#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSPG2	3339	hgsc.bcm.edu	37	1	22190695	22190695	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:22190695G>A	ENST00000374695.3	-	37	4717	c.4638C>T	c.(4636-4638)ccC>ccT	p.P1546P		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1546	Laminin EGF-like 9; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCGTGTAGCCGGGGGCACAGT	0.652																																					p.P1546P		.											.	HSPG2-141	0			c.C4638T						.						36.0	31.0	33.0					1																	22190695		2163	4218	6381	SO:0001819	synonymous_variant	3339	exon37			GTAGCCGGGGGCA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.4638C>T	1.37:g.22190695G>A		1	0		3	3	NM_005529	0	0	1	1	0	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																			.		0.652	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
KHDRBS1	10657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32508212	32508212	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:32508212A>G	ENST00000327300.7	+	9	1486	c.1319A>G	c.(1318-1320)tAt>tGt	p.Y440C	KHDRBS1_ENST00000492989.1_Missense_Mutation_p.Y401C|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GAGCACCCATATGGACGTTAT	0.483																																					p.Y440C	Ovarian(173;401 1982 12359 31110 42403)	.											.	KHDRBS1-227	0			c.A1319G						.						59.0	57.0	58.0					1																	32508212		2203	4300	6503	SO:0001583	missense	10657	exon9			ACCCATATGGACG	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.1319A>G	1.37:g.32508212A>G	ENSP00000313829:p.Tyr440Cys	66	0		58	13	NM_006559	0	0	40	74	34		Missense_Mutation	SNP	ENST00000327300.7	37	CCDS350.1	.	.	.	.	.	.	.	.	.	.	A	13.93	2.382684	0.42207	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	T;T	0.71103	-0.54;-0.51	5.85	4.72	0.59763	.	0.057453	0.64402	D	0.000001	T	0.81735	0.4885	M	0.78456	2.415	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.63192	0.819;0.912	D	0.83637	0.0148	10	0.87932	D	0	.	12.1125	0.53848	0.9331:0.0:0.0668:0.0	.	440;401	Q07666;Q07666-3	KHDR1_HUMAN;.	C	440;401;416	ENSP00000313829:Y440C;ENSP00000417731:Y401C	ENSP00000313829:Y440C	Y	+	2	0	KHDRBS1	32280799	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.716000	0.91420	1.156000	0.42514	-0.256000	0.11100	TAT	.		0.483	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011199.4	NM_006559	
TTLL7	79739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	84348653	84348653	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:84348653T>C	ENST00000260505.8	-	20	2913	c.2536A>G	c.(2536-2538)Aat>Gat	p.N846D	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	846					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TACCTGGAATTACCCCAGTCA	0.398																																					p.N846D		.											.	TTLL7-91	0			c.A2536G						.						156.0	150.0	152.0					1																	84348653		2203	4300	6503	SO:0001583	missense	79739	exon20			TGGAATTACCCCA	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2536A>G	1.37:g.84348653T>C	ENSP00000260505:p.Asn846Asp	209	0		162	21	NM_024686	0	0	0	0	0	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	CCDS690.2	.	.	.	.	.	.	.	.	.	.	T	11.08	1.532905	0.27387	.	.	ENSG00000137941	ENST00000260505	T	0.03004	4.08	5.5	1.79	0.24919	.	0.504331	0.23351	N	0.049127	T	0.00468	0.0015	N	0.04880	-0.145	0.28908	N	0.892872	B	0.06786	0.001	B	0.04013	0.001	T	0.44711	-0.9310	10	0.12766	T	0.61	.	3.8611	0.08996	0.0:0.188:0.414:0.398	.	846	Q6ZT98	TTLL7_HUMAN	D	846	ENSP00000260505:N846D	ENSP00000260505:N846D	N	-	1	0	TTLL7	84121241	1.000000	0.71417	0.971000	0.41717	0.928000	0.56348	3.636000	0.54317	0.417000	0.25871	-0.321000	0.08615	AAT	.		0.398	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
HSD17B7	51478	broad.mit.edu	37	1	162769622	162769622	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:162769622C>A	ENST00000254521.3	+	5	592	c.537C>A	c.(535-537)ttC>ttA	p.F179L	HSD17B7_ENST00000367917.3_Missense_Mutation_p.F179L|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	179					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					AATCTAATTTCAGCCTCGAGG	0.493																																					p.F179L													.	HSD17B7-91	0			c.C537A						.						68.0	62.0	64.0					1																	162769622		2203	4300	6503	SO:0001583	missense	51478	exon5			TAATTTCAGCCTC	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.537C>A	1.37:g.162769622C>A	ENSP00000254521:p.Phe179Leu	64	0		63	3	NM_016371	0	0	17	17	0	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Missense_Mutation	SNP	ENST00000254521.3	37	CCDS1242.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241919	0.39598	.	.	ENSG00000132196	ENST00000367917;ENST00000254521;ENST00000413934	T;T;T	0.75477	3.05;-0.94;3.05	4.44	2.56	0.30785	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	N	0.16266	0.395	0.37031	D	0.896675	P	0.37038	0.579	B	0.41988	0.372	T	0.30475	-0.9977	9	0.40728	T	0.16	-15.6945	6.7317	0.23387	0.0:0.7057:0.0:0.2943	.	179	P56937	DHB7_HUMAN	L	179;179;32	ENSP00000356894:F179L;ENSP00000254521:F179L;ENSP00000412146:F32L	ENSP00000254521:F179L	F	+	3	2	HSD17B7	161036246	1.000000	0.71417	0.969000	0.41365	0.955000	0.61496	1.007000	0.29860	0.488000	0.27723	0.650000	0.86243	TTC	.		0.493	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
CFH	3075	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	196706023	196706023	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:196706023A>T	ENST00000367429.4	+	16	2723	c.2483A>T	c.(2482-2484)aAt>aTt	p.N828I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	828	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ACCACACTGAATTATCGGGAT	0.333																																					p.N828I		.											.	CFH-566	0			c.A2483T						.						65.0	62.0	63.0					1																	196706023		2203	4300	6503	SO:0001583	missense	3075	exon16			CACTGAATTATCG	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2483A>T	1.37:g.196706023A>T	ENSP00000356399:p.Asn828Ile	84	0		61	6	NM_000186	0	0	1	1	0	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	12.36	1.913921	0.33815	.	.	ENSG00000000971	ENST00000367429	T	0.65732	-0.17	5.91	3.6	0.41247	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.69735	0.3144	M	0.73372	2.23	0.80722	D	1	D	0.60160	0.987	P	0.59357	0.856	T	0.68217	-0.5467	9	0.42905	T	0.14	.	6.5067	0.22198	0.7623:0.1583:0.0794:0.0	.	828	P08603	CFAH_HUMAN	I	828	ENSP00000356399:N828I	ENSP00000356399:N828I	N	+	2	0	CFH	194972646	0.999000	0.42202	0.929000	0.37066	0.092000	0.18411	1.560000	0.36331	1.049000	0.40321	0.454000	0.30748	AAT	.		0.333	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
PPP1R15B	84919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204379183	204379183	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:204379183C>A	ENST00000367188.4	-	1	1736	c.1357G>T	c.(1357-1359)Gag>Tag	p.E453*	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	453					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CCATCATCCTCAGCTTCCTCA	0.448																																					p.E453X		.											.	PPP1R15B-652	0			c.G1357T						.						132.0	133.0	133.0					1																	204379183		2203	4300	6503	SO:0001587	stop_gained	84919	exon1			CATCCTCAGCTTC	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1357G>T	1.37:g.204379183C>A	ENSP00000356156:p.Glu453*	300	1		269	61	NM_032833	0	0	0	0	0	Q53GQ4|Q658M2|Q6P156|Q96SN1	Nonsense_Mutation	SNP	ENST00000367188.4	37	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	C	42	9.816625	0.99271	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	.	.	.	4.95	4.95	0.65309	.	0.314427	0.31051	N	0.008354	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-17.5764	16.3288	0.82997	0.0:1.0:0.0:0.0	.	.	.	.	X	453;363	.	ENSP00000356156:E453X	E	-	1	0	PPP1R15B	202645806	1.000000	0.71417	0.826000	0.32828	0.997000	0.91878	6.493000	0.73658	2.423000	0.82170	0.655000	0.94253	GAG	.		0.448	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
BATF3	55509	hgsc.bcm.edu	37	1	212873074	212873074	+	Missense_Mutation	SNP	C	C	T	rs2202683	byFrequency	TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:212873074C>T	ENST00000243440.1	-	1	253	c.31G>A	c.(31-33)Gtc>Atc	p.V11I	BATF3_ENST00000478275.1_5'Flank	NM_018664.2	NP_061134.1	Q9NR55	BATF3_HUMAN	basic leucine zipper transcription factor, ATF-like 3	11			V -> I (in dbSNP:rs2202683).		dendritic cell differentiation (GO:0097028)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0046)|all cancers(67;0.00785)|GBM - Glioblastoma multiforme(131;0.0731)|Epithelial(68;0.0781)		CTCTGCAGGACGCTGCCGGCG	0.806													c|||	1011	0.201877	0.2239	0.1052	5008	,	,		4637	0.1875		0.1233	False		,,,				2504	0.3364				p.V11I		.											.	BATF3-68	0			c.G31A						.						1.0	1.0	1.0					1																	212873074		797	2005	2802	SO:0001583	missense	55509	exon1			GCAGGACGCTGCC	AF255346	CCDS1508.1	1q32.3	2013-01-10			ENSG00000123685	ENSG00000123685		"""basic leucine zipper proteins"""	28915	protein-coding gene	gene with protein product	"""Jun dimerization protein 1"""	612470				10878360, 12087103	Standard	NM_018664		Approved	JUNDM1, SNFT, JDP1	uc001hjl.2	Q9NR55	OTTHUMG00000036807	ENST00000243440.1:c.31G>A	1.37:g.212873074C>T	ENSP00000243440:p.Val11Ile	1	1		4	4	NM_018664	0	0	0	0	0		Missense_Mutation	SNP	ENST00000243440.1	37	CCDS1508.1	369	0.16895604395604397	110	0.22357723577235772	53	0.1464088397790055	109	0.19055944055944055	97	0.1279683377308707	c	15.18	2.756149	0.49362	.	.	ENSG00000123685	ENST00000243440	T	0.57107	0.42	3.94	3.94	0.45596	.	0.397991	0.20707	U	0.087161	T	0.00039	0.0001	L	0.29908	0.895	0.42635	P	0.006601999999999997	D	0.52996	0.957	B	0.36719	0.231	T	0.11203	-1.0597	9	0.35671	T	0.21	-0.8671	11.5076	0.50476	0.0:1.0:0.0:0.0	rs2202683	11	Q9NR55	BATF3_HUMAN	I	11	ENSP00000243440:V11I	ENSP00000243440:V11I	V	-	1	0	BATF3	210939697	1.000000	0.71417	0.957000	0.39632	0.662000	0.39071	1.053000	0.30442	1.720000	0.51447	0.424000	0.28305	GTC	C|0.001;G|0.830		0.806	BATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089403.1	NM_018664	
CAMK1D	57118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12811756	12811756	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr10:12811756G>A	ENST00000378847.3	+	5	860	c.523G>A	c.(523-525)Gga>Aga	p.G175R	CAMK1D_ENST00000378845.1_Missense_Mutation_p.G175R	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		GGAGGGCAAAGGAGATGTGAT	0.458																																					p.G175R		.											.	CAMK1D-334	0			c.G523A						.						177.0	140.0	153.0					10																	12811756		2203	4300	6503	SO:0001583	missense	57118	exon5			GGCAAAGGAGATG	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.523G>A	10.37:g.12811756G>A	ENSP00000368124:p.Gly175Arg	123	0		92	17	NM_153498	0	0	0	0	0	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	37	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892484	0.91889	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.65364	-0.15;-0.15	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.115496	0.64402	D	0.000017	T	0.68796	0.3040	N	0.25060	0.705	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.79784	0.993;0.987	T	0.71912	-0.4449	10	0.52906	T	0.07	-14.2799	17.7041	0.88303	0.0:0.0:1.0:0.0	.	175;175	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	R	175	ENSP00000368124:G175R;ENSP00000368122:G175R	ENSP00000368122:G175R	G	+	1	0	CAMK1D	12851762	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.950000	0.87804	2.403000	0.81681	0.561000	0.74099	GGA	.		0.458	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
MUC5B	727897	hgsc.bcm.edu;ucsc.edu	37	11	1253260	1253260	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr11:1253260C>A	ENST00000529681.1	+	15	1771	c.1713C>A	c.(1711-1713)gaC>gaA	p.D571E	MUC5B_ENST00000447027.1_Missense_Mutation_p.D574E	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	571	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCAGGCTGACGACTTCACGG	0.672																																					p.D571E		.											.	.	0			c.C1713A						.						42.0	50.0	48.0					11																	1253260		2049	4192	6241	SO:0001583	missense	727897	exon15			GGCTGACGACTTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1713C>A	11.37:g.1253260C>A	ENSP00000436812:p.Asp571Glu	59	0		43	4	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254981	0.22965	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.65364	-0.15;-0.15	3.77	-5.54	0.02544	von Willebrand factor, type D domain (3);	.	.	.	.	D	0.83982	0.5372	H	0.98314	4.2	0.36992	D	0.894823	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.984;0.996;0.996	D	0.86512	0.1810	9	0.87932	D	0	.	12.6531	0.56772	0.0:0.2249:0.0:0.7751	.	571;1230;574	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	E	571;574;572;607	ENSP00000436812:D571E;ENSP00000415793:D574E	ENSP00000343037:D572E	D	+	3	2	MUC5B	1209836	0.027000	0.19231	0.934000	0.37439	0.455000	0.32408	-1.078000	0.03413	-1.179000	0.02737	-0.369000	0.07265	GAC	.		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR5T2	219464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56000140	56000140	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr11:56000140G>T	ENST00000313264.4	-	1	597	c.522C>A	c.(520-522)agC>agA	p.S174R		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TGGGTGACATGCTCACTGAAT	0.433																																					p.S174R		.											.	OR5T2-70	0			c.C522A						.						201.0	169.0	180.0					11																	56000140		2201	4296	6497	SO:0001583	missense	219464	exon1			TGACATGCTCACT	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.522C>A	11.37:g.56000140G>T	ENSP00000323688:p.Ser174Arg	194	1		217	50	NM_001004746	0	0	0	0	0	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	G	2.242	-0.373512	0.05034	.	.	ENSG00000181718	ENST00000313264	T	0.00446	7.39	5.07	2.07	0.26955	GPCR, rhodopsin-like superfamily (1);	0.718686	0.11856	N	0.522814	T	0.00210	0.0006	N	0.11651	0.15	0.18873	N	0.999985	B	0.09022	0.002	B	0.08055	0.003	T	0.35674	-0.9779	10	0.38643	T	0.18	.	3.4272	0.07414	0.1451:0.1394:0.5715:0.144	.	174	Q8NGG2	OR5T2_HUMAN	R	174	ENSP00000323688:S174R	ENSP00000323688:S174R	S	-	3	2	OR5T2	55756716	0.018000	0.18449	0.544000	0.28141	0.303000	0.27691	0.074000	0.14662	0.617000	0.30160	0.471000	0.43371	AGC	.		0.433	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
SLCO1B3	28234	broad.mit.edu	37	12	21030825	21030825	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr12:21030825G>C	ENST00000381545.3	+	10	1309	c.1090G>C	c.(1090-1092)Gag>Cag	p.E364Q	SLCO1B3_ENST00000261196.2_Missense_Mutation_p.E364Q|LST3_ENST00000540229.1_Missense_Mutation_p.E364Q|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.E364Q|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	364					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TAAATATATGGAGCAACAGTA	0.353																																					p.E364Q													.	SLCO1B3-155	0			c.G1090C						.						136.0	136.0	136.0					12																	21030825		2203	4299	6502	SO:0001583	missense	28234	exon10			TATATGGAGCAAC		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1090G>C	12.37:g.21030825G>C	ENSP00000370956:p.Glu364Gln	157	0		168	4	NM_019844	0	0	0	0	0	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	.	17.94	3.511137	0.64522	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	3.13	3.13	0.36017	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.83700	0.5311	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;D;D	0.79108	0.992;0.989;0.974	D	0.86364	0.1719	10	0.87932	D	0	.	12.1271	0.53922	0.0:0.0:1.0:0.0	.	364;364;364	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	Q	364;364;364;188;364	ENSP00000261196:E364Q;ENSP00000370956:E364Q;ENSP00000451758:E364Q;ENSP00000443225:E188Q;ENSP00000441269:E364Q	ENSP00000441269:E364Q	E	+	1	0	SLCO1B3;RP11-545J16.1	20922092	1.000000	0.71417	0.180000	0.23079	0.187000	0.23431	7.557000	0.82243	1.585000	0.49928	0.305000	0.20034	GAG	.		0.353	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
CELA1	1990	hgsc.bcm.edu	37	12	51740415	51740415	+	Missense_Mutation	SNP	A	A	C	rs370927847|rs386762976|rs55827519	byFrequency	TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr12:51740415A>C	ENST00000293636.1	-	1	48	c.8T>G	c.(7-9)gTc>gGc	p.V3G		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	3					exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V3fs*21(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ACCATAAAGGACCAGCATGTT	0.512																																					p.V3G		.											.	CELA1-153	1	Deletion - Frameshift(1)	large_intestine(1)	c.T8G						.						198.0	125.0	149.0					12																	51740415		2199	4290	6489	SO:0001583	missense	1990	exon1			TAAAGGACCAGCA		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.8T>G	12.37:g.51740415A>C	ENSP00000293636:p.Val3Gly	81	1		80	4	NM_001971	0	0	0	0	0	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	37	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	-	10.50	1.368338	0.24771	.	.	ENSG00000139610	ENST00000293636	D	0.89552	-2.53	3.61	0.701	0.18104	.	0.180867	0.43747	D	0.000529	T	0.82121	0.4968	L	0.55990	1.75	0.28932	N	0.891491	B	0.27823	0.19	B	0.26517	0.07	T	0.73855	-0.3851	10	0.87932	D	0	-1.5222	3.134	0.06433	0.3198:0.0:0.4933:0.1868	.	3	Q9UNI1	CELA1_HUMAN	G	3	ENSP00000293636:V3G	ENSP00000293636:V3G	V	-	2	0	CELA1	50026682	0.009000	0.17119	0.433000	0.26760	0.045000	0.14185	0.204000	0.17335	-0.043000	0.13513	-0.633000	0.03987	GTC	.		0.512	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
TPCN1	53373	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113704162	113704162	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr12:113704162G>T	ENST00000335509.6	+	4	728		c.e4+1		TPCN1_ENST00000392569.4_Splice_Site|TPCN1_ENST00000541517.1_Splice_Site|TPCN1_ENST00000550785.1_Splice_Site	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1						calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						TGGCATCTATGTGAGCGCACA	0.622																																					.													.	TPCN1-93	0			c.414+1G>T						.						112.0	127.0	122.0					12																	113704162		2203	4300	6503	SO:0001630	splice_region_variant	53373	exon4			ATCTATGTGAGCG	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.414+1G>T	12.37:g.113704162G>T		353	2		384	73	NM_017901	0	0	0	1	1	A7E258|Q86XS9|Q8NC20	Splice_Site	SNP	ENST00000335509.6	37	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152622	0.38021	.	.	ENSG00000186815	ENST00000552642;ENST00000335509;ENST00000552897;ENST00000550785;ENST00000541517;ENST00000392569;ENST00000552542;ENST00000548465	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1947	0.93682	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TPCN1	112188545	1.000000	0.71417	0.989000	0.46669	0.005000	0.04900	9.428000	0.97476	2.532000	0.85374	0.561000	0.74099	.	.		0.622	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	Intron
HERC1	8925	hgsc.bcm.edu	37	15	63929810	63929810	+	Missense_Mutation	SNP	G	G	C	rs368460721		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr15:63929810G>C	ENST00000443617.2	-	64	12213	c.12126C>G	c.(12124-12126)atC>atG	p.I4042M		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4042					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CATTGGCCTGGATGACAAAGG	0.373																																					p.I4042M		.											.	HERC1-666	0			c.C12126G						.	G	MET/ILE	0,3740		0,0,1870	57.0	51.0	53.0		12126	1.8	1.0	15		53	1,8159		0,1,4079	no	missense	HERC1	NM_003922.3	10	0,1,5949	CC,CG,GG		0.0123,0.0,0.0084	probably-damaging	4042/4862	63929810	1,11899	1870	4080	5950	SO:0001583	missense	8925	exon64			GGCCTGGATGACA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.12126C>G	15.37:g.63929810G>C	ENSP00000390158:p.Ile4042Met	4	1		8	3	NM_003922	0	0	0	1	1	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214505	0.58452	0.0	1.23E-4	ENSG00000103657	ENST00000443617	D	0.87029	-2.2	4.92	1.77	0.24775	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.64402	U	0.000001	D	0.88800	0.6535	L	0.61218	1.895	0.52501	D	0.999954	D	0.59767	0.986	D	0.63283	0.913	D	0.86234	0.1639	10	0.87932	D	0	.	4.5728	0.12217	0.2168:0.0:0.5167:0.2665	.	4042	Q15751	HERC1_HUMAN	M	4042	ENSP00000390158:I4042M	ENSP00000390158:I4042M	I	-	3	3	HERC1	61716863	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.893000	0.28336	0.596000	0.29794	0.655000	0.94253	ATC	.		0.373	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
SNX1	6642	hgsc.bcm.edu	37	15	64426982	64426982	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr15:64426982G>A	ENST00000559844.1	+	12	1355	c.1341G>A	c.(1339-1341)caG>caA	p.Q447Q	SNX1_ENST00000353874.4_Intron|SNX1_ENST00000561026.1_Silent_p.Q382Q|SNX1_ENST00000261889.5_Silent_p.Q447Q|SNX1_ENST00000560829.1_Silent_p.Q229Q			Q13596	SNX1_HUMAN	sorting nexin 1	447	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						ATAAGCTGCAGCAGGCCAAGG	0.627																																					p.Q447Q		.											.	SNX1-226	0			c.G1341A						.						34.0	32.0	33.0					15																	64426982		2203	4300	6503	SO:0001819	synonymous_variant	6642	exon12			GCTGCAGCAGGCC	BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1341G>A	15.37:g.64426982G>A		41	0		39	2	NM_003099	0	0	52	52	0	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Silent	SNP	ENST00000559844.1	37	CCDS32266.1																																																																																			.		0.627	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418559.1	NM_003099	
METTL9	51108	hgsc.bcm.edu	37	16	21611192	21611192	+	Silent	SNP	C	C	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr16:21611192C>G	ENST00000358154.3	+	1	396	c.138C>G	c.(136-138)gcC>gcG	p.A46A	METTL9_ENST00000396014.4_Silent_p.A46A	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	46	Poly-Ala.									endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		cggcggcggccgcgggcggcA	0.771																																					p.A46A		.											.	METTL9-91	0			c.C138G						.						3.0	4.0	3.0					16																	21611192		1579	3397	4976	SO:0001819	synonymous_variant	51108	exon1			GGCGGCCGCGGGC	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.138C>G	16.37:g.21611192C>G		4	1		9	5	NM_016025	0	0	12	32	20	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Silent	SNP	ENST00000358154.3	37	CCDS10598.2																																																																																			.		0.771	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89345492	89345492	+	Silent	SNP	G	G	A	rs569755271		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr16:89345492G>A	ENST00000301030.4	-	9	7918	c.7458C>T	c.(7456-7458)ctC>ctT	p.L2486L	ANKRD11_ENST00000378330.2_Silent_p.L2486L	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2486					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGGGATGTGGAGCTTGCTGA	0.657																																					p.L2486L		.											.	ANKRD11-139	0			c.C7458T						.						25.0	22.0	23.0					16																	89345492		2197	4298	6495	SO:0001819	synonymous_variant	29123	exon9			GATGTGGAGCTTG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7458C>T	16.37:g.89345492G>A		28	0		50	11	NM_001256183	0	0	0	0	0	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			.		0.657	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
SLFN11	91607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33679780	33679780	+	Silent	SNP	G	G	A	rs377363363		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr17:33679780G>A	ENST00000394566.1	-	7	2573	c.2301C>T	c.(2299-2301)gcC>gcT	p.A767A	SLFN11_ENST00000308377.4_Silent_p.A767A	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	767					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGACCATTCGGCTTCAGGAA	0.443																																					p.A767A		.											.	SLFN11-159	0			c.C2301T						.	G	,,,,	0,4406		0,0,2203	65.0	61.0	62.0		2301,2301,2301,2301,2301	1.7	0.0	17		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLFN11	NM_001104587.1,NM_001104588.1,NM_001104589.1,NM_001104590.1,NM_152270.3	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	767/902,767/902,767/902,767/902,767/902	33679780	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	91607	exon5			CCATTCGGCTTCA	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2301C>T	17.37:g.33679780G>A		117	0		94	21	NM_152270	0	0	18	21	3	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1																																																																																			.		0.443	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
KRTAP1-3	81850	hgsc.bcm.edu	37	17	39191011	39191011	+	Silent	SNP	G	G	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr17:39191011G>C	ENST00000344363.5	-	1	96	c.63C>G	c.(61-63)ggC>ggG	p.G21G		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	21						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCAGCTGGAGCCGCATGTCC	0.587																																					p.G21G		.											.	.	0			c.C63G						.						42.0	50.0	47.0					17																	39191011		1973	4168	6141	SO:0001819	synonymous_variant	81850	exon1			GCTGGAGCCGCAT	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.63C>G	17.37:g.39191011G>C		48	0		65	5	NM_030966	0	0	0	0	0	Q07628|Q8IUG0|Q9BYS2	Silent	SNP	ENST00000344363.5	37	CCDS42323.1																																																																																			.		0.587	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
PTPRM	5797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	8379245	8379245	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr18:8379245G>A	ENST00000332175.8	+	26	4691	c.3654G>A	c.(3652-3654)cgG>cgA	p.R1218R	PTPRM_ENST00000580170.1_Silent_p.R1231R|PTPRM_ENST00000400053.4_Silent_p.R1156R|PTPRM_ENST00000444013.1_Silent_p.R1005R|PTPRM_ENST00000400060.4_Silent_p.R1232R	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1218	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGAAAAACCGGTGCATGGACA	0.562																																					p.R1231R		.											.	PTPRM-228	0			c.G3693A						.						138.0	108.0	118.0					18																	8379245		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon28			AAACCGGTGCATG	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3654G>A	18.37:g.8379245G>A		73	0		107	22	NM_001105244	0	0	23	38	15	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.562	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PRTN3	5657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	841048	841048	+	Silent	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:841048C>T	ENST00000234347.5	+	1	86	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	PRTN3_ENST00000544537.2_5'Flank	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	14					collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGTCCGTGCTGCTGGCCTT	0.657																																					p.L14L		.											.	PRTN3-91	0			c.C40T						.						32.0	30.0	31.0					19																	841048		2202	4300	6502	SO:0001819	synonymous_variant	5657	exon1			TCCGTGCTGCTGG		CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.40C>T	19.37:g.841048C>T		32	0		49	12	NM_002777	0	0	0	0	0	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Silent	SNP	ENST00000234347.5	37	CCDS32860.1																																																																																			.		0.657	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457888.2	NM_002777	
NDUFA11	126328	ucsc.edu	37	19	5897010	5897010	+	Splice_Site	SNP	T	T	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:5897010T>A	ENST00000308961.4	-	2	145		c.e2-2		NDUFA11_ENST00000418389.2_Splice_Site|FUT5_ENST00000252675.5_Splice_Site|AC104532.3_ENST00000590441.1_RNA|NDUFA11_ENST00000592634.1_Splice_Site|AC104532.3_ENST00000589277.1_RNA|AC024592.12_ENST00000586349.1_Splice_Site	NM_175614.4	NP_783313.1	Q86Y39	NDUAB_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa						cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(1)	2						CGGTCAGGCCTGCGAGACAGA	0.612																																					.													.	NDUFA11-90	0			c.98-2A>T						.						118.0	102.0	108.0					19																	5897010		2203	4300	6503	SO:0001630	splice_region_variant	126328	exon3			CAGGCCTGCGAGA	AJ539081	CCDS12155.1, CCDS54203.1	19p13.3	2011-07-04				ENSG00000174886		"""Mitochondrial respiratory chain complex / Complex I"""	20371	protein-coding gene	gene with protein product	"""complex I B14.7 subunit"""	612638				12381726	Standard	NM_001193375		Approved	B14.7	uc002mdp.2	Q86Y39		ENST00000308961.4:c.98-2A>T	19.37:g.5897010T>A		81	1		102	1	NM_001193375	0	0	2	2	0	C9JT23|Q6ZS66	Splice_Site	SNP	ENST00000308961.4	37	CCDS12155.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620763	0.46736	.	.	ENSG00000174886	ENST00000418389;ENST00000308961	.	.	.	3.96	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5079	0.39058	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NDUFA11	5848010	0.976000	0.34144	0.906000	0.35671	0.227000	0.25037	2.368000	0.44222	1.583000	0.49898	0.334000	0.21626	.	.		0.612	NDUFA11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452218.1	NM_175614	Intron
HNRNPL	3191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39336576	39336576	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:39336576G>C	ENST00000221419.5	-	3	907	c.541C>G	c.(541-543)Cgc>Ggc	p.R181G	HNRNPL_ENST00000600873.1_Missense_Mutation_p.R48G|AC008982.2_ENST00000600473.1_RNA	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	181					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TCCCCAGGGCGGGAGATCTTC	0.542																																					p.R181G		.											.	HNRNPL-22	0			c.C541G						.						117.0	115.0	115.0					19																	39336576		2203	4300	6503	SO:0001583	missense	3191	exon3			CAGGGCGGGAGAT	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.541C>G	19.37:g.39336576G>C	ENSP00000221419:p.Arg181Gly	188	0		227	31	NM_001533	0	0	37	82	45	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004874	0.54254	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750;ENST00000423415;ENST00000536292	.	.	.	5.39	5.39	0.77823	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.69655	0.3135	M	0.74258	2.255	0.58432	D	0.999995	B	0.18461	0.028	B	0.20767	0.031	T	0.68812	-0.5310	9	0.66056	D	0.02	.	17.9088	0.88928	0.0:0.0:1.0:0.0	.	181	P14866	HNRPL_HUMAN	G	181;48;48;48;109	.	ENSP00000221419:R181G	R	-	1	0	HNRNPL	44028416	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	5.035000	0.64158	2.541000	0.85698	0.462000	0.41574	CGC	.		0.542	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
TRPM4	54795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	49703680	49703680	+	Silent	SNP	G	G	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:49703680G>T	ENST00000252826.5	+	18	2895	c.2769G>T	c.(2767-2769)gtG>gtT	p.V923V	TRPM4_ENST00000355712.5_Silent_p.V569V|TRPM4_ENST00000427978.2_Silent_p.V778V	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	923					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TCGTCATCGTGAGCAAGATGG	0.612																																					p.V923V		.											.	TRPM4-91	0			c.G2769T						.						35.0	33.0	34.0					19																	49703680		2203	4300	6503	SO:0001819	synonymous_variant	54795	exon18			CATCGTGAGCAAG	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2769G>T	19.37:g.49703680G>T		41	1		43	10	NM_017636	0	0	0	0	0	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	37	CCDS33073.1																																																																																			.		0.612	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
LILRA6	79168	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	54745734	54745734	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:54745734G>T	ENST00000396365.2	-	4	415	c.376C>A	c.(376-378)Ctc>Atc	p.L126I	LILRA6_ENST00000419410.2_Missense_Mutation_p.L126I|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000440558.2_Missense_Mutation_p.L126I|LILRA6_ENST00000391735.3_Missense_Mutation_p.L126I|LILRA6_ENST00000270464.5_Missense_Mutation_p.L126I|LILRA6_ENST00000245621.5_Missense_Mutation_p.L126I	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	126					immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.L126F(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGCTGAGAGGGTGGGTTTG	0.567																																					p.L126I		.											.	LILRA6-24	2	Substitution - Missense(2)	lung(2)	c.C376A						.						62.0	102.0	89.0					19																	54745734		2108	4294	6402	SO:0001583	missense	79168	exon4			CTGAGAGGGTGGG	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.376C>A	19.37:g.54745734G>T	ENSP00000379651:p.Leu126Ile	90	0		64	23	NM_024318	0	0	1	1	0		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212570	0.58452	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000391735;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T;T	0.01981	5.38;5.38;5.38;4.52;5.38;5.38	3.4	3.4	0.38934	Immunoglobulin-like fold (1);	0.278862	0.25747	N	0.028562	T	0.11153	0.0272	M	0.81942	2.565	0.23546	N	0.997443	D;P;D;D;D;D	0.76494	0.995;0.947;0.982;0.997;0.997;0.999	D;D;D;D;D;D	0.81914	0.986;0.959;0.949;0.987;0.995;0.995	T	0.00984	-1.1491	10	0.87932	D	0	.	10.5189	0.44907	0.0:0.0:1.0:0.0	.	126;126;126;126;126;126	C9JFH3;Q6PI73-2;Q6PI73;F8WCY4;D3YTC4;F8W6G6	.;.;LIRA6_HUMAN;.;.;.	I	126	ENSP00000390120:L126I;ENSP00000270464:L126I;ENSP00000411227:L126I;ENSP00000375615:L126I;ENSP00000379651:L126I;ENSP00000245621:L126I	ENSP00000245621:L126I	L	-	1	0	LILRA6	59437546	0.011000	0.17503	0.553000	0.28255	0.078000	0.17371	1.276000	0.33156	1.936000	0.56123	0.184000	0.17185	CTC	.		0.567	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
ZNF446	55663	hgsc.bcm.edu	37	19	58991385	58991385	+	Splice_Site	SNP	G	G	A	rs372496370	byFrequency	TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:58991385G>A	ENST00000594369.1	+	6	1182	c.801G>A	c.(799-801)tcG>tcA	p.S267S	ZNF446_ENST00000596341.1_Splice_Site_p.S267S|ZNF446_ENST00000335841.4_Splice_Site_p.R239Q	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	267					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GCCTGCGCTCGGGTGAGTGCC	0.677													G|||	5	0.000998403	0.003	0.0	5008	,	,		14880	0.0		0.0	False		,,,				2504	0.001				p.S267S		.											.	ZNF446-91	0			c.G801A						.	G		3,4347		0,3,2172	9.0	11.0	10.0		801	-5.9	0.1	19		10	0,8546		0,0,4273	no	coding-synonymous-near-splice	ZNF446	NM_017908.2		0,3,6445	AA,AG,GG		0.0,0.069,0.0233		267/451	58991385	3,12893	2175	4273	6448	SO:0001630	splice_region_variant	55663	exon6			GCGCTCGGGTGAG		CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.802+1G>A	19.37:g.58991385G>A		12	1		11	7	NM_017908	0	0	2	2	0		Silent	SNP	ENST00000594369.1	37	CCDS12982.1																																																																																			.		0.677	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467052.1	NM_017908	Silent
DIS3L2	129563	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	233075106	233075106	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr2:233075106C>G	ENST00000409307.1	+	9	1195	c.1195C>G	c.(1195-1197)Ctc>Gtc	p.L399V	DIS3L2_ENST00000273009.6_Missense_Mutation_p.L399V|DIS3L2_ENST00000325385.7_Missense_Mutation_p.L399V					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CTGCAAGCCACTCGCTGACGG	0.512																																					p.L399V		.											.	DIS3L2-136	0			c.C1195G						.						97.0	98.0	98.0					2																	233075106		2074	4234	6308	SO:0001583	missense	129563	exon10			AAGCCACTCGCTG	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1195C>G	2.37:g.233075106C>G	ENSP00000386799:p.Leu399Val	77	0		79	9	NM_152383	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409307.1	37	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954379	0.73902	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.16	5.16	0.70880	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.79693	2.465	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	T	0.67409	-0.5678	10	0.72032	D	0.01	-16.4035	15.5539	0.76177	0.0:1.0:0.0:0.0	.	399	Q8IYB7	DI3L2_HUMAN	V	399;399;399;399;399;34	ENSP00000273009:L399V;ENSP00000315569:L399V;ENSP00000386799:L399V;ENSP00000415419:L34V	ENSP00000273009:L399V	L	+	1	0	DIS3L2	232783350	0.994000	0.37717	0.445000	0.26908	0.945000	0.59286	3.829000	0.55760	2.381000	0.81170	0.455000	0.32223	CTC	.		0.512	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
CHRNA4	1137	hgsc.bcm.edu	37	20	61981411	61981411	+	Missense_Mutation	SNP	G	G	A	rs55915440	byFrequency	TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr20:61981411G>A	ENST00000370263.4	-	5	1573	c.1352C>T	c.(1351-1353)cCg>cTg	p.P451L	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	451					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCCGTGGGGCGGGCGGCAGGG	0.711													G|||	9	0.00179712	0.0	0.0029	5008	,	,		12301	0.0		0.004	False		,,,				2504	0.0031				p.P451L		.											.	CHRNA4-91	0			c.C1352T						.	G	LEU/PRO	1,4185		0,1,2092	6.0	6.0	6.0		1352	2.6	0.0	20	dbSNP_129	6	20,8254		0,20,4117	no	missense	CHRNA4	NM_000744.5	98	0,21,6209	AA,AG,GG		0.2417,0.0239,0.1685	benign	451/628	61981411	21,12439	2093	4137	6230	SO:0001583	missense	1137	exon5			TGGGGCGGGCGGC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1352C>T	20.37:g.61981411G>A	ENSP00000359285:p.Pro451Leu	9	1		10	6	NM_000744	0	0	0	0	0	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	3.039	-0.197981	0.06219	2.39E-4	0.002417	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.76578	-1.03	4.65	2.6	0.31112	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.565980	0.03236	N	0.179688	T	0.72669	0.3489	L	0.47716	1.5	0.20703	N	0.999863	B;B	0.11235	0.004;0.004	B;B	0.10450	0.005;0.001	T	0.53556	-0.8422	10	0.48119	T	0.1	.	5.8657	0.18773	0.1788:0.1724:0.6487:0.0	rs55915440	380;451	Q4VAQ5;P43681	.;ACHA4_HUMAN	L	357;451;380	ENSP00000359285:P451L	ENSP00000359280:P357L	P	-	2	0	CHRNA4	61451855	0.640000	0.27243	0.001000	0.08648	0.001000	0.01503	1.128000	0.31369	0.354000	0.24105	-0.211000	0.12701	CCG	G|0.999;A|0.001		0.711	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
PRDM15	63977	hgsc.bcm.edu	37	21	43298959	43298959	+	Silent	SNP	C	C	G	rs375565529		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr21:43298959C>G	ENST00000269844.3	-	3	368	c.258G>C	c.(256-258)ccG>ccC	p.P86P	PRDM15_ENST00000398548.1_Intron|PRDM15_ENST00000538201.1_Intron|AP001619.2_ENST00000432411.1_RNA|PRDM15_ENST00000422911.1_Intron	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						cgggccggggcggcgaagacc	0.861																																					p.P86P		.											.	PRDM15-90	0			c.G258C						.						1.0	1.0	1.0					21																	43298959		34	112	146	SO:0001819	synonymous_variant	63977	exon3			CCGGGGCGGCGAA	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.258G>C	21.37:g.43298959C>G		0	0		2	2	NM_022115	0	0	0	0	0	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1																																																																																			.		0.861	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
KRTAP10-3	386682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45978127	45978127	+	Missense_Mutation	SNP	C	C	T	rs369545090		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr21:45978127C>T	ENST00000391620.1	-	1	516	c.472G>A	c.(472-474)Gtg>Atg	p.V158M	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	158	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						AGGAGGGACACGGAGGAGGAG	0.692																																					p.V158M		.											.	KRTAP10-3-91	0			c.G472A						.	C	MET/VAL,	1,4405	2.1+/-5.4	0,1,2202	89.0	96.0	93.0		472,	2.6	0.6	21		93	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	TSPEAR,KRTAP10-3	NM_198696.2,NM_144991.2	21,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,	158/222,	45978127	2,13004	2203	4300	6503	SO:0001583	missense	386682	exon1			GGGACACGGAGGA	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.472G>A	21.37:g.45978127C>T	ENSP00000375478:p.Val158Met	162	0		152	31	NM_198696	0	0	0	0	0	A3KN67|Q70LJ4	Missense_Mutation	SNP	ENST00000391620.1	37	CCDS42956.1	.	.	.	.	.	.	.	.	.	.	c	3.276	-0.148013	0.06627	2.27E-4	1.16E-4	ENSG00000212935	ENST00000391620	T	0.01438	4.89	3.53	2.61	0.31194	.	.	.	.	.	T	0.05823	0.0152	M	0.84948	2.725	0.09310	N	1	D	0.59357	0.985	P	0.53593	0.73	T	0.14144	-1.0483	9	0.59425	D	0.04	.	9.6661	0.39986	0.0:0.5593:0.4407:0.0	.	158	P60369	KR103_HUMAN	M	158	ENSP00000375478:V158M	ENSP00000375478:V158M	V	-	1	0	KRTAP10-3	44802555	0.060000	0.20803	0.577000	0.28562	0.005000	0.04900	0.116000	0.15561	0.772000	0.33382	0.561000	0.74099	GTG	.		0.692	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1		
GTSE1	51512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46724721	46724721	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr22:46724721A>C	ENST00000454366.1	+	10	2073	c.1861A>C	c.(1861-1863)Aaa>Caa	p.K621Q		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	602					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TACTTTCTCCAAAAGTACTGC	0.567																																					p.K621Q	GBM(153;542 1915 12487 29016 50495)	.											.	GTSE1-187	0			c.A1861C						.						88.0	95.0	93.0					22																	46724721		2203	4300	6503	SO:0001583	missense	51512	exon10			TTCTCCAAAAGTA	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1861A>C	22.37:g.46724721A>C	ENSP00000415430:p.Lys621Gln	226	0		255	43	NM_016426	0	0	0	1	1	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	37	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	A	7.057	0.565524	0.13560	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.07021	3.23	4.41	-0.765	0.11023	.	0.925293	0.09363	N	0.812463	T	0.03871	0.0109	N	0.12471	0.22	0.09310	N	1	B;B	0.25312	0.123;0.123	B;B	0.21360	0.023;0.034	T	0.45687	-0.9244	10	0.25751	T	0.34	-5.7757	4.1358	0.10170	0.3102:0.4118:0.278:0.0	.	602;581	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	Q	621;581	ENSP00000415430:K621Q	ENSP00000354634:K581Q	K	+	1	0	GTSE1	45103385	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.240000	0.08952	-0.032000	0.13758	0.533000	0.62120	AAA	.		0.567	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
GMPPB	29925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49755505	49755505	+	3'UTR	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr3:49755505T>C	ENST00000480687.1	-	0	4879				AMIGO3_ENST00000535833.1_Missense_Mutation_p.N465S|RNF123_ENST00000433785.1_Intron|RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000320431.7_Missense_Mutation_p.N465S			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CACGCGGCCATTGAGGCCCCT	0.632																																					p.N465S		.											.	AMIGO3-91	0			c.A1394G						.						72.0	71.0	71.0					3																	49755505		2203	4300	6503	SO:0001624	3_prime_UTR_variant	386724	exon1			CGGCCATTGAGGC	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3680A>G	3.37:g.49755505T>C		142	1		127	22	NM_198722	0	0	2	3	1	A8K6N5|Q9H7U3	Missense_Mutation	SNP	ENST00000480687.1	37	CCDS2803.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096839	0.76870	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.66460	-0.21;-0.21	5.45	5.45	0.79879	.	0.114778	0.64402	D	0.000020	T	0.76814	0.4040	M	0.75777	2.31	0.80722	D	1	D	0.67145	0.996	P	0.60609	0.877	T	0.79640	-0.1719	10	0.87932	D	0	-14.8242	8.9474	0.35767	0.0:0.0836:0.0:0.9164	.	465	Q86WK7	AMGO3_HUMAN	S	465	ENSP00000323096:N465S;ENSP00000439268:N465S	ENSP00000323096:N465S	N	-	2	0	AMIGO3	49730509	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.856000	0.69518	2.080000	0.62538	0.459000	0.35465	AAT	.		0.632	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
OTOL1	131149	hgsc.bcm.edu	37	3	161221062	161221062	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr3:161221062A>G	ENST00000327928.4	+	4	766	c.766A>G	c.(766-768)Aaa>Gaa	p.K256E		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	256	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						AAAAGGACAGAAAGGTGAGGG	0.582																																					p.K256E		.											.	.	0			c.A766G						.						6.0	6.0	6.0					3																	161221062		1882	4058	5940	SO:0001583	missense	131149	exon4			GGACAGAAAGGTG		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.766A>G	3.37:g.161221062A>G	ENSP00000330808:p.Lys256Glu	4	0		4	4	NM_001080440	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.600002	0.46318	.	.	ENSG00000182447	ENST00000327928	D	0.93247	-3.19	4.79	3.6	0.41247	.	0.260709	0.36519	N	0.002555	D	0.93713	0.7991	M	0.74546	2.27	0.09310	N	1	D	0.53619	0.961	P	0.52957	0.714	D	0.86251	0.1649	10	0.22109	T	0.4	.	10.4489	0.44509	0.836:0.164:0.0:0.0	.	256	A6NHN0	OTOL1_HUMAN	E	256	ENSP00000330808:K256E	ENSP00000330808:K256E	K	+	1	0	OTOL1	162703756	0.044000	0.20184	0.039000	0.18376	0.750000	0.42670	2.908000	0.48750	0.649000	0.30751	0.455000	0.32223	AAA	.		0.582	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
OTOP1	133060	hgsc.bcm.edu	37	4	4228410	4228410	+	Missense_Mutation	SNP	A	A	G	rs201691469		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr4:4228410A>G	ENST00000296358.4	-	1	206	c.182T>C	c.(181-183)cTg>cCg	p.L61P		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	61					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTGGCTGCTCAGCATCTCGGC	0.726																																					p.L61P		.											.	OTOP1-92	0			c.T182C						.						9.0	10.0	9.0					4																	4228410		2137	4171	6308	SO:0001583	missense	133060	exon1			CTGCTCAGCATCT	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.182T>C	4.37:g.4228410A>G	ENSP00000296358:p.Leu61Pro	31	0		29	2	NM_177998	0	0	0	0	0	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095183	0.56075	.	.	ENSG00000163982	ENST00000296358	T	0.17691	2.26	4.08	1.58	0.23477	.	0.182461	0.36628	U	0.002487	T	0.23289	0.0563	L	0.39245	1.2	0.80722	D	1	D	0.64830	0.994	P	0.60789	0.879	T	0.01720	-1.1288	10	0.87932	D	0	.	6.1537	0.20326	0.749:0.1634:0.0876:0.0	.	61	Q7RTM1	OTOP1_HUMAN	P	61	ENSP00000296358:L61P	ENSP00000296358:L61P	L	-	2	0	OTOP1	4279311	1.000000	0.71417	0.999000	0.59377	0.643000	0.38383	3.369000	0.52365	0.426000	0.26116	0.352000	0.21897	CTG	A|0.993;G|0.007		0.726	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
JMY	133746	hgsc.bcm.edu	37	5	78610479	78610479	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr5:78610479C>A	ENST00000396137.4	+	9	2926	c.2464C>A	c.(2464-2466)Cca>Aca	p.P822T	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	822	Pro-rich.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ccctcccccaccaccaccacc	0.542																																					p.P822T		.											.	JMY-227	0			c.C2464A						.																																			SO:0001583	missense	133746	exon9			CCCCCACCACCAC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2464C>A	5.37:g.78610479C>A	ENSP00000379441:p.Pro822Thr	24	1		21	3	NM_152405	0	0	1	1	0	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639613	0.29157	.	.	ENSG00000152409	ENST00000396137	D	0.89681	-2.55	4.69	3.8	0.43715	.	0.692508	0.13482	N	0.384606	D	0.93400	0.7895	M	0.70275	2.135	0.45837	D	0.998707	D	0.89917	1.0	D	0.91635	0.999	D	0.90329	0.4350	10	0.29301	T	0.29	.	14.3113	0.66416	0.0:0.8498:0.1502:0.0	.	822	Q8N9B5	JMY_HUMAN	T	822	ENSP00000379441:P822T	ENSP00000379441:P822T	P	+	1	0	JMY	78646235	1.000000	0.71417	0.009000	0.14445	0.106000	0.19336	4.961000	0.63681	0.930000	0.37217	0.650000	0.86243	CCA	.		0.542	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
EBF1	1879	bcgsc.ca	37	5	158158101	158158101	+	Silent	SNP	A	A	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr5:158158101A>G	ENST00000313708.6	-	11	1383	c.1101T>C	c.(1099-1101)ccT>ccC	p.P367P	EBF1_ENST00000380654.4_Silent_p.P336P|EBF1_ENST00000517373.1_Silent_p.P359P|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	367					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGGTCACCAGGGTGCCGAG	0.438			T	HMGA2	lipoma																																p.P367P				Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	EBF1-92	0			c.T1101C						.						68.0	68.0	68.0					5																	158158101		2203	4300	6503	SO:0001819	synonymous_variant	1879	exon11			GTCACCAGGGTGC	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1101T>C	5.37:g.158158101A>G		38	0		63	4	NM_024007	0	0	0	0	0	Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1																																																																																			.		0.438	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
ABCC10	89845	broad.mit.edu	37	6	43412937	43412937	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr6:43412937C>T	ENST00000372530.4	+	14	3130	c.2915C>T	c.(2914-2916)gCg>gTg	p.A972V	ABCC10_ENST00000244533.3_Missense_Mutation_p.A944V	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	972	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	ACCGTGTATGCGACCATTGCT	0.607																																					p.A972V													.	ABCC10-96	0			c.C2915T						.						130.0	100.0	110.0					6																	43412937		2203	4300	6503	SO:0001583	missense	89845	exon14			TGTATGCGACCAT	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2915C>T	6.37:g.43412937C>T	ENSP00000361608:p.Ala972Val	98	0		92	4	NM_001198934	0	0	12	12	0	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775586	0.70107	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.89196	-2.48;-2.48	4.56	3.65	0.41850	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.261486	0.36409	N	0.002602	T	0.78780	0.4337	L	0.44542	1.39	0.39035	D	0.960021	P;P	0.52316	0.936;0.952	B;B	0.42462	0.388;0.348	T	0.79001	-0.1981	10	0.36615	T	0.2	-11.8221	11.6154	0.51086	0.0:0.5948:0.4051:0.0	.	944;972	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	V	972;944	ENSP00000361608:A972V;ENSP00000244533:A944V	ENSP00000244533:A944V	A	+	2	0	ABCC10	43520915	1.000000	0.71417	0.719000	0.30619	0.914000	0.54420	3.693000	0.54735	2.359000	0.80004	0.462000	0.41574	GCG	.		0.607	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
WASF1	8936	hgsc.bcm.edu	37	6	110424747	110424747	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr6:110424747C>A	ENST00000392589.1	-	9	1563	c.727G>T	c.(727-729)Gtg>Ttg	p.V243L	WASF1_ENST00000392588.1_Missense_Mutation_p.V243L|WASF1_ENST00000359451.2_Missense_Mutation_p.V243L|WASF1_ENST00000392587.2_Missense_Mutation_p.V243L|WASF1_ENST00000392586.1_Missense_Mutation_p.V243L	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	243					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		ATATGATCCACGTATGTCTGA	0.358																																					p.V243L		.											.	WASF1-90	0			c.G727T						.						100.0	92.0	95.0					6																	110424747		2203	4300	6503	SO:0001583	missense	8936	exon8			GATCCACGTATGT	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.727G>T	6.37:g.110424747C>A	ENSP00000376368:p.Val243Leu	99	0		70	4	NM_001024935	0	0	1	1	0	E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	37	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612405	0.46631	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.51	5.51	0.81932	.	0.213000	0.48286	D	0.000185	T	0.12263	0.0298	N	0.08118	0	0.34639	D	0.720416	B	0.14012	0.009	B	0.09377	0.004	T	0.07366	-1.0776	10	0.10902	T	0.67	.	19.7791	0.96410	0.0:1.0:0.0:0.0	.	243	Q92558	WASF1_HUMAN	L	243	ENSP00000376365:V243L;ENSP00000376366:V243L;ENSP00000376368:V243L;ENSP00000376367:V243L;ENSP00000352425:V243L	ENSP00000352425:V243L	V	-	1	0	WASF1	110531440	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.456000	0.60081	2.763000	0.94921	0.650000	0.86243	GTG	.		0.358	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	121681010	121681010	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr7:121681010G>A	ENST00000393386.2	+	21	6189	c.5778G>A	c.(5776-5778)gtG>gtA	p.V1926V	PTPRZ1_ENST00000449182.1_Silent_p.V1059V	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1926	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GCCATGCAGTGGGGCCTGTTG	0.498																																					p.V1926V		.											.	PTPRZ1-699	0			c.G5778A						.						74.0	66.0	69.0					7																	121681010		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon21			TGCAGTGGGGCCT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5778G>A	7.37:g.121681010G>A		118	0		108	18	NM_002851	0	0	0	0	0	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			.		0.498	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
MTBP	27085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	121518998	121518998	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr8:121518998C>T	ENST00000305949.1	+	16	1825	c.1780C>T	c.(1780-1782)Cct>Tct	p.P594S		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	594	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			CAAAGAGGGTCCTCGGGACTC	0.398																																					p.P594S		.											.	MTBP-228	0			c.C1780T						.						83.0	79.0	80.0					8																	121518998		2203	4300	6503	SO:0001583	missense	27085	exon16			GAGGGTCCTCGGG		CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.1780C>T	8.37:g.121518998C>T	ENSP00000303398:p.Pro594Ser	87	0		84	6	NM_022045	0	0	4	4	0	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.586138	0.28268	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.44	4.55	0.56014	.	0.197586	0.44902	D	0.000417	T	0.49047	0.1534	L	0.60455	1.87	0.32183	N	0.58014	P	0.38078	0.617	B	0.33960	0.173	T	0.61978	-0.6951	9	0.46703	T	0.11	-8.4215	15.931	0.79659	0.0:0.8506:0.1494:0.0	.	594	Q96DY7	MTBP_HUMAN	S	594	.	ENSP00000303398:P594S	P	+	1	0	MTBP	121588179	1.000000	0.71417	0.997000	0.53966	0.864000	0.49448	2.735000	0.47377	1.267000	0.44247	0.563000	0.77884	CCT	.		0.398	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	
SLC35D2	11046	hgsc.bcm.edu	37	9	99122448	99122448	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr9:99122448G>C	ENST00000253270.7	-	4	397	c.335C>G	c.(334-336)aCa>aGa	p.T112R	SLC35D2_ENST00000375259.4_Missense_Mutation_p.T112R|SLC35D2_ENST00000375257.1_Missense_Mutation_p.T112R|SLC35D2_ENST00000482643.1_5'UTR	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2	112					carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)			endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				TAATTTACTTGTGCTTGATAA	0.383																																					p.T112R		.											.	SLC35D2-90	0			c.C335G						.						114.0	102.0	106.0					9																	99122448		2203	4300	6503	SO:0001583	missense	11046	exon4			TTACTTGTGCTTG	AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.335C>G	9.37:g.99122448G>C	ENSP00000253270:p.Thr112Arg	39	0		40	2	NM_007001	0	0	1	1	0	O95454|Q498C1|Q75W21|Q7Z5X5	Missense_Mutation	SNP	ENST00000253270.7	37	CCDS6717.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955964	0.73902	.	.	ENSG00000130958	ENST00000253270;ENST00000375259;ENST00000375257	T;T;T	0.65549	0.48;-0.16;-0.15	4.81	4.81	0.61882	.	0.338511	0.29529	N	0.011888	T	0.80243	0.4587	M	0.82823	2.61	0.48901	D	0.999722	D;D	0.76494	0.999;0.991	D;D	0.83275	0.996;0.954	T	0.83281	-0.0038	10	0.87932	D	0	.	14.9045	0.70709	0.0:0.0:1.0:0.0	.	112;112	Q76EJ3-2;Q76EJ3	.;S35D2_HUMAN	R	112	ENSP00000253270:T112R;ENSP00000364408:T112R;ENSP00000364406:T112R	ENSP00000253270:T112R	T	-	2	0	SLC35D2	98162269	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.627000	0.61276	2.502000	0.84385	0.655000	0.94253	ACA	.		0.383	SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053261.1		
SHROOM4	57477	hgsc.bcm.edu	37	X	50350698	50350698	+	Silent	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chrX:50350698C>T	ENST00000289292.7	-	6	3727	c.3444G>A	c.(3442-3444)gaG>gaA	p.E1148E	SHROOM4_ENST00000376020.2_Silent_p.E1148E|SHROOM4_ENST00000460112.3_Silent_p.E1032E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1148	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctcctcctcctcctcttcct	0.557													C|||	1	0.000264901	0.0	0.0014	3775	,	,		12007	0.0		0.0	False		,,,				2504	0.0				p.E1148E		.											.	SHROOM4-131	0			c.G3444A						.						22.0	20.0	21.0					X																	50350698		2203	4298	6501	SO:0001819	synonymous_variant	57477	exon6			CTCCTCCTCCTCT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3444G>A	X.37:g.50350698C>T		5	0		23	2	NM_020717	0	0	0	0	0	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.557	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
IRS4	8471	broad.mit.edu	37	X	107978243	107978243	+	Silent	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chrX:107978243C>T	ENST00000372129.2	-	1	1408	c.1332G>A	c.(1330-1332)cgG>cgA	p.R444R	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	444					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CTGCAGGGTGCCGGGGACGTG	0.617																																					p.R444R													.	IRS4-623	0			c.G1332A						.						65.0	63.0	64.0					X																	107978243		2203	4300	6503	SO:0001819	synonymous_variant	8471	exon1			AGGGTGCCGGGGA	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1332G>A	X.37:g.107978243C>T		194	0		197	5	NM_003604	0	0	0	0	0		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																			.		0.617	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
MYRF	745	broad.mit.edu;bcgsc.ca	37	11	61544792	61544798	+	Frame_Shift_Del	DEL	GGTGCCC	GGTGCCC	-			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	GGTGCCC	GGTGCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr11:61544792_61544798delGGTGCCC	ENST00000278836.5	+	12	1743_1749	c.1647_1653delGGTGCCC	c.(1645-1653)caggtgcccfs	p.QVP549fs	MYRF_ENST00000389602.4_5'Flank|MYRF_ENST00000265460.5_Frame_Shift_Del_p.QVP540fs|TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000327797.1_Frame_Shift_Del_p.QVP174fs	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	549					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGCGGGCACAGGTGCCCGACACCGTCT	0.647																																					p.549_551del													.	.	0			c.1647_1653del						.																																			SO:0001589	frameshift_variant	745	exon12			GGCACAGGTGCCC		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1647_1653delGGTGCCC	11.37:g.61544792_61544798delGGTGCCC	ENSP00000278836:p.Gln549fs	78	0		60	6	NM_001127392	0	0	0	0	0	O43582|Q9P1Q6	Frame_Shift_Del	DEL	ENST00000278836.5	37	CCDS44622.1																																																																																			.		0.647	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
CDH10	1008	broad.mit.edu	37	5	24492973	24492973	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr5:24492973delA	ENST00000264463.4	-	10	2084	c.1577delT	c.(1576-1578)ttcfs	p.F526fs	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AGCTAAACTGAAAAAAAATTT	0.313										HNSCC(23;0.051)																											p.F526fs													.	CDH10-253	0			c.1577delT						.						170.0	183.0	179.0					5																	24492973		2203	4298	6501	SO:0001589	frameshift_variant	1008	exon10			AAACTGAAAAAAA	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1577delT	5.37:g.24492973delA	ENSP00000264463:p.Phe526fs	351	0		348	7	NM_006727	0	0	0	0	0	Q9ULB3	Frame_Shift_Del	DEL	ENST00000264463.4	37	CCDS3892.1																																																																																			.		0.313	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
