#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES4	57801	hgsc.bcm.edu	37	1	934488	934488	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:934488C>G	ENST00000304952.6	-	4	754	c.617G>C	c.(616-618)aGg>aCg	p.R206T	HES4_ENST00000428771.2_Missense_Mutation_p.R232T|RP11-54O7.17_ENST00000606034.1_lincRNA|HES4_ENST00000484667.2_Missense_Mutation_p.R174T			Q9HCC6	HES4_HUMAN	hes family bHLH transcription factor 4	206	Pro-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		cggccccgccctgggggcggc	0.796																																					p.R232T		.											.	HES4-226	0			c.G695C						.																																			SO:0001583	missense	57801	exon3			CCCGCCCTGGGGG	BC012351	CCDS5.1, CCDS44034.1	1p36	2013-10-17	2013-10-17		ENSG00000188290	ENSG00000188290		"""Basic helix-loop-helix proteins"""	24149	protein-coding gene	gene with protein product		608060	"""hairy and enhancer of split 4 (Drosophila)"""			11260262, 15254753	Standard	NM_021170		Approved	bHLHb42	uc001aci.2	Q9HCC6	OTTHUMG00000040758	ENST00000304952.6:c.617G>C	1.37:g.934488C>G	ENSP00000304595:p.Arg206Thr	5	1		2	2	NM_001142467	0	0	0	0	0	Q5SVA5	Missense_Mutation	SNP	ENST00000304952.6	37	CCDS5.1	.	.	.	.	.	.	.	.	.	.	C	3.404	-0.121669	0.06838	.	.	ENSG00000188290	ENST00000428771;ENST00000304952;ENST00000484667	T;T;T	0.59502	0.26;0.26;1.53	2.88	1.95	0.26073	.	.	.	.	.	T	0.36193	0.0958	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.18429	-1.0337	9	0.24483	T	0.36	.	4.8453	0.13510	0.0:0.4879:0.3756:0.1365	.	232;206	E9PB28;Q9HCC6	.;HES4_HUMAN	T	232;206;174	ENSP00000393198:R232T;ENSP00000304595:R206T;ENSP00000425085:R174T	ENSP00000304595:R206T	R	-	2	0	HES4	924351	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.923000	0.04000	0.413000	0.25759	0.393000	0.25936	AGG	.		0.796	HES4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097944.1	NM_021170	
PEX14	5195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10678475	10678475	+	Splice_Site	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:10678475G>A	ENST00000356607.4	+	5	464		c.e5+1		RN7SL614P_ENST00000461850.2_RNA|PEX14_ENST00000538836.1_Splice_Site	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		GCTCTACAAGGTGAGTCACCC	0.627																																					.		.											.	PEX14-90	0			c.384+1G>A						.						70.0	62.0	64.0					1																	10678475		2203	4300	6503	SO:0001630	splice_region_variant	5195	exon5			TACAAGGTGAGTC	AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.384+1G>A	1.37:g.10678475G>A		50	0		36	16	NM_004565	0	0	0	0	0	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Splice_Site	SNP	ENST00000356607.4	37	CCDS30582.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726384	0.89298	.	.	ENSG00000142655	ENST00000356607;ENST00000538836	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.856	0.88762	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PEX14	10601062	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	9.430000	0.97488	2.195000	0.70347	0.655000	0.94253	.	.		0.627	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005414.1		Intron
CROCC	9696	hgsc.bcm.edu	37	1	17263238	17263238	+	Missense_Mutation	SNP	G	G	C	rs202121748		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:17263238G>C	ENST00000375541.5	+	9	1132	c.1063G>C	c.(1063-1065)Gca>Cca	p.A355P	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCGGGCCGAGGCAGCCCTGGA	0.697																																					p.A355P		.											.	CROCC-137	0			c.G1063C						.						15.0	15.0	15.0					1																	17263238		2194	4274	6468	SO:0001583	missense	9696	exon9			GCCGAGGCAGCCC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1063G>C	1.37:g.17263238G>C	ENSP00000364691:p.Ala355Pro	31	1		31	2	NM_014675	0	0	3	3	0		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	9.902	1.207111	0.22205	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.10573	2.86	3.91	2.98	0.34508	.	.	.	.	.	T	0.13927	0.0337	L	0.38531	1.155	0.27212	N	0.959891	P;P;D	0.54207	0.955;0.904;0.965	B;B;P	0.51229	0.347;0.347;0.663	T	0.10590	-1.0623	9	0.31617	T	0.26	.	10.8238	0.46620	0.0962:0.0:0.9038:0.0	.	218;218;355	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	P	355;236	ENSP00000364691:A355P	ENSP00000364691:A355P	A	+	1	0	CROCC	17135825	1.000000	0.71417	0.064000	0.19789	0.141000	0.21300	4.821000	0.62679	0.970000	0.38263	0.462000	0.41574	GCA	.		0.697	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
AGO4	192670	hgsc.bcm.edu;broad.mit.edu	37	1	36316582	36316582	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:36316582C>A	ENST00000373210.3	+	17	2650	c.2405C>A	c.(2404-2406)cCa>cAa	p.P802Q	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	802	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										GTCTCTATTCCAGCCCCTGCA	0.478																																					p.P802Q		.											.	.	0			c.C2405A						.						100.0	87.0	91.0					1																	36316582		2203	4300	6503	SO:0001583	missense	192670	exon17			CTATTCCAGCCCC	AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2405C>A	1.37:g.36316582C>A	ENSP00000362306:p.Pro802Gln	45	0		48	3	NM_017629	0	0	0	0	0	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473642	0.84640	.	.	ENSG00000134698	ENST00000373210	T	0.57907	0.37	5.22	5.22	0.72569	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.84042	0.5385	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90316	0.4341	10	0.62326	D	0.03	-9.3183	18.7904	0.91971	0.0:1.0:0.0:0.0	.	802	Q9HCK5	AGO4_HUMAN	Q	802	ENSP00000362306:P802Q	ENSP00000362306:P802Q	P	+	2	0	EIF2C4	36089169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.417000	0.82017	0.591000	0.81541	CCA	.		0.478	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
ZCCHC11	23318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	52961169	52961169	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:52961169T>C	ENST00000371544.3	-	6	1458	c.1196A>G	c.(1195-1197)tAt>tGt	p.Y399C	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.Y399C|ZCCHC11_ENST00000371541.1_5'UTR	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	399					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						AGATGAGCCATACAACCTAAG	0.338																																					p.Y399C		.											.	ZCCHC11-93	0			c.A1196G						.						56.0	58.0	57.0					1																	52961169		2203	4299	6502	SO:0001583	missense	23318	exon6			GAGCCATACAACC	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.1196A>G	1.37:g.52961169T>C	ENSP00000360599:p.Tyr399Cys	75	0		65	28	NM_001009881	0	0	2	7	5	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	37	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.180486	0.78677	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.998	D	0.91443	0.5175	10	0.87932	D	0	.	15.929	0.79646	0.0:0.0:0.0:1.0	.	158;399;399	E9PKX1;Q5TAX3-2;Q5TAX3	.;.;TUT4_HUMAN	C	399;399;399;158	ENSP00000257177:Y399C;ENSP00000360599:Y399C;ENSP00000433486:Y399C;ENSP00000435256:Y158C	ENSP00000257177:Y399C	Y	-	2	0	ZCCHC11	52733757	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.780000	0.62382	2.243000	0.73865	0.533000	0.62120	TAT	.		0.338	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
LEPR	3953	hgsc.bcm.edu	37	1	66087101	66087101	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:66087101T>C	ENST00000349533.6	+	18	2742	c.2557T>C	c.(2557-2559)Tcc>Ccc	p.S853P	LEPR_ENST00000371060.3_Missense_Mutation_p.S853P|LEPR_ENST00000371058.1_Missense_Mutation_p.S853P|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371059.3_Missense_Mutation_p.S853P|LEPR_ENST00000344610.8_Missense_Mutation_p.S853P	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TATTTCCTCTTCCATCTTATT	0.338																																					p.S853P		.											.	LEPR-91	0			c.T2557C						.						162.0	151.0	155.0					1																	66087101		2203	4297	6500	SO:0001583	missense	3953	exon18			TCCTCTTCCATCT	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2557T>C	1.37:g.66087101T>C	ENSP00000330393:p.Ser853Pro	51	0		38	2	NM_001003680	0	0	4	4	0	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175705	0.38413	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.60171	0.28;0.21;0.28;0.31;0.28	5.13	5.13	0.70059	.	0.310582	0.36374	N	0.002625	T	0.57533	0.2060	M	0.66939	2.045	0.52099	D	0.99994	P;P;D	0.55385	0.882;0.928;0.971	P;P;P	0.56278	0.629;0.795;0.736	T	0.61806	-0.6987	10	0.45353	T	0.12	-2.4259	10.2523	0.43377	0.0:0.0:0.1661:0.8338	.	853;853;853	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	P	853	ENSP00000340884:S853P;ENSP00000330393:S853P;ENSP00000360099:S853P;ENSP00000360098:S853P;ENSP00000360097:S853P	ENSP00000340884:S853P	S	+	1	0	LEPR	65859689	0.968000	0.33430	0.715000	0.30552	0.225000	0.24961	2.752000	0.47516	2.056000	0.61249	0.482000	0.46254	TCC	.		0.338	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
ABCA4	24	hgsc.bcm.edu	37	1	94485270	94485270	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:94485270G>C	ENST00000370225.3	-	36	5150	c.5064C>G	c.(5062-5064)ttC>ttG	p.F1688L	ABCA4_ENST00000536513.1_5'Flank	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1688					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AGGACATGGAGAAAATCACGC	0.547																																					p.F1688L		.											.	ABCA4-162	0			c.C5064G						.						74.0	66.0	69.0					1																	94485270		2203	4300	6503	SO:0001583	missense	24	exon36			CATGGAGAAAATC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5064C>G	1.37:g.94485270G>C	ENSP00000359245:p.Phe1688Leu	24	0		27	2	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290922	0.80914	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.86956	-2.19	5.38	-3.17	0.05202	.	0.099805	0.64402	N	0.000001	D	0.85221	0.5647	M	0.62209	1.925	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.82792	-0.0282	10	0.44086	T	0.13	.	7.1314	0.25504	0.654:0.0:0.2065:0.1395	.	1688	P78363	ABCA4_HUMAN	L	480;1688	ENSP00000359245:F1688L	ENSP00000359245:F1688L	F	-	3	2	ABCA4	94257858	0.800000	0.28916	0.981000	0.43875	0.978000	0.69477	-0.121000	0.10643	-0.418000	0.07450	0.655000	0.94253	TTC	.		0.547	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
GPR161	23432	hgsc.bcm.edu	37	1	168066462	168066462	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:168066462G>A	ENST00000367838.1	-	5	696	c.383C>T	c.(382-384)gCt>gTt	p.A128V	GPR161_ENST00000367836.1_5'UTR|GPR161_ENST00000537209.1_Missense_Mutation_p.A148V|GPR161_ENST00000271357.5_Missense_Mutation_p.A128V|GPR161_ENST00000539777.1_Missense_Mutation_p.A50V|GPR161_ENST00000546300.1_Missense_Mutation_p.A14V|GPR161_ENST00000361697.2_Missense_Mutation_p.A128V|GPR161_ENST00000367835.1_Missense_Mutation_p.A128V	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	128					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					GTACAGGACAGCATAGTAGCT	0.567																																					p.A148V		.											.	GPR161-90	0			c.C443T						.						63.0	58.0	59.0					1																	168066462		2201	4298	6499	SO:0001583	missense	23432	exon4			AGGACAGCATAGT	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.383C>T	1.37:g.168066462G>A	ENSP00000356812:p.Ala128Val	72	0		59	3	NM_001267609	0	0	0	0	0	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	37	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922844	0.92319	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.62088	1.915	0.49299	D	0.999773	D;D;D;D;D;D	0.89917	0.99;0.978;1.0;1.0;0.988;1.0	D;D;D;D;P;D	0.91635	0.914;0.946;0.997;0.999;0.81;0.999	T	0.65651	-0.6116	9	0.87932	D	0	-17.0027	18.2107	0.89869	0.0:0.0:1.0:0.0	.	148;14;50;148;128;128	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	V	128;128;128;14;50;148;128	ENSP00000356812:A128V;ENSP00000271357:A128V;ENSP00000356809:A128V;ENSP00000444348:A14V;ENSP00000437576:A50V;ENSP00000441039:A148V;ENSP00000355194:A128V	ENSP00000271357:A128V	A	-	2	0	GPR161	166333086	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.634000	0.98435	2.490000	0.84030	0.561000	0.74099	GCT	.		0.567	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
GALNT2	2590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	230372159	230372159	+	Silent	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr1:230372159C>T	ENST00000366672.4	+	5	606	c.534C>T	c.(532-534)agC>agT	p.S178S	GALNT2_ENST00000543760.1_Silent_p.S140S|GALNT2_ENST00000541865.1_Silent_p.S88S	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	178	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				ATGACTACAGCAATGATCGTG	0.448																																					p.S178S		.											.	GALNT2-92	0			c.C534T						.						79.0	77.0	78.0					1																	230372159		2203	4300	6503	SO:0001819	synonymous_variant	2590	exon5			CTACAGCAATGAT	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.534C>T	1.37:g.230372159C>T		73	1		67	21	NM_004481	0	0	0	0	0	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Silent	SNP	ENST00000366672.4	37	CCDS1582.1																																																																																			.		0.448	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481	
TMEM72	643236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	45429133	45429133	+	5'UTR	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr10:45429133G>C	ENST00000544540.1	+	0	388				TMEM72-AS1_ENST00000450287.2_RNA			A0PK05	TMM72_HUMAN	transmembrane protein 72							integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						AAGCCCACTGGCTGGGCTGCT	0.602																																					p.W86C		.											.	TMEM72-90	0			c.G258C						.						54.0	58.0	57.0					10																	45429133		1568	3582	5150	SO:0001623	5_prime_UTR_variant	643236	exon4			CCACTGGCTGGGC	AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.-97G>C	10.37:g.45429133G>C		54	0		53	25	NM_001123376	0	0	0	0	0	A1L181|Q5T740	Missense_Mutation	SNP	ENST00000544540.1	37		.	.	.	.	.	.	.	.	.	.	G	17.68	3.448729	0.63178	.	.	ENSG00000187783	ENST00000389583	.	.	.	5.59	4.68	0.58851	.	0.407067	0.24354	N	0.039259	T	0.67439	0.2893	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	D	0.63192	0.912	T	0.65512	-0.6150	9	0.42905	T	0.14	-9.242	9.7258	0.40330	0.0925:0.0:0.9075:0.0	.	86	A0PK05	TMM72_HUMAN	C	86	.	ENSP00000374234:W86C	W	+	3	0	TMEM72	44749139	0.995000	0.38212	1.000000	0.80357	0.867000	0.49689	0.969000	0.29370	2.793000	0.96121	0.655000	0.94253	TGG	.		0.602	TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1275533	1275533	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:1275533G>C	ENST00000529681.1	+	34	15487	c.15429G>C	c.(15427-15429)atG>atC	p.M5143I	MUC5B_ENST00000447027.1_Missense_Mutation_p.M5146I	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5143	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACAAGTCCATGGATATCGTCC	0.642																																					p.M5143I		.											.	.	0			c.G15429C						.						34.0	41.0	39.0					11																	1275533		2164	4260	6424	SO:0001583	missense	727897	exon34			GTCCATGGATATC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15429G>C	11.37:g.1275533G>C	ENSP00000436812:p.Met5143Ile	47	0		53	21	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789191	0.31685	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.15952	2.38;2.58	4.31	-3.06	0.05379	.	.	.	.	.	T	0.09113	0.0225	L	0.29908	0.895	0.09310	N	1	P;P	0.34462	0.454;0.454	B;B	0.31191	0.125;0.125	T	0.29792	-1.0000	9	0.87932	D	0	.	2.4091	0.04420	0.4222:0.118:0.3402:0.1197	.	5480;5146	A7Y9J9;E9PBJ0	.;.	I	5143;5146;5087;42;4855	ENSP00000436812:M5143I;ENSP00000415793:M5146I	ENSP00000343037:M5087I	M	+	3	0	MUC5B	1232109	0.000000	0.05858	0.003000	0.11579	0.609000	0.37215	-0.057000	0.11768	-0.168000	0.10853	0.400000	0.26472	ATG	.		0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
LGALS12	85329	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	63273900	63273900	+	Silent	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:63273900G>C	ENST00000394618.3	+	1	327	c.36G>C	c.(34-36)acG>acC	p.T12T	LGALS12_ENST00000255684.5_Silent_p.T12T|LGALS12_ENST00000415491.2_5'Flank|LGALS12_ENST00000340246.5_Silent_p.T12T|LGALS12_ENST00000425950.2_5'Flank	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	12					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						CTCCTGGAACGAGGATCTACA	0.572																																					p.T12T		.											.	LGALS12-92	0			c.G36C						.						126.0	114.0	118.0					11																	63273900		2201	4298	6499	SO:0001819	synonymous_variant	85329	exon1			TGGAACGAGGATC	AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.36G>C	11.37:g.63273900G>C		103	0		86	5	NM_001142535	0	0	0	0	0	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000394618.3	37	CCDS8045.1																																																																																			.		0.572	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101	
CATSPER1	117144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65788966	65788966	+	Splice_Site	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:65788966C>T	ENST00000312106.5	-	4	1829		c.e4+1			NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1						calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TGGCCACTGACCTGAGCCTCC	0.627																																					.		.											.	CATSPER1-92	0			c.1691+1G>A						.						41.0	45.0	44.0					11																	65788966		2201	4296	6497	SO:0001630	splice_region_variant	117144	exon5			CACTGACCTGAGC	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1691+1G>A	11.37:g.65788966C>T		56	0		29	16	NM_053054	0	0	0	0	0	Q96P76	Splice_Site	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826703	0.32329	.	.	ENSG00000175294	ENST00000312106	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4667	0.61258	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CATSPER1	65545542	1.000000	0.71417	0.985000	0.45067	0.197000	0.23852	4.738000	0.62073	2.227000	0.72691	0.561000	0.74099	.	.		0.627	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	Intron
C11orf52	91894	hgsc.bcm.edu	37	11	111796415	111796415	+	Missense_Mutation	SNP	C	C	G	rs202170534		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:111796415C>G	ENST00000278601.5	+	3	205	c.109C>G	c.(109-111)Cag>Gag	p.Q37E	HSPB2-C11orf52_ENST00000534100.1_3'UTR|CRYAB_ENST00000527950.1_5'Flank|RNA5SP351_ENST00000459480.1_RNA|DIXDC1_ENST00000529225.1_5'Flank|C11orf52_ENST00000527286.1_3'UTR	NM_080659.2	NP_542390.2	Q96A22	CK052_HUMAN	chromosome 11 open reading frame 52	37						extracellular vesicular exosome (GO:0070062)		p.Q37*(1)		lung(2)|ovary(1)	3		all_cancers(61;8.8e-15)|all_epithelial(67;6.27e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.63e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.7e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		GCAGCCACAACAGCTGCAGCA	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		21658	0.0		0.001	False		,,,				2504	0.0				p.Q37E		.											.	C11orf52-91	1	Substitution - Nonsense(1)	ovary(1)	c.C109G						.	C	GLU/GLN	0,4402		0,0,2201	74.0	82.0	79.0		109	1.1	0.1	11		79	3,8591	3.7+/-12.6	0,3,4294	yes	missense	C11orf52	NM_080659.2	29	0,3,6495	GG,GC,CC		0.0349,0.0,0.0231	benign	37/124	111796415	3,12993	2201	4297	6498	SO:0001583	missense	91894	exon3			CCACAACAGCTGC	AK057948	CCDS8353.1	11q23.1	2006-02-06	2006-02-06		ENSG00000149300	ENSG00000149300			30531	protein-coding gene	gene with protein product							Standard	NM_080659		Approved	MGC14839, FLJ25219		Q96A22	OTTHUMG00000166888	ENST00000278601.5:c.109C>G	11.37:g.111796415C>G	ENSP00000278601:p.Gln37Glu	38	0		40	2	NM_080659	0	0	25	25	0		Missense_Mutation	SNP	ENST00000278601.5	37	CCDS8353.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.03	2.115309	0.37339	0.0	3.49E-4	ENSG00000149300	ENST00000529342;ENST00000278601	T;T	0.44881	0.91;0.91	4.38	1.08	0.20341	.	0.574067	0.15833	N	0.242382	T	0.30166	0.0756	L	0.39898	1.24	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.25502	-1.0130	10	0.62326	D	0.03	-0.2206	6.4554	0.21926	0.3722:0.4467:0.1811:0.0	.	37	Q96A22	CK052_HUMAN	E	37	ENSP00000436268:Q37E;ENSP00000278601:Q37E	ENSP00000278601:Q37E	Q	+	1	0	C11orf52	111301625	0.728000	0.28080	0.108000	0.21378	0.186000	0.23388	1.389000	0.34453	0.543000	0.28864	0.561000	0.74099	CAG	C|0.999;G|0.000		0.512	C11orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391673.1	NM_080659	
BCL9L	283149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118771983	118771983	+	Silent	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:118771983C>T	ENST00000334801.3	-	6	3433	c.2469G>A	c.(2467-2469)caG>caA	p.Q823Q	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	823	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CACTGCTGTTCTGGGCCCGAA	0.652																																					p.Q823Q		.											.	BCL9L-229	0			c.G2469A						.						49.0	49.0	49.0					11																	118771983		2200	4295	6495	SO:0001819	synonymous_variant	283149	exon6			GCTGTTCTGGGCC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2469G>A	11.37:g.118771983C>T		78	0		92	38	NM_182557	0	0	4	12	8	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	37	CCDS8403.1																																																																																			.		0.652	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
CBL	867	bcgsc.ca	37	11	119156157	119156157	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:119156157C>T	ENST00000264033.4	+	11	2198	c.1822C>T	c.(1822-1824)Ccc>Tcc	p.P608S		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	608	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		TTCCAGTGATCCCTGGACAGG	0.557			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																												p.P608S				"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	.	CBL-4020	0			c.C1822T						.						67.0	67.0	67.0					11																	119156157		2199	4295	6494	SO:0001583	missense	867	exon11	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	AGTGATCCCTGGA	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1822C>T	11.37:g.119156157C>T	ENSP00000264033:p.Pro608Ser	91	0		68	4	NM_005188	0	0	3	3	0	A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	37	CCDS8418.1	.	.	.	.	.	.	.	.	.	.	C	7.137	0.581011	0.13686	.	.	ENSG00000110395	ENST00000264033	T	0.76839	-1.05	5.34	3.48	0.39840	.	0.541904	0.21736	N	0.069893	T	0.68531	0.3011	L	0.36672	1.1	0.30177	N	0.800794	B	0.23442	0.085	B	0.19666	0.026	T	0.66432	-0.5925	10	0.56958	D	0.05	-36.4407	12.6911	0.56974	0.1315:0.7423:0.1262:0.0	.	608	P22681	CBL_HUMAN	S	608	ENSP00000264033:P608S	ENSP00000264033:P608S	P	+	1	0	CBL	118661367	1.000000	0.71417	0.955000	0.39395	0.335000	0.28730	3.388000	0.52509	0.825000	0.34637	-0.127000	0.14921	CCC	.		0.557	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188	
ARHGEF12	23365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	120352127	120352127	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr11:120352127G>T	ENST00000397843.2	+	39	4562	c.4396G>T	c.(4396-4398)Gca>Tca	p.A1466S	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.A1447S|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.A1363S	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1466					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CTCCGATGGGGCAATTTCACC	0.537			T	MLL	AML																																p.A1466S		.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12-661	0			c.G4396T						.						91.0	92.0	92.0					11																	120352127		1937	4149	6086	SO:0001583	missense	23365	exon39			GATGGGGCAATTT	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.4396G>T	11.37:g.120352127G>T	ENSP00000380942:p.Ala1466Ser	94	0		83	28	NM_015313	0	1	16	28	11	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820487	0.32145	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.66099	-0.08;-0.19;-0.08	6.08	3.08	0.35506	.	0.599101	0.14093	N	0.341889	T	0.43233	0.1238	N	0.19112	0.55	0.18873	N	0.999987	B	0.23377	0.084	B	0.21708	0.036	T	0.22103	-1.0226	10	0.13108	T	0.6	-1.3411	10.087	0.42423	0.0683:0.2579:0.6738:0.0	.	1466	Q9NZN5	ARHGC_HUMAN	S	1466;1447;1363	ENSP00000380942:A1466S;ENSP00000349056:A1447S;ENSP00000432984:A1363S	ENSP00000349056:A1447S	A	+	1	0	ARHGEF12	119857337	1.000000	0.71417	0.695000	0.30226	0.341000	0.28922	3.420000	0.52735	0.398000	0.25338	0.655000	0.94253	GCA	.		0.537	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
LARP4	113251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50847454	50847454	+	Splice_Site	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr12:50847454T>C	ENST00000398473.2	+	9	1128	c.1016T>C	c.(1015-1017)cTg>cCg	p.L339P	LARP4_ENST00000429001.3_Splice_Site_p.L345P|LARP4_ENST00000293618.8_Splice_Site_p.L339P|LARP4_ENST00000518444.1_Splice_Site_p.L338P|LARP4_ENST00000522085.1_Splice_Site_p.L339P|LARP4_ENST00000347328.5_Intron|LARP4_ENST00000518561.1_Splice_Site_p.L269P	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	339					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						GAAACACCACTGGTAAGTGAG	0.353																																					p.L339P		.											.	LARP4-91	0			c.T1016C						.						143.0	119.0	126.0					12																	50847454		1844	4078	5922	SO:0001630	splice_region_variant	113251	exon9			CACCACTGGTAAG	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1017+1T>C	12.37:g.50847454T>C		126	0		123	59	NM_001170808	0	0	0	0	0	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760444	0.69763	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000522085;ENST00000398464;ENST00000518444;ENST00000518561;ENST00000520064	T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36	4.05	4.05	0.47172	.	0.000000	0.64402	D	0.000005	T	0.57784	0.2077	M	0.71581	2.175	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.911;1.0;1.0;1.0	D;P;D;D;D	0.91635	0.997;0.756;0.999;0.996;0.996	T	0.61739	-0.7001	10	0.54805	T	0.06	.	13.6919	0.62550	0.0:0.0:0.0:1.0	.	240;338;339;339;345	Q71RC2-2;Q71RC2-3;G3XAA8;Q71RC2;Q71RC2-4	.;.;.;LARP4_HUMAN;.	P	339;345;339;339;339;338;269;240	ENSP00000293618:L339P;ENSP00000415464:L345P;ENSP00000381490:L339P;ENSP00000429781:L339P;ENSP00000429077:L338P;ENSP00000430851:L269P	ENSP00000293618:L339P	L	+	2	0	LARP4	49133721	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	1.793000	0.52555	0.402000	0.26972	CTG	.		0.353	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	Missense_Mutation
GRASP	160622	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	52401016	52401016	+	Silent	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr12:52401016C>A	ENST00000293662.4	+	1	293	c.213C>A	c.(211-213)ctC>ctA	p.L71L		NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	71					protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		ACCGCGCGCTCGCCGTGTCCG	0.741																																					p.L71L		.											.	GRASP-91	0			c.C213A						.						8.0	9.0	9.0					12																	52401016		1938	4028	5966	SO:0001819	synonymous_variant	160622	exon1			CGCGCTCGCCGTG	AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.213C>A	12.37:g.52401016C>A		22	0		25	14	NM_181711	0	0	0	0	0	Q6PIF8|Q7Z741	Silent	SNP	ENST00000293662.4	37	CCDS8817.1																																																																																			.		0.741	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404972.1		
YY1	7528	bcgsc.ca	37	14	100705945	100705945	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr14:100705945C>T	ENST00000262238.4	+	1	624	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	RP11-638I2.4_ENST00000554537.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	122	Interaction with the SMAD1/SMAD4 complex.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				GGACGGGCTGCGCGCCGAGGA	0.697																																					p.R122C													.	YY1-226	0			c.C364T						.						35.0	38.0	37.0					14																	100705945		2195	4298	6493	SO:0001583	missense	7528	exon1			GGGCTGCGCGCCG	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.364C>T	14.37:g.100705945C>T	ENSP00000262238:p.Arg122Cys	122	0		104	6	NM_003403	0	0	8	8	0	Q14935	Missense_Mutation	SNP	ENST00000262238.4	37	CCDS9957.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593967	0.86953	.	.	ENSG00000100811	ENST00000262238	T	0.10960	2.82	2.34	2.34	0.29019	.	0.145303	0.45867	U	0.000332	T	0.08313	0.0207	N	0.22421	0.69	0.58432	D	0.999999	D	0.58620	0.983	B	0.43575	0.424	T	0.25916	-1.0118	10	0.51188	T	0.08	.	11.574	0.50850	0.0:1.0:0.0:0.0	.	122	P25490	TYY1_HUMAN	C	122	ENSP00000262238:R122C	ENSP00000262238:R122C	R	+	1	0	YY1	99775698	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	6.051000	0.71072	1.305000	0.44909	0.549000	0.68633	CGC	.		0.697	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403	
TYRO3	7301	hgsc.bcm.edu	37	15	41864763	41864763	+	Splice_Site	SNP	G	G	A	rs200965082		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr15:41864763G>A	ENST00000263798.3	+	15	2099		c.e15+1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAACCCCTTTGTGAGTACCTG	0.612																																					.		.											.	TYRO3-1388	0			c.1875+1G>A						.						45.0	40.0	42.0					15																	41864763		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon15			CCCTTTGTGAGTA	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1875+1G>A	15.37:g.41864763G>A		73	2		55	4	NM_006293	0	0	0	0	0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398910	0.83120	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4658	0.94939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39652055	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.858000	0.99539	2.599000	0.87857	0.655000	0.94253	.	G|0.999;T|0.001		0.612	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Intron
MAPK6	5597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	52338881	52338881	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr15:52338881A>G	ENST00000261845.5	+	2	1031	c.224A>G	c.(223-225)gAt>gGt	p.D75G		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	75	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CTTGACCATGATAACATTGTG	0.398																																					p.D75G		.											.	MAPK6-1403	0			c.A224G						.						95.0	94.0	94.0					15																	52338881		2195	4293	6488	SO:0001583	missense	5597	exon2			ACCATGATAACAT	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.224A>G	15.37:g.52338881A>G	ENSP00000261845:p.Asp75Gly	132	0		119	45	NM_002748	0	0	7	9	2	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.189988	0.78789	.	.	ENSG00000069956	ENST00000261845	T	0.43688	0.94	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	L	0.56199	1.76	0.80722	D	1	D	0.60575	0.988	D	0.79784	0.993	T	0.63646	-0.6590	10	0.87932	D	0	-21.6017	15.4537	0.75297	1.0:0.0:0.0:0.0	.	75	Q16659	MK06_HUMAN	G	75	ENSP00000261845:D75G	ENSP00000261845:D75G	D	+	2	0	MAPK6	50126173	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.249000	0.95470	2.067000	0.61834	0.529000	0.55759	GAT	.		0.398	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
SLTM	79811	hgsc.bcm.edu	37	15	59186365	59186365	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr15:59186365T>C	ENST00000380516.2	-	11	1492	c.1405A>G	c.(1405-1407)Atg>Gtg	p.M469V	SLTM_ENST00000536328.1_Missense_Mutation_p.M38V|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	469					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCTTTCTTCATTTCTTTCTTA	0.294																																					p.M469V		.											.	SLTM-91	0			c.A1405G						.						85.0	80.0	82.0					15																	59186365		2188	4289	6477	SO:0001583	missense	79811	exon11			TCTTCATTTCTTT	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1405A>G	15.37:g.59186365T>C	ENSP00000369887:p.Met469Val	15	0		15	2	NM_024755	0	0	19	19	0	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708574	0.30322	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328;ENST00000249736	D;T	0.86956	-2.19;2.86	5.46	0.551	0.17225	.	0.132360	0.33610	N	0.004722	T	0.69214	0.3086	N	0.14661	0.345	0.22737	N	0.998798	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.51957	-0.8639	10	0.10636	T	0.68	.	5.9184	0.19067	0.2961:0.0:0.3918:0.3121	.	469;38	Q9NWH9;A8K5V8	SLTM_HUMAN;.	V	469;62;38;451	ENSP00000369887:M469V;ENSP00000249736:M451V	ENSP00000249736:M451V	M	-	1	0	SLTM	56973657	0.052000	0.20516	0.988000	0.46212	0.993000	0.82548	0.155000	0.16362	-0.156000	0.11079	0.528000	0.53228	ATG	.		0.294	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
RAB11FIP3	9727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	568988	568988	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr16:568988G>A	ENST00000262305.4	+	10	2074	c.1686G>A	c.(1684-1686)acG>acA	p.T562T	RAB11FIP3_ENST00000450428.1_Silent_p.T266T|RAB11FIP3_ENST00000457159.1_Silent_p.T607T	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	562	ARF-binding domain (ABD).				cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				GGTCCTGCACGCCCTGTCTGA	0.612																																					p.T562T	Melanoma(160;2366 2595 4474 8099)	.											.	RAB11FIP3-90	0			c.G1686A						.						142.0	124.0	130.0					16																	568988		2201	4300	6501	SO:0001819	synonymous_variant	9727	exon10			CTGCACGCCCTGT	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1686G>A	16.37:g.568988G>A		130	0		129	34	NM_014700	0	0	48	68	20	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Silent	SNP	ENST00000262305.4	37	CCDS32351.1																																																																																			.		0.612	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	NM_014700	
MRPS34	65993	hgsc.bcm.edu	37	16	1822947	1822947	+	Silent	SNP	C	C	G	rs1076695	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr16:1822947C>G	ENST00000397375.2	-	1	209	c.174G>C	c.(172-174)gtG>gtC	p.V58V	NME3_ENST00000219302.3_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000568449.1_5'Flank|EME2_ENST00000307394.7_5'Flank|MRPS34_ENST00000177742.3_Silent_p.V58V	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	58						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TCTCGCGGCGCACGTCGGCCC	0.726													C|||	251	0.0501198	0.0061	0.0965	5008	,	,		10499	0.002		0.1421	False		,,,				2504	0.0317				p.V58V		.											.	MRPS34-92	0			c.G174C						.	C		25,2311		0,25,1143	1.0	2.0	2.0		174	1.7	1.0	16	dbSNP_86	2	405,4871		9,387,2242	no	coding-synonymous	MRPS34	NM_023936.1		9,412,3385	GG,GC,CC		7.6763,1.0702,5.649		58/219	1822947	430,7182	1168	2638	3806	SO:0001819	synonymous_variant	65993	exon1			GCGGCGCACGTCG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.174G>C	16.37:g.1822947C>G		1	1		4	2	NM_023936	0	0	2	7	5	Q9BVI7	Silent	SNP	ENST00000397375.2	37	CCDS10444.1																																																																																			C|0.923;G|0.077		0.726	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
PPP4C	5531	hgsc.bcm.edu	37	16	30087732	30087732	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr16:30087732G>C	ENST00000279387.7	+	2	202	c.34G>C	c.(34-36)Gag>Cag	p.E12Q	PPP4C_ENST00000561610.1_Missense_Mutation_p.E12Q	NM_002720.1	NP_002711.1	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	12					dephosphorylation (GO:0016311)|NIK/NF-kappaB signaling (GO:0038061)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase 4 complex (GO:0030289)	metal ion binding (GO:0046872)|NF-kappaB-inducing kinase activity (GO:0004704)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(2)|pancreas(1)|skin(1)|urinary_tract(1)	9						CCGGCAGATCGAGCAGCTGCG	0.706																																					p.E12Q		.											.	PPP4C-226	0			c.G34C						.						28.0	26.0	27.0					16																	30087732		2197	4299	6496	SO:0001583	missense	5531	exon2			CAGATCGAGCAGC		CCDS10669.1	16p11.2	2010-03-17	2010-03-05		ENSG00000149923	ENSG00000149923	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9319	protein-coding gene	gene with protein product	"""protein phosphatase X, catalytic subunit"""	602035	"""protein phosphatase 4 (formerly X), catalytic subunit"""			9177794	Standard	NM_002720		Approved	PP4, PPX	uc002dwf.3	P60510	OTTHUMG00000132113	ENST00000279387.7:c.34G>C	16.37:g.30087732G>C	ENSP00000279387:p.Glu12Gln	38	0		27	2	NM_002720	0	0	75	77	2	P33172	Missense_Mutation	SNP	ENST00000279387.7	37	CCDS10669.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700379	0.88924	.	.	ENSG00000149923	ENST00000279387	T	0.06608	3.28	6.16	4.18	0.49190	.	0.047590	0.85682	D	0.000000	T	0.12603	0.0306	M	0.86268	2.805	0.80722	D	1	B	0.17268	0.021	B	0.14023	0.01	T	0.01982	-1.1235	10	0.62326	D	0.03	-5.1047	11.8243	0.52259	0.068:0.1226:0.8094:0.0	.	12	P60510	PP4C_HUMAN	Q	12	ENSP00000279387:E12Q	ENSP00000279387:E12Q	E	+	1	0	PPP4C	29995233	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.378000	0.66190	1.600000	0.50102	0.650000	0.86243	GAG	.		0.706	PPP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255155.2	NM_002720	
ALOX15	246	hgsc.bcm.edu	37	17	4542864	4542864	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:4542864G>A	ENST00000570836.1	-	3	294	c.198C>T	c.(196-198)cgC>cgT	p.R66R	ALOX15_ENST00000574640.1_Intron|ALOX15_ENST00000545513.1_Silent_p.R88R|ALOX15_ENST00000293761.3_Silent_p.R66R			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	66	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		GGTGCCGTTTGCGCAGTTTCA	0.627																																					p.R66R		.											.	ALOX15-229	0			c.C198T						.						42.0	42.0	42.0					17																	4542864		2203	4300	6503	SO:0001819	synonymous_variant	246	exon2			CCGTTTGCGCAGT	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.198C>T	17.37:g.4542864G>A		47	2		69	5	NM_001140	0	0	0	0	0	A8K2P4|B7ZA11|Q8N6R7|Q99657	Silent	SNP	ENST00000570836.1	37	CCDS11049.1																																																																																			.		0.627	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2		
ULK2	9706	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	19770705	19770705	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:19770705T>A	ENST00000395544.4	-	1	525	c.26A>T	c.(25-27)tAc>tTc	p.Y9F	ULK2_ENST00000361658.2_Missense_Mutation_p.Y9F	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	9	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CCTCTTGCTGTACTCGAAGTC	0.771																																					p.Y9F		.											.	ULK2-334	0			c.A26T						.						21.0	21.0	21.0					17																	19770705		2197	4295	6492	SO:0001583	missense	9706	exon1			TTGCTGTACTCGA	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.26A>T	17.37:g.19770705T>A	ENSP00000378914:p.Tyr9Phe	22	0		51	29	NM_001142610	0	0	0	0	0	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	T	13.25	2.181057	0.38511	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.30981	1.51;1.51	4.71	3.61	0.41365	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067152	0.64402	D	0.000007	T	0.39860	0.1094	L	0.42744	1.35	0.49687	D	0.999814	D	0.76494	0.999	D	0.79108	0.992	T	0.21724	-1.0237	10	0.09590	T	0.72	-10.0083	9.917	0.41442	0.1526:0.0:0.0:0.8474	.	9	Q8IYT8	ULK2_HUMAN	F	9	ENSP00000354877:Y9F;ENSP00000378914:Y9F	ENSP00000354877:Y9F	Y	-	2	0	ULK2	19711297	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.963000	0.56773	0.633000	0.30452	0.472000	0.43445	TAC	.		0.771	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
FAM222B	55731	ucsc.edu	37	17	27086705	27086705	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:27086705T>G	ENST00000341217.5	-	3	487	c.272A>C	c.(271-273)tAc>tCc	p.Y91S	FAM222B_ENST00000583953.1_3'UTR|FAM222B_ENST00000583522.1_3'UTR|FAM222B_ENST00000582059.1_3'UTR|FAM222B_ENST00000452648.3_Missense_Mutation_p.Y91S|FAM222B_ENST00000581381.1_3'UTR|FAM222B_ENST00000581407.1_Missense_Mutation_p.Y91S|FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000577682.1_3'UTR	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	91																	CTGTGTCGGGTAGGGGCTGTA	0.567																																					p.Y91S													.	.	0			c.A272C						.						47.0	54.0	52.0					17																	27086705		2103	4238	6341	SO:0001583	missense	55731	exon4			GTCGGGTAGGGGC	AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.272A>C	17.37:g.27086705T>G	ENSP00000343115:p.Tyr91Ser	21	3		44	5	NM_018182	0	0	14	14	0	Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	ENST00000341217.5	37	CCDS45637.1	.	.	.	.	.	.	.	.	.	.	T	9.530	1.110669	0.20714	.	.	ENSG00000173065	ENST00000341217;ENST00000452648	T;T	0.62941	-0.01;-0.01	4.97	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	M	0.68317	2.08	0.58432	D	0.999999	P	0.44309	0.832	B	0.40375	0.327	T	0.63945	-0.6522	10	0.87932	D	0	-7.1164	11.2659	0.49110	0.0:0.0:0.1533:0.8466	.	91	Q8WU58	CQ063_HUMAN	S	91	ENSP00000343115:Y91S;ENSP00000413645:Y91S	ENSP00000343115:Y91S	Y	-	2	0	C17orf63	24110831	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.513000	0.81739	0.900000	0.36469	0.459000	0.35465	TAC	.		0.567	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1	NM_018182	
EVI2A	2123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29645740	29645740	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:29645740A>T	ENST00000462804.2	-	2	691	c.292T>A	c.(292-294)Tct>Act	p.S98T	EVI2A_ENST00000247270.3_Missense_Mutation_p.S121T|CTD-2370N5.3_ENST00000578584.1_Missense_Mutation_p.F37Y|EVI2A_ENST00000461237.1_Missense_Mutation_p.S98T|NF1_ENST00000358273.4_Intron|NF1_ENST00000581113.2_Intron|NF1_ENST00000356175.3_Intron	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	98					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)|p.S121P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		CTGACGACAGAAGGTATATAA	0.368																																					p.S121T		.											.	EVI2A-136	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)|liver(1)	c.T361A						.						153.0	153.0	153.0					17																	29645740		2203	4300	6503	SO:0001583	missense	2123	exon3			CGACAGAAGGTAT	M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.292T>A	17.37:g.29645740A>T	ENSP00000420557:p.Ser98Thr	122	0		196	116	NM_001003927	0	0	1	1	0	B2R5X2|B4DHX8	Missense_Mutation	SNP	ENST00000462804.2	37	CCDS42293.1	.	.	.	.	.	.	.	.	.	.	A	7.116	0.577064	0.13686	.	.	ENSG00000126860	ENST00000394755;ENST00000462804;ENST00000461237;ENST00000247270	.	.	.	4.67	-0.204	0.13200	.	1.194170	0.05806	N	0.613220	T	0.23249	0.0562	L	0.50333	1.59	0.19300	N	0.99998	B;B	0.33318	0.058;0.408	B;B	0.29785	0.091;0.107	T	0.12400	-1.0549	9	0.07175	T	0.84	.	0.9302	0.01333	0.421:0.1575:0.2688:0.1527	.	98;121	P22794;P22794-2	EVI2A_HUMAN;.	T	98;94;98;121	.	ENSP00000247270:S121T	S	-	1	0	EVI2A	26669866	0.000000	0.05858	0.002000	0.10522	0.601000	0.36947	0.005000	0.13129	-0.022000	0.13986	0.459000	0.35465	TCT	.		0.368	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354491.3	NM_014210	
HNF1B	6928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36099582	36099582	+	Silent	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:36099582T>C	ENST00000225893.4	-	2	754	c.393A>G	c.(391-393)caA>caG	p.Q131Q	HNF1B_ENST00000427275.2_Silent_p.Q131Q|HNF1B_ENST00000560016.1_Silent_p.Q131Q|HNF1B_ENST00000561193.1_Silent_p.Q131Q	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	131					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GGATGTTGTGTTGCTGCATGT	0.547																																					p.Q131Q	Colon(71;102 1179 9001 27917 43397)	.											.	HNF1B-71	0			c.A393G						.						101.0	86.0	92.0					17																	36099582		2203	4300	6503	SO:0001819	synonymous_variant	6928	exon2			GTTGTGTTGCTGC	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.393A>G	17.37:g.36099582T>C		46	0		68	42	NM_001165923	0	0	26	88	62	B4DKM3|E0YMJ9	Silent	SNP	ENST00000225893.4	37	CCDS11324.1																																																																																			.		0.547	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458	
KRT26	353288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38926071	38926071	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:38926071C>A	ENST00000335552.4	-	5	952	c.904G>T	c.(904-906)Gag>Tag	p.E302*		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				TCGGTCAGCTCATTTCTGGCT	0.463																																					p.E302X		.											.	KRT26-90	0			c.G904T						.						174.0	159.0	164.0					17																	38926071		2203	4300	6503	SO:0001587	stop_gained	353288	exon5			TCAGCTCATTTCT	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.904G>T	17.37:g.38926071C>A	ENSP00000334798:p.Glu302*	147	0		214	68	NM_181539	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000335552.4	37	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	C	36	5.661653	0.96734	.	.	ENSG00000186393	ENST00000335552	.	.	.	5.24	4.24	0.50183	.	0.102432	0.42821	D	0.000643	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.7173	0.77677	0.0:0.7423:0.2577:0.0	.	.	.	.	X	302	.	ENSP00000334798:E302X	E	-	1	0	KRT26	36179597	0.424000	0.25490	1.000000	0.80357	0.917000	0.54804	1.023000	0.30065	1.292000	0.44672	0.655000	0.94253	GAG	.		0.463	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539	
NARF	26502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80443514	80443514	+	Silent	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr17:80443514C>T	ENST00000309794.11	+	10	1311	c.1113C>T	c.(1111-1113)gtC>gtT	p.V371V	NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Silent_p.V417V|NARF_ENST00000345415.7_Silent_p.V323V|NARF_ENST00000390006.4_Silent_p.V312V	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	371						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TTGTGGAGGTCCTCGCCTGTG	0.572																																					p.V371V		.											.	NARF-226	0			c.C1113T						.						106.0	93.0	97.0					17																	80443514		2203	4300	6503	SO:0001819	synonymous_variant	26502	exon10			GGAGGTCCTCGCC	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1113C>T	17.37:g.80443514C>T		85	0		123	86	NM_012336	0	0	26	60	34	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Silent	SNP	ENST00000309794.11	37	CCDS32777.1																																																																																			.		0.572	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968	
MEP1B	4225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	29788204	29788204	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr18:29788204A>T	ENST00000269202.6	+	9	936	c.889A>T	c.(889-891)Agt>Tgt	p.S297C	MEP1B_ENST00000581447.1_Missense_Mutation_p.S297C	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	297	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GGGGCCAGAGAGTGATCACTC	0.478																																					p.S297C		.											.	MEP1B-92	0			c.A889T						.						83.0	86.0	85.0					18																	29788204		1915	4116	6031	SO:0001583	missense	4225	exon9			CCAGAGAGTGATC	X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.889A>T	18.37:g.29788204A>T	ENSP00000269202:p.Ser297Cys	69	0		83	36	NM_005925	0	0	0	0	0	B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	ENST00000269202.6	37	CCDS45846.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103407	0.56291	.	.	ENSG00000141434	ENST00000269202	T	0.02369	4.32	5.48	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.625246	0.18028	N	0.154004	T	0.11965	0.0291	M	0.77313	2.365	0.09310	N	1	P	0.51791	0.948	P	0.59948	0.866	T	0.02047	-1.1223	10	0.62326	D	0.03	-5.1783	10.7622	0.46272	0.9255:0.0:0.0745:0.0	.	297	Q16820	MEP1B_HUMAN	C	297	ENSP00000269202:S297C	ENSP00000269202:S297C	S	+	1	0	MEP1B	28042202	0.761000	0.28439	0.207000	0.23584	0.486000	0.33341	6.024000	0.70857	2.078000	0.62432	0.459000	0.35465	AGT	.		0.478	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925	
PQLC1	80148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	77679262	77679262	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr18:77679262A>T	ENST00000397778.2	-	5	712	c.530T>A	c.(529-531)cTg>cAg	p.L177Q	PQLC1_ENST00000590381.1_Intron|PQLC1_ENST00000357575.4_Missense_Mutation_p.L159Q|PQLC1_ENST00000409073.1_Missense_Mutation_p.L94Q	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	177						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CAGCACAGCCAGGAAGCCCAG	0.652																																					p.L177Q		.											.	PQLC1-154	0			c.T530A						.						88.0	75.0	79.0					18																	77679262		2203	4300	6503	SO:0001583	missense	80148	exon5			ACAGCCAGGAAGC	AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.530T>A	18.37:g.77679262A>T	ENSP00000380880:p.Leu177Gln	58	0		50	18	NM_025078	0	0	12	17	5	B7Z7D9|G5E989|Q9H6D0	Missense_Mutation	SNP	ENST00000397778.2	37	CCDS12020.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453736	0.84209	.	.	ENSG00000122490	ENST00000397778;ENST00000409073;ENST00000357575	D;D;D	0.98531	-4.98;-4.98;-4.98	5.1	3.95	0.45737	.	0.000000	0.64402	D	0.000002	D	0.98707	0.9566	M	0.85197	2.74	0.80722	D	1	D;P	0.89917	1.0;0.937	D;P	0.81914	0.995;0.71	D	0.98869	1.0765	10	0.56958	D	0.05	-19.803	10.2033	0.43099	0.9213:0.0:0.0786:0.0	.	177;159	Q8N2U9;G5E989	PQLC1_HUMAN;.	Q	177;94;159	ENSP00000380880:L177Q;ENSP00000387221:L94Q;ENSP00000350188:L159Q	ENSP00000350188:L159Q	L	-	2	0	PQLC1	75780250	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	6.181000	0.71988	1.917000	0.55516	0.533000	0.62120	CTG	.		0.652	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256434.1	NM_025078	
ABCA7	10347	hgsc.bcm.edu	37	19	1046944	1046944	+	Missense_Mutation	SNP	C	C	G	rs144979723|rs142076058|rs375206158	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:1046944C>G	ENST00000263094.6	+	14	1997	c.1766C>G	c.(1765-1767)gCg>gGg	p.A589G	ABCA7_ENST00000435683.2_Missense_Mutation_p.A451G|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000433129.1_Missense_Mutation_p.A589G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	589					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCAGCCGCGCGGTGCTCTGG	0.692													C|||	5	0.000998403	0.0	0.0	5008	,	,		13253	0.002		0.0	False		,,,				2504	0.0031				p.A589G		.											.	ABCA7-98	0			c.C1766G						.						17.0	18.0	18.0					19																	1046944		2170	4265	6435	SO:0001583	missense	10347	exon14			GCCGCGCGGTGCT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1766C>G	19.37:g.1046944C>G	ENSP00000263094:p.Ala589Gly	8	1		10	3	NM_019112	0	0	2	3	1	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.154384	0.00325	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	T;T	0.80909	-1.43;-1.43	4.68	0.595	0.17490	.	.	.	.	.	T	0.60183	0.2249	N	0.03948	-0.315	0.09310	N	1	B;B	0.14805	0.003;0.011	B;B	0.21546	0.015;0.035	T	0.30357	-0.9981	9	0.09590	T	0.72	.	16.2636	0.82563	0.0:0.5375:0.4625:0.0	.	451;589	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	G	589	ENSP00000263094:A589G;ENSP00000414062:A589G	ENSP00000263094:A589G	A	+	2	0	ABCA7	997944	0.806000	0.28996	0.000000	0.03702	0.012000	0.07955	1.386000	0.34419	0.054000	0.16065	-1.338000	0.01255	GCG	C|0.999;T|0.001		0.692	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TMPRSS9	360200	hgsc.bcm.edu	37	19	2416797	2416797	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:2416797G>A	ENST00000332578.3	+	11	1905	c.1905G>A	c.(1903-1905)caG>caA	p.Q635Q		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	635	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAATACGCAGGAAGGAAATG	0.592																																					p.Q635Q		.											.	TMPRSS9-91	0			c.G1905A						.						31.0	35.0	34.0					19																	2416797		2203	4299	6502	SO:0001819	synonymous_variant	360200	exon11			TACGCAGGAAGGA	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.1905G>A	19.37:g.2416797G>A		44	1		39	2	NM_182973	0	0	0	0	0	Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	37	CCDS12088.1																																																																																			.		0.592	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9077786	9077786	+	Silent	SNP	G	G	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:9077786G>T	ENST00000397910.4	-	3	9863	c.9660C>A	c.(9658-9660)atC>atA	p.I3220I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3221	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTGGACCTGATCTCTGGGC	0.498																																					p.I3220I		.											.	MUC16-566	0			c.C9660A						.						142.0	140.0	140.0					19																	9077786		1965	4150	6115	SO:0001819	synonymous_variant	94025	exon3			GGACCTGATCTCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9660C>A	19.37:g.9077786G>T		162	0		157	71	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ANGPTL6	83854	broad.mit.edu	37	19	10206815	10206815	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:10206815C>T	ENST00000253109.4	-	2	663	c.425G>A	c.(424-426)cGc>cAc	p.R142H	ANGPTL6_ENST00000592641.1_Missense_Mutation_p.R142H|ANGPTL6_ENST00000589181.1_Missense_Mutation_p.R142H	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	142					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			GTTGAGCACGCGCTCCCCGAG	0.771																																					p.R142H													.	ANGPTL6-90	0			c.G425A						.						4.0	4.0	4.0					19																	10206815		1659	3270	4929	SO:0001583	missense	83854	exon2			AGCACGCGCTCCC	AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.425G>A	19.37:g.10206815C>T	ENSP00000253109:p.Arg142His	14	0		8	3	NM_031917	0	0	0	0	0	A5PKV7|Q9BZZ0	Missense_Mutation	SNP	ENST00000253109.4	37	CCDS12224.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214259	0.79352	.	.	ENSG00000130812	ENST00000253109	T	0.56776	0.44	4.36	2.11	0.27256	.	0.730444	0.12789	N	0.438963	T	0.40546	0.1121	L	0.39245	1.2	0.30614	N	0.75922	B	0.12630	0.006	B	0.06405	0.002	T	0.43032	-0.9416	10	0.54805	T	0.06	.	6.8988	0.24271	0.0:0.6789:0.0:0.3211	.	142	Q8NI99	ANGL6_HUMAN	H	142	ENSP00000253109:R142H	ENSP00000253109:R142H	R	-	2	0	ANGPTL6	10067815	0.995000	0.38212	1.000000	0.80357	0.884000	0.51177	0.382000	0.20635	1.030000	0.39839	0.455000	0.32223	CGC	.		0.771	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451142.1	NM_031917	
MAST3	23031	hgsc.bcm.edu	37	19	18257754	18257754	+	Missense_Mutation	SNP	G	G	A	rs372265542		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:18257754G>A	ENST00000262811.6	+	25	3139	c.3139G>A	c.(3139-3141)Gcc>Acc	p.A1047T	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	1047							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GGTGGGCCCCGCCCGGAAGAA	0.672																																					p.A1047T		.											.	MAST3-502	0			c.G3139A						.		THR/ALA	0,3852		0,0,1926	20.0	22.0	21.0		3139	4.4	0.2	19		21	1,8143		0,1,4071	no	missense	MAST3	NM_015016.1	58	0,1,5997	AA,AG,GG		0.0123,0.0,0.0083	probably-damaging	1047/1310	18257754	1,11995	1926	4072	5998	SO:0001583	missense	23031	exon25			GGCCCCGCCCGGA	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.3139G>A	19.37:g.18257754G>A	ENSP00000262811:p.Ala1047Thr	6	2		4	3	NM_015016	0	0	1	1	0	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	g	26.0	4.698857	0.88830	0.0	1.23E-4	ENSG00000099308	ENST00000262811	T	0.69561	-0.41	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	D	0.83022	0.5164	M	0.85542	2.76	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.85721	0.1325	10	0.52906	T	0.07	-27.2754	15.9367	0.79717	0.0:0.0:1.0:0.0	.	1047	O60307	MAST3_HUMAN	T	1047	ENSP00000262811:A1047T	ENSP00000262811:A1047T	A	+	1	0	MAST3	18118754	1.000000	0.71417	0.187000	0.23214	0.712000	0.41017	9.712000	0.98738	1.985000	0.57927	0.486000	0.48141	GCC	.		0.672	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
MAU2	23383	hgsc.bcm.edu	37	19	19431719	19431719	+	Silent	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:19431719G>C	ENST00000392313.6	+	1	230	c.51G>C	c.(49-51)gcG>gcC	p.A17A	SUGP1_ENST00000247001.5_5'Flank|MAU2_ENST00000262815.8_Silent_p.A17A|SUGP1_ENST00000585763.1_5'Flank|SUGP1_ENST00000334782.5_5'Flank	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	17	Ala-rich.|Sufficient for interaction with NIPBL.				maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						cccaggctgcgcaggccgagg	0.716																																					p.A17A		.											.	MAU2-91	0			c.G51C						.						4.0	5.0	5.0					19																	19431719		1710	3860	5570	SO:0001819	synonymous_variant	23383	exon1			GGCTGCGCAGGCC	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.51G>C	19.37:g.19431719G>C		5	1		6	5	NM_015329	0	0	2	8	6	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Silent	SNP	ENST00000392313.6	37	CCDS32969.2																																																																																			.		0.716	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
LMTK3	114783	hgsc.bcm.edu;broad.mit.edu	37	19	49000760	49000760	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:49000760G>A	ENST00000600059.1	-	11	3793	c.3566C>T	c.(3565-3567)aCg>aTg	p.T1189M	LMTK3_ENST00000270238.3_Missense_Mutation_p.T1218M			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1189	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GCTGAGTGCCGTGTCTCCGCC	0.726																																					p.T1218M		.											.	LMTK3-1357	0			c.C3653T						.						20.0	22.0	22.0					19																	49000760		1899	4097	5996	SO:0001583	missense	114783	exon12			AGTGCCGTGTCTC	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.3566C>T	19.37:g.49000760G>A	ENSP00000472020:p.Thr1189Met	46	0		36	3	NM_001080434	0	0	4	4	0	Q4G0U1	Missense_Mutation	SNP	ENST00000600059.1	37		.	.	.	.	.	.	.	.	.	.	G	3.648	-0.072072	0.07228	.	.	ENSG00000142235	ENST00000270238	T	0.75821	-0.97	3.8	1.65	0.23941	.	0.769546	0.11439	N	0.563997	T	0.47637	0.1456	N	0.08118	0	0.20489	N	0.999892	B	0.13145	0.007	B	0.08055	0.003	T	0.26710	-1.0095	10	0.25751	T	0.34	.	2.6431	0.04976	0.2569:0.0:0.513:0.2301	.	1189	Q96Q04	LMTK3_HUMAN	M	1218	ENSP00000270238:T1218M	ENSP00000270238:T1218M	T	-	2	0	LMTK3	53692572	0.094000	0.21725	1.000000	0.80357	0.292000	0.27327	-0.331000	0.07914	0.919000	0.36945	0.563000	0.77884	ACG	.		0.726	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	
LENG9	94059	hgsc.bcm.edu	37	19	54974538	54974538	+	Missense_Mutation	SNP	C	C	T	rs202206879	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr19:54974538C>T	ENST00000333834.4	-	1	356	c.238G>A	c.(238-240)Ggg>Agg	p.G80R		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	80							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		TTCTTGGCCCCGGCCTCCGGC	0.776													C|||	18	0.00359425	0.0008	0.013	5008	,	,		8860	0.0		0.008	False		,,,				2504	0.0				p.G80R		.											.	LENG9-68	0			c.G238A						.	C	ARG/GLY	3,2029		0,3,1013	1.0	1.0	1.0		238	-0.5	0.0	19		1	17,4149		0,17,2066	no	missense	LENG9	NM_198988.1	125	0,20,3079	TT,TC,CC		0.4081,0.1476,0.3227	benign	80/502	54974538	20,6178	1016	2083	3099	SO:0001583	missense	94059	exon1			TGGCCCCGGCCTC	AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.238G>A	19.37:g.54974538C>T	ENSP00000331647:p.Gly80Arg	4	0		5	4	NM_198988	0	0	0	0	0	B2VAM3	Missense_Mutation	SNP	ENST00000333834.4	37	CCDS12895.2	.	.	.	.	.	.	.	.	.	.	C	6.063	0.379917	0.11466	0.001476	0.004081	ENSG00000182909	ENST00000333834	T	0.32988	1.43	3.31	-0.497	0.12023	.	1.586810	0.03704	N	0.249105	T	0.15219	0.0367	N	0.11064	0.09	0.09310	N	1	B	0.16802	0.019	B	0.10450	0.005	T	0.17077	-1.0381	10	0.13470	T	0.59	-0.0431	5.1691	0.15101	0.0:0.6056:0.1681:0.2264	.	80	Q96B70	LENG9_HUMAN	R	80	ENSP00000331647:G80R	ENSP00000331647:G80R	G	-	1	0	LENG9	59666350	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.192000	0.17096	-0.111000	0.12001	-0.362000	0.07510	GGG	.		0.776	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140806.3	NM_198988	
SRBD1	55133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	45616665	45616665	+	Silent	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:45616665G>C	ENST00000263736.4	-	21	2834	c.2772C>G	c.(2770-2772)ggC>ggG	p.G924G	SRBD1_ENST00000535761.1_Silent_p.G443G|SRBD1_ENST00000490133.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	924	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TCTCAACTTTGCCTGTAAGAA	0.378																																					p.G924G		.											.	SRBD1-90	0			c.C2772G						.						66.0	64.0	64.0					2																	45616665		2202	4300	6502	SO:0001819	synonymous_variant	55133	exon21			AACTTTGCCTGTA	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2772C>G	2.37:g.45616665G>C		71	0		65	17	NM_018079	0	0	6	7	1	Q53T56|Q96TA4|Q9NW11	Silent	SNP	ENST00000263736.4	37	CCDS1823.1																																																																																			.		0.378	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
ZNF514	84874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95815137	95815137	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:95815137A>C	ENST00000295208.2	-	5	1555	c.1093T>G	c.(1093-1095)Ttt>Gtt	p.F365V	MRPS5_ENST00000475040.1_5'UTR|ZNF514_ENST00000411425.1_Missense_Mutation_p.F365V	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(6)|urinary_tract(1)	11						CCAGTGTGAAATCTGTAATGT	0.398																																					p.F365V		.											.	ZNF514-90	0			c.T1093G						.						78.0	72.0	74.0					2																	95815137		2203	4300	6503	SO:0001583	missense	84874	exon5			TGTGAAATCTGTA	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.1093T>G	2.37:g.95815137A>C	ENSP00000295208:p.Phe365Val	78	0		74	33	NM_032788	0	0	11	21	10	Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	A	12.19	1.864411	0.32977	.	.	ENSG00000144026	ENST00000295208;ENST00000411425	T;T	0.28454	1.61;1.61	2.74	1.57	0.23409	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.00611	-1.325	0.23572	N	0.997388	B;B	0.14805	0.011;0.0	B;B	0.14578	0.011;0.002	T	0.26326	-1.0106	9	0.35671	T	0.21	.	2.3501	0.04281	0.6187:0.0:0.1395:0.2419	.	365;184	Q96K75;Q658L7	ZN514_HUMAN;.	V	365	ENSP00000295208:F365V;ENSP00000405509:F365V	ENSP00000295208:F365V	F	-	1	0	ZNF514	95178864	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	0.606000	0.24194	0.454000	0.26884	0.533000	0.62120	TTT	.		0.398	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788	
SF3B1	23451	hgsc.bcm.edu	37	2	198266726	198266726	+	Missense_Mutation	SNP	G	G	T	rs78164940		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:198266726G>T	ENST00000335508.6	-	15	2297	c.2206C>A	c.(2206-2208)Cgc>Agc	p.R736S	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	736					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.R736C(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTGTGTTGGCGGATACCCTTC	0.373			Mis		myelodysplastic syndrome																																p.R736S		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	1	Substitution - Missense(1)	endometrium(1)	c.C2206A						.						92.0	88.0	89.0					2																	198266726		2203	4300	6503	SO:0001583	missense	23451	exon15			GTTGGCGGATACC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2206C>A	2.37:g.198266726G>T	ENSP00000335321:p.Arg736Ser	59	0		64	4	NM_012433	0	0	85	85	0	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006500	0.54361	.	.	ENSG00000115524	ENST00000335508	T	0.63913	-0.07	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	M	0.76574	2.34	0.80722	D	1	B	0.33857	0.429	B	0.36335	0.222	T	0.69525	-0.5122	10	0.52906	T	0.07	.	19.3674	0.94469	0.0:0.0:1.0:0.0	.	736	O75533	SF3B1_HUMAN	S	736	ENSP00000335321:R736S	ENSP00000335321:R736S	R	-	1	0	SF3B1	197974971	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.892000	0.56235	2.567000	0.86603	0.650000	0.86243	CGC	.		0.373	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
UGT1A3	54659	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	234638329	234638329	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:234638329A>G	ENST00000482026.1	+	1	576	c.557A>G	c.(556-558)cAg>cGg	p.Q186R	UGT1A6_ENST00000406651.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.Q186R|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A1_ENST00000373450.4_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	186					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	AAGGGCACACAGTGTCCAAAC	0.458																																					p.Q186R		.											.	UGT1A3-24	0			c.A557G						.						184.0	182.0	183.0					2																	234638329		2203	4300	6503	SO:0001583	missense	54659	exon1			GCACACAGTGTCC	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.557A>G	2.37:g.234638329A>G	ENSP00000418532:p.Gln186Arg	234	0		254	122	NM_019093	0	0	0	0	0	B8K287	Missense_Mutation	SNP	ENST00000482026.1	37	CCDS2509.1	.	.	.	.	.	.	.	.	.	.	a	8.706	0.910893	0.17833	.	.	ENSG00000243135	ENST00000482026	T	0.61392	0.11	4.13	-0.128	0.13506	.	.	.	.	.	T	0.52403	0.1732	L	0.41961	1.31	0.26480	N	0.975128	P;P	0.38863	0.65;0.65	P;P	0.49140	0.601;0.601	T	0.46275	-0.9203	9	0.13108	T	0.6	.	6.8323	0.23917	0.6376:0.2835:0.0789:0.0	.	186;186	Q5DT01;P35503	.;UD13_HUMAN	R	186	ENSP00000418532:Q186R	ENSP00000418532:Q186R	Q	+	2	0	UGT1A3	234303068	0.618000	0.27051	0.013000	0.15412	0.284000	0.27059	2.244000	0.43124	-0.332000	0.08489	-0.359000	0.07587	CAG	.		0.458	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
SCLY	51540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	238990470	238990470	+	Missense_Mutation	SNP	T	T	C	rs548740545		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:238990470T>C	ENST00000555827.1	+	5	669	c.605T>C	c.(604-606)aTt>aCt	p.I202T	SCLY_ENST00000373332.3_Missense_Mutation_p.I120T|SCLY_ENST00000254663.6_Missense_Mutation_p.I210T|SCLY_ENST00000429612.2_Intron|SCLY_ENST00000422984.2_Missense_Mutation_p.I108T|SCLY_ENST00000409736.2_Missense_Mutation_p.I202T			Q96I15	SCLY_HUMAN	selenocysteine lyase	202					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		GAGACTGGCATTGTCATGGTG	0.572													T|||	1	0.000199681	0.0	0.0	5008	,	,		19116	0.0		0.0	False		,,,				2504	0.001				p.I210T	Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)	.											.	SCLY-92	0			c.T629C						.						95.0	77.0	83.0					2																	238990470		2203	4300	6503	SO:0001583	missense	51540	exon5			CTGGCATTGTCAT	AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.605T>C	2.37:g.238990470T>C	ENSP00000450613:p.Ile202Thr	62	0		50	19	NM_016510	0	0	0	1	1	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Missense_Mutation	SNP	ENST00000555827.1	37		.	.	.	.	.	.	.	.	.	.	T	5.647	0.303939	0.10678	.	.	ENSG00000132330	ENST00000254663;ENST00000555827;ENST00000373332;ENST00000413463;ENST00000409736;ENST00000422984;ENST00000450965	D;D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	5.84	4.67	0.58626	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.126390	0.52532	D	0.000062	T	0.61874	0.2382	N	0.00996	-1.065	0.80722	D	1	B;B;B	0.24043	0.036;0.096;0.006	B;B;B	0.31751	0.132;0.135;0.016	T	0.61426	-0.7065	10	0.02654	T	1	-27.8716	12.3833	0.55320	0.0:0.0:0.1409:0.8591	.	108;202;202	E7ESG3;Q96I15;Q96I15-2	.;SCLY_HUMAN;.	T	210;202;120;116;202;108;32	ENSP00000254663:I210T;ENSP00000450613:I202T;ENSP00000362429:I120T;ENSP00000414165:I116T;ENSP00000387162:I202T;ENSP00000416865:I108T;ENSP00000414053:I32T	ENSP00000254663:I202T	I	+	2	0	SCLY	238655209	1.000000	0.71417	0.002000	0.10522	0.045000	0.14185	7.953000	0.87836	1.020000	0.39573	0.533000	0.62120	ATT	.		0.572	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B-22	0			c.529-2A>G						.																																			SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G		226	5		280	17	NR_003579	0	0	1	1	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
SNTA1	6640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32026771	32026771	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr20:32026771G>A	ENST00000217381.2	-	2	643	c.372C>T	c.(370-372)gaC>gaT	p.D124D		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	124	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						CCTCTGTCTGGTCAGCTGCCA	0.527																																					p.D124D		.											.	SNTA1-91	0			c.C372T						.						123.0	121.0	122.0					20																	32026771		2203	4300	6503	SO:0001819	synonymous_variant	6640	exon2			TGTCTGGTCAGCT	U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.372C>T	20.37:g.32026771G>A		178	1		235	74	NM_003098	0	0	0	1	1	A8K7H9|B4DX40|E1P5N1|Q16438	Silent	SNP	ENST00000217381.2	37	CCDS13220.1																																																																																			.		0.527	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078704.2	NM_003098	
RALGAPB	57148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	37153507	37153507	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr20:37153507C>A	ENST00000262879.6	+	11	1990	c.1706C>A	c.(1705-1707)cCt>cAt	p.P569H	RALGAPB_ENST00000397040.1_Missense_Mutation_p.P569H|RALGAPB_ENST00000397038.1_Missense_Mutation_p.P347H|RALGAPB_ENST00000397042.3_Missense_Mutation_p.P569H			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	569					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AACTCTCCTCCTTTGTTCTGC	0.393																																					p.P569H		.											.	RALGAPB-92	0			c.C1706A						.						301.0	273.0	283.0					20																	37153507		2203	4300	6503	SO:0001583	missense	57148	exon11			CTCCTCCTTTGTT	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.1706C>A	20.37:g.37153507C>A	ENSP00000262879:p.Pro569His	171	0		247	151	NM_020336	0	0	4	8	4	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	37	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249579	0.59212	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000397038;ENST00000397040;ENST00000438490	T;T	0.66280	-0.2;-0.2	5.51	4.54	0.55810	.	0.099219	0.64402	D	0.000001	T	0.49423	0.1556	N	0.22421	0.69	0.49299	D	0.999778	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.06405	0.001;0.002;0.002;0.002	T	0.46707	-0.9172	10	0.48119	T	0.1	.	15.7457	0.77939	0.1369:0.8631:0.0:0.0	.	397;569;569;569	A2A2F0;Q86X10-4;A2A2E9;Q86X10	.;.;.;RLGPB_HUMAN	H	569;569;569;347;569;397	ENSP00000262879:P569H;ENSP00000380233:P569H	ENSP00000262879:P569H	P	+	2	0	RALGAPB	36586921	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.977000	0.70492	2.587000	0.87381	0.561000	0.74099	CCT	.		0.393	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
SULF2	55959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	46291842	46291842	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr20:46291842T>A	ENST00000359930.4	-	17	3193	c.2342A>T	c.(2341-2343)tAc>tTc	p.Y781F	SULF2_ENST00000361612.4_Missense_Mutation_p.Y781F|SULF2_ENST00000467815.1_Missense_Mutation_p.Y781F|SULF2_ENST00000484875.1_Missense_Mutation_p.Y781F	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	781					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GAGATCAAAGTACTCTAGGAA	0.547											OREG0026005	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y781F		.											.	SULF2-293	0			c.A2342T						.						155.0	142.0	147.0					20																	46291842		2203	4300	6503	SO:0001583	missense	55959	exon17			TCAAAGTACTCTA	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.2342A>T	20.37:g.46291842T>A	ENSP00000353007:p.Tyr781Phe	89	0	938	98	51	NM_001161841	0	0	68	195	127	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.42|19.42	3.824660|3.824660	0.71143|0.71143	.|.	.|.	ENSG00000196562|ENSG00000196562	ENST00000495544|ENST00000359930;ENST00000484875;ENST00000361612;ENST00000371978;ENST00000467815	.|D;D;D;D	.|0.96073	.|-3.9;-3.9;-3.9;-3.9	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	.|0.054592	.|0.85682	.|D	.|0.000000	D|D	0.95956|0.95956	0.8683|0.8683	L|L	0.41356|0.41356	1.27|1.27	0.54753|0.54753	D|D	0.999982|0.999982	.|D;D	.|0.89917	.|1.0;0.998	.|D;D	.|0.87578	.|0.998;0.99	D|D	0.94418|0.94418	0.7638|0.7638	5|10	.|0.19147	.|T	.|0.46	-23.4617|-23.4617	15.4799|15.4799	0.75517|0.75517	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|781;781	.|Q8IWU5-2;Q8IWU5	.|.;SULF2_HUMAN	S|F	136|781;781;781;200;781	.|ENSP00000353007:Y781F;ENSP00000418290:Y781F;ENSP00000354662:Y781F;ENSP00000418442:Y781F	.|ENSP00000353007:Y781F	T|Y	-|-	1|2	0|0	SULF2|SULF2	45725249|45725249	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	8.040000|8.040000	0.89188|0.89188	2.068000|2.068000	0.61886|0.61886	0.454000|0.454000	0.30748|0.30748	ACT|TAC	.		0.547	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
DDX27	55661	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	47835928	47835928	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr20:47835928A>C	ENST00000371764.4	+	1	45	c.36A>C	c.(34-36)gaA>gaC	p.E12D	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	12						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAGGCTGCGAAAAGTTAAGGG	0.607																																					p.E12D		.											.	DDX27-537	0			c.A36C						.						78.0	66.0	70.0					20																	47835928		2203	4300	6503	SO:0001583	missense	55661	exon1			CTGCGAAAAGTTA	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.36A>C	20.37:g.47835928A>C	ENSP00000360828:p.Glu12Asp	39	0		49	14	NM_017895	0	0	1	1	0	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	A	8.891	0.954106	0.18431	.	.	ENSG00000124228	ENST00000535160;ENST00000371764	T	0.01446	4.88	5.04	-4.9E-5	0.14040	.	2.187840	0.02319	N	0.072815	T	0.01353	0.0044	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.46830	-0.9163	10	0.87932	D	0	4.3423	3.5735	0.07926	0.5451:0.0:0.2933:0.1616	.	12	Q96GQ7	DDX27_HUMAN	D	12	ENSP00000360828:E12D	ENSP00000360828:E12D	E	+	3	2	DDX27	47269335	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.050000	0.14120	-0.113000	0.11958	0.533000	0.62120	GAA	.		0.607	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1		
CRYAA	1409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	44589374	44589374	+	Silent	SNP	C	C	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr21:44589374C>G	ENST00000291554.2	+	1	257	c.165C>G	c.(163-165)acC>acG	p.T55T	CRYAA_ENST00000398132.1_5'Flank|CRYAA_ENST00000482775.1_3'UTR|CRYAA_ENST00000398133.1_5'Flank	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A	55					negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						TCTTCCGCACCGTGCTGGACT	0.622																																					p.T55T		.											.	CRYAA-289	0			c.C165G						.						130.0	118.0	122.0					21																	44589374		2203	4300	6503	SO:0001819	synonymous_variant	1409	exon1			CCGCACCGTGCTG		CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.165C>G	21.37:g.44589374C>G		174	0		183	92	NM_000394	0	0	0	0	0	Q53X53	Silent	SNP	ENST00000291554.2	37	CCDS13695.1																																																																																			.		0.622	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195562.1		
DIP2A	23181	hgsc.bcm.edu	37	21	47958481	47958481	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr21:47958481G>A	ENST00000417564.2	+	16	1908	c.1887G>A	c.(1885-1887)ctG>ctA	p.L629L	DIP2A_ENST00000400274.1_Silent_p.L625L|DIP2A_ENST00000457905.3_Silent_p.L629L|Metazoa_SRP_ENST00000607098.1_RNA|DIP2A_ENST00000466639.1_Silent_p.L586L|DIP2A_ENST00000427143.2_Silent_p.L565L|DIP2A_ENST00000435722.3_Silent_p.L629L|DIP2A_ENST00000318711.7_Silent_p.L630L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	629					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TCAGCTCACTGCGCATGCTGA	0.617																																					p.L629L		.											.	DIP2A-24	0			c.G1887A						.						40.0	49.0	46.0					21																	47958481		2154	4215	6369	SO:0001819	synonymous_variant	23181	exon16			CTCACTGCGCATG	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.1887G>A	21.37:g.47958481G>A		5	1		10	6	NM_206891	0	0	2	10	8	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	ENST00000417564.2	37	CCDS46655.1																																																																																			.		0.617	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
MED15	51586	hgsc.bcm.edu	37	22	20920816	20920816	+	Silent	SNP	G	G	A	rs535773989	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr22:20920816G>A	ENST00000263205.7	+	7	822	c.753G>A	c.(751-753)caG>caA	p.Q251Q	MED15_ENST00000382974.2_Silent_p.Q180Q|MED15_ENST00000406969.1_Silent_p.Q225Q|MED15_ENST00000541476.1_Silent_p.Q225Q|MED15_ENST00000425759.2_Silent_p.Q140Q|MED15_ENST00000292733.7_Silent_p.Q251Q|MED15_ENST00000542773.1_Silent_p.Q56Q|MED15_ENST00000478831.1_3'UTR	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	251	Poly-Gln.			Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			aacagcaacagcagcagcagc	0.592																																					p.Q251Q		.											.	MED15-211	0			c.G753A						.						19.0	25.0	23.0					22																	20920816		2129	4141	6270	SO:0001819	synonymous_variant	51586	exon7			GCAACAGCAGCAG	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.753G>A	22.37:g.20920816G>A		56	2		46	5	NM_015889	0	0	23	23	0	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	G	3.627	-0.076441	0.07184	.	.	ENSG00000099917	ENST00000423862	.	.	.	0.998	0.998	0.19857	.	.	.	.	.	T	0.51839	0.1698	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39143	-0.9628	4	.	.	.	.	5.6489	0.17604	0.0:0.0:1.0:0.0	.	.	.	.	T	192	.	.	A	+	1	0	MED15	19250816	0.894000	0.30519	0.949000	0.38748	0.643000	0.38383	0.816000	0.27267	0.293000	0.22520	0.298000	0.19748	GCA	.		0.592	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889	
UQCR10	29796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30163434	30163434	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr22:30163434G>A	ENST00000330029.6	+	1	77	c.47G>A	c.(46-48)cGc>cAc	p.R16H	ZMAT5_ENST00000344318.3_5'Flank|UQCR10_ENST00000401406.3_Missense_Mutation_p.R16H|ZMAT5_ENST00000397781.3_5'Flank	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X	16					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						CTGCTGTTCCGCAGGACCTCC	0.612																																					p.R16H		.											.	UQCR10-23	0			c.G47A						.						54.0	62.0	59.0					22																	30163434		2053	4195	6248	SO:0001583	missense	29796	exon1			TGTTCCGCAGGAC	AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.47G>A	22.37:g.30163434G>A	ENSP00000332887:p.Arg16His	58	0		60	29	NM_001003684	0	0	96	175	79	B5MCM5|Q9T2V6	Missense_Mutation	SNP	ENST00000330029.6	37	CCDS46680.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541323	0.85917	.	.	ENSG00000184076	ENST00000332801;ENST00000330029;ENST00000401406;ENST00000406782	T;T	0.61158	0.13;0.13	5.73	5.73	0.89815	.	0.000000	0.42821	D	0.000649	T	0.76485	0.3994	.	.	.	0.51482	D	0.999921	B;D	0.89917	0.403;1.0	B;D	0.85130	0.152;0.997	T	0.78137	-0.2321	9	0.62326	D	0.03	-4.8723	15.4576	0.75327	0.0:0.0:1.0:0.0	.	16;16	Q9UDW1;Q9UDW1-2	QCR9_HUMAN;.	H	16	ENSP00000332887:R16H;ENSP00000384962:R16H	ENSP00000332887:R16H	R	+	2	0	UQCR10	28493434	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.728000	0.62000	2.720000	0.93068	0.558000	0.71614	CGC	.		0.612	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322081.1	NM_013387	
SEC14L3	266629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30866522	30866522	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr22:30866522A>T	ENST00000215812.4	-	2	192	c.102T>A	c.(100-102)gaT>gaA	p.D34E	SEC14L3_ENST00000415957.2_5'UTR|SEC14L3_ENST00000540910.1_5'UTR|SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000403066.1_5'UTR|SEC14L3_ENST00000539629.1_5'UTR|SEC14L3_ENST00000401751.1_5'UTR	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	34						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GGAAATAATCATCAGGGTTGG	0.567																																					p.D34E	Esophageal Squamous(108;290 1516 3584 23771 37333)	.											.	SEC14L3-95	0			c.T102A						.						131.0	111.0	118.0					22																	30866522		2203	4300	6503	SO:0001583	missense	266629	exon2			ATAATCATCAGGG	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.102T>A	22.37:g.30866522A>T	ENSP00000215812:p.Asp34Glu	61	0		63	31	NM_174975	0	0	0	0	0	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.81|17.81	3.481554|3.481554	0.63849|0.63849	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000215812|ENST00000435069	D|.	0.87729|.	-2.29|.	5.39|5.39	0.515|0.515	0.17013|0.17013	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);|.	0.223524|.	0.46145|.	D|.	0.000308|.	T|.	0.77890|.	0.4198|.	M|M	0.92367|0.92367	3.3|3.3	0.80722|0.80722	D|D	1|1	P|.	0.47253|.	0.892|.	P|.	0.58391|.	0.838|.	T|.	0.77958|.	-0.2392|.	10|.	0.59425|.	D|.	0.04|.	-19.4435|-19.4435	9.2711|9.2711	0.37673|0.37673	0.5993:0.0:0.4007:0.0|0.5993:0.0:0.4007:0.0	.|.	34|.	Q9UDX4|.	S14L3_HUMAN|.	E|R	34|15	ENSP00000215812:D34E|.	ENSP00000215812:D34E|.	D|X	-|-	3|1	2|0	SEC14L3|SEC14L3	29196522|29196522	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.890000|0.890000	0.51754|0.51754	0.735000|0.735000	0.26115|0.26115	0.058000|0.058000	0.16222|0.16222	0.528000|0.528000	0.53228|0.53228	GAT|TGA	.		0.567	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
SUN2	25777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	39138452	39138452	+	Silent	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr22:39138452G>A	ENST00000405510.1	-	10	1280	c.922C>T	c.(922-924)Ctg>Ttg	p.L308L	RP3-508I15.21_ENST00000609212.1_RNA|RP3-508I15.22_ENST00000607991.1_RNA|SUN2_ENST00000405018.1_Silent_p.L329L|SUN2_ENST00000216064.4_Silent_p.L308L|SUN2_ENST00000406622.1_Silent_p.L308L|SUN2_ENST00000411587.2_Silent_p.L297L|RP3-508I15.14_ENST00000416406.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	308					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CGCAGCTCCAGACGTTCCAGC	0.647																																					p.L329L		.											.	SUN2-154	0			c.C985T						.						30.0	30.0	30.0					22																	39138452		2203	4300	6503	SO:0001819	synonymous_variant	25777	exon9			GCTCCAGACGTTC	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.922C>T	22.37:g.39138452G>A		53	0		43	19	NM_001199579	0	0	16	23	7	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	ENST00000405510.1	37	CCDS13978.1																																																																																			.		0.647	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1	XM_039332	
ANKRD28	23243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	15751227	15751227	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr3:15751227T>C	ENST00000399451.2	-	13	1631	c.1264A>G	c.(1264-1266)Aac>Gac	p.N422D	ANKRD28_ENST00000383777.1_Missense_Mutation_p.N455D|ANKRD28_ENST00000497037.1_5'UTR	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	422						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						AGCAGAAGGTTTAGGCACTCC	0.323																																					p.N422D		.											.	ANKRD28-135	0			c.A1264G						.						68.0	60.0	62.0					3																	15751227		1816	4070	5886	SO:0001583	missense	23243	exon13			GAAGGTTTAGGCA	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.1264A>G	3.37:g.15751227T>C	ENSP00000382379:p.Asn422Asp	11	0		15	9	NM_015199	0	0	0	4	4	B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	ENST00000399451.2	37	CCDS46769.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.992948	0.54041	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.63744	-0.06;-0.06;-0.06	5.96	5.96	0.96718	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	N	0.05608	-0.01	0.80722	D	1	B;B;B	0.19817	0.039;0.019;0.003	B;B;B	0.20184	0.028;0.012;0.013	T	0.34950	-0.9808	10	0.32370	T	0.25	.	16.4311	0.83844	0.0:0.0:0.0:1.0	.	455;452;422	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	D	422;455;422	ENSP00000382379:N422D;ENSP00000373287:N455D;ENSP00000397341:N422D	ENSP00000373287:N455D	N	-	1	0	ANKRD28	15726231	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.972000	0.88022	2.277000	0.76020	0.528000	0.53228	AAC	.		0.323	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1	NM_015199	
SACM1L	22908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45780273	45780273	+	Splice_Site	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr3:45780273G>A	ENST00000389061.5	+	18	1681	c.1477G>A	c.(1477-1479)Gat>Aat	p.D493N	SACM1L_ENST00000541314.1_Splice_Site_p.D432N|SACM1L_ENST00000418611.1_Splice_Site_p.D390N	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	493					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TCTGTTCTAGGATTCCATAGA	0.363																																					p.D493N		.											.	SACM1L-91	0			c.G1477A						.						145.0	139.0	141.0					3																	45780273		2203	4300	6503	SO:0001630	splice_region_variant	22908	exon18			TTCTAGGATTCCA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.1477-1G>A	3.37:g.45780273G>A		47	0		55	31	NM_014016	0	0	0	0	0	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	37	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	G	33	5.226777	0.95173	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314;ENST00000433336	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	6.05	6.05	0.98169	.	0.091827	0.85682	D	0.000000	T	0.27629	0.0679	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.995	D;D;P	0.87578	0.918;0.998;0.831	T	0.00063	-1.2155	9	.	.	.	-4.7089	13.7549	0.62930	0.0698:0.0:0.9302:0.0	.	432;136;493	B4DK71;B3KX17;Q9NTJ5	.;.;SAC1_HUMAN	N	390;493;432;170	ENSP00000396387:D390N;ENSP00000373713:D493N;ENSP00000443373:D432N;ENSP00000412883:D170N	.	D	+	1	0	SACM1L	45755277	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.455000	0.80726	2.878000	0.98634	0.650000	0.86243	GAT	.		0.363	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	Missense_Mutation
PDZRN3	23024	hgsc.bcm.edu	37	3	73673578	73673578	+	Silent	SNP	G	G	C	rs6763344	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr3:73673578G>C	ENST00000263666.4	-	1	513	c.399C>G	c.(397-399)gcC>gcG	p.A133A	PDZRN3-AS1_ENST00000608743.1_RNA|PDZRN3-AS1_ENST00000478988.1_RNA|PDZRN3-AS1_ENST00000608304.1_RNA|PDZRN3_ENST00000308537.4_Silent_p.A133A	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	133					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GCGCGTCGCAGGCGTCGCGCA	0.776													C|||	4619	0.922324	0.9781	0.8977	5008	,	,		6325	0.9385		0.8757	False		,,,				2504	0.8957				p.A133A		.											.	PDZRN3-232	0			c.C399G						.						1.0	1.0	1.0					3																	73673578		356	609	965	SO:0001819	synonymous_variant	23024	exon1			GTCGCAGGCGTCG	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.399C>G	3.37:g.73673578G>C		1	1		2	2	NM_015009	0	0	0	0	0	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	CCDS33789.1																																																																																			G|0.119;C|0.881		0.776	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PXYLP1	92370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	140979087	140979087	+	Missense_Mutation	SNP	C	C	A	rs367551091	byFrequency	TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr3:140979087C>A	ENST00000286353.4	+	2	207	c.70C>A	c.(70-72)Ctg>Atg	p.L24M	ACPL2_ENST00000393010.2_Missense_Mutation_p.L24M|ACPL2_ENST00000504264.1_5'Flank|ACPL2_ENST00000502783.1_5'UTR	NM_001037172.1|NM_001282728.1	NP_001032249.1|NP_001269657.1	Q8TE99	PXYP1_HUMAN		24						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)			endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(2)	23						GAGCCTCAGCCTGCAGTTCTG	0.517																																					p.L24M		.											.	ACPL2-91	0			c.C70A						.						49.0	56.0	53.0					3																	140979087		2203	4300	6503	SO:0001583	missense	92370	exon4			CTCAGCCTGCAGT																												ENST00000286353.4:c.70C>A	3.37:g.140979087C>A	ENSP00000286353:p.Leu24Met	47	0		46	22	NM_152282	0	0	0	0	0	D3DNF5|Q49AJ2|W0TR04	Missense_Mutation	SNP	ENST00000286353.4	37	CCDS3116.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845120	0.51164	.	.	ENSG00000155893	ENST00000505013;ENST00000286353;ENST00000393010;ENST00000514680	T;T	0.25085	1.82;1.82	5.87	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.42832	-0.9428	10	0.49607	T	0.09	.	13.2927	0.60280	0.0:0.9233:0.0:0.0767	.	24	Q8TE99	ACPL2_HUMAN	M	24	ENSP00000286353:L24M;ENSP00000376733:L24M	ENSP00000286353:L24M	L	+	1	2	ACPL2	142461777	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.962000	0.63687	1.628000	0.50416	-0.150000	0.13652	CTG	.		0.517	ACPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359533.2		
ZNF721	170960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	437056	437056	+	Silent	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:437056A>G	ENST00000338977.5	-	2	1212	c.1164T>C	c.(1162-1164)agT>agC	p.S388S	ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Silent_p.S400S|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	388				NS -> VC (in Ref. 1; CAH10687). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						GGTTTGTTGAACTATTAAAGG	0.428																																					p.M400I		.											.	ZNF721-47	0			c.G1200C						.						92.0	96.0	95.0					4																	437056		2109	4254	6363	SO:0001819	synonymous_variant	170960	exon3			TGTTGAACTATTA	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1164T>C	4.37:g.437056A>G		59	0		56	24	NM_133474	8	0	1	12	3	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37																																																																																				.		0.428	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
SLC26A1	10861	hgsc.bcm.edu;broad.mit.edu	37	4	983983	983983	+	Silent	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:983983T>C	ENST00000361661.2	-	4	1121	c.744A>G	c.(742-744)acA>acG	p.T248T	IDUA_ENST00000453894.1_Intron|SLC26A1_ENST00000513138.1_5'Flank|SLC26A1_ENST00000398516.2_Silent_p.T248T|SLC26A1_ENST00000398520.2_Intron|IDUA_ENST00000247933.4_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	248					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGCTCAGCCATGTGAGGACCA	0.697																																					p.T248T		.											.	SLC26A1-91	0			c.A744G						.						10.0	12.0	11.0					4																	983983		2134	4181	6315	SO:0001819	synonymous_variant	10861	exon3			CAGCCATGTGAGG	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.744A>G	4.37:g.983983T>C		9	0		7	5	NM_022042	0	0	3	5	2	A8K9N2|Q7Z5R3|Q96BK0	Silent	SNP	ENST00000361661.2	37	CCDS33934.1																																																																																			.		0.697	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
SH3BP2	6452	hgsc.bcm.edu;bcgsc.ca	37	4	2824664	2824664	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:2824664C>T	ENST00000356331.5	+	3	400	c.139C>T	c.(139-141)Ccc>Tcc	p.P47S	SH3BP2_ENST00000389838.2_Missense_Mutation_p.P47S|SH3BP2_ENST00000442312.2_Missense_Mutation_p.P75S|SH3BP2_ENST00000503393.2_Missense_Mutation_p.P104S|SH3BP2_ENST00000452765.2_Missense_Mutation_p.P47S|SH3BP2_ENST00000435136.2_Missense_Mutation_p.P47S|SH3BP2_ENST00000511747.1_Missense_Mutation_p.P47S	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	47	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)	p.P47S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TCCCACAGGGCCCCTGCGCTT	0.627									Cherubism																												p.P104S		.											.	SH3BP2-514	1	Substitution - Missense(1)	prostate(1)	c.C310T						.						64.0	52.0	56.0					4																	2824664		2203	4300	6503	SO:0001583	missense	6452	exon3	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	ACAGGGCCCCTGC	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.139C>T	4.37:g.2824664C>T	ENSP00000348685:p.Pro47Ser	22	0		33	14	NM_001145856	0	0	0	0	0	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Missense_Mutation	SNP	ENST00000356331.5	37	CCDS33944.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553572	0.65425	.	.	ENSG00000087266	ENST00000452765;ENST00000389838;ENST00000503219;ENST00000504294;ENST00000508385;ENST00000512014;ENST00000513095;ENST00000442312;ENST00000502260;ENST00000435136;ENST00000511747;ENST00000503393;ENST00000356331	T;T;T;T;T;T;T;T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77	3.94	3.94	0.45596	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.20373	0.0490	L	0.31207	0.915	0.58432	D	0.999997	P;D;P;P	0.61080	0.863;0.989;0.939;0.939	P;D;P;P	0.64595	0.524;0.927;0.666;0.666	T	0.02877	-1.1099	10	0.52906	T	0.07	-4.9102	15.9158	0.79517	0.0:1.0:0.0:0.0	.	75;75;104;47	B4DT04;B7Z9B6;D6R919;P78314	.;.;.;3BP2_HUMAN	S	47;47;47;47;47;47;47;75;47;47;47;104;47	ENSP00000409746:P47S;ENSP00000374488:P47S;ENSP00000422796:P47S;ENSP00000423275:P47S;ENSP00000424917:P47S;ENSP00000424105:P47S;ENSP00000423823:P47S;ENSP00000388152:P75S;ENSP00000425537:P47S;ENSP00000403231:P47S;ENSP00000424846:P47S;ENSP00000422168:P104S;ENSP00000348685:P47S	ENSP00000348685:P47S	P	+	1	0	SH3BP2	2794462	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.870000	0.75526	1.927000	0.55829	0.491000	0.48974	CCC	.		0.627	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	
MFSD10	10227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2934166	2934166	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:2934166A>G	ENST00000329687.4	-	5	1139	c.605T>C	c.(604-606)aTg>aCg	p.M202T	NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507999.1_RNA|MFSD10_ENST00000514800.1_Missense_Mutation_p.M202T|MFSD10_ENST00000508221.1_Missense_Mutation_p.M202T|MFSD10_ENST00000355443.4_Missense_Mutation_p.M202T|MFSD10_ENST00000507555.1_Missense_Mutation_p.M202T	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	202					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCAGGGTGCCATTTCCAGGGG	0.632																																					p.M202T		.											.	MFSD10-68	0			c.T605C						.						52.0	58.0	56.0					4																	2934166		2203	4300	6503	SO:0001583	missense	10227	exon5			GGTGCCATTTCCA	L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.605T>C	4.37:g.2934166A>G	ENSP00000332646:p.Met202Thr	69	0		64	26	NM_001120	0	0	52	120	68	Q07706	Missense_Mutation	SNP	ENST00000329687.4	37	CCDS3365.1	.	.	.	.	.	.	.	.	.	.	A	0.137	-1.106537	0.01828	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	4.69	-2.4	0.06583	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.719668	0.14277	N	0.329747	T	0.14141	0.0342	N	0.00890	-1.11	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.23762	-1.0179	10	0.15066	T	0.55	-26.4194	2.158	0.03818	0.4585:0.122:0.2967:0.1227	.	202;202;202;202	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	T	202	ENSP00000426907:M202T;ENSP00000347619:M202T;ENSP00000332646:M202T;ENSP00000425757:M202T;ENSP00000423402:M202T	ENSP00000332646:M202T	M	-	2	0	MFSD10	2903964	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.615000	0.05597	-0.477000	0.06832	-0.417000	0.06048	ATG	.		0.632	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358072.2	NM_001120	
SEC24D	9871	bcgsc.ca	37	4	119666217	119666217	+	Splice_Site	SNP	T	T	A	rs78494615|rs35951660		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:119666217T>A	ENST00000280551.6	-	14	1946		c.e14-2		SEC24D_ENST00000505134.1_Splice_Site|SEC24D_ENST00000511481.1_Splice_Site|SEC24D_ENST00000419654.2_Splice_Site|SEC24D_ENST00000379735.5_Splice_Site|SEC24D_ENST00000429811.2_Splice_Site			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GTCTGCTGCCTAAAAAAAAAA	0.383																																					.													.	SEC24D-90	0			c.1708-2A>T						.						57.0	62.0	60.0					4																	119666217		2203	4300	6503	SO:0001630	splice_region_variant	9871	exon15			GCTGCCTAAAAAA	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1708-2A>T	4.37:g.119666217T>A		64	3		68	9	NM_014822	0	0	0	0	0	Q8IYI7	Splice_Site	SNP	ENST00000280551.6	37	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.843690	0.71488	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000429811;ENST00000511481;ENST00000419654	.	.	.	5.59	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9966	0.53206	0.1298:0.0:0.0:0.8702	.	.	.	.	.	-1	.	.	.	-	.	.	SEC24D	119885665	1.000000	0.71417	0.977000	0.42913	0.934000	0.57294	7.994000	0.88315	0.917000	0.36895	0.533000	0.62120	.	.		0.383	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4		Intron
TKTL2	84076	hgsc.bcm.edu	37	4	164394649	164394649	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:164394649C>A	ENST00000280605.3	-	1	398	c.238G>T	c.(238-240)Gct>Tct	p.A80S		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	80						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AGGATAGGAGCAGCATGTCCC	0.532																																					p.A80S		.											.	TKTL2-95	0			c.G238T						.						172.0	116.0	135.0					4																	164394649		2203	4300	6503	SO:0001583	missense	84076	exon1			TAGGAGCAGCATG	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.238G>T	4.37:g.164394649C>A	ENSP00000280605:p.Ala80Ser	51	0		40	2	NM_032136	0	0	0	0	0	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	6.285	0.420662	0.11928	.	.	ENSG00000151005	ENST00000280605	T	0.21191	2.02	4.02	2.25	0.28309	Transketolase, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.20088	0.0483	L	0.37561	1.115	0.48341	D	0.999636	B	0.27416	0.178	B	0.42214	0.38	T	0.06499	-1.0823	10	0.18710	T	0.47	-7.0095	7.6308	0.28238	0.0:0.7376:0.1665:0.0959	.	80	Q9H0I9	TKTL2_HUMAN	S	80	ENSP00000280605:A80S	ENSP00000280605:A80S	A	-	1	0	TKTL2	164614099	0.986000	0.35501	0.024000	0.17045	0.011000	0.07611	2.894000	0.48640	0.630000	0.30394	-0.332000	0.08345	GCT	.		0.532	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
ZFR	51663	hgsc.bcm.edu	37	5	32407029	32407029	+	Silent	SNP	A	A	T	rs139769264		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr5:32407029A>T	ENST00000265069.8	-	6	984	c.882T>A	c.(880-882)gcT>gcA	p.A294A		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	294	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A294A(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		cagcagcagcagctgctgctg	0.483																																					p.A294A		.											.	ZFR-90	1	Substitution - coding silent(1)	endometrium(1)	c.T882A						.	A		0,4406		0,0,2203	35.0	36.0	36.0		882	-7.9	1.0	5	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZFR	NM_016107.3		0,1,6502	TT,TA,AA		0.0116,0.0,0.0077		294/1075	32407029	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51663	exon6			AGCAGCAGCTGCT	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.882T>A	5.37:g.32407029A>T		60	0		53	3	NM_016107	0	1	11	12	0	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711849	0.30322	0.0	1.16E-4	ENSG00000056097	ENST00000416900	.	.	.	5.89	-7.9	0.01169	.	.	.	.	.	T	0.27731	0.0682	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33292	-0.9874	5	0.08179	T	0.78	.	8.2119	0.31488	0.2876:0.1859:0.0:0.5266	.	.	.	.	S	175	.	ENSP00000393243:C175S	C	-	1	0	ZFR	32442786	0.089000	0.21612	0.989000	0.46669	0.998000	0.95712	-1.076000	0.03420	-0.596000	0.05821	0.454000	0.30748	TGC	A|1.000;T|0.000		0.483	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	101834204	101834204	+	Silent	SNP	C	C	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr5:101834204C>A	ENST00000506729.1	-	1	516	c.345G>T	c.(343-345)ctG>ctT	p.L115L	SLCO6A1_ENST00000513675.1_Silent_p.L115L|SLCO6A1_ENST00000379807.3_Silent_p.L115L|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000389019.3_Silent_p.L115L|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000379810.1_Silent_p.L115L			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	115	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GACATATGAGCAGGATGCAGT	0.572																																					p.L115L		.											.	SLCO6A1-96	0			c.G345T						.						59.0	60.0	60.0					5																	101834204		2203	4300	6503	SO:0001819	synonymous_variant	133482	exon1			TATGAGCAGGATG	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.345G>T	5.37:g.101834204C>A		73	0		73	35	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	37	CCDS34206.1																																																																																			.		0.572	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
IL9	3578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	135228124	135228124	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr5:135228124T>C	ENST00000274520.1	-	5	401	c.391A>G	c.(391-393)Att>Gtt	p.I131V		NM_000590.1	NP_000581.1	P15248	IL9_HUMAN	interleukin 9	131					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-5 biosynthetic process (GO:0045407)	extracellular space (GO:0005615)				large_intestine(3)|lung(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTCTGGAAAATTTCCAGAAGA	0.368																																					p.I131V		.											.	IL9-90	0			c.A391G						.						66.0	73.0	71.0					5																	135228124		2203	4300	6503	SO:0001583	missense	3578	exon5			GGAAAATTTCCAG	S63356	CCDS4189.1	5q31-q35	2008-07-18			ENSG00000145839	ENSG00000145839		"""Interleukins and interleukin receptors"""	6029	protein-coding gene	gene with protein product	"""p40 T-cell and mast cell growth factor"", ""T-cell growth factor p40"", ""p40 cytokine"", ""homolog of mouse T cell and mast cell growth factor 40"""	146931				8379467	Standard	NM_000590		Approved	IL-9, HP40, P40	uc003lbb.1	P15248	OTTHUMG00000129147	ENST00000274520.1:c.391A>G	5.37:g.135228124T>C	ENSP00000274520:p.Ile131Val	74	0		49	23	NM_000590	0	0	0	0	0		Missense_Mutation	SNP	ENST00000274520.1	37	CCDS4189.1	.	.	.	.	.	.	.	.	.	.	T	0.246	-1.010364	0.02095	.	.	ENSG00000145839	ENST00000274520	T	0.42131	0.98	5.48	-7.84	0.01196	.	1.696530	0.03303	N	0.189306	T	0.12944	0.0314	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25916	-1.0118	10	0.08179	T	0.78	-2.0474	8.7041	0.34343	0.0:0.3821:0.1035:0.5144	.	131	P15248	IL9_HUMAN	V	131	ENSP00000274520:I131V	ENSP00000274520:I131V	I	-	1	0	IL9	135256023	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-0.778000	0.04664	-1.878000	0.01128	-1.601000	0.00813	ATT	.		0.368	IL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251210.1	NM_000590	
SLC35A4	113829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	139947279	139947279	+	Silent	SNP	T	T	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr5:139947279T>A	ENST00000514199.1	+	2	2211	c.525T>A	c.(523-525)gcT>gcA	p.A175A	SLC35A4_ENST00000323146.3_Silent_p.A175A|APBB3_ENST00000507279.1_Intron			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	175	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCAGCAGCTGCTGCCAGCC	0.622																																					p.A175A		.											.	SLC35A4-90	0			c.T525A						.						59.0	57.0	58.0					5																	139947279		2203	4300	6503	SO:0001819	synonymous_variant	113829	exon3			AGCAGCTGCTGCC	AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.525T>A	5.37:g.139947279T>A		89	0		73	35	NM_080670	0	0	19	36	17	A8K013	Silent	SNP	ENST00000514199.1	37	CCDS4231.1																																																																																			.		0.622	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372815.1	NM_080670	
TREM2	54209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	41129014	41129014	+	Silent	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr6:41129014C>T	ENST00000373113.3	-	2	471	c.378G>A	c.(376-378)gtG>gtA	p.V126V	TREM2_ENST00000338469.3_Silent_p.V126V|TREM2_ENST00000373122.4_Silent_p.V126V	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	126					axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCAGCACCTCCACCAGGACCT	0.612																																					p.V126V		.											.	TREM2-91	0			c.G378A						.						43.0	41.0	42.0					6																	41129014		2203	4300	6503	SO:0001819	synonymous_variant	54209	exon2			CACCTCCACCAGG	AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.378G>A	6.37:g.41129014C>T		45	0		42	13	NM_018965	0	0	0	0	0	Q8N5H8|Q8WYN6	Silent	SNP	ENST00000373113.3	37	CCDS4852.1																																																																																			.		0.612	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
TJAP1	93643	hgsc.bcm.edu	37	6	43466779	43466779	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr6:43466779G>C	ENST00000372445.5	+	4	416	c.40G>C	c.(40-42)Gca>Cca	p.A14P	TJAP1_ENST00000438588.2_Missense_Mutation_p.A14P|TJAP1_ENST00000372444.2_Missense_Mutation_p.A14P|TJAP1_ENST00000372452.1_Missense_Mutation_p.A14P|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Missense_Mutation_p.A14P|TJAP1_ENST00000372449.1_Missense_Mutation_p.A14P|TJAP1_ENST00000259751.1_Missense_Mutation_p.A14P	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	14					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)		p.A14S(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTACCGTAAGGCACCACCAGA	0.587																																					p.A14P		.											.	TJAP1-90	1	Substitution - Missense(1)	lung(1)	c.G40C						.						92.0	77.0	82.0					6																	43466779		2203	4300	6503	SO:0001583	missense	93643	exon4			CGTAAGGCACCAC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.40G>C	6.37:g.43466779G>C	ENSP00000361522:p.Ala14Pro	51	0		51	4	NM_080604	0	0	8	8	0	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300029	0.95574	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.56426	0.1984	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.60188	-0.7312	10	0.87932	D	0	-0.0171	17.1606	0.86802	0.0:0.0:1.0:0.0	.	14;14;14	E2QRK7;Q5JTD0;Q5JTD0-2	.;TJAP1_HUMAN;.	P	14	ENSP00000361521:A14P;ENSP00000361522:A14P;ENSP00000407080:A14P;ENSP00000390981:A14P;ENSP00000259751:A14P;ENSP00000361530:A14P;ENSP00000361527:A14P;ENSP00000408769:A14P	ENSP00000259751:A14P	A	+	1	0	TJAP1	43574757	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.903000	0.87398	2.495000	0.84180	0.655000	0.94253	GCA	.		0.587	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
LCA5	167691	hgsc.bcm.edu	37	6	80197555	80197555	+	Silent	SNP	C	C	T	rs141642284		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr6:80197555C>T	ENST00000392959.1	-	9	1871	c.1260G>A	c.(1258-1260)aaG>aaA	p.K420K	LCA5_ENST00000369846.4_Silent_p.K420K|LCA5_ENST00000467898.3_3'UTR	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	420					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TTTCTTTTTGCTTTTTATCAA	0.308													C|||	1	0.000199681	0.0	0.0	5008	,	,		15674	0.0		0.001	False		,,,				2504	0.0				p.K420K		.											.	LCA5-90	0			c.G1260A						.	C	,	1,4401		0,1,2200	77.0	78.0	77.0		1260,1260	1.5	0.9	6	dbSNP_134	77	4,8594	3.7+/-12.6	0,4,4295	no	coding-synonymous,coding-synonymous	LCA5	NM_001122769.2,NM_181714.3	,	0,5,6495	TT,TC,CC		0.0465,0.0227,0.0385	,	420/698,420/698	80197555	5,12995	2201	4299	6500	SO:0001819	synonymous_variant	167691	exon8			TTTTTGCTTTTTA		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1260G>A	6.37:g.80197555C>T		44	0		38	2	NM_001122769	0	0	2	2	0	E1P542|Q9BWX7	Silent	SNP	ENST00000392959.1	37	CCDS4990.1																																																																																			C|1.000;T|0.000		0.308	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
POR	5447	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	75617074	75617074	+	IGR	SNP	C	C	T	rs201249328		TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr7:75617074C>T	ENST00000461988.1	+	0	2522				TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase						carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	GCCCAGCGCCCGCAGGCGGTA	0.672																																					.													.	.	0			.						.	C	GLN/ARG	0,4056		0,0,2028	19.0	26.0	24.0		746	2.7	0.9	7		24	3,8299		0,3,4148	yes	missense	TMEM120A	NM_031925.2	43	0,3,6176	TT,TC,CC		0.0361,0.0,0.0243	probably-damaging	249/344	75617074	3,12355	2028	4151	6179	SO:0001628	intergenic_variant	83862	.			AGCGCCCGCAGGC	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413		7.37:g.75617074C>T		33	0		36	9	.	0	0	30	46	16	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1																																																																																			.		0.672	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
WDR91	29062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134873248	134873248	+	Silent	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr7:134873248C>T	ENST00000354475.4	-	13	1849	c.1818G>A	c.(1816-1818)gaG>gaA	p.E606E	WDR91_ENST00000344400.5_Intron|WDR91_ENST00000423565.1_Silent_p.E571E	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	606										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						CAGAGTAGACCTCCCCGTAGT	0.592																																					p.E606E		.											.	WDR91-137	0			c.G1818A						.						177.0	161.0	167.0					7																	134873248		2203	4300	6503	SO:0001819	synonymous_variant	29062	exon13			GTAGACCTCCCCG	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1818G>A	7.37:g.134873248C>T		217	0		304	64	NM_014149	0	0	76	119	43	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Silent	SNP	ENST00000354475.4	37	CCDS34758.1																																																																																			.		0.592	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48744423	48744423	+	Silent	SNP	G	G	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr8:48744423G>T	ENST00000314191.2	-	61	8270	c.8214C>A	c.(8212-8214)ctC>ctA	p.L2738L	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.L2738L	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2739	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ACATCAAACTGAGCTTCTCCT	0.532								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)												.	PRKDC-1515	0			.						.						193.0	198.0	196.0					8																	48744423		1984	4172	6156	SO:0001819	synonymous_variant	5591	.			CAAACTGAGCTTC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8214C>A	8.37:g.48744423G>T		221	0		196	76	.	0	0	4	7	3	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37																																																																																				.		0.532	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
VCPIP1	80124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	67577113	67577113	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr8:67577113A>G	ENST00000310421.4	-	1	2339	c.2081T>C	c.(2080-2082)cTt>cCt	p.L694P	C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	694					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CTGTCCAGTAAGAATAATTTT	0.373																																					p.L694P	NSCLC(179;265 2915 6144 43644)	.											.	VCPIP1-662	0			c.T2081C						.						133.0	142.0	139.0					8																	67577113		2203	4300	6503	SO:0001583	missense	80124	exon1			CCAGTAAGAATAA	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.2081T>C	8.37:g.67577113A>G	ENSP00000309031:p.Leu694Pro	158	0		151	58	NM_025054	0	0	2	3	1	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.036462	0.54896	.	.	ENSG00000175073	ENST00000310421	T	0.46063	0.88	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.61160	0.2325	L	0.56769	1.78	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.64778	-0.6327	10	0.87932	D	0	-11.0176	15.447	0.75238	1.0:0.0:0.0:0.0	.	694	Q96JH7	VCIP1_HUMAN	P	694	ENSP00000309031:L694P	ENSP00000309031:L694P	L	-	2	0	VCPIP1	67739667	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.244000	0.95423	2.091000	0.63221	0.533000	0.62120	CTT	.		0.373	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
TAF2	6873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	120816142	120816142	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr8:120816142G>A	ENST00000378164.2	-	5	834	c.536C>T	c.(535-537)tCt>tTt	p.S179F		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	179					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATACCCACAAGAGAAAACATG	0.333																																					p.S179F		.											.	TAF2-274	0			c.C536T						.						138.0	140.0	139.0					8																	120816142		2203	4300	6503	SO:0001583	missense	6873	exon5			CCACAAGAGAAAA	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.536C>T	8.37:g.120816142G>A	ENSP00000367406:p.Ser179Phe	226	0		160	75	NM_003184	0	0	0	0	0	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198064	0.94997	.	.	ENSG00000064313	ENST00000378164	T	0.05855	3.38	5.89	5.89	0.94794	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24431	0.0592	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.00024	-1.2327	10	0.87932	D	0	-13.5961	20.2617	0.98447	0.0:0.0:1.0:0.0	.	179	Q6P1X5	TAF2_HUMAN	F	179	ENSP00000367406:S179F	ENSP00000367406:S179F	S	-	2	0	TAF2	120885323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.814000	0.99346	2.793000	0.96121	0.655000	0.94253	TCT	.		0.333	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
TNFSF15	9966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117552848	117552848	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr9:117552848G>A	ENST00000374045.4	-	4	753	c.640C>T	c.(640-642)Ctc>Ttc	p.L214F	TNFSF15_ENST00000374044.1_Missense_Mutation_p.L137F|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	214					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						ATGGCTCCGAGGTAGATGGGC	0.493																																					p.L214F		.											.	TNFSF15-227	0			c.C640T						.						155.0	135.0	142.0					9																	117552848		2203	4300	6503	SO:0001583	missense	9966	exon4			CTCCGAGGTAGAT	AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.640C>T	9.37:g.117552848G>A	ENSP00000363157:p.Leu214Phe	84	0		91	39	NM_005118	0	0	0	0	0	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Missense_Mutation	SNP	ENST00000374045.4	37	CCDS6809.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299347	0.60195	.	.	ENSG00000181634	ENST00000374045;ENST00000374044	T;T	0.67523	-0.27;-0.27	6.03	4.2	0.49525	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.000000	0.64402	D	0.000009	T	0.77896	0.4199	M	0.73372	2.23	0.46203	D	0.998926	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76539	-0.2922	10	0.48119	T	0.1	-26.8042	8.9914	0.36026	0.3322:0.0:0.6678:0.0	.	214;155	O95150;O95150-2	TNF15_HUMAN;.	F	214;137	ENSP00000363157:L214F;ENSP00000363156:L137F	ENSP00000363156:L137F	L	-	1	0	TNFSF15	116592669	0.994000	0.37717	0.997000	0.53966	0.967000	0.64934	0.902000	0.28459	0.885000	0.36088	0.655000	0.94253	CTC	.		0.493	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2	NM_005118	
TNC	3371	hgsc.bcm.edu	37	9	117853282	117853282	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr9:117853282G>C	ENST00000350763.4	-	2	427	c.16C>G	c.(16-18)Cag>Gag	p.Q6E	TNC_ENST00000423613.2_Missense_Mutation_p.Q6E|TNC_ENST00000340094.3_Missense_Mutation_p.Q6E|TNC_ENST00000537320.1_Missense_Mutation_p.Q6E|TNC_ENST00000345230.3_Missense_Mutation_p.Q6E|TNC_ENST00000341037.4_Missense_Mutation_p.Q6E|TNC_ENST00000542877.1_Missense_Mutation_p.Q6E|TNC_ENST00000346706.3_Missense_Mutation_p.Q6E|TNC_ENST00000535648.1_Missense_Mutation_p.Q6E	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	6					bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GCCAACAGCTGAGTCATGGCC	0.567																																					p.Q6E		.											.	TNC-517	0			c.C16G						.						32.0	33.0	33.0					9																	117853282		2203	4300	6503	SO:0001583	missense	3371	exon2			ACAGCTGAGTCAT		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.16C>G	9.37:g.117853282G>C	ENSP00000265131:p.Gln6Glu	41	0		24	2	NM_002160	0	0	7	7	0	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.488221	0.26686	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877;ENST00000534839	T;T;T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.54	-0.0359	0.13891	.	1.121870	0.06517	N	0.738965	T	0.22437	0.0541	L	0.44542	1.39	0.09310	N	1	B;B	0.33103	0.397;0.031	B;B	0.32928	0.155;0.034	T	0.22103	-1.0226	10	0.33141	T	0.24	.	2.2322	0.03999	0.2935:0.1119:0.467:0.1276	.	6;6	E9PC84;P24821	.;TENA_HUMAN	E	6	ENSP00000344400:Q6E;ENSP00000438152:Q6E;ENSP00000344555:Q6E;ENSP00000345861:Q6E;ENSP00000265131:Q6E;ENSP00000339553:Q6E;ENSP00000411406:Q6E;ENSP00000443478:Q6E;ENSP00000442242:Q6E;ENSP00000443469:Q6E	ENSP00000344400:Q6E	Q	-	1	0	TNC	116893103	0.005000	0.15991	0.001000	0.08648	0.005000	0.04900	0.717000	0.25851	-0.293000	0.08986	0.456000	0.33151	CAG	.		0.567	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
PIP5KL1	138429	hgsc.bcm.edu;broad.mit.edu	37	9	130684238	130684238	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr9:130684238C>T	ENST00000388747.4	-	10	1117	c.1073G>A	c.(1072-1074)cGg>cAg	p.R358Q	PIP5KL1_ENST00000300432.3_Missense_Mutation_p.R155Q	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	358	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						GTGCTCCAGCCGCTTGCGGAG	0.687											OREG0019512	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R358Q		.											.	PIP5KL1-240	0			c.G1073A						.						21.0	21.0	21.0					9																	130684238		2183	4276	6459	SO:0001583	missense	138429	exon10			TCCAGCCGCTTGC	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.1073G>A	9.37:g.130684238C>T	ENSP00000373399:p.Arg358Gln	12	0	1582	5	4	NM_001135219	0	0	0	0	0	Q8IVS3	Missense_Mutation	SNP	ENST00000388747.4	37	CCDS48030.1	.	.	.	.	.	.	.	.	.	.	C	36	5.911299	0.97093	.	.	ENSG00000167103	ENST00000388747;ENST00000300432	T;T	0.35605	1.3;1.3	5.32	5.32	0.75619	Phosphatidylinositol-4-phosphate 5-kinase, core (2);	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.56013	-0.8049	10	0.87932	D	0	-38.4281	16.4798	0.84155	0.0:1.0:0.0:0.0	.	358	Q5T9C9	PI5L1_HUMAN	Q	358;155	ENSP00000373399:R358Q;ENSP00000300432:R155Q	ENSP00000300432:R155Q	R	-	2	0	PIP5KL1	129724059	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.211000	0.51137	2.473000	0.83533	0.555000	0.69702	CGG	.		0.687	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054289.2	NM_173492	
C9orf69	90120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139008421	139008421	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr9:139008421C>T	ENST00000418388.1	-	2	828	c.326G>A	c.(325-327)cGc>cAc	p.R109H	C9orf69_ENST00000561457.1_Missense_Mutation_p.A134T			H0YL14	CI069_HUMAN	chromosome 9 open reading frame 69	109					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of viral process (GO:0048524)|viral process (GO:0016032)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)			endometrium(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.58e-07)|Epithelial(140;6.42e-06)		GTTCACCAGGCGGAAGTCCAC	0.657																																					p.R109H		.											.	.	0			c.G326A						.						13.0	18.0	16.0					9																	139008421		2159	4244	6403	SO:0001583	missense	90120	exon2			ACCAGGCGGAAGT		CCDS59155.1	9q34.3	2012-11-26	2012-07-05	2012-07-05	ENSG00000238227	ENSG00000238227			31009	protein-coding gene	gene with protein product						21667337	Standard	NM_152833		Approved	bA83N9.1	uc004cgx.5	H0YL14	OTTHUMG00000020922	ENST00000418388.1:c.326G>A	9.37:g.139008421C>T	ENSP00000453019:p.Arg109His	28	0		24	12	NM_152833	0	0	6	11	5		Missense_Mutation	SNP	ENST00000418388.1	37	CCDS59155.1																																																																																			.		0.657	C9orf69-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055043.3	NM_152833	
TMEM27	57393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	15682860	15682860	+	Silent	SNP	A	A	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chrX:15682860A>G	ENST00000380342.3	-	1	294	c.39T>C	c.(37-39)caT>caC	p.H13H		NM_020665.4	NP_065716.1	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27	13					positive regulation of amino acid transport (GO:0051957)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of SNARE complex assembly (GO:0035543)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)			endometrium(3)|lung(4)|ovary(1)	8	Hepatocellular(33;0.183)					AGAGTTCAGCATGAATGGCAG	0.373																																					p.H13H		.											.	TMEM27-131	0			c.T39C						.						58.0	53.0	55.0					X																	15682860		2203	4299	6502	SO:0001819	synonymous_variant	57393	exon1			TTCAGCATGAATG	AF229179	CCDS14170.1	Xp22	2012-04-13			ENSG00000147003	ENSG00000147003			29437	protein-coding gene	gene with protein product	"""collectrin"""	300631				11278314	Standard	NM_020665		Approved	NX17	uc004cxc.2	Q9HBJ8	OTTHUMG00000021181	ENST00000380342.3:c.39T>C	X.37:g.15682860A>G		34	0		34	26	NM_020665	0	0	1	134	133	B2R9M1|Q6UW07	Silent	SNP	ENST00000380342.3	37	CCDS14170.1																																																																																			.		0.373	TMEM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055879.1	NM_020665	
THOC2	57187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	122756985	122756985	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chrX:122756985T>A	ENST00000245838.8	-	29	3684	c.3653A>T	c.(3652-3654)aAa>aTa	p.K1218I	THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Missense_Mutation_p.K1103I|THOC2_ENST00000355725.4_Missense_Mutation_p.K1218I	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1218					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TTCATCCGATTTAGATGCACT	0.403																																					p.K1218I		.											.	THOC2-133	0			c.A3653T						.						100.0	89.0	93.0					X																	122756985		1868	4105	5973	SO:0001583	missense	57187	exon29			TCCGATTTAGATG	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3653A>T	X.37:g.122756985T>A	ENSP00000245838:p.Lys1218Ile	73	0		67	60	NM_001081550	0	0	0	19	19	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.82|15.82	2.945939|2.945939	0.53079|0.53079	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	T;T;T|.	0.48836|.	0.8;0.8;0.8|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|.	0.53850|.	0.1822|.	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.80764|.	0.994|.	T|.	0.52155|.	-0.8613|.	10|.	0.44086|.	T|.	0.13|.	-18.2877|-18.2877	11.3724|11.3724	0.49708|0.49708	0.0:0.0733:0.0:0.9266|0.0:0.0733:0.0:0.9266	.|.	1218|.	Q8NI27|.	THOC2_HUMAN|.	I|Y	1218;1218;1103|312	ENSP00000245838:K1218I;ENSP00000347959:K1218I;ENSP00000419795:K1103I|.	ENSP00000245838:K1218I|.	K|X	-|-	2|3	0|2	THOC2|THOC2	122584666|122584666	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	2.582000|2.582000	0.46085|0.46085	2.011000|2.011000	0.59026|0.59026	0.437000|0.437000	0.28790|0.28790	AAA|TAA	.		0.403	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
FLNA	2316	hgsc.bcm.edu	37	X	153592962	153592962	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chrX:153592962C>G	ENST00000369850.3	-	13	2190	c.1954G>C	c.(1954-1956)Gaa>Caa	p.E652Q	FLNA_ENST00000360319.4_Missense_Mutation_p.E652Q|FLNA_ENST00000344736.4_Missense_Mutation_p.E652Q|FLNA_ENST00000422373.1_Missense_Mutation_p.E652Q	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	652					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGATGTCTTCGCTGTTGCAC	0.607																																					p.E652Q		.											.	FLNA-599	0			c.G1954C						.						53.0	58.0	56.0					X																	153592962		2179	4245	6424	SO:0001583	missense	2316	exon13			TGTCTTCGCTGTT	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1954G>C	X.37:g.153592962C>G	ENSP00000358866:p.Glu652Gln	46	0		49	3	NM_001456	0	0	45	45	0	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919545	0.73098	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87	4.95	4.95	0.65309	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.070140	0.53938	D	0.000053	D	0.89570	0.6753	L	0.47016	1.485	0.80722	D	1	D;D	0.69078	0.997;0.994	D;D	0.69479	0.964;0.959	D	0.89925	0.4062	10	0.49607	T	0.09	.	17.4666	0.87634	0.0:1.0:0.0:0.0	.	652;652	P21333-2;P21333	.;FLNA_HUMAN	Q	652;625;652;652;652	ENSP00000353467:E652Q;ENSP00000416926:E652Q;ENSP00000358866:E652Q;ENSP00000358863:E652Q	ENSP00000358863:E652Q	E	-	1	0	FLNA	153246156	1.000000	0.71417	0.767000	0.31495	0.823000	0.46562	6.022000	0.70839	2.049000	0.60858	0.525000	0.51046	GAA	.		0.607	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
PDZD8	118987	hgsc.bcm.edu	37	10	119049810	119049814	+	Frame_Shift_Del	DEL	AGACG	AGACG	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	AGACG	AGACG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr10:119049810_119049814delAGACG	ENST00000334464.5	-	4	1383_1387	c.1144_1148delCGTCT	c.(1144-1149)cgtcttfs	p.RL382fs	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	382	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TGACTGGACAAGACGAAGTGTAAGT	0.41																																					p.382_383del		.											.	PDZD8-90	0			c.1144_1148del						.																																			SO:0001589	frameshift_variant	118987	exon4			.	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1144_1148delCGTCT	10.37:g.119049810_119049814delAGACG	ENSP00000334642:p.Arg382fs	57	0		46	12	NM_173791	0	0	0	0	0	Q86WE0|Q86WE5|Q9UFF1	Frame_Shift_Del	DEL	ENST00000334464.5	37	CCDS7600.1																																																																																			.		0.410	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PCDH17	27253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	58208351	58208351	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr13:58208351delG	ENST00000377918.3	+	1	1697	c.1671delG	c.(1669-1671)tcgfs	p.S557fs		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CTAAGGACTCGGGGGCGCCCG	0.592																																					p.S557fs	Melanoma(72;952 1291 1619 12849 33676)	.											.	PCDH17-97	0			c.1671delG						.						39.0	41.0	40.0					13																	58208351		2203	4300	6503	SO:0001589	frameshift_variant	27253	exon1			.	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1671delG	13.37:g.58208351delG	ENSP00000367151:p.Ser557fs	78	0		93	21	NM_001040429	0	0	0	0	0	A8K1R5|Q5VVW9|Q5VVX0	Frame_Shift_Del	DEL	ENST00000377918.3	37	CCDS31986.1																																																																																			.		0.592	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
MTHFD1	4522	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	64914978	64914979	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr14:64914978_64914979delAA	ENST00000545908.1	+	23	2619_2620	c.2390_2391delAA	c.(2389-2391)caafs	p.Q797fs	MTHFD1_ENST00000216605.8_Frame_Shift_Del_p.Q741fs|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	741	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	TTGAAGAAACAAATTGAAAATG	0.401																																					p.741_741del	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	.											.	MTHFD1-92	0			c.2222_2223del						.																																			SO:0001589	frameshift_variant	4522	exon23			.	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2390_2391delAA	14.37:g.64914978_64914979delAA	ENSP00000438588:p.Gln797fs	55	0		47	16	NM_005956	0	0	0	0	0	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Frame_Shift_Del	DEL	ENST00000545908.1	37																																																																																				.		0.401	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
ZNF263	10127	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3339974	3339974	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr16:3339974delT	ENST00000219069.5	+	6	2344	c.1468delT	c.(1468-1470)tacfs	p.Y490fs	ZNF263_ENST00000538765.1_Frame_Shift_Del_p.Y138fs	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	490					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GGAGAAGCCCTACAAGTGCCC	0.537																																					p.Y490fs		.											.	ZNF263-94	0			c.1468delT						.						69.0	67.0	68.0					16																	3339974		2197	4300	6497	SO:0001589	frameshift_variant	10127	exon6			.	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1468delT	16.37:g.3339974delT	ENSP00000219069:p.Tyr490fs	53	0		68	19	NM_005741	0	0	0	0	0	B2R634|O43387|Q96H95	Frame_Shift_Del	DEL	ENST00000219069.5	37	CCDS10499.1																																																																																			.		0.537	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2		
KIDINS220	57498	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	8872073	8872073	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr2:8872073delA	ENST00000256707.3	-	30	4274	c.4093delT	c.(4093-4095)tccfs	p.S1365fs	KIDINS220_ENST00000427284.1_Frame_Shift_Del_p.S1346fs|KIDINS220_ENST00000418530.1_Frame_Shift_Del_p.S1266fs|KIDINS220_ENST00000473731.1_Frame_Shift_Del_p.S1346fs	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1365					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GAATCCTGGGAATTGAGACTC	0.363																																					p.S1365fs		.											.	KIDINS220-93	0			c.4093delT						.						81.0	77.0	78.0					2																	8872073		1825	4096	5921	SO:0001589	frameshift_variant	57498	exon30			.	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4093delT	2.37:g.8872073delA	ENSP00000256707:p.Ser1365fs	141	0		129	43	NM_020738	0	0	0	0	0	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Frame_Shift_Del	DEL	ENST00000256707.3	37	CCDS42650.1																																																																																			.		0.363	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
ERC2	26059	broad.mit.edu	37	3	55733470	55733472	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr3:55733470_55733472delTGG	ENST00000288221.6	-	16	3036_3038	c.2781_2783delCCA	c.(2779-2784)caccat>cat	p.927_928HH>H		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	927	Poly-His.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		gtggtggtgatggtggtggtggt	0.502																																					p.925_926del													.	ERC2-24	0			c.2775_2777del						.																																			SO:0001651	inframe_deletion	26059	exon15			TGGTGATGGTGGT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2781_2783delCCA	3.37:g.55733479_55733481delTGG	ENSP00000288221:p.His932del	271	0		359	7	NM_015576	0	0	0	0	0	Q2T9F6|Q86TK4	In_Frame_Del	DEL	ENST00000288221.6	37	CCDS46851.1																																																																																			.		0.502	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
SH3BP2	6452	broad.mit.edu	37	4	2824661	2824661	+	Splice_Site	DEL	G	G	-			TCGA-A4-8311-01A-11D-2396-08	TCGA-A4-8311-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ed5c8ff4-0d94-443d-9024-efdae20db5f3	ffccfd57-43fd-497f-b78d-a644b37173b2	g.chr4:2824661delG	ENST00000356331.5	+	3	397		c.e3-1		SH3BP2_ENST00000389838.2_Splice_Site|SH3BP2_ENST00000442312.2_Splice_Site|SH3BP2_ENST00000503393.2_Splice_Site|SH3BP2_ENST00000452765.2_Splice_Site|SH3BP2_ENST00000435136.2_Splice_Site|SH3BP2_ENST00000511747.1_Splice_Site	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2						positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		ACCTCCCACAGGGCCCCTGCG	0.622									Cherubism																												.													.	SH3BP2-514	0			c.137-1G>-						.						63.0	51.0	55.0					4																	2824661		2203	4300	6503	SO:0001630	splice_region_variant	6452	exon3	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	CCCACAGGGCCCC	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.137-1G>-	4.37:g.2824661delG		21	0		27	11	NM_001122681	0	0	0	0	0	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Splice_Site	DEL	ENST00000356331.5	37	CCDS33944.1																																																																																			.		0.622	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	Intron
