#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS6	11174	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	64510620	64510620	+	IGR	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr5:64510620C>T								ADAMTS6 (16028 upstream) : ADAMTS6 (82414 downstream)																							GGGCATCTTACCTCCAGCACA	0.443																																																	0													122.0	107.0	112.0					5																	64510620		2203	4300	6503	SO:0001628	intergenic_variant	11174																															5.37:g.64510620C>T				Splice_Site	SNP		37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.48|17.48	3.400966|3.400966	0.62177|0.62177	.|.	.|.	ENSG00000049192|ENSG00000049192	ENST00000381055|ENST00000261306;ENST00000464680	.|T	.|0.29917	.|1.55	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	.|.	.|.	.|.	.|.	.|T	.|0.59528	.|0.2200	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.62671	.|-0.6805	.|8	.|0.72032	.|D	.|0.01	.|.	19.037|19.037	0.92983|0.92983	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|859	.|D6R9L6	.|.	.|D	-1|809;859	.|ENSP00000423551:G859D	.|ENSP00000261306:G809D	.|G	-|-	.|2	.|0	ADAMTS6|ADAMTS6	64546376|64546376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.320000|7.320000	0.79064|0.79064	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	.|GGT	0	0.443									
ADCY9	115	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4043480	4043480	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:4043480G>T	ENST00000294016.3	-	4	2454	c.1916C>A	c.(1915-1917)cCc>cAc	p.P639H	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	639					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TTCAGATTTGGGAGCAAATGT	0.542																																																	0													128.0	122.0	124.0					16																	4043480		2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1916C>A	16.37:g.4043480G>T	ENSP00000294016:p.Pro639His		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937252	0.73557	.	.	ENSG00000162104	ENST00000294016	D	0.82803	-1.65	5.36	5.36	0.76844	.	0.202033	0.42294	D	0.000735	T	0.80188	0.4577	L	0.36672	1.1	0.39811	D	0.972703	P	0.51351	0.944	P	0.48189	0.57	T	0.77088	-0.2717	10	0.14656	T	0.56	.	17.2861	0.87142	0.0:0.0:1.0:0.0	.	639	O60503	ADCY9_HUMAN	H	639	ENSP00000294016:P639H	ENSP00000294016:P639H	P	-	2	0	ADCY9	3983481	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.119000	0.64679	2.514000	0.84764	0.544000	0.68410	CCC		0.542	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			
ADCY9	115	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4043482	4043482	+	Silent	SNP	A	A	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:4043482A>T	ENST00000294016.3	-	4	2452	c.1914T>A	c.(1912-1914)gcT>gcA	p.A638A	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	638					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CAGATTTGGGAGCAAATGTGA	0.547																																																	0													130.0	123.0	126.0					16																	4043482		2197	4300	6497	SO:0001819	synonymous_variant	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1914T>A	16.37:g.4043482A>T			A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	37	CCDS32382.1																																																																																				0.547	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			
AGAP6	414189	hgsc.bcm.edu	37	10	51748682	51748682	+	Frame_Shift_Del	DEL	C	C	-	rs575835505	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr10:51748682delC	ENST00000374056.4	+	1	605	c.207delC	c.(205-207)gacfs	p.D69fs	AGAP6_ENST00000412531.3_Frame_Shift_Del_p.D69fs			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	69					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						ACGTTCGTGACCGGGAGATGC	0.592													cc|CC|C|deletion	315	0.0628994	0.1316	0.0231	5008	,	,		19596	0.0248		0.0527	False		,,,				2504	0.0481																0																																										SO:0001589	frameshift_variant	414189				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.207delC	10.37:g.51748682delC	ENSP00000363168:p.Asp69fs			Frame_Shift_Del	DEL	ENST00000374056.4	37																																																																																					0.592	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001077665	
AP1G1	164	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	71789925	71789925	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:71789925T>C	ENST00000299980.4	-	12	1667	c.1226A>G	c.(1225-1227)gAa>gGa	p.E409G	AP1G1_ENST00000569748.1_Missense_Mutation_p.E409G|AP1G1_ENST00000393512.3_Missense_Mutation_p.E412G|AP1G1_ENST00000433195.2_Missense_Mutation_p.E432G|AP1G1_ENST00000423132.2_Missense_Mutation_p.E412G|SNORD71_ENST00000411292.1_RNA	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	409					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				ATCTTACTTTTCTGCAGCAAG	0.408																																																	0													94.0	102.0	100.0					16																	71789925		2198	4300	6498	SO:0001583	missense	164			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.1226A>G	16.37:g.71789925T>C	ENSP00000299980:p.Glu409Gly		O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.974873	0.74360	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000425422	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.22	5.22	0.72569	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.100193	0.64402	D	0.000002	T	0.49677	0.1571	M	0.89095	3.005	0.80722	D	1	B;P;B	0.34662	0.295;0.462;0.444	B;B;B	0.42087	0.375;0.375;0.209	T	0.57991	-0.7715	10	0.66056	D	0.02	.	15.0846	0.72142	0.0:0.0:0.0:1.0	.	409;432;412	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	G	409;412;412;432;494	ENSP00000299980:E409G;ENSP00000377148:E412G;ENSP00000409153:E412G;ENSP00000403259:E432G	ENSP00000299980:E409G	E	-	2	0	AP1G1	70347426	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.665000	0.83852	1.958000	0.56883	0.433000	0.28618	GAA		0.408	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1			
PHF7	51533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52443568	52443568	+	5'Flank	SNP	A	A	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr3:52443568A>G	ENST00000327906.3	+	0	0				BAP1_ENST00000296288.5_Splice_Site|PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Splice_Site	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.?(2)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		ACAGCCACTCACCCCTGACAT	0.577																																																	2	Unknown(2)	kidney(1)|pleura(1)											211.0	221.0	218.0					3																	52443568		2203	4300	6503	SO:0001631	upstream_gene_variant	8314			AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52443568A>G	Exception_encountered		K4DI82	Splice_Site	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293528	0.80914	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3639	0.66792	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BAP1	52418608	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	9.090000	0.94144	1.809000	0.52856	0.533000	0.62120	.		0.577	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1		NM_016483	
BDP1	55814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	70808132	70808132	+	Missense_Mutation	SNP	A	A	G	rs551127646	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr5:70808132A>G	ENST00000358731.4	+	18	4387	c.4124A>G	c.(4123-4125)aAa>aGa	p.K1375R	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1375					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AATTCTGAAAAAGAAGTATCA	0.363																																																	0													89.0	88.0	88.0					5																	70808132		1810	4070	5880	SO:0001583	missense	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.4124A>G	5.37:g.70808132A>G	ENSP00000351575:p.Lys1375Arg		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659537	0.67586	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.12465	2.68	4.64	4.64	0.57946	.	0.286563	0.25109	N	0.033066	T	0.25680	0.0625	M	0.71581	2.175	0.80722	D	1	D;D	0.57257	0.979;0.974	P;P	0.52189	0.558;0.692	T	0.01935	-1.1244	10	0.66056	D	0.02	.	10.7636	0.46279	1.0:0.0:0.0:0.0	.	1375;1375	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	R	1375;955	ENSP00000351575:K1375R	ENSP00000351575:K1375R	K	+	2	0	BDP1	70843888	1.000000	0.71417	0.301000	0.25044	0.032000	0.12392	1.189000	0.32114	1.854000	0.53819	0.533000	0.62120	AAA		0.363	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2		NM_018429	
SPX	80763	broad.mit.edu;ucsc.edu	37	12	21679901	21679901	+	Splice_Site	SNP	G	G	T	rs200909527		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:21679901G>T	ENST00000256969.2	+	2	253		c.e2+1			NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN							long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CGCTCCGCAGGTAATCAAATG	0.413																																																	0													108.0	110.0	109.0					12																	21679901		2203	4300	6503	SO:0001630	splice_region_variant	80763																														ENST00000256969.2:c.87+1G>T	12.37:g.21679901G>T			B3KND6	Splice_Site	SNP	ENST00000256969.2	37	CCDS31757.1	.	.	.	.	.	.	.	.	.	.	G	9.813	1.183764	0.21870	.	.	ENSG00000134548	ENST00000256969	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5994	0.62010	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C12orf39	21571168	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	4.862000	0.62976	2.656000	0.90262	0.591000	0.81541	.		0.413	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402389.1			Intron
CA7	766	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	66887326	66887326	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:66887326G>T	ENST00000338437.2	+	7	829	c.720G>T	c.(718-720)agG>agT	p.R240S	CA7_ENST00000394069.3_Missense_Mutation_p.R184S|RP11-61A14.1_ENST00000551187.1_RNA	NM_005182.2	NP_005173.1	P43166	CAH7_HUMAN	carbonic anhydrase VII	240					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of chloride transport (GO:2001225)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.R240R(1)		kidney(1)|large_intestine(1)|lung(4)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)	Acetazolamide(DB00819)|Diclofenamide(DB01144)|Methazolamide(DB00703)|Zonisamide(DB00909)	ACGATGAGAGGATCCACATGG	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											71.0	63.0	66.0					16																	66887326		2200	4300	6500	SO:0001583	missense	766				CCDS10821.1, CCDS42173.1	16q22.1	2008-02-05			ENSG00000168748	ENSG00000168748	4.2.1.1	"""Carbonic anhydrases"""	1381	protein-coding gene	gene with protein product		114770				1783392	Standard	XM_005256135		Approved		uc002eqi.3	P43166	OTTHUMG00000137524	ENST00000338437.2:c.720G>T	16.37:g.66887326G>T	ENSP00000345659:p.Arg240Ser		Q541F0|Q86YU0	Missense_Mutation	SNP	ENST00000338437.2	37	CCDS10821.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672546	0.29693	.	.	ENSG00000168748	ENST00000338437;ENST00000394069	T;T	0.62364	0.03;0.03	5.18	4.22	0.49857	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.076000	0.50627	D	0.000117	T	0.45155	0.1328	N	0.10874	0.06	0.49051	D	0.999747	P	0.34977	0.478	B	0.40940	0.344	T	0.49123	-0.8972	10	0.62326	D	0.03	-0.4708	7.9844	0.30202	0.0821:0.0:0.7601:0.1578	.	240	P43166	CAH7_HUMAN	S	240;184	ENSP00000345659:R240S;ENSP00000377632:R184S	ENSP00000345659:R240S	R	+	3	2	CA7	65444827	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	4.192000	0.58378	1.320000	0.45209	0.561000	0.74099	AGG		0.602	CA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268847.1			
CAPN9	10753	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	230910375	230910375	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:230910375C>A	ENST00000271971.2	+	8	1064	c.951C>A	c.(949-951)ttC>ttA	p.F317L	RP11-99J16__A.2_ENST00000452640.1_RNA|RP11-99J16__A.2_ENST00000428480.1_RNA|CAPN9_ENST00000366666.2_Missense_Mutation_p.F254L|CAPN9_ENST00000354537.1_Intron|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	317	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ATGGGGAATTCTGGTACCGTG	0.512																																																	0													199.0	160.0	173.0					1																	230910375		2203	4300	6503	SO:0001583	missense	10753			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.951C>A	1.37:g.230910375C>A	ENSP00000271971:p.Phe317Leu		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852237	0.91355	.	.	ENSG00000135773	ENST00000271971;ENST00000366666	T;T	0.35048	1.33;1.33	4.88	4.88	0.63580	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.75354	0.3838	H	0.98068	4.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.86109	0.1561	10	0.87932	D	0	.	18.027	0.89272	0.0:1.0:0.0:0.0	.	254;317	E7ESS6;O14815	.;CAN9_HUMAN	L	317;254	ENSP00000271971:F317L;ENSP00000355626:F254L	ENSP00000271971:F317L	F	+	3	2	CAPN9	228976998	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.207000	0.51106	2.260000	0.74910	0.455000	0.32223	TTC		0.512	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1		NM_006615	
CCDC62	84660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	123307924	123307924	+	Silent	SNP	C	C	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:123307924C>A	ENST00000253079.6	+	12	2357	c.2013C>A	c.(2011-2013)gtC>gtA	p.V671V	CCDC62_ENST00000392440.2_Silent_p.V432V|CCDC62_ENST00000392441.4_Intron|CCDC62_ENST00000537566.1_Silent_p.V432V	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	671					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AGTCAGAGGTCCCAGAAGAGT	0.353																																																	0													93.0	99.0	97.0					12																	123307924		2203	4300	6503	SO:0001819	synonymous_variant	84660				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.2013C>A	12.37:g.123307924C>A			A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Silent	SNP	ENST00000253079.6	37	CCDS9238.1																																																																																				0.353	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1		NM_032573	
CCNF	899	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	2503516	2503516	+	Missense_Mutation	SNP	C	C	T	rs200908912		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:2503516C>T	ENST00000397066.4	+	15	1781	c.1693C>T	c.(1693-1695)Ccc>Tcc	p.P565S	RP11-715J22.4_ENST00000566085.1_lincRNA|RP11-715J22.3_ENST00000561653.1_RNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	565					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				CCTCAGCTCTCCCTCGGGGCG	0.607																																																	0													93.0	85.0	88.0					16																	2503516		2198	4300	6498	SO:0001583	missense	899			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1693C>T	16.37:g.2503516C>T	ENSP00000380256:p.Pro565Ser		B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221020	0.58560	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.34472	1.36	4.92	4.92	0.64577	.	0.049784	0.85682	D	0.000000	T	0.44808	0.1311	L	0.59436	1.845	0.80722	D	1	P	0.45044	0.849	P	0.47102	0.537	T	0.42616	-0.9441	10	0.48119	T	0.1	-27.1386	16.6901	0.85319	0.0:1.0:0.0:0.0	.	565	P41002	CCNF_HUMAN	S	565;480	ENSP00000380256:P565S	ENSP00000293968:P480S	P	+	1	0	CCNF	2443517	1.000000	0.71417	0.945000	0.38365	0.473000	0.32948	6.135000	0.71696	2.272000	0.75746	0.455000	0.32223	CCC		0.607	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1		NM_001761	
CNKSR1	10256	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	26513674	26513674	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:26513674G>A	ENST00000374253.5	+	15	1384	c.1345G>A	c.(1345-1347)Ggc>Agc	p.G449S	CNKSR1_ENST00000361530.6_Missense_Mutation_p.G442S|CNKSR1_ENST00000531191.1_Missense_Mutation_p.G184S	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	449	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGGCTGAGGGCCTCATCAA	0.532																																					NSCLC(180;1396 2109 28270 30756 34275)												0													90.0	96.0	94.0					1																	26513674		2203	4300	6503	SO:0001583	missense	10256			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1345G>A	1.37:g.26513674G>A	ENSP00000363371:p.Gly449Ser		B1AMW9|O95381	Missense_Mutation	SNP	ENST00000374253.5	37		.	.	.	.	.	.	.	.	.	.	G	33	5.240556	0.95240	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.20598	2.06;2.06;2.06	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.50752	0.1634	M	0.82193	2.58	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64237	0.923;0.923	T	0.56062	-0.8041	10	0.87932	D	0	-26.1337	19.5245	0.95199	0.0:0.0:1.0:0.0	.	449;442	Q969H4;Q53GM7	CNKR1_HUMAN;.	S	442;449;184	ENSP00000354609:G442S;ENSP00000363371:G449S;ENSP00000431817:G184S	ENSP00000354609:G442S	G	+	1	0	CNKSR1	26386261	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	8.595000	0.90840	2.608000	0.88229	0.655000	0.94253	GGC		0.532	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2		NM_006314	
CFHR2	3080	hgsc.bcm.edu;ucsc.edu	37	1	196918739	196918739	+	Silent	SNP	G	G	A	rs61746417	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:196918739G>A	ENST00000367415.5	+	2	313	c.213G>A	c.(211-213)acG>acA	p.T71T	CFHR2_ENST00000496448.1_Intron|CFHR2_ENST00000367421.3_Silent_p.T71T|CFHR2_ENST00000476712.2_Silent_p.T71T	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	71	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						CTCGCATAACGTGCGCAGAAG	0.398													g|||	165	0.0329473	0.121	0.0072	5008	,	,		18621	0.0		0.0	False		,,,				2504	0.0																0								A		471,3935		26,419,1758	101.0	88.0	92.0		213	-6.7	0.0	1	dbSNP_129	92	15,8585		0,15,4285	no	coding-synonymous	CFHR2	NM_005666.2		26,434,6043	AA,AG,GG		0.1744,10.69,3.7367		71/271	196918739	486,12520	2203	4300	6503	SO:0001819	synonymous_variant	3080			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.213G>A	1.37:g.196918739G>A			Q14310|Q5T9T1	Silent	SNP	ENST00000367415.5	37	CCDS30959.1																																																																																				0.398	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2		NM_005666	
COL21A1	81578	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	56035909	56035909	+	Nonsense_Mutation	SNP	G	G	A	rs202026963		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr6:56035909G>A	ENST00000244728.5	-	4	1055	c.658C>T	c.(658-660)Cga>Tga	p.R220*	COL21A1_ENST00000535941.1_Nonsense_Mutation_p.R220*|COL21A1_ENST00000370819.1_Nonsense_Mutation_p.R220*	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	220					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACTGGAATTCGTGTTGGACAG	0.318																																																	0								G	stop/ARG	0,3656		0,0,1828	79.0	74.0	76.0		658	-0.3	1.0	6		76	1,8155		0,1,4077	yes	stop-gained	COL21A1	NM_030820.3		0,1,5905	AA,AG,GG		0.0123,0.0,0.0085		220/958	56035909	1,11811	1828	4078	5906	SO:0001587	stop_gained	81578			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.658C>T	6.37:g.56035909G>A	ENSP00000244728:p.Arg220*		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Nonsense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	37	6.359240	0.97502	0.0	1.23E-4	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	.	.	.	4.47	-0.303	0.12792	.	0.000000	0.47455	D	0.000221	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	13.2817	0.60219	0.0:0.0:0.3111:0.6889	.	.	.	.	X	220	.	ENSP00000244728:R220X	R	-	1	2	COL21A1	56143868	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.111000	0.41883	0.273000	0.22049	0.585000	0.79938	CGA		0.318	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			
CWH43	80157	broad.mit.edu;hgsc.bcm.edu	37	4	49019269	49019269	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr4:49019269T>C	ENST00000226432.4	+	9	1373	c.1190T>C	c.(1189-1191)cTg>cCg	p.L397P	CWH43_ENST00000513409.1_Missense_Mutation_p.L370P	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	397					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TGTTTAGTTCTGTGGCTGCTT	0.363																																																	0													86.0	86.0	86.0					4																	49019269		2203	4300	6503	SO:0001583	missense	80157				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1190T>C	4.37:g.49019269T>C	ENSP00000226432:p.Leu397Pro		B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.431724	0.62844	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.53857	1.18;0.6	4.46	4.46	0.54185	.	0.397832	0.18219	N	0.147924	T	0.67002	0.2847	M	0.67953	2.075	0.80722	D	1	D	0.67145	0.996	D	0.65010	0.931	T	0.67114	-0.5752	9	.	.	.	.	12.434	0.55588	0.0:0.0:0.0:1.0	.	397	Q9H720	PG2IP_HUMAN	P	397;370	ENSP00000226432:L397P;ENSP00000422802:L370P	.	L	+	2	0	CWH43	48714026	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.321000	0.59209	2.012000	0.59069	0.477000	0.44152	CTG		0.363	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2		NM_025087	
DENND2D	79961	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	111741341	111741341	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:111741341C>A	ENST00000357640.4	-	3	496	c.267G>T	c.(265-267)caG>caT	p.Q89H	DENND2D_ENST00000369752.5_Missense_Mutation_p.Q86H|DENND2D_ENST00000473682.1_5'UTR|CHI3L2_ENST00000445067.2_5'Flank	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	89	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CCTCCTCCTGCTGACCCCGAA	0.552																																																	0													64.0	62.0	63.0					1																	111741341		2203	4300	6503	SO:0001583	missense	79961				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.267G>T	1.37:g.111741341C>A	ENSP00000350266:p.Gln89His		Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	37	CCDS831.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276005	0.59649	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.15603	2.41;2.42	5.93	-2.63	0.06133	uDENN (3);	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	M	0.72479	2.2	0.34747	D	0.731369	D;D	0.71674	0.998;0.998	D;D	0.71656	0.957;0.974	T	0.15093	-1.0449	10	0.29301	T	0.29	-17.7514	17.3921	0.87435	0.0:0.8277:0.0:0.1723	.	86;89	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	H	89;86	ENSP00000350266:Q89H;ENSP00000358767:Q86H	ENSP00000350266:Q89H	Q	-	3	2	DENND2D	111542864	0.973000	0.33851	0.951000	0.38953	0.987000	0.75469	0.149000	0.16243	-0.448000	0.07128	0.655000	0.94253	CAG		0.552	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1		NM_024901	
DTNB	1838	broad.mit.edu;ucsc.edu	37	2	25754451	25754451	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr2:25754451T>A	ENST00000406818.3	-	9	1141	c.892A>T	c.(892-894)Aag>Tag	p.K298*	DTNB_ENST00000545439.1_Nonsense_Mutation_p.K94*|DTNB_ENST00000496972.2_Nonsense_Mutation_p.K241*|DTNB_ENST00000405222.1_Nonsense_Mutation_p.K298*|DTNB_ENST00000407661.3_Nonsense_Mutation_p.K298*|DTNB_ENST00000404103.3_Nonsense_Mutation_p.K298*|DTNB_ENST00000407186.1_Nonsense_Mutation_p.K298*|DTNB_ENST00000407038.3_Nonsense_Mutation_p.K298*|DTNB_ENST00000288642.8_Nonsense_Mutation_p.K298*	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	298						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCTCAGCTTCTTTGCAGGA	0.408																																																	0													86.0	86.0	86.0					2																	25754451		1860	4094	5954	SO:0001587	stop_gained	1838			AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.892A>T	2.37:g.25754451T>A	ENSP00000384084:p.Lys298*		B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Nonsense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	T	40	8.352880	0.98774	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439;ENST00000535791	.	.	.	5.15	5.15	0.70609	.	0.136039	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-25.2419	12.9424	0.58352	0.0:0.0:0.0:1.0	.	.	.	.	X	241;298;298;298;298;298;298;298;94;151	.	ENSP00000288642:K298X	K	-	1	0	DTNB	25607955	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.890000	0.87313	1.930000	0.55929	0.383000	0.25322	AAG		0.408	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1		NM_033147	
ESRRA	2101	hgsc.bcm.edu	37	11	64083296	64083298	+	In_Frame_Del	DEL	GGG	GGG	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	GGG	GGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr11:64083296_64083298delGGG	ENST00000405666.1	+	7	1364_1366	c.1130_1132delGGG	c.(1129-1134)cgggcg>ccg	p.377_378RA>P	ESRRA_ENST00000000442.6_In_Frame_Del_p.377_378RA>P|PRDX5_ENST00000352435.4_5'Flank|PRDX5_ENST00000347941.4_5'Flank|PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_In_Frame_Del_p.376_377RA>P	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	377	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R377_A378>P(2)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GAGCGGCGGCGGGCGGGCAGGCT	0.69																																																	2	Complex - deletion inframe(2)	lung(2)								51,3601		5,41,1780						2.3	1.0			19	264,7542		4,256,3643	no	coding	ESRRA	NM_004451.3		9,297,5423	A1A1,A1R,RR		3.382,1.3965,2.7492				315,11143				SO:0001651	inframe_deletion	2101			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.1130_1132delGGG	11.37:g.64083296_64083298delGGG	ENSP00000384851:p.Arg377_Ala378delinsPro		Q14514	In_Frame_Del	DEL	ENST00000405666.1	37	CCDS41667.1																																																																																				0.690	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1		NM_004451	
FBXL13	222235	broad.mit.edu;hgsc.bcm.edu	37	7	102665656	102665656	+	Silent	SNP	A	A	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr7:102665656A>G	ENST00000313221.4	-	6	775	c.349T>C	c.(349-351)Ttg>Ctg	p.L117L	FBXL13_ENST00000379305.3_Silent_p.L117L|FBXL13_ENST00000456695.1_Silent_p.L117L|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000436908.1_Silent_p.L117L|FBXL13_ENST00000379306.3_Silent_p.L117L|FBXL13_ENST00000455112.2_Silent_p.L117L|FBXL13_ENST00000393772.2_Silent_p.L117L|FBXL13_ENST00000379308.3_Silent_p.L117L	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	117										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						CATTTTTTCAATTGAAGTTCA	0.338																																																	0													38.0	36.0	37.0					7																	102665656		2200	4297	6497	SO:0001819	synonymous_variant	222235			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.349T>C	7.37:g.102665656A>G			C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Silent	SNP	ENST00000313221.4	37	CCDS5726.1																																																																																				0.338	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1		NM_145032	
FREM3	166752	hgsc.bcm.edu;ucsc.edu	37	4	144618993	144618993	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr4:144618993A>G	ENST00000329798.5	-	1	2835	c.2836T>C	c.(2836-2838)Tct>Cct	p.S946P	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	946					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CTTCTGAGAGAGATCCTAGGA	0.428																																																	0													82.0	67.0	72.0					4																	144618993		692	1591	2283	SO:0001583	missense	166752			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.2836T>C	4.37:g.144618993A>G	ENSP00000332886:p.Ser946Pro			Missense_Mutation	SNP	ENST00000329798.5	37	CCDS54808.1	.	.	.	.	.	.	.	.	.	.	A	8.037	0.763038	0.15914	.	.	ENSG00000183090	ENST00000329798	T	0.25749	1.78	4.33	3.06	0.35304	.	0.340314	0.24583	N	0.037289	T	0.31638	0.0803	M	0.72894	2.215	0.33628	D	0.6057	.	.	.	.	.	.	T	0.42327	-0.9458	8	0.38643	T	0.18	-3.8949	3.3463	0.07136	0.6113:0.0:0.1126:0.2761	.	.	.	.	P	946	ENSP00000332886:S946P	ENSP00000332886:S946P	S	-	1	0	FREM3	144838443	0.000000	0.05858	0.108000	0.21378	0.130000	0.20726	0.305000	0.19254	1.809000	0.52856	0.533000	0.62120	TCT		0.428	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365391.1		XM_094074	
GPN1	11321	hgsc.bcm.edu;ucsc.edu	37	2	27861049	27861049	+	Intron	SNP	T	T	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr2:27861049T>A	ENST00000610189.1	+	8	531				GPN1_ENST00000264718.3_Intron|GPN1_ENST00000503738.1_Intron|GPN1_ENST00000458167.2_Intron|GPN1_ENST00000424214.1_Intron|GPN1_ENST00000407583.3_Intron|GPN1_ENST00000515877.1_Intron|GPN1_ENST00000461249.1_Intron	NM_007266.3	NP_009197.2			GPN-loop GTPase 1											endometrium(1)|large_intestine(1)|lung(12)	14						GTGCTTTTACTAATAACTTCT	0.358																																																	0													126.0	106.0	113.0					2																	27861049		2203	4298	6501	SO:0001627	intron_variant	11321			AB044661	CCDS1760.2, CCDS46248.1, CCDS46249.1, CCDS46250.1	2p23.3	2011-11-04	2008-04-30	2008-04-30	ENSG00000198522	ENSG00000198522		"""GPN-loop GTPases"""	17030	protein-coding gene	gene with protein product	"""RNA polymerase II associated protein 4"""	611479	"""XPA binding protein 1"", ""XPA binding protein 1, GTPase"""	XAB1		11058119, 11124703	Standard	NM_007266		Approved	NTPBP, MBDIN, ATPBD1A, RPAP4	uc010ymc.2	Q9HCN4	OTTHUMG00000097784	ENST00000610189.1:c.525-28T>A	2.37:g.27861049T>A				RNA	SNP	ENST00000610189.1	37																																																																																					0.358	GPN1-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473126.1		NM_007266	
GRM6	2916	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	178416292	178416292	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr5:178416292G>C	ENST00000517717.1	-	6	1165	c.1127C>G	c.(1126-1128)tCa>tGa	p.S376*	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Nonsense_Mutation_p.S376*			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	376					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GGAATCGTCTGACTGGGTACC	0.592																																																	0													80.0	77.0	78.0					5																	178416292		2203	4300	6503	SO:0001587	stop_gained	2916			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1127C>G	5.37:g.178416292G>C	ENSP00000430767:p.Ser376*			Nonsense_Mutation	SNP	ENST00000517717.1	37	CCDS4442.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118849	0.77323	.	.	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	.	.	.	5.14	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	11.7441	0.51809	0.0:0.0:0.6825:0.3175	.	.	.	.	X	408;376;376	.	ENSP00000231188:S376X	S	-	2	0	GRM6	178348898	0.000000	0.05858	0.018000	0.16275	0.006000	0.05464	0.138000	0.16016	1.268000	0.44264	0.655000	0.94253	TCA		0.592	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2			
HBZ	3050	hgsc.bcm.edu	37	16	203950	203951	+	Frame_Shift_Ins	INS	-	-	GTCC			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr16:203950_203951insGTCC	ENST00000252951.2	+	2	378_379	c.155_156insGTCC	c.(154-159)gggtccfs	p.-53fs	HBM_ENST00000472539.1_3'UTR	NM_005332.2	NP_005323.1	P02008	HBAZ_HUMAN	hemoglobin, zeta						erythrocyte maturation (GO:0043249)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)						all_cancers(16;4.28e-07)|all_epithelial(16;2.09e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				CTGCACCCGGGGTCCGCGCAGT	0.723																																																	0																																										SO:0001589	frameshift_variant	3050			M24173	CCDS10397.1	16p13.3	2014-05-19			ENSG00000130656	ENSG00000130656			4835	protein-coding gene	gene with protein product		142310				2649166	Standard	XM_005255287		Approved	HBZ1, HBZ-T1	uc002cft.1	P02008	OTTHUMG00000059928	ENST00000252951.2:c.156_159dupGTCC	16.37:g.203951_203954dupGTCC	ENSP00000252951:p.Ser53fs		Q6IBF6	Frame_Shift_Ins	INS	ENST00000252951.2	37	CCDS10397.1																																																																																				0.723	HBZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133205.1		NM_005332	
HNRNPC	3183	broad.mit.edu;hgsc.bcm.edu	37	14	21699200	21699200	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr14:21699200G>T	ENST00000320084.7	-	3	512	c.273C>A	c.(271-273)aaC>aaA	p.N91K	HNRNPC_ENST00000556513.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000554969.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000553300.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000557201.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000553753.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000556628.1_Intron|HNRNPC_ENST00000555883.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000430246.2_Missense_Mutation_p.N91K|HNRNPC_ENST00000556142.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000556897.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000555914.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000554455.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000449098.1_Missense_Mutation_p.N91K|HNRNPC_ENST00000420743.2_Missense_Mutation_p.N91K|HNRNPC_ENST00000336053.6_Missense_Mutation_p.N91K|HNRNPC_ENST00000555309.1_Missense_Mutation_p.N91K	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	91					3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CTTTTCCTCGGTTCACTTTTG	0.413																																					NSCLC(108;607 2244 12726 38757)												0													93.0	96.0	95.0					14																	21699200		2201	4298	6499	SO:0001583	missense	3183				CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.273C>A	14.37:g.21699200G>T	ENSP00000319690:p.Asn91Lys		D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	37	CCDS41915.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923505	0.52653	.	.	ENSG00000092199	ENST00000336053;ENST00000320084;ENST00000449098;ENST00000554969;ENST00000556142;ENST00000554455;ENST00000430246;ENST00000553753;ENST00000555914;ENST00000555309;ENST00000452166;ENST00000555883;ENST00000556513;ENST00000557201;ENST00000553300;ENST00000556897;ENST00000420743;ENST00000557157;ENST00000445284;ENST00000554383;ENST00000555215;ENST00000555137;ENST00000554891;ENST00000556226;ENST00000555176	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;2.68;1.07;1.07;1.07;1.07;1.07;1.07	5.88	3.09	0.35607	Nucleotide-binding, alpha-beta plait (1);	0.163970	0.36854	U	0.002369	T	0.41581	0.1165	M	0.64404	1.975	0.42341	D	0.992332	B;B;B;B;B	0.22851	0.021;0.001;0.076;0.009;0.001	B;B;B;B;B	0.29267	0.017;0.005;0.1;0.027;0.009	T	0.34477	-0.9827	10	0.72032	D	0.01	.	10.1977	0.43065	0.218:0.0:0.782:0.0	.	91;91;91;91;91	B4DY08;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;HNRPC_HUMAN;.	K	91;91;91;91;91;91;91;91;91;91;91;91;91;91;91;91;91;12;91;91;91;91;91;91;91	ENSP00000338095:N91K;ENSP00000319690:N91K;ENSP00000404559:N91K;ENSP00000450725:N91K;ENSP00000451187:N91K;ENSP00000451291:N91K;ENSP00000442816:N91K;ENSP00000450548:N91K;ENSP00000451708:N91K;ENSP00000450790:N91K;ENSP00000450629:N91K;ENSP00000452214:N91K;ENSP00000452276:N91K;ENSP00000450544:N91K;ENSP00000451176:N91K;ENSP00000404848:N91K;ENSP00000450601:N12K;ENSP00000452021:N91K;ENSP00000452213:N91K;ENSP00000452185:N91K;ENSP00000450467:N91K;ENSP00000451292:N91K;ENSP00000452573:N91K	ENSP00000319690:N91K	N	-	3	2	HNRNPC	20769040	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.709000	0.54853	0.404000	0.25506	-0.218000	0.12543	AAC		0.413	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1			
IL19	29949	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	207014376	207014376	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:207014376C>T	ENST00000270218.6	+	6	1330	c.391C>T	c.(391-393)Cag>Tag	p.Q131*	IL19_ENST00000340758.2_Nonsense_Mutation_p.Q169*	NM_013371.3	NP_037503.2	Q9UHD0	IL19_HUMAN	interleukin 19	131					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			TCACTGCAGGCAGGAAGCCAC	0.522																																																	0													122.0	92.0	102.0					1																	207014376		2203	4300	6503	SO:0001587	stop_gained	29949			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000270218.6:c.391C>T	1.37:g.207014376C>T	ENSP00000270218:p.Gln131*		B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Nonsense_Mutation	SNP	ENST00000270218.6	37	CCDS1469.1	.	.	.	.	.	.	.	.	.	.	C	43	10.372598	0.99393	.	.	ENSG00000142224	ENST00000340758;ENST00000270218	.	.	.	5.71	0.398	0.16319	.	0.569373	0.19426	N	0.114573	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	12.681	0.56922	0.1036:0.1947:0.7017:0.0	.	.	.	.	X	169;131	.	ENSP00000270218:Q131X	Q	+	1	0	IL19	205080999	0.625000	0.27111	0.955000	0.39395	0.909000	0.53808	0.119000	0.15626	0.030000	0.15379	0.591000	0.81541	CAG		0.522	IL19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088567.2		NM_153758	
ITPR3	3710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33657132	33657132	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr6:33657132G>A	ENST00000374316.5	+	51	7872	c.6812G>A	c.(6811-6813)cGc>cAc	p.R2271H	ITPR3_ENST00000605930.1_Missense_Mutation_p.R2271H			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2271					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CTCATCCTGCGCTCCATCTAC	0.582																																																	0													108.0	92.0	97.0					6																	33657132		2203	4300	6503	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6812G>A	6.37:g.33657132G>A	ENSP00000363435:p.Arg2271His		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	35	5.495365	0.96355	.	.	ENSG00000096433	ENST00000374316	D	0.92699	-3.09	5.07	5.07	0.68467	.	0.053033	0.64402	D	0.000003	D	0.96204	0.8762	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.95	D	0.96347	0.9255	10	0.72032	D	0.01	-30.6562	18.6371	0.91383	0.0:0.0:1.0:0.0	.	2271;1941	Q14573;Q59ES2	ITPR3_HUMAN;.	H	2271	ENSP00000363435:R2271H	ENSP00000363435:R2271H	R	+	2	0	ITPR3	33765110	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.263000	0.95617	2.653000	0.90120	0.561000	0.74099	CGC		0.582	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2		NM_002224	
KIAA1210	57481	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	118219357	118219357	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chrX:118219357G>T	ENST00000402510.2	-	12	4836	c.4837C>A	c.(4837-4839)Cct>Act	p.P1613T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1613										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCATATTTAGGCTCCTTAGTC	0.448																																																	0													156.0	144.0	148.0					X																	118219357		1887	4106	5993	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4837C>A	X.37:g.118219357G>T	ENSP00000384670:p.Pro1613Thr		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.76|16.76	3.213001|3.213001	0.58452|0.58452	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.13538	.|2.58	4.21|4.21	2.41|2.41	0.29592|0.29592	.|.	.|.	.|.	.|.	.|.	T|T	0.28665|0.28665	0.0710|0.0710	M|M	0.72894|0.72894	2.215|2.215	0.09310|0.09310	N|N	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.69479	.|0.964	T|T	0.09079|0.09079	-1.0691|-1.0691	5|9	.|0.29301	.|T	.|0.29	.|.	5.913|5.913	0.19039|0.19039	0.2433:0.0:0.7567:0.0|0.2433:0.0:0.7567:0.0	.|.	.|1613	.|Q9ULL0	.|K1210_HUMAN	D|T	1019|1613	.|ENSP00000384670:P1613T	.|ENSP00000384670:P1613T	A|P	-|-	2|1	0|0	KIAA1210|RP13-347D8.6	118103385|118103385	0.001000|0.001000	0.12720|0.12720	0.011000|0.011000	0.14972|0.14972	0.804000|0.804000	0.45430|0.45430	-0.115000|-0.115000	0.10741|0.10741	0.523000|0.523000	0.28482|0.28482	0.513000|0.513000	0.50165|0.50165	GCC|CCT		0.448	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2		NM_020721	
KIFAP3	22920	hgsc.bcm.edu;ucsc.edu	37	1	170003574	170003574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:170003574delA	ENST00000361580.2	-	7	908	c.681delT	c.(679-681)attfs	p.I227fs	KIFAP3_ENST00000538366.1_Frame_Shift_Del_p.I149fs|KIFAP3_ENST00000367765.1_Frame_Shift_Del_p.I187fs|KIFAP3_ENST00000490550.1_5'Flank|KIFAP3_ENST00000367767.1_Frame_Shift_Del_p.I183fs	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	227					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ACTCATGATCAATAATATTCA	0.303																																																	0													86.0	85.0	85.0					1																	170003574		2202	4300	6502	SO:0001589	frameshift_variant	22920			U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.681delT	1.37:g.170003574delA	ENSP00000354560:p.Ile227fs		B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Frame_Shift_Del	DEL	ENST00000361580.2	37	CCDS1288.1																																																																																				0.303	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1		NM_014970	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197609	39197609	+	Missense_Mutation	SNP	C	C	A	rs138200823	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:39197609C>A	ENST00000306271.4	-	1	104	c.41G>T	c.(40-42)tGc>tTc	p.C14F		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	14			PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGTGGAGCAGCTGGGAAA	0.597													c|||	498	0.0994409	0.1838	0.1124	5008	,	,		15162	0.1409		0.0169	False		,,,				2504	0.0184																0													45.0	55.0	52.0					17																	39197609		1959	4162	6121	SO:0001583	missense	81851			AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.41G>T	17.37:g.39197609C>A	ENSP00000305975:p.Cys14Phe		A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	108	0.04945054945054945	40	0.08130081300813008	18	0.049723756906077346	44	0.07692307692307693	6	0.0079155672823219	C	10.59	1.391756	0.25118	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.33216	1.42	4.56	2.52	0.30459	.	.	.	.	.	T	0.03136	0.0092	M	0.92604	3.325	0.27968	P	0.9365203	B	0.22146	0.065	B	0.20767	0.031	T	0.41734	-0.9492	8	0.66056	D	0.02	.	11.8299	0.52288	0.3171:0.6829:0.0:0.0	.	14	Q07627	KRA11_HUMAN	F	14	ENSP00000305975:C14F	ENSP00000305975:C14F	C	-	2	0	KRTAP1-1	36451135	0.993000	0.37304	0.993000	0.49108	0.637000	0.38172	0.435000	0.21510	0.840000	0.34995	-0.182000	0.12963	TGC		0.597	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1		NM_030967	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197614	39197614	+	Silent	SNP	G	G	A	rs141856614	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:39197614G>A	ENST00000306271.4	-	1	99	c.36C>T	c.(34-36)ccC>ccT	p.P12P		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	12			PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGAGCAGCTGGGAAATCCAC	0.587													g|||	501	0.10004	0.1846	0.1138	5008	,	,		15385	0.1419		0.0169	False		,,,				2504	0.0184																0													48.0	56.0	53.0					17																	39197614		1952	4163	6115	SO:0001819	synonymous_variant	81851			AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.36C>T	17.37:g.39197614G>A			A6NC32|Q96S60|Q96S67	Silent	SNP	ENST00000306271.4	37	CCDS42324.1																																																																																				0.587	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1		NM_030967	
LRRC10	376132	broad.mit.edu;hgsc.bcm.edu	37	12	70003903	70003903	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:70003903C>T	ENST00000361484.3	-	1	1039	c.716G>A	c.(715-717)aGa>aAa	p.R239K		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	239					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)				large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CTCTGCCCATCTCCCCACACG	0.597																																																	0													95.0	79.0	84.0					12																	70003903		2203	4300	6503	SO:0001583	missense	376132			AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.716G>A	12.37:g.70003903C>T	ENSP00000355166:p.Arg239Lys		Q6ZVY4	Missense_Mutation	SNP	ENST00000361484.3	37	CCDS31856.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521137	0.85600	.	.	ENSG00000198812	ENST00000361484	T	0.56611	0.45	5.63	4.74	0.60224	.	0.044695	0.85682	N	0.000000	T	0.49184	0.1542	M	0.67953	2.075	0.38435	D	0.946547	B	0.13145	0.007	B	0.15052	0.012	T	0.49943	-0.8885	10	0.11182	T	0.66	.	14.6078	0.68493	0.0:0.9299:0.0:0.0701	.	239	Q5BKY1	LRC10_HUMAN	K	239	ENSP00000355166:R239K	ENSP00000355166:R239K	R	-	2	0	LRRC10	68290170	0.939000	0.31865	0.983000	0.44433	0.992000	0.81027	4.045000	0.57368	1.512000	0.48834	0.561000	0.74099	AGA		0.597	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403834.1		NM_201550	
MAML3	55534	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	140640547	140640547	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr4:140640547T>C	ENST00000509479.2	-	5	4203	c.3347A>G	c.(3346-3348)gAc>gGc	p.D1116G	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GATGATGGAGTCCACAAGGTC	0.572																																																	0													52.0	57.0	56.0					4																	140640547		2072	4200	6272	SO:0001583	missense	55534			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3347A>G	4.37:g.140640547T>C	ENSP00000421180:p.Asp1116Gly			Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.321540	0.81580	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.70749	-0.51	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000001	D	0.83326	0.5230	M	0.81239	2.535	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.65140	0.932;0.932	D	0.86258	0.1653	10	0.87932	D	0	.	14.9697	0.71223	0.0:0.0:0.0:1.0	.	1116;1112	E7EVW8;Q96JK9	.;MAML3_HUMAN	G	1116;423	ENSP00000421180:D1116G	ENSP00000421180:D1116G	D	-	2	0	MAML3	140859997	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.146000	0.71777	1.992000	0.58205	0.482000	0.46254	GAC		0.572	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			
MAST4	375449	broad.mit.edu;ucsc.edu	37	5	66462005	66462005	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr5:66462005A>T	ENST00000403625.2	+	29	7293	c.6998A>T	c.(6997-6999)cAc>cTc	p.H2333L	MAST4_ENST00000403666.1_Missense_Mutation_p.H2144L|MAST4_ENST00000404260.3_Missense_Mutation_p.H2336L|MAST4_ENST00000405643.1_Missense_Mutation_p.H2154L|MAST4_ENST00000261569.7_Missense_Mutation_p.H2139L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2336						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCTCCAAAGCACCCCAAACCA	0.572											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													21.0	30.0	27.0					5																	66462005		2036	4140	6176	SO:0001583	missense	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.6998A>T	5.37:g.66462005A>T	ENSP00000385727:p.His2333Leu	1092	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.792733	0.31685	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569	T;T;T;T;T	0.68181	-0.3;-0.3;-0.31;-0.31;-0.29	4.8	3.66	0.41972	.	0.507213	0.18203	N	0.148439	T	0.44540	0.1298	L	0.29908	0.895	0.27533	N	0.951029	B;B	0.06786	0.001;0.0	B;B	0.08055	0.001;0.003	T	0.34825	-0.9813	10	0.02654	T	1	-5.8115	5.3059	0.15803	0.6296:0.2025:0.0:0.1679	.	2336;2144	O15021;O15021-3	MAST4_HUMAN;.	L	2336;2333;2144;2154;2154;2139	ENSP00000385048:H2336L;ENSP00000385727:H2333L;ENSP00000384313:H2144L;ENSP00000384099:H2154L;ENSP00000261569:H2139L	ENSP00000261569:H2139L	H	+	2	0	MAST4	66497761	0.999000	0.42202	0.928000	0.36995	0.446000	0.32137	1.568000	0.36418	0.878000	0.35920	0.459000	0.35465	CAC		0.572	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			
MBL2	4153	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	54527937	54527937	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr10:54527937C>T	ENST00000373968.3	-	4	771	c.707G>A	c.(706-708)tGc>tAc	p.C236Y		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	236	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						GGAGGTGGAGCAGGGGACGTC	0.507																																																	0													286.0	256.0	266.0					10																	54527937		2202	4300	6502	SO:0001583	missense	4153			AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.707G>A	10.37:g.54527937C>T	ENSP00000363079:p.Cys236Tyr		Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	ENST00000373968.3	37	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944135	0.73672	.	.	ENSG00000165471	ENST00000373968	T	0.60672	0.17	5.13	5.13	0.70059	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000002	D	0.85915	0.5808	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91596	0.5291	10	0.87932	D	0	-7.8349	16.4461	0.83932	0.0:1.0:0.0:0.0	.	236	P11226	MBL2_HUMAN	Y	236	ENSP00000363079:C236Y	ENSP00000363079:C236Y	C	-	2	0	MBL2	54197943	0.950000	0.32346	0.238000	0.24106	0.007000	0.05969	3.242000	0.51384	2.532000	0.85374	0.591000	0.81541	TGC		0.507	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1		NM_000242	
METTL3	56339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21966492	21966492	+	Silent	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr14:21966492C>T	ENST00000298717.4	-	11	1804	c.1653G>A	c.(1651-1653)ctG>ctA	p.L551L	TOX4_ENST00000262709.3_3'UTR|TOX4_ENST00000405508.1_3'UTR	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	551					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GGATCCCATCCAGTTGGTTTC	0.418																																																	0													129.0	117.0	121.0					14																	21966492		2203	4300	6503	SO:0001819	synonymous_variant	56339			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1653G>A	14.37:g.21966492C>T			O14736|Q86V05|Q9HB32	Silent	SNP	ENST00000298717.4	37	CCDS32044.1																																																																																				0.418	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1		NM_019852	
METTL3	56339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21967449	21967449	+	Splice_Site	SNP	C	C	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr14:21967449C>G	ENST00000298717.4	-	9	1670		c.e9+1			NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3						circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GAAGCACATACCTCAGCTACG	0.423																																																	0													155.0	143.0	147.0					14																	21967449		2203	4300	6503	SO:0001630	splice_region_variant	56339			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1518+1G>C	14.37:g.21967449C>G			O14736|Q86V05|Q9HB32	Splice_Site	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286285	0.80803	.	.	ENSG00000165819	ENST00000298717	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5764	0.87950	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	METTL3	21037289	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.268000	0.65536	2.449000	0.82847	0.467000	0.42956	.		0.423	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1		NM_019852	Intron
METTL3	56339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21967512	21967512	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr14:21967512C>T	ENST00000298717.4	-	9	1607	c.1456G>A	c.(1456-1458)Ggt>Agt	p.G486S		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	486					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CCTTTGACACCAACCTGCTCA	0.433																																																	0													174.0	163.0	166.0					14																	21967512		2203	4300	6503	SO:0001583	missense	56339			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1456G>A	14.37:g.21967512C>T	ENSP00000298717:p.Gly486Ser		O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254221	0.95336	.	.	ENSG00000165819	ENST00000298717	T	0.54866	0.55	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80869	0.4706	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86253	0.1650	10	0.72032	D	0.01	-15.9953	17.7965	0.88574	0.0:1.0:0.0:0.0	.	486	Q86U44	MTA70_HUMAN	S	486	ENSP00000298717:G486S	ENSP00000298717:G486S	G	-	1	0	METTL3	21037352	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.762000	0.74950	2.506000	0.84524	0.467000	0.42956	GGT		0.433	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1		NM_019852	
METTL3	56339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21967647	21967647	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr14:21967647C>T	ENST00000298717.4	-	8	1592	c.1441G>A	c.(1441-1443)Gaa>Aaa	p.E481K		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	481					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AAGCAGTGTTCCTTCCCATGG	0.448																																																	0													162.0	153.0	156.0					14																	21967647		2203	4300	6503	SO:0001583	missense	56339			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1441G>A	14.37:g.21967647C>T	ENSP00000298717:p.Glu481Lys		O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	37	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127984	0.94473	.	.	ENSG00000165819	ENST00000298717	T	0.71461	-0.57	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.89863	0.6838	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93353	0.6720	10	0.87932	D	0	-14.0611	17.016	0.86419	0.0:1.0:0.0:0.0	.	481	Q86U44	MTA70_HUMAN	K	481	ENSP00000298717:E481K	ENSP00000298717:E481K	E	-	1	0	METTL3	21037487	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.059000	0.76684	2.559000	0.86315	0.460000	0.39030	GAA		0.448	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1		NM_019852	
MKKS	8195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	10393658	10393658	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr20:10393658T>C	ENST00000347364.3	-	3	1267	c.505A>G	c.(505-507)Aag>Gag	p.K169E	MKKS_ENST00000399054.2_Missense_Mutation_p.K169E	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	169					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						TCTGTTTCCTTTCTGGTGAGC	0.413																																					Melanoma(79;1979 2212 6640)												0													93.0	89.0	90.0					20																	10393658		2203	4300	6503	SO:0001583	missense	8195			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.505A>G	20.37:g.10393658T>C	ENSP00000246062:p.Lys169Glu		A8K7B0|D3DW18	Missense_Mutation	SNP	ENST00000347364.3	37	CCDS13111.1	.	.	.	.	.	.	.	.	.	.	T	0.032	-1.325297	0.01309	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	T;T	0.78003	-1.14;-1.14	5.63	-0.644	0.11479	.	0.592358	0.19250	N	0.118948	T	0.54679	0.1873	N	0.17674	0.51	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.34675	-0.9819	10	0.11182	T	0.66	-32.3547	6.1575	0.20346	0.0:0.204:0.2187:0.5773	.	169	Q9NPJ1	MKKS_HUMAN	E	169	ENSP00000246062:K169E;ENSP00000382008:K169E	ENSP00000246062:K169E	K	-	1	0	MKKS	10341658	0.004000	0.15560	0.076000	0.20297	0.009000	0.06853	-0.030000	0.12308	-0.326000	0.08564	-1.499000	0.00960	AAG		0.413	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3			
MUC4	4585	hgsc.bcm.edu	37	3	195506760	195506760	+	Silent	SNP	T	T	A	rs62282473	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr3:195506760T>A	ENST00000463781.3	-	2	12150	c.11691A>T	c.(11689-11691)gcA>gcT	p.A3897A	MUC4_ENST00000475231.1_Silent_p.A3897A|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACGTGTGGATGCTGAGGAAG	0.592													.|||	492	0.0982428	0.0166	0.0994	5008	,	,		8412	0.0526		0.2008	False		,,,				2504	0.1493																0													9.0	8.0	8.0					3																	195506760		534	1118	1652	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11691A>T	3.37:g.195506760T>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NCOR2	9612	hgsc.bcm.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																																	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)											9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																				0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2		NM_006312	
NEDD4L	23327	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	55992365	55992365	+	Silent	SNP	G	G	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr18:55992365G>A	ENST00000400345.3	+	9	934	c.651G>A	c.(649-651)cgG>cgA	p.R217R	NEDD4L_ENST00000382850.4_Silent_p.R217R|NEDD4L_ENST00000256832.7_Silent_p.R96R|NEDD4L_ENST00000586263.1_Silent_p.R209R|NEDD4L_ENST00000431212.2_Silent_p.R96R|NEDD4L_ENST00000256830.9_Silent_p.R217R|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000357895.5_Silent_p.R209R|NEDD4L_ENST00000456173.2_Silent_p.R96R|NEDD4L_ENST00000456986.1_Silent_p.R96R|NEDD4L_ENST00000435432.2_Silent_p.R96R|NEDD4L_ENST00000356462.6_Silent_p.R217R	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	217	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						ACAACAACCGGACCACTCAGT	0.542																																																	0													176.0	176.0	176.0					18																	55992365		2061	4197	6258	SO:0001819	synonymous_variant	23327			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.651G>A	18.37:g.55992365G>A			O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	37	CCDS45872.1																																																																																				0.542	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1			
NPFFR2	10886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	73013282	73013282	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr4:73013282A>T	ENST00000308744.6	+	4	1420	c.1322A>T	c.(1321-1323)aAt>aTt	p.N441I	NPFFR2_ENST00000358749.3_Missense_Mutation_p.N339I|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.N342I	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	441					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TTCAACGAGAATTTCCGCCGT	0.463																																																	0													82.0	85.0	84.0					4																	73013282		2203	4300	6503	SO:0001583	missense	10886			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1322A>T	4.37:g.73013282A>T	ENSP00000307822:p.Asn441Ile		Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	A	16.67	3.186466	0.57909	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.39056	1.1;1.1;1.1	5.83	5.83	0.93111	.	0.099693	0.44688	D	0.000421	T	0.65196	0.2668	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.74674	0.967;0.984	T	0.69131	-0.5226	10	0.87932	D	0	.	15.8582	0.79000	1.0:0.0:0.0:0.0	.	342;441	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	I	441;342;339	ENSP00000307822:N441I;ENSP00000379321:N342I;ENSP00000351599:N339I	ENSP00000307822:N441I	N	+	2	0	NPFFR2	73232146	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	9.195000	0.94971	2.225000	0.72522	0.533000	0.62120	AAT		0.463	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2		NM_004885	
OGN	4969	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	95165563	95165563	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr9:95165563A>C	ENST00000262551.4	-	2	547	c.127T>G	c.(127-129)Ttt>Gtt	p.F43V	OGN_ENST00000375561.5_Missense_Mutation_p.F43V|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	43					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						TCTTGGCTAAATATGGATTCT	0.353																																																	0													67.0	68.0	68.0					9																	95165563		2203	4300	6503	SO:0001583	missense	4969			AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.127T>G	9.37:g.95165563A>C	ENSP00000262551:p.Phe43Val		Q6FIB0|Q9UF90|Q9UNK5	Missense_Mutation	SNP	ENST00000262551.4	37	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	A	4.006	-0.001551	0.07819	.	.	ENSG00000106809	ENST00000262551;ENST00000375561;ENST00000447356	T;T;T	0.59638	0.26;0.26;0.25	5.15	4.02	0.46733	.	0.382132	0.27219	N	0.020378	T	0.36468	0.0968	L	0.27053	0.805	0.09310	N	1	B;B	0.26318	0.146;0.146	B;B	0.22152	0.038;0.016	T	0.14062	-1.0486	10	0.17369	T	0.5	.	5.0653	0.14578	0.7397:0.0:0.0887:0.1716	.	101;43	B4DI63;P20774	.;MIME_HUMAN	V	43;43;101	ENSP00000262551:F43V;ENSP00000364711:F43V;ENSP00000396709:F101V	ENSP00000262551:F43V	F	-	1	0	OGN	94205384	0.291000	0.24352	0.685000	0.30070	0.155000	0.21991	0.777000	0.26718	1.065000	0.40693	0.533000	0.62120	TTT		0.353	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1		NM_024416	
OR8D4	338662	broad.mit.edu;ucsc.edu	37	11	123777914	123777914	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr11:123777914A>T	ENST00000321355.2	+	1	806	c.776A>T	c.(775-777)tAt>tTt	p.Y259F		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		ATGTCCATGTATCTCAAACCT	0.443																																																	0													114.0	114.0	114.0					11																	123777914		2202	4299	6501	SO:0001583	missense	338662			AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.776A>T	11.37:g.123777914A>T	ENSP00000325381:p.Tyr259Phe		Q6IFE9	Missense_Mutation	SNP	ENST00000321355.2	37	CCDS31698.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305852	0.81247	.	.	ENSG00000181518	ENST00000321355	T	0.00291	8.27	5.81	5.81	0.92471	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000596	T	0.01189	0.0039	H	0.96430	3.82	0.33018	D	0.528403	D	0.89917	1.0	D	0.77557	0.99	T	0.06770	-1.0808	10	0.87932	D	0	.	15.1504	0.72692	1.0:0.0:0.0:0.0	.	259	Q8NGM9	OR8D4_HUMAN	F	259	ENSP00000325381:Y259F	ENSP00000325381:Y259F	Y	+	2	0	OR8D4	123283124	0.309000	0.24518	1.000000	0.80357	0.992000	0.81027	4.248000	0.58760	2.214000	0.71695	0.533000	0.62120	TAT		0.443	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1		NM_001005197	
PAK6	56924	hgsc.bcm.edu;ucsc.edu	37	15	40564552	40564552	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr15:40564552C>T	ENST00000542403.2	+	4	1097	c.986C>T	c.(985-987)cCc>cTc	p.P329L	PAK6_ENST00000560346.1_Missense_Mutation_p.P329L|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000260404.4_Missense_Mutation_p.P329L|PAK6_ENST00000453867.1_Missense_Mutation_p.P329L|PAK6_ENST00000441369.1_Missense_Mutation_p.P329L|PAK6_ENST00000455577.2_Missense_Mutation_p.P329L	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	329	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		ACCAGCAGCCCCCAGAAGTCC	0.687																																																	0													56.0	65.0	62.0					15																	40564552		2203	4300	6503	SO:0001583	missense	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.986C>T	15.37:g.40564552C>T	ENSP00000439597:p.Pro329Leu		A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647016	0.47258	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.76709	-0.94;-0.94;-1.04;-0.94;-0.94	4.69	3.76	0.43208	.	0.108132	0.64402	D	0.000004	T	0.65112	0.2660	L	0.29908	0.895	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.12156	0.003;0.007	T	0.65364	-0.6186	10	0.72032	D	0.01	.	9.0686	0.36478	0.0:0.8351:0.0:0.1649	.	329;329	Q9NQU5;G5E9R2	PAK6_HUMAN;.	L	329	ENSP00000406873:P329L;ENSP00000401153:P329L;ENSP00000409465:P329L;ENSP00000260404:P329L;ENSP00000439597:P329L	ENSP00000260404:P329L	P	+	2	0	PAK6	38351844	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.662000	0.37418	2.318000	0.78349	0.555000	0.69702	CCC		0.687	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			
PAPOLB	56903	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	4899654	4899654	+	Silent	SNP	G	G	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr7:4899654G>A	ENST00000404991.1	-	1	1971	c.1785C>T	c.(1783-1785)caC>caT	p.H595H	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	595					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		GAGAGACAGCGTGAGGAATAC	0.458																																																	0													88.0	92.0	91.0					7																	4899654		2134	4278	6412	SO:0001819	synonymous_variant	56903			AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1785C>T	7.37:g.4899654G>A			Q75LH1|Q8NE14	Silent	SNP	ENST00000404991.1	37																																																																																					0.458	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1		NM_020144	
PARP4	143	hgsc.bcm.edu;ucsc.edu	37	13	25034117	25034117	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr13:25034117delT	ENST00000381989.3	-	18	2396	c.2291delA	c.(2290-2292)aacfs	p.N764fs	PARP4_ENST00000480576.1_5'Flank	NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	764					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AACCTGAAGGTTTTCATTCAA	0.498																																																	0													69.0	66.0	67.0					13																	25034117		2203	4300	6503	SO:0001589	frameshift_variant	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2291delA	13.37:g.25034117delT	ENSP00000371419:p.Asn764fs		O75903|Q14682|Q5QNZ9|Q9H1M6	Frame_Shift_Del	DEL	ENST00000381989.3	37	CCDS9307.1																																																																																				0.498	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1		NM_006437	
PDE1B	5153	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	54971106	54971106	+	Silent	SNP	G	G	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:54971106G>A	ENST00000243052.3	+	15	2041	c.1605G>A	c.(1603-1605)ctG>ctA	p.L535L	PDE1B_ENST00000550620.1_Silent_p.L515L|PPP1R1A_ENST00000547431.1_3'UTR|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Silent_p.L494L	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	535					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ATGGGAATCTGGATTAGCCCT	0.577																																																	0													141.0	137.0	138.0					12																	54971106		2203	4300	6503	SO:0001819	synonymous_variant	5153			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1605G>A	12.37:g.54971106G>A			Q92825|Q96KP3	Silent	SNP	ENST00000243052.3	37	CCDS8882.1																																																																																				0.577	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			
RPTOR	57521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	78935234	78935234	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:78935234A>C	ENST00000306801.3	+	31	4008	c.3646A>C	c.(3646-3648)Aag>Cag	p.K1216Q	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.K1058Q|CTD-2561B21.3_ENST00000571591.1_RNA	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1216					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CTGGGTGGTGAAGGCCTCCCT	0.617																																																	0													95.0	55.0	69.0					17																	78935234		2162	4204	6366	SO:0001583	missense	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3646A>C	17.37:g.78935234A>C	ENSP00000307272:p.Lys1216Gln		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145057	0.77888	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.28666	1.6;1.6	4.27	4.27	0.50696	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44030	0.1274	L	0.40543	1.245	0.80722	D	1	D;P	0.61080	0.989;0.828	D;B	0.72625	0.978;0.374	T	0.20438	-1.0275	10	0.32370	T	0.25	.	13.8388	0.63426	1.0:0.0:0.0:0.0	.	1058;1216	F5H7J5;Q8N122	.;RPTOR_HUMAN	Q	1216;1058	ENSP00000307272:K1216Q;ENSP00000442479:K1058Q	ENSP00000307272:K1216Q	K	+	1	0	RPTOR	76549829	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	8.388000	0.90170	1.920000	0.55613	0.482000	0.46254	AAG		0.617	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1		NM_020761	
SART3	9733	hgsc.bcm.edu;ucsc.edu	37	12	108941708	108941708	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr12:108941708delC	ENST00000228284.3	-	3	733	c.499delG	c.(499-501)gagfs	p.E167fs	SART3_ENST00000431469.2_Frame_Shift_Del_p.E167fs|SART3_ENST00000552221.1_5'UTR	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	167					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						TACACGTGCTCTCTGTCCAGG	0.463									Porokeratosis																																								0													77.0	72.0	74.0					12																	108941708		2203	4300	6503	SO:0001589	frameshift_variant	9733	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.499delG	12.37:g.108941708delC	ENSP00000228284:p.Glu167fs		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Frame_Shift_Del	DEL	ENST00000228284.3	37	CCDS9117.1																																																																																				0.463	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1			
SLC13A2	9058	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	26820678	26820678	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:26820678G>T	ENST00000314669.5	+	7	1388	c.968G>T	c.(967-969)gGc>gTc	p.G323V	SLC13A2_ENST00000537681.1_Missense_Mutation_p.G252V|SLC13A2_ENST00000444914.3_Missense_Mutation_p.G372V|SLC13A2_ENST00000545060.1_Missense_Mutation_p.G280V	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	323					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	AGGCTGCTGGGCCCCATGACC	0.572																																																	0													62.0	56.0	58.0					17																	26820678		2203	4300	6503	SO:0001583	missense	9058			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.968G>T	17.37:g.26820678G>T	ENSP00000316202:p.Gly323Val		B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858737	0.91433	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.62636	0.2444	M	0.93507	3.425	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.75651	-0.3244	10	0.87932	D	0	-12.9081	17.5447	0.87858	0.0:0.0:1.0:0.0	.	280;372;279;252;323	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	V	323;372;280;279;252	ENSP00000316202:G323V;ENSP00000392411:G372V;ENSP00000441935:G280V;ENSP00000440802:G252V	ENSP00000316202:G323V	G	+	2	0	SLC13A2	23844805	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.146000	0.94640	2.215000	0.71742	0.449000	0.29647	GGC		0.572	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1		NM_003984	
SLC44A5	204962	broad.mit.edu;ucsc.edu	37	1	75681492	75681492	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:75681492A>G	ENST00000370855.5	-	19	1788	c.1675T>C	c.(1675-1677)Ttc>Ctc	p.F559L	SLC44A5_ENST00000535611.1_Missense_Mutation_p.F429L|SLC44A5_ENST00000370859.3_Missense_Mutation_p.F559L	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	559					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AAACACCAGAAGCAGCATCTC	0.338																																																	0													77.0	80.0	79.0					1																	75681492		2203	4300	6503	SO:0001583	missense	204962			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1675T>C	1.37:g.75681492A>G	ENSP00000359892:p.Phe559Leu		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	A	17.77	3.470619	0.63625	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.19806	2.12;2.12;2.12	5.4	4.26	0.50523	.	0.146747	0.64402	D	0.000007	T	0.10423	0.0255	L	0.41492	1.28	0.80722	D	1	P;P;P;P;P	0.41214	0.554;0.554;0.742;0.498;0.498	P;B;P;B;B	0.48400	0.498;0.371;0.576;0.44;0.44	T	0.02617	-1.1133	10	0.05721	T	0.95	-17.7661	11.8509	0.52412	0.9279:0.0:0.0721:0.0	.	553;598;559;559;598	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	L	559;598;559;429;552	ENSP00000359896:F559L;ENSP00000359892:F559L;ENSP00000443090:F429L	ENSP00000359892:F559L	F	-	1	0	SLC44A5	75454080	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.259000	0.72494	2.171000	0.68590	0.528000	0.53228	TTC		0.338	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1		NM_152697	
ST3GAL1	6482	broad.mit.edu;ucsc.edu	37	8	134478309	134478309	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr8:134478309T>C	ENST00000319914.5	-	5	1358	c.331A>G	c.(331-333)Aat>Gat	p.N111D	ST3GAL1_ENST00000399640.2_Missense_Mutation_p.N111D|ST3GAL1_ENST00000522652.1_Missense_Mutation_p.N111D|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.N111D			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	111			N -> S (in dbSNP:rs2230544).		carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			TTCAAGTTATTGGGCTTCTTC	0.612																																																	0													73.0	70.0	71.0					8																	134478309		2203	4300	6503	SO:0001583	missense	6482			L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.331A>G	8.37:g.134478309T>C	ENSP00000318445:p.Asn111Asp		O60677|Q9UN51	Missense_Mutation	SNP	ENST00000319914.5	37	CCDS6373.1	.	.	.	.	.	.	.	.	.	.	T	9.977	1.227053	0.22542	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	4.69	0.478	0.16789	.	0.830200	0.11393	N	0.568572	T	0.24392	0.0591	L	0.40543	1.245	0.09310	N	1	B	0.12013	0.005	B	0.17433	0.018	T	0.27157	-1.0082	10	0.24483	T	0.36	-4.7921	11.6907	0.51514	0.0:0.0:0.4309:0.5691	.	111	Q11201	SIA4A_HUMAN	D	111	ENSP00000318445:N111D;ENSP00000414073:N111D;ENSP00000428540:N111D;ENSP00000430515:N111D	ENSP00000318445:N111D	N	-	1	0	ST3GAL1	134547491	0.027000	0.19231	0.136000	0.22124	0.967000	0.64934	0.653000	0.24902	0.230000	0.21059	0.454000	0.30748	AAT		0.612	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379132.1		NM_003033	
SUZ12	23512	hgsc.bcm.edu	37	17	30310080	30310080	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:30310080delT	ENST00000322652.5	+	9	1209	c.980delT	c.(979-981)atafs	p.I327fs	SUZ12_ENST00000580398.1_Frame_Shift_Del_p.I304fs	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	327					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GAATGTCCAATAAGCAAGAAA	0.393			T	JAZF1	endometrial stromal tumours																																			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0													118.0	114.0	115.0					17																	30310080		2203	4298	6501	SO:0001589	frameshift_variant	23512			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.980delT	17.37:g.30310080delT	ENSP00000316578:p.Ile327fs		Q96BD9	Frame_Shift_Del	DEL	ENST00000322652.5	37	CCDS11270.1																																																																																				0.393	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2		NM_015355	
TMC8	147138	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	76134202	76134202	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr17:76134202T>A	ENST00000318430.5	+	12	1840	c.1466T>A	c.(1465-1467)cTc>cAc	p.L489H	TMC8_ENST00000589691.1_Missense_Mutation_p.L266H	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	489					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			TGGATGGGCCTCTTCTACTGC	0.612																																																	0													91.0	92.0	92.0					17																	76134202		2203	4300	6503	SO:0001583	missense	147138			AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1466T>A	17.37:g.76134202T>A	ENSP00000325561:p.Leu489His		Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	ENST00000318430.5	37	CCDS32749.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.905542	0.72868	.	.	ENSG00000167895	ENST00000318430	T	0.65364	-0.15	4.57	4.57	0.56435	.	0.068510	0.56097	D	0.000025	T	0.76870	0.4048	M	0.72118	2.19	0.34112	D	0.663124	D	0.89917	1.0	D	0.85130	0.997	D	0.84823	0.0797	10	0.66056	D	0.02	-34.7634	13.1778	0.59637	0.0:0.0:0.0:1.0	.	489	Q8IU68	TMC8_HUMAN	H	489	ENSP00000325561:L489H	ENSP00000325561:L489H	L	+	2	0	TMC8	73645797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.449000	0.52950	1.814000	0.52955	0.460000	0.39030	CTC		0.612	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3			
VHL	7428	hgsc.bcm.edu	37	3	10183665	10183665	+	Missense_Mutation	SNP	C	C	T	rs199583685		TCGA-CJ-4636-01A-02W-1382-10	TCGA-CJ-4636-11A-01W-1244-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina MiSeq	c437a272-1a90-4b2d-bf5b-e3602527c210	5b191139-f06e-4add-a934-f6116591658f	g.chr3:10183665C>T	ENST00000256474.2	+	1	974	c.134C>T	c.(133-135)cCg>cTg	p.P45L	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.P45L	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	45	8 X 5 AA tandem repeats of G-[PAVG]-E-E- [DAYSLE].				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)			adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GAGTCCGGCCCGGAGGAACTG	0.716		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia				C|||	1	0.000199681	0.0	0.0	5008	,	,		10527	0.001		0.0	False		,,,				2504	0.0					.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	0																																										SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.134C>T	3.37:g.10183665C>T	ENSP00000256474:p.Pro45Leu		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.59	2.580733	0.46006	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.84298	-1.83;-1.83	3.53	0.582	0.17412	.	1.482540	0.04888	N	0.448902	T	0.73737	0.3625	N	0.19112	0.55	0.09310	N	1	B;B	0.22604	0.072;0.043	B;B	0.19666	0.026;0.012	T	0.61192	-0.7112	10	0.72032	D	0.01	0.0061	2.9019	0.05708	0.1708:0.3546:0.3717:0.1029	.	45;45	P40337-2;P40337	.;VHL_HUMAN	L	45	ENSP00000256474:P45L;ENSP00000344757:P45L	ENSP00000256474:P45L	P	+	2	0	VHL	10158665	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.435000	0.21510	0.107000	0.17824	0.555000	0.69702	CCG		0.716	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191513	10191513	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr3:10191513T>C	ENST00000256474.2	+	3	1346	c.506T>C	c.(505-507)cTa>cCa	p.L169P	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Missense_Mutation_p.L128P	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	169					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L169P(11)|p.L169fs*33(2)|p.S168fs*3(1)|p.V170fs*31(1)|p.L169_V170del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCCGGAGCCTAGTCAAGCCT	0.517		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	16	Substitution - Missense(11)|Deletion - Frameshift(4)|Deletion - In frame(1)	kidney(16)	GRCh37	CM003060	VHL	M							95.0	86.0	89.0					3																	10191513		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.506T>C	3.37:g.10191513T>C	ENSP00000256474:p.Leu169Pro		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866443	0.72065	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99856	-7.21;-7.21	4.86	4.86	0.63082	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.64402	D	0.000004	D	0.99782	0.9909	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96607	0.9449	10	0.87932	D	0	-8.7798	12.7224	0.57149	0.0:0.0:0.0:1.0	.	128;169	P40337-2;P40337	.;VHL_HUMAN	P	169;128;87	ENSP00000256474:L169P;ENSP00000344757:L128P	ENSP00000256474:L169P	L	+	2	0	VHL	10166513	1.000000	0.71417	0.937000	0.37676	0.716000	0.41182	5.790000	0.69038	2.162000	0.67917	0.533000	0.62120	CTA		0.517	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR77	79084	broad.mit.edu;hgsc.bcm.edu	37	1	111989749	111989749	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:111989749A>C	ENST00000235090.5	-	4	667	c.461T>G	c.(460-462)cTt>cGt	p.L154R	WDR77_ENST00000497278.1_5'UTR|ATP5F1_ENST00000369722.3_5'Flank|ATP5F1_ENST00000483994.1_5'Flank|WDR77_ENST00000411751.2_Intron|Y_RNA_ENST00000363020.1_RNA	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	154					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCTGAGCAAGGTCCCAAAC	0.383																																																	0													146.0	136.0	139.0					1																	111989749		2203	4300	6503	SO:0001583	missense	79084			BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.461T>G	1.37:g.111989749A>C	ENSP00000235090:p.Leu154Arg		B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Missense_Mutation	SNP	ENST00000235090.5	37	CCDS835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.2|23.2	4.390082|4.390082	0.82902|0.82902	.|.	.|.	ENSG00000116455|ENSG00000116455	ENST00000235090|ENST00000449340	T|T	0.36878|0.33654	1.23|1.4	5.67|5.67	5.67|5.67	0.87782|0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);|.	0.126311|0.126311	0.53938|0.53938	D|D	0.000054|0.000054	T|T	0.32164|0.32164	0.0820|0.0820	L|L	0.60957|0.60957	1.885|1.885	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.74674|.	0.984|.	T|T	0.10132|0.10132	-1.0643|-1.0643	10|8	0.27082|0.14656	T|T	0.32|0.56	-14.3657|-14.3657	15.5761|15.5761	0.76387|0.76387	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	154|.	Q9BQA1|.	MEP50_HUMAN|.	R|V	154|91	ENSP00000235090:L154R|ENSP00000409300:L91V	ENSP00000235090:L154R|ENSP00000409300:L91V	L|L	-|-	2|1	0|2	WDR77|WDR77	111791272|111791272	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	7.057000|7.057000	0.76669|0.76669	2.172000|2.172000	0.68678|0.68678	0.379000|0.379000	0.24179|0.24179	CTT|TTG		0.383	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1		NM_024102	
ZFPM2	23414	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	106815071	106815071	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr8:106815071A>C	ENST00000407775.2	+	8	3011	c.2761A>C	c.(2761-2763)Aat>Cat	p.N921H	ZFPM2_ENST00000520492.1_Missense_Mutation_p.N789H|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.N789H|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.N652H	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	921					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAAAAATGGGAATTTGAAGCA	0.458																																																	0													42.0	40.0	41.0					8																	106815071		1882	4106	5988	SO:0001583	missense	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2761A>C	8.37:g.106815071A>C	ENSP00000384179:p.Asn921His		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.471668	0.26423	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.22945	1.93;2.42;2.42;3.62	5.76	5.76	0.90799	.	0.135289	0.64402	D	0.000003	T	0.21062	0.0507	L	0.27053	0.805	0.52501	D	0.999954	P	0.49447	0.924	B	0.40782	0.34	T	0.01604	-1.1314	10	0.45353	T	0.12	.	16.0709	0.80928	1.0:0.0:0.0:0.0	.	921	Q8WW38	FOG2_HUMAN	H	921;789;789;652	ENSP00000384179:N921H;ENSP00000430757:N789H;ENSP00000428720:N789H;ENSP00000367733:N652H	ENSP00000367733:N652H	N	+	1	0	ZFPM2	106884247	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	7.219000	0.78000	2.198000	0.70561	0.528000	0.53228	AAT		0.458	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			
SKIDA1	387640	broad.mit.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517																2	Insertion - In frame(2)	soft_tissue(2)								3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				SO:0001652	inframe_insertion	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup		B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	ENST00000449193.2	37	CCDS44363.1																																																																																				0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2		NM_207371	
EPPK1	83481	broad.mit.edu	37	8	144942850	144942850	+	Silent	SNP	G	G	A	rs267601818		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr8:144942850G>A	ENST00000525985.1	-	2	4643	c.4572C>T	c.(4570-4572)ctC>ctT	p.L1524L				P58107	EPIPL_HUMAN	epiplakin 1	1524						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGCTTCCGGAGCCCTCTGA	0.672																																																	0													12.0	14.0	13.0					8																	144942850		2040	4190	6230	SO:0001819	synonymous_variant	83481			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4572C>T	8.37:g.144942850G>A			Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																					0.672	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1		NM_031308	
CLCNKA	1187	broad.mit.edu	37	1	16361925	16361925	+	IGR	SNP	G	G	A	rs146790110		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:16361925G>A	ENST00000331433.4	+	0	2475							P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CGCTGGGAAGGCTGTCCTGAA	0.647																																																	0																																										SO:0001628	intergenic_variant	348487				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529		1.37:g.16361925G>A			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	ENST00000331433.4	37	CCDS167.1																																																																																				0.647	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1			
RP3-470B24.5	0	broad.mit.edu	37	6	168377220	168377220	+	lincRNA	SNP	T	T	G	rs79173693	byFrequency	TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr6:168377220T>G	ENST00000538528.1	-	0	399																											TGCAGTGTGTTGGGAGGAGAA	0.622													N|||	1179	0.235423	0.1604	0.2118	5008	,	,		16845	0.378		0.167	False		,,,				2504	0.2771																0													3.0	5.0	4.0					6																	168377220		585	1382	1967			100128124																															6.37:g.168377220T>G				Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.622	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	A	G	rs371436644		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr1:144813815A>G	ENST00000440491.2	+	2	288	c.288A>G	c.(286-288)gcA>gcG	p.A96A	NBPF9_ENST00000338347.4_Silent_p.A96A|NBPF9_ENST00000281815.8_5'UTR|NBPF9_ENST00000468645.1_3'UTR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	354						cytoplasm (GO:0005737)		p.A96A(5)		NS(2)|prostate(1)	3						AGAAGCTTGCAGAGCAGCTGA	0.532																																																	5	Substitution - coding silent(5)	kidney(4)|endometrium(1)											1.0	1.0	1.0					1																	144813815		263	708	971	SO:0001819	synonymous_variant	400818				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.288A>G	1.37:g.144813815A>G				Silent	SNP	ENST00000440491.2	37		.	.	.	.	.	.	.	.	.	.	.	1.684	-0.505860	0.04261	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.723	-0.563	0.11778	.	.	.	.	.	T	0.07908	0.0198	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.36040	-0.9764	4	.	.	.	.	2.9279	0.05789	0.6738:0.0:0.3262:0.0	.	.	.	.	R	95	.	.	Q	+	2	0	NBPF9	143525172	0.031000	0.19500	0.003000	0.11579	0.003000	0.03518	0.134000	0.15932	-0.209000	0.10156	-1.211000	0.01629	CAG		0.532	NBPF9-203	KNOWN	basic	protein_coding	protein_coding			NM_001037675	
PNLDC1	154197	broad.mit.edu	37	6	160240368	160240368	+	Missense_Mutation	SNP	G	G	A	rs138386704		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr6:160240368G>A	ENST00000610273.1	+	18	1654	c.1483G>A	c.(1483-1485)Gtc>Atc	p.V495I	PNLDC1_ENST00000392167.3_Missense_Mutation_p.V506I	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	495						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTCCCCAAACGTCAACTGCCT	0.617																																																	0								G	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	88.0	66.0	74.0		1483	-7.8	0.8	6	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PNLDC1	NM_173516.1	29	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	benign	495/521	160240368	3,13003	2203	4300	6503	SO:0001583	missense	154197			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1483G>A	6.37:g.160240368G>A	ENSP00000476448:p.Val495Ile		Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	9.716	1.158311	0.21454	4.54E-4	1.16E-4	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.86	-7.76	0.01232	.	0.904550	0.09461	N	0.799073	T	0.10551	0.0258	N	0.11560	0.145	0.21527	N	0.999654	B;B	0.18310	0.027;0.016	B;B	0.14578	0.011;0.005	T	0.18871	-1.0323	9	0.17369	T	0.5	.	20.2616	0.98447	0.1653:0.0:0.8347:0.0	.	506;495	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	I	495;506	.	ENSP00000275275:V495I	V	+	1	0	PNLDC1	160160358	0.000000	0.05858	0.847000	0.33407	0.016000	0.09150	-0.446000	0.06837	-1.600000	0.01603	-0.291000	0.09656	GTC		0.617	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_173516	
RTF1	23168	broad.mit.edu	37	15	41769654	41769654	+	Splice_Site	SNP	A	A	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr15:41769654A>T	ENST00000389629.4	+	14	1694		c.e14-1			NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)						DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		CTTACCCCACAGTTACATCAA	0.473																																																	0													112.0	106.0	108.0					15																	41769654		2203	4300	6503	SO:0001630	splice_region_variant	23168			D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1683-1A>T	15.37:g.41769654A>T			Q96BX6	Splice_Site	SNP	ENST00000389629.4	37	CCDS32200.2	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268785	0.80469	.	.	ENSG00000137815	ENST00000389629	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4462	0.75232	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RTF1	39556946	1.000000	0.71417	0.935000	0.37517	0.928000	0.56348	8.658000	0.91110	2.235000	0.73313	0.460000	0.39030	.		0.473	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258111.1		NM_015138	Intron
SYT4	6860	broad.mit.edu	37	18	40853880	40853880	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr18:40853880C>T	ENST00000255224.3	-	2	882	c.514G>A	c.(514-516)Gtc>Atc	p.V172I	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.V154I	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	172	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TTGATATTGACCACAAATGCT	0.443																																					NSCLC(85;81 1419 2855 22820 35912)												0													54.0	54.0	54.0					18																	40853880		2203	4299	6502	SO:0001583	missense	6860			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.514G>A	18.37:g.40853880C>T	ENSP00000255224:p.Val172Ile		B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834843	0.91036	.	.	ENSG00000132872	ENST00000255224	T	0.14893	2.47	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (2);	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	L	0.54965	1.715	0.80722	D	1	P;P	0.51791	0.948;0.948	D;D	0.74674	0.984;0.984	T	0.02958	-1.1089	10	0.72032	D	0.01	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	154;172	B4DEU3;Q9H2B2	.;SYT4_HUMAN	I	172	ENSP00000255224:V172I	ENSP00000255224:V172I	V	-	1	0	SYT4	39107878	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.536000	0.82023	2.941000	0.99782	0.655000	0.94253	GTC		0.443	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2		NM_020783	
TRIB3	57761	broad.mit.edu	37	20	377225	377225	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr20:377225delC	ENST00000217233.3	+	4	1521	c.968delC	c.(967-969)gccfs	p.A323fs	TRIB3_ENST00000422053.2_Frame_Shift_Del_p.A350fs	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	323					cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		ATGCCCTTAGCCCCAACCCGA	0.642																																					Melanoma(101;421 2374 19538)												0													53.0	49.0	50.0					20																	377225		2198	4294	6492	SO:0001589	frameshift_variant	57761			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.968delC	20.37:g.377225delC	ENSP00000217233:p.Ala323fs		Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Frame_Shift_Del	DEL	ENST00000217233.3	37	CCDS12997.1																																																																																				0.642	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2		NM_021158	
SECISBP2L	9728	broad.mit.edu	37	15	49301547	49301547	+	Silent	SNP	A	A	C			TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr15:49301547A>C	ENST00000559471.1	-	14	2156	c.1893T>G	c.(1891-1893)acT>acG	p.T631T	SECISBP2L_ENST00000261847.3_Silent_p.T586T	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	631							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						GAGAGAGTGAAGTATCACTGG	0.438																																						.											0													168.0	152.0	157.0					15																	49301547		2197	4295	6492	SO:0001819	synonymous_variant	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1893T>G	15.37:g.49301547A>C			Q8N767	Silent	SNP	ENST00000559471.1	37	CCDS53942.1																																																																																				0.438	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1		NM_014701	
WASH3P	374666	broad.mit.edu	37	15	102516424	102516424	+	RNA	SNP	G	G	T	rs201105823		TCGA-CJ-4636-01A-02D-1386-10	TCGA-CJ-4636-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e5bd693-fb80-426a-bde3-16f33938ea45	769417fc-b475-4126-854a-409b97cdcb2f	g.chr15:102516424G>T	ENST00000557932.1	+	0	1372				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.P449P(4)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGCCGCCACCGCAGCAGCCAC	0.647																																																	4	Substitution - coding silent(4)	endometrium(3)|kidney(1)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516424G>T				Silent	SNP	ENST00000557932.1	37																																																																																					0.647	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1		NM_199163	
