSP00000339824:L610M;ENSP00000414914:L608M;ENSP00000412903:L496M;ENSP00000260795:L608M;ENSP00000231803:L496M	ENSP00000260795:L608M	L	+	1	2	FGFR3	1777451	0.995000	0.38212	0.995000	0.50966	0.390000	0.30446	0.568000	0.23623	0.311000	0.23014	-1.193000	0.01689	TTG	.		0.662	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
SLC4A4	8671	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	72413388	72413388	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr4:72413388T>C	ENST00000264485.5	+	20	2762	c.2645T>C	c.(2644-2646)cTt>cCt	p.L882P	SLC4A4_ENST00000425175.1_Missense_Mutation_p.L882P|SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Missense_Mutation_p.L838P	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	882					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ACTGGAACCCTTGTGTTTATT	0.373																																					p.L882P		.											.	SLC4A4-95	0			c.T2645C						.						217.0	212.0	214.0					4																	72413388		2203	4300	6503	SO:0001583	missense	8671	exon20			GAACCCTTGTGTT	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2645T>C	4.37:g.72413388T>C	ENSP00000264485:p.Leu882Pro	109	0		82	7	NM_001098484	0	0	1	1	0	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277920	0.80692	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	D;D;D	0.82167	-1.58;-1.58;-1.58	5.81	5.81	0.92471	Bicarbonate transporter, C-terminal (1);	0.329506	0.33980	N	0.004364	D	0.87661	0.6233	M	0.80183	2.485	0.80722	D	1	P;P;B	0.40230	0.708;0.481;0.242	P;B;B	0.46208	0.507;0.419;0.427	D	0.89124	0.3505	10	0.87932	D	0	.	16.167	0.81768	0.0:0.0:0.0:1.0	.	882;838;882	A5JJ20;Q9Y6R1-2;Q9Y6R1	.;.;S4A4_HUMAN	P	882;882;838	ENSP00000264485:L882P;ENSP00000393557:L882P;ENSP00000344272:L838P	ENSP00000264485:L882P	L	+	2	0	SLC4A4	72632252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.184000	0.72008	2.210000	0.71456	0.533000	0.62120	CTT	.		0.373	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
ISL1	3670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	50680410	50680410	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:50680410A>G	ENST00000230658.7	+	2	649	c.64A>G	c.(64-66)Aat>Gat	p.N22D	ISL1_ENST00000511384.1_Missense_Mutation_p.N22D|CTD-2314G24.2_ENST00000559112.2_RNA	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	22	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				TGGTTGCGGCAATCAGATTCA	0.393																																					p.N22D		.											.	ISL1-515	0			c.A64G						.						141.0	131.0	134.0					5																	50680410		1856	4100	5956	SO:0001583	missense	3670	exon2			TGCGGCAATCAGA	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.64A>G	5.37:g.50680410A>G	ENSP00000230658:p.Asn22Asp	189	0		173	47	NM_002202	0	0	0	0	0	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682347	0.47991	.	.	ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384	D;D	0.87029	-2.2;-2.2	6.16	6.16	0.99307	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	T	0.79040	0.4379	N	0.13098	0.295	0.58432	D	0.999993	P	0.36183	0.542	B	0.36030	0.216	T	0.78427	-0.2208	10	0.31617	T	0.26	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	22	P61371	ISL1_HUMAN	D	22	ENSP00000230658:N22D;ENSP00000422676:N22D	ENSP00000230658:N22D	N	+	1	0	ISL1	50716167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.543000	0.82106	2.367000	0.80283	0.528000	0.53228	AAT	.		0.393	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
SEC24A	10802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	134060676	134060676	+	Missense_Mutation	SNP	G	G	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:134060676G>C	ENST00000398844.2	+	23	3462	c.3174G>C	c.(3172-3174)gaG>gaC	p.E1058D		NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	1058					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAAGGGATGAGAGTCCAATGA	0.323																																					p.E1058D		.											.	SEC24A-68	0			c.G3174C						.						60.0	56.0	57.0					5																	134060676		1806	4068	5874	SO:0001583	missense	10802	exon23			GGATGAGAGTCCA	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.3174G>C	5.37:g.134060676G>C	ENSP00000381823:p.Glu1058Asp	409	0		404	43	NM_021982	0	0	0	0	0	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	7.791	0.711484	0.15239	.	.	ENSG00000113615	ENST00000398844	T	0.28666	1.6	5.68	5.68	0.88126	.	0.045285	0.85682	D	0.000000	T	0.11623	0.0283	N	0.04260	-0.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29731	-1.0002	10	0.10902	T	0.67	-12.469	5.5239	0.16947	0.1812:0.1697:0.6491:0.0	.	822;1058	B4E205;O95486	.;SC24A_HUMAN	D	1058	ENSP00000381823:E1058D	ENSP00000381823:E1058D	E	+	3	2	SEC24A	134088575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.734000	0.26101	2.691000	0.91804	0.650000	0.86243	GAG	.		0.323	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
HNRNPA0	10949	broad.mit.edu	37	5	137088931	137088931	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:137088931G>A	ENST00000314940.4	-	1	1108	c.825C>T	c.(823-825)ggC>ggT	p.G275G		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	275	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)	p.G275G(1)		large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			Tgcctccaccgccgccgccgc	0.632																																					p.G275G													.	HNRNPA0-68	1	Substitution - coding silent(1)	large_intestine(1)	c.C825T						.						9.0	13.0	11.0					5																	137088931		1925	3891	5816	SO:0001819	synonymous_variant	10949	exon1			TCCACCGCCGCCG	U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.825C>T	5.37:g.137088931G>A		74	1		87	7	NM_006805	0	0	94	95	1	Q6IB18	Silent	SNP	ENST00000314940.4	37	CCDS4193.1																																																																																			.		0.632	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251221.1	NM_006805	
CREBRF	153222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	172518246	172518246	+	Missense_Mutation	SNP	A	A	T	rs374100928		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:172518246A>T	ENST00000296953.2	+	4	1383	c.1064A>T	c.(1063-1065)gAa>gTa	p.E355V	CREBRF_ENST00000522692.1_Missense_Mutation_p.E355V|CREBRF_ENST00000520420.1_Missense_Mutation_p.E355V|CREBRF_ENST00000540014.1_Missense_Mutation_p.E355V	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	355	Glu-rich.				negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGCAGTCCtgaagaagatgag	0.443																																					p.E355V		.											.	.	0			c.A1064T						.						63.0	50.0	54.0					5																	172518246		2203	4300	6503	SO:0001583	missense	153222	exon4			GTCCTGAAGAAGA	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1064A>T	5.37:g.172518246A>T	ENSP00000296953:p.Glu355Val	190	0		169	32	NM_153607	0	0	4	5	1	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	37	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323089	0.60634	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T;T;T	0.70749	-0.51;2.19;2.19;-0.51	5.52	5.52	0.82312	.	0.433677	0.23268	N	0.050045	T	0.75525	0.3861	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.991;0.996	T	0.78703	-0.2101	10	0.66056	D	0.02	.	15.3153	0.74069	1.0:0.0:0.0:0.0	.	355;355	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	V	355	ENSP00000431107:E355V;ENSP00000296953:E355V;ENSP00000440075:E355V;ENSP00000428290:E355V	ENSP00000296953:E355V	E	+	2	0	C5orf41	172450852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.297000	0.72757	2.103000	0.63969	0.533000	0.62120	GAA	.		0.443	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
PHYKPL	85007	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	177649897	177649897	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:177649897T>C	ENST00000308158.5	-	7	891	c.657A>G	c.(655-657)ggA>ggG	p.G219G	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	219						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TGATCTGCCCTCCCACACTGG	0.582																																					p.G219G													.	AGXT2L2-91	0			c.A657G						.						94.0	80.0	85.0					5																	177649897		2203	4300	6503	SO:0001819	synonymous_variant	85007	exon7			CTGCCCTCCCACA	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.657A>G	5.37:g.177649897T>C		97	1		76	8	NM_153373	0	0	15	21	6	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																			.		0.582	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
TBC1D7	51256	broad.mit.edu;ucsc.edu	37	6	13307840	13307840	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:13307840A>T	ENST00000379300.3	-	6	900	c.657T>A	c.(655-657)agT>agA	p.S219R	TBC1D7_ENST00000379307.2_Missense_Mutation_p.S192R|TBC1D7_ENST00000607532.1_5'UTR|TBC1D7_ENST00000607658.1_Missense_Mutation_p.S192R|TBC1D7_ENST00000356436.4_Missense_Mutation_p.S219R|TBC1D7_ENST00000343141.4_Missense_Mutation_p.S173R	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	219	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			GCCTCTGTAAACTGGATTCAG	0.478																																					p.S219R													.	TBC1D7-91	0			c.T657A						.						116.0	114.0	115.0					6																	13307840		2203	4300	6503	SO:0001583	missense	51256	exon6			CTGTAAACTGGAT	AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.657T>A	6.37:g.13307840A>T	ENSP00000368602:p.Ser219Arg	80	0		48	3	NM_001143965	0	0	0	1	1	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Missense_Mutation	SNP	ENST00000379300.3	37	CCDS4523.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464789	0.84425	.	.	ENSG00000145979	ENST00000334971;ENST00000356436;ENST00000379300;ENST00000379307;ENST00000343141;ENST00000452989;ENST00000450347;ENST00000422136;ENST00000446018;ENST00000420456	T;T;T;T;T;T;T;T;T	0.42900	1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;0.96	6.17	2.41	0.29592	Rab-GAP/TBC domain (3);	0.474423	0.28504	N	0.015120	T	0.47507	0.1449	M	0.81682	2.555	0.54753	D	0.999986	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.966;0.999;0.992;0.999	T	0.45977	-0.9224	10	0.26408	T	0.33	-0.0635	8.4637	0.32942	0.7018:0.0:0.2982:0.0	.	173;192;192;219	Q2TU37;Q5SZL5;Q9P0N9-2;Q9P0N9	.;.;.;TBCD7_HUMAN	R	160;219;219;192;173;192;192;219;192;192	ENSP00000348813:S219R;ENSP00000368602:S219R;ENSP00000368609:S192R;ENSP00000343100:S173R;ENSP00000414292:S192R;ENSP00000404680:S192R;ENSP00000394425:S219R;ENSP00000417005:S192R;ENSP00000412102:S192R	ENSP00000334212:S160R	S	-	3	2	TBC1D7	13415819	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.781000	0.38644	0.177000	0.19895	0.533000	0.62120	AGT	.		0.478	TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039896.2	NM_016495	
PBX2	5089	broad.mit.edu	37	6	32156280	32156280	+	Splice_Site	SNP	G	G	T	rs568374645	byFrequency	TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:32156280G>T	ENST00000375050.4	-	3	567	c.297C>A	c.(295-297)ggC>ggA	p.G99G	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	99					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G99G(1)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GAATGCTGAGGCCTAGCATGC	0.612													G|||	24	0.00479233	0.0045	0.0029	5008	,	,		16536	0.002		0.006	False		,,,				2504	0.0082				p.G99G													.	PBX2-91	1	Substitution - coding silent(1)	prostate(1)	c.C297A						.						20.0	22.0	21.0					6																	32156280		2203	4298	6501	SO:0001630	splice_region_variant	5089	exon3			GCTGAGGCCTAGC		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.296-1C>A	6.37:g.32156280G>T		79	1		71	6	NM_002586	0	0	2	2	0	A2BFJ2	Silent	SNP	ENST00000375050.4	37	CCDS4748.1																																																																																			.		0.612	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		Silent
HIVEP2	3097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	143090738	143090738	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:143090738G>T	ENST00000367604.1	-	4	5777	c.5138C>A	c.(5137-5139)cCt>cAt	p.P1713H	HIVEP2_ENST00000367603.2_Missense_Mutation_p.P1713H|HIVEP2_ENST00000012134.2_Missense_Mutation_p.P1713H			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1713					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCCGGTTCCAGGCCTATGCAT	0.433																																					p.P1713H	Esophageal Squamous(107;843 1510 13293 16805 42198)	.											.	HIVEP2-95	0			c.C5138A						.						118.0	109.0	112.0					6																	143090738		1861	4116	5977	SO:0001583	missense	3097	exon5			GTTCCAGGCCTAT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5138C>A	6.37:g.143090738G>T	ENSP00000356576:p.Pro1713His	133	0		93	17	NM_006734	0	0	1	1	0	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231189	0.58777	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02863	4.13;4.13;4.13	5.95	4.11	0.48088	.	0.192613	0.56097	D	0.000024	T	0.04907	0.0132	M	0.72894	2.215	0.47407	D	0.999417	D	0.67145	0.996	P	0.58013	0.831	T	0.10019	-1.0648	10	0.87932	D	0	-17.5678	8.3283	0.32171	0.135:0.1282:0.7368:0.0	.	1713	P31629	ZEP2_HUMAN	H	1713	ENSP00000356576:P1713H;ENSP00000356575:P1713H;ENSP00000012134:P1713H	ENSP00000012134:P1713H	P	-	2	0	HIVEP2	143132431	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	6.728000	0.74769	1.514000	0.48869	0.655000	0.94253	CCT	.		0.433	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
EIF2AK1	27102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6084205	6084205	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr7:6084205T>G	ENST00000199389.6	-	7	864	c.718A>C	c.(718-720)Att>Ctt	p.I240L	EIF2AK1_ENST00000495565.1_5'UTR|EIF2AK1_ENST00000536084.1_Missense_Mutation_p.I116L	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		CGTGGCTGAATCACATGAACA	0.468																																					p.I240L		.											.	EIF2AK1-408	0			c.A718C						.						99.0	79.0	86.0					7																	6084205		2203	4300	6503	SO:0001583	missense	27102	exon7			GCTGAATCACATG	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.718A>C	7.37:g.6084205T>G	ENSP00000199389:p.Ile240Leu	31	0		41	6	NM_001134335	0	0	0	0	0	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	1.012	-0.687440	0.03328	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	T;T	0.14144	2.53;2.53	5.2	2.36	0.29203	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.526065	0.21443	N	0.074457	T	0.06826	0.0174	N	0.17723	0.515	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.006;0.002;0.002	T	0.42932	-0.9422	10	0.11485	T	0.65	-0.4159	5.4401	0.16504	0.0:0.4964:0.2696:0.234	.	116;240;240	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	L	240;116	ENSP00000199389:I240L;ENSP00000445784:I116L	ENSP00000199389:I240L	I	-	1	0	EIF2AK1	6050731	0.000000	0.05858	0.062000	0.19696	0.277000	0.26821	-0.787000	0.04618	0.180000	0.19960	-0.248000	0.11899	ATT	.		0.468	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
CLCN1	1180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143049049	143049049	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr7:143049049G>A	ENST00000343257.2	+	23	3045	c.2958G>A	c.(2956-2958)ctG>ctA	p.L986L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	986					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AGGATGAACTGATCCTTTGAC	0.617																																					p.L986L		.											.	CLCN1-156	0			c.G2958A						.						85.0	83.0	84.0					7																	143049049		2203	4300	6503	SO:0001819	synonymous_variant	1180	exon23			TGAACTGATCCTT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2958G>A	7.37:g.143049049G>A		110	0		105	23	NM_000083	0	0	0	0	0	A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	37	CCDS5881.1																																																																																			.		0.617	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
ANK1	286	ucsc.edu	37	8	41566447	41566447	+	Missense_Mutation	SNP	T	T	C	rs372122833		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr8:41566447T>C	ENST00000347528.4	-	17	1930	c.1847A>G	c.(1846-1848)gAg>gGg	p.E616G	ANK1_ENST00000352337.4_Missense_Mutation_p.E616G|ANK1_ENST00000396942.1_Missense_Mutation_p.E616G|ANK1_ENST00000396945.1_Missense_Mutation_p.E616G|ANK1_ENST00000379758.2_Missense_Mutation_p.E616G|ANK1_ENST00000289734.7_Missense_Mutation_p.E616G|ANK1_ENST00000265709.8_Missense_Mutation_p.E649G	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	616	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			ACGGGCCACCTCCACCTGGTT	0.607																																					p.E649G													.	ANK1-716	0			c.A1946G						.						80.0	71.0	74.0					8																	41566447		2203	4300	6503	SO:0001583	missense	286	exon17			GCCACCTCCACCT	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1847A>G	8.37:g.41566447T>C	ENSP00000339620:p.Glu616Gly	31	0		42	4	NM_001142446	0	0	0	0	0	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.194486	0.78902	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.51	5.51	0.81932	Ankyrin repeat-containing domain (3);	0.102848	0.64402	D	0.000003	T	0.64057	0.2564	L	0.45470	1.425	0.80722	D	1	P;P;B;B;P	0.40107	0.703;0.664;0.027;0.354;0.703	B;B;B;B;B	0.40410	0.328;0.188;0.023;0.048;0.328	T	0.69011	-0.5258	10	0.87932	D	0	.	15.6125	0.76737	0.0:0.0:0.0:1.0	.	649;616;616;616;616	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	G	616;616;616;616;616;616;649;616	ENSP00000339620:E616G;ENSP00000289734:E616G;ENSP00000369082:E616G;ENSP00000380149:E616G;ENSP00000380147:E616G;ENSP00000309131:E616G;ENSP00000265709:E649G	ENSP00000265709:E649G	E	-	2	0	ANK1	41685604	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.276000	0.72601	2.091000	0.63221	0.459000	0.35465	GAG	.		0.607	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
UBR5	51366	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	103287958	103287958	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr8:103287958T>C	ENST00000520539.1	-	46	7214	c.6608A>G	c.(6607-6609)gAt>gGt	p.D2203G	UBR5_ENST00000518205.1_5'Flank|UBR5_ENST00000220959.4_Missense_Mutation_p.D2203G|UBR5_ENST00000521922.1_Missense_Mutation_p.D2197G	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2203					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TGCTCCAACATCTTCCATGAA	0.418																																					p.D2203G	Ovarian(131;96 1741 5634 7352 27489)												.	UBR5-761	0			c.A6608G						.						97.0	83.0	88.0					8																	103287958		2203	4300	6503	SO:0001583	missense	51366	exon46			CCAACATCTTCCA	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6608A>G	8.37:g.103287958T>C	ENSP00000429084:p.Asp2203Gly	118	1		117	13	NM_015902	0	0	3	6	3	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.749637	0.89753	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922;ENST00000521566	T;T;T	0.54071	0.59;0.6;0.6	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.67397	2.05	0.58432	D	0.999999	D;D	0.65815	0.995;0.972	D;P	0.64687	0.928;0.871	T	0.73285	-0.4031	10	0.87932	D	0	.	15.3625	0.74492	0.0:0.0:0.0:1.0	.	2197;2203	E7EMW7;O95071	.;UBR5_HUMAN	G	2203;2203;2197;28	ENSP00000429084:D2203G;ENSP00000220959:D2203G;ENSP00000427819:D2197G	ENSP00000220959:D2203G	D	-	2	0	UBR5	103357134	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.698000	0.84413	2.046000	0.60703	0.528000	0.53228	GAT	.		0.418	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
SNTB1	6641	broad.mit.edu	37	8	121706046	121706046	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr8:121706046C>T	ENST00000395601.3	-	3	1088	c.674G>A	c.(673-675)aGc>aAc	p.S225N	SNTB1_ENST00000517992.1_Missense_Mutation_p.S225N|SNTB1_ENST00000519177.1_5'UTR	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	225	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GTCTGAGGTGCTGCCCCCTAA	0.572																																					p.S225N													.	SNTB1-228	0			c.G674A						.						96.0	93.0	94.0					8																	121706046		2203	4300	6503	SO:0001583	missense	6641	exon2			GAGGTGCTGCCCC	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.674G>A	8.37:g.121706046C>T	ENSP00000378965:p.Ser225Asn	121	0		92	4	NM_021021	0	0	5	5	0	A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	ENST00000395601.3	37	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	C	7.745	0.702140	0.15172	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.54479	0.57;0.57	5.96	4.09	0.47781	Pleckstrin homology domain (2);	0.980591	0.08401	N	0.951494	T	0.40791	0.1131	N	0.24115	0.695	0.09310	N	1	B;B	0.23806	0.015;0.091	B;B	0.15870	0.011;0.014	T	0.25047	-1.0143	10	0.39692	T	0.17	.	11.9555	0.52978	0.0998:0.5015:0.3986:0.0	.	225;225	Q13884;Q13884-2	SNTB1_HUMAN;.	N	225	ENSP00000378965:S225N;ENSP00000431124:S225N	ENSP00000378965:S225N	S	-	2	0	SNTB1	121775227	0.125000	0.22332	0.041000	0.18516	0.069000	0.16628	2.938000	0.48987	1.476000	0.48215	0.655000	0.94253	AGC	.		0.572	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
CTSL	1514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	90344596	90344596	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr9:90344596C>T	ENST00000343150.5	+	6	1620	c.730C>T	c.(730-732)Ccc>Tcc	p.P244S	CTSL_ENST00000495822.1_3'UTR|CTSL_ENST00000340342.6_Missense_Mutation_p.P244S			P07711	CATL1_HUMAN	cathepsin L	244					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										AACTGTGGGGCCCATTTCTGT	0.428																																					p.P244S		.											.	CTSL1-93	0			c.C730T						.						153.0	147.0	149.0					9																	90344596		2203	4300	6503	SO:0001583	missense	1514	exon6			GTGGGGCCCATTT	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.730C>T	9.37:g.90344596C>T	ENSP00000345344:p.Pro244Ser	108	0		81	16	NM_145918	0	1	759	886	126	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	37	CCDS6675.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562005	0.65538	.	.	ENSG00000135047	ENST00000343150;ENST00000340342	T;T	0.58652	0.32;0.32	4.19	4.19	0.49359	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86167	0.5868	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92638	0.6122	10	0.87932	D	0	.	16.7092	0.85380	0.0:1.0:0.0:0.0	.	244	P07711	CATL1_HUMAN	S	244	ENSP00000345344:P244S;ENSP00000365061:P244S	ENSP00000365061:P244S	P	+	1	0	CTSL1	89534416	1.000000	0.71417	0.118000	0.21660	0.300000	0.27592	6.804000	0.75186	2.134000	0.65973	0.655000	0.94253	CCC	.		0.428	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912	
RP2	6102	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	46696623	46696623	+	Missense_Mutation	SNP	G	G	T	rs377324837		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chrX:46696623G>T	ENST00000218340.3	+	1	249	c.88G>T	c.(88-90)Gat>Tat	p.D30Y		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	30	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						GTACAGCTGGGATCAGCGCGA	0.657																																					p.D30Y													.	RP2-130	0			c.G88T						.						67.0	44.0	52.0					X																	46696623		2133	4095	6228	SO:0001583	missense	6102	exon1			AGCTGGGATCAGC	AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.88G>T	X.37:g.46696623G>T	ENSP00000218340:p.Asp30Tyr	231	1		202	55	NM_006915	0	0	0	0	0	Q86XJ7|Q9NU67	Missense_Mutation	SNP	ENST00000218340.3	37	CCDS14270.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801424	0.70682	.	.	ENSG00000102218	ENST00000218340	D	0.90955	-2.76	3.85	3.85	0.44370	C-CAP/cofactor C-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	M	0.78049	2.395	0.58432	D	0.999998	D	0.63046	0.992	P	0.60068	0.868	D	0.93614	0.6941	10	0.72032	D	0.01	-5.5346	10.3577	0.43974	0.0:0.0:1.0:0.0	.	30	O75695	XRP2_HUMAN	Y	30	ENSP00000218340:D30Y	ENSP00000218340:D30Y	D	+	1	0	RP2	46581567	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.164000	0.58190	1.903000	0.55091	0.462000	0.41574	GAT	.		0.657	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
SYVN1	84447	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64900251	64900251	+	Splice_Site	DEL	T	T	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:64900251delT	ENST00000377190.3	-	5	473	c.379delA	c.(379-381)atg>tg	p.M127fs	SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000526060.1_Splice_Site_p.M127fs|SYVN1_ENST00000307289.6_Intron|SYVN1_ENST00000294256.8_Splice_Site_p.M127fs	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	127					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTGCGTTCCATCTGAGGCAGA	0.612																																					p.M127fs		.											.	SYVN1-91	0			c.379delA						.						97.0	97.0	97.0					11																	64900251		2201	4297	6498	SO:0001630	splice_region_variant	84447	exon5			.	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.379-1A>-	11.37:g.64900251delT		76	0		49	11	NM_172230	0	0	0	0	0	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Frame_Shift_Del	DEL	ENST00000377190.3	37	CCDS31605.1																																																																																			.		0.612	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	Frame_Shift_Del
ONECUT1	3175	broad.mit.edu	37	15	53081865	53081867	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:53081865_53081867delGGT	ENST00000305901.5	-	1	342_344	c.215_217delACC	c.(214-219)caccgg>cgg	p.H72del	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	72	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		TCAGGGGCCCGGTGGTGGTGGTG	0.719																																					p.72_73del													.	ONECUT1-68	0			c.215_217del						.																																			SO:0001651	inframe_deletion	3175	exon1			GGGCCCGGTGGTG	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.215_217delACC	15.37:g.53081874_53081876delGGT	ENSP00000302630:p.His72del	20	0		6	2	NM_004498	0	0	0	0	0	B2RTV4|Q99744|Q9UMR6	In_Frame_Del	DEL	ENST00000305901.5	37	CCDS10150.1																																																																																			.		0.719	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2		
ANKRD44	91526	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	197878244	197878244	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:197878244delG	ENST00000328737.2	-	18	1916	c.1840delC	c.(1840-1842)catfs	p.H614fs	ANKRD44_ENST00000282272.8_Frame_Shift_Del_p.H631fs|ANKRD44_ENST00000337207.5_Frame_Shift_Del_p.H614fs|ANKRD44_ENST00000450567.1_Frame_Shift_Del_p.H614fs			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	639										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCTGAGGCATGAAGTGGGGTT	0.443																																					p.H639fs		.											.	ANKRD44-230	0			c.1915delC						.						168.0	160.0	163.0					2																	197878244		2203	4300	6503	SO:0001589	frameshift_variant	91526	exon18			.	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1840delC	2.37:g.197878244delG	ENSP00000331516:p.His614fs	141	0		134	31	NM_001195144	0	0	0	0	0	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Frame_Shift_Del	DEL	ENST00000328737.2	37																																																																																				.		0.443	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
NKD2	85409	broad.mit.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.P86del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69																																					p.439_439del													.	NKD2-226	0			c.1315_1317del						.																																			SO:0001651	inframe_deletion	85409	exon10			CACGAGCACCACC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del	14	0		16	5	NM_033120	0	0	0	0	0	Q96EK8|Q9BSN0	In_Frame_Del	DEL	ENST00000296849.5	37	CCDS3859.1																																																																																			.		0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
TRIO	7204	broad.mit.edu	37	5	14358383	14358385	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:14358383_14358385delCAG	ENST00000344204.4	+	12	2167_2169	c.2143_2145delCAG	c.(2143-2145)cagdel	p.Q718del	TRIO_ENST00000509967.2_In_Frame_Del_p.Q669del|TRIO_ENST00000537187.1_In_Frame_Del_p.Q718del	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	718	Poly-Gln.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GCGCTTTGGCCAGCAGCAGCAGA	0.631																																					p.715_715del													.	TRIO-562	0			c.2143_2145del						.																																			SO:0001651	inframe_deletion	7204	exon12			TTTGGCCAGCAGC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2143_2145delCAG	5.37:g.14358392_14358394delCAG	ENSP00000339299:p.Gln718del	184	0		233	7	NM_007118	0	0	0	0	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	In_Frame_Del	DEL	ENST00000344204.4	37	CCDS3883.1																																																																																			.		0.631	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
SESN1	27244	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	109309823	109309823	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:109309823delT	ENST00000356644.7	-	9	1409	c.1315delA	c.(1315-1317)actfs	p.T439fs	SESN1_ENST00000436639.2_Frame_Shift_Del_p.T498fs|SESN1_ENST00000302071.2_Frame_Shift_Del_p.T373fs	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	439					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)				cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		CAAACAACAGTTTTGATATAA	0.343																																					p.T498fs		.											.	SESN1-227	0			c.1492delA						.						83.0	75.0	77.0					6																	109309823		2203	4300	6503	SO:0001589	frameshift_variant	27244	exon9			.	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.1315delA	6.37:g.109309823delT	ENSP00000349061:p.Thr439fs	51	0		56	13	NM_014454	0	0	0	0	0	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Frame_Shift_Del	DEL	ENST00000356644.7	37	CCDS56445.1																																																																																			.		0.343	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
RBAK	57786	broad.mit.edu	37	7	5112027	5112029	+	IGR	DEL	TGC	TGC	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr7:5112027_5112029delTGC	ENST00000396912.1	+	0	6551				RBAKDN_ENST00000498308.1_lincRNA|RBAK-RBAKDN_ENST00000396904.2_In_Frame_Del_p.A97del|RBAK-RBAKDN_ENST00000407184.1_In_Frame_Del_p.C117del	NM_021163.3	NP_066986.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger						negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		CCCCCgctgttgctgctgctgct	0.709																																					p.91_92del													.	.	0			c.273_275del						.			46,3424		4,38,1693						-2.5	0.6			13	125,6467		13,99,3184	no	coding	RBAK-LOC389458	NM_001204513.1		17,137,4877	A1A1,A1R,RR		1.8962,1.3256,1.6995				171,9891				SO:0001628	intergenic_variant	0	exon5			CGCTGTTGCTGCT	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155		7.37:g.5112036_5112038delTGC		75	0		93	5	NM_001204513	0	0	0	0	0	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	In_Frame_Del	DEL	ENST00000396912.1	37	CCDS5337.1																																																																																			.		0.709	RBAK-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_021163	
TRPM3	80036	broad.mit.edu;bcgsc.ca	37	9	73151135	73151136	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr9:73151135_73151136insT	ENST00000377110.3	-	25	5100_5101	c.4857_4858insA	c.(4855-4860)tcagagfs	p.E1620fs	TRPM3_ENST00000377105.1_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000358082.3_Frame_Shift_Ins_p.E1482fs|TRPM3_ENST00000396280.5_Frame_Shift_Ins_p.E1469fs|TRPM3_ENST00000408909.2_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000357533.2_Frame_Shift_Ins_p.E1624fs|TRPM3_ENST00000396292.4_Frame_Shift_Ins_p.E1492fs|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396285.1_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000377106.1_Frame_Shift_Ins_p.E1492fs|TRPM3_ENST00000360823.2_Frame_Shift_Ins_p.E1482fs|TRPM3_ENST00000423814.3_Frame_Shift_Ins_p.E1647fs			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1645					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGGGTTCTCTCTGAGTTATCAC	0.55																																					p.E1620fs													.	TRPM3-521	0			c.4858_4859insA						.																																			SO:0001589	frameshift_variant	80036	exon25			TTCTCTCTGAGTT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4858dupA	9.37:g.73151136_73151136dupT	ENSP00000366314:p.Glu1620fs	148	0		129	15	NM_001007471	0	0	0	0	0	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Frame_Shift_Ins	INS	ENST00000377110.3	37	CCDS43835.1																																																																																			.		0.550	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945	
COL1A1	1277	broad.mit.edu;bcgsc.ca	37	17	48277127	48277128	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:48277127_48277128GC>AT	ENST00000225964.5	-	2	402_403	c.284_285GC>AT	c.(283-285)tGC>tAT	p.C95Y		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	95	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	AGCCGTCGGGGCAGACGGGACA	0.728			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.C95Y				Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1-986	0			c.G284A						.																																			SO:0001583	missense	1277	exon2			TCGGGGCAGACGG	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.284_285delinsAT	17.37:g.48277127_48277128delinsAT	ENSP00000225964:p.Cys95Tyr	35	0		60	6	NM_000088	0	0	0	0	0	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	DNP	ENST00000225964.5	37	CCDS11561.1																																																																																			.		0.728	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
