#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABRA	137735	broad.mit.edu;hgsc.bcm.edu	37	8	107773724	107773724	+	Silent	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr8:107773724C>T	ENST00000311955.3	-	2	741	c.687G>A	c.(685-687)gaG>gaA	p.E229E		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.E229E(2)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			AGTTGAGTTTCTCTGTAAATC	0.433																																																	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)											56.0	54.0	54.0					8																	107773724		2203	4300	6503	SO:0001819	synonymous_variant	137735			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.687G>A	8.37:g.107773724C>T				Silent	SNP	ENST00000311955.3	37	CCDS6305.1																																																																																				0.433	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1		NM_139166	
ACRC	93953	broad.mit.edu;ucsc.edu	37	X	70824426	70824426	+	Silent	SNP	T	T	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chrX:70824426T>C	ENST00000373695.1	+	7	1836	c.1299T>C	c.(1297-1299)aaT>aaC	p.N433N	ACRC_ENST00000373696.3_Silent_p.N433N			Q96QF7	ACRC_HUMAN	acidic repeat containing	433	Arg/Lys/Pro-rich.					nucleus (GO:0005634)		p.N433N(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					AGACCAAAAATATAGTGGAGC	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											60.0	44.0	49.0					X																	70824426		2200	4299	6499	SO:0001819	synonymous_variant	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1299T>C	X.37:g.70824426T>C			B9EG62	Silent	SNP	ENST00000373695.1	37	CCDS35326.1																																																																																				0.453	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			
ADSSL1	122622	broad.mit.edu;hgsc.bcm.edu	37	14	105196283	105196283	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr14:105196283G>T	ENST00000332972.5	+	1	213	c.54G>T	c.(52-54)agG>agT	p.R18S	ADSSL1_ENST00000330877.2_Intron	NM_199165.1	NP_954634.1			adenylosuccinate synthase like 1									p.R18S(1)		central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		gtgGGCAGAGGCCCACGAACC	0.692																																																	1	Substitution - Missense(1)	kidney(1)											34.0	33.0	33.0					14																	105196283		2183	4271	6454	SO:0001583	missense	122622			AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000332972.5:c.54G>T	14.37:g.105196283G>T	ENSP00000333019:p.Arg18Ser			Missense_Mutation	SNP	ENST00000332972.5	37	CCDS9991.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148469	0.37923	.	.	ENSG00000185100	ENST00000332972	T	0.49139	0.79	0.471	0.471	0.16752	.	.	.	.	.	T	0.30759	0.0775	N	0.08118	0	0.80722	D	1	P	0.37500	0.597	B	0.42916	0.402	T	0.24154	-1.0168	8	0.87932	D	0	-10.3745	.	.	.	.	18	Q8N142-2	.	S	18	ENSP00000333019:R18S	ENSP00000333019:R18S	R	+	3	2	ADSSL1	104267328	0.028000	0.19301	0.187000	0.23214	0.043000	0.13939	-0.121000	0.10643	0.489000	0.27749	0.205000	0.17691	AGG		0.692	ADSSL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410531.1			
ALDH18A1	5832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	97366699	97366699	+	Splice_Site	SNP	T	T	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr10:97366699T>G	ENST00000371224.2	-	18	2345	c.2208A>C	c.(2206-2208)ggA>ggC	p.G736G	ALDH18A1_ENST00000371221.3_Splice_Site_p.G734G	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	736	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)	p.G736G(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		CCACTTCAGCTCCTGTGAAAA	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											118.0	116.0	117.0					10																	97366699		2203	4300	6503	SO:0001630	splice_region_variant	5832			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.2207-1A>C	10.37:g.97366699T>G			B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Silent	SNP	ENST00000371224.2	37	CCDS7443.1																																																																																				0.542	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1		NM_002860	Silent
ARFGAP2	84364	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	47193866	47193866	+	Missense_Mutation	SNP	A	A	G	rs369493716		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr11:47193866A>G	ENST00000524782.1	-	8	866	c.638T>C	c.(637-639)aTt>aCt	p.I213T	ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.I106T|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000426335.2_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	213	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.I213T(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTTCTTGCCAATGATGGAGCT	0.537																																																	1	Substitution - Missense(1)	kidney(1)						A	THR/ILE,THR/ILE	1,4401	2.1+/-5.4	0,1,2200	316.0	285.0	295.0		554,638	6.1	1.0	11		295	0,8596		0,0,4298	no	missense,missense	ARFGAP2	NM_001242832.1,NM_032389.4	89,89	0,1,6498	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	185/494,213/522	47193866	1,12997	2201	4298	6499	SO:0001583	missense	84364			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.638T>C	11.37:g.47193866A>G	ENSP00000434442:p.Ile213Thr		B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276919	0.80580	2.27E-4	0.0	ENSG00000149182	ENST00000524782;ENST00000419701;ENST00000525398;ENST00000525314;ENST00000528444	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.99	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	M	0.74258	2.255	0.80722	D	1	P;P	0.52061	0.95;0.745	P;B	0.53185	0.72;0.367	T	0.56269	-0.8007	10	0.34782	T	0.22	-15.0887	15.8218	0.78654	1.0:0.0:0.0:0.0	.	106;213	B4DX29;Q8N6H7	.;ARFG2_HUMAN	T	213;106;227;227;238	ENSP00000434442:I213T;ENSP00000389264:I106T;ENSP00000431939:I227T;ENSP00000434809:I227T;ENSP00000431684:I238T	ENSP00000389264:I106T	I	-	2	0	ARFGAP2	47150442	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.870000	0.92336	2.326000	0.78906	0.533000	0.62120	ATT		0.537	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1		NM_032389	
AXIN2	8313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	63554465	63554465	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr17:63554465C>T	ENST00000375702.5	-	1	382	c.274G>A	c.(274-276)Gct>Act	p.A92T	AXIN2_ENST00000307078.5_Missense_Mutation_p.A92T|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	92	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.A92T(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						AACAGGTAAGCACCGTCTTGA	0.552									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								1	Substitution - Missense(1)	kidney(1)											143.0	138.0	140.0					17																	63554465		2203	4300	6503	SO:0001583	missense	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.274G>A	17.37:g.63554465C>T	ENSP00000364854:p.Ala92Thr		Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	C	13.38	2.220192	0.39201	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.22336	1.96;1.96;1.96	4.91	4.91	0.64330	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	L	0.45228	1.405	0.80722	D	1	D;B;D	0.63046	0.992;0.016;0.992	P;B;P	0.62382	0.901;0.063;0.901	T	0.03193	-1.1062	10	0.16420	T	0.52	-10.5408	17.7206	0.88350	0.0:1.0:0.0:0.0	.	92;92;92	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	T	92	ENSP00000302625:A92T;ENSP00000441151:A92T;ENSP00000364854:A92T	ENSP00000302625:A92T	A	-	1	0	AXIN2	60984927	0.999000	0.42202	0.976000	0.42696	0.979000	0.70002	3.295000	0.51794	2.262000	0.75019	0.555000	0.69702	GCT		0.552	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1		NM_004655	
BAP1	8314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52441304	52441304	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr3:52441304G>A	ENST00000460680.1	-	7	937	c.466C>T	c.(466-468)Cag>Tag	p.Q156*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q156*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q156*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGCCATTCTGCTTCTCAGGG	0.577			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	1	Substitution - Nonsense(1)	kidney(1)											79.0	81.0	80.0					3																	52441304		2203	4300	6503	SO:0001587	stop_gained	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.466C>T	3.37:g.52441304G>A	ENSP00000417132:p.Gln156*		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	40	8.080308	0.98643	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-6.3818	20.3927	0.98949	0.0:0.0:1.0:0.0	.	.	.	.	X	156;156;77	.	ENSP00000296288:Q156X	Q	-	1	0	BAP1	52416344	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.824000	0.99380	2.833000	0.97629	0.655000	0.94253	CAG		0.577	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
FAXDC2	10826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	154200918	154200918	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr5:154200918C>T	ENST00000326080.5	-	8	1170	c.747G>A	c.(745-747)atG>atA	p.M249I	FAXDC2_ENST00000517938.1_Missense_Mutation_p.M226I|FAXDC2_ENST00000523997.1_5'Flank	NM_032385.3	NP_115761.2	Q96IV6	FXDC2_HUMAN	fatty acid hydroxylase domain containing 2	249					fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.M249I(1)									AGGAAAACCACATGGTGATGG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											193.0	202.0	199.0					5																	154200918		2123	4219	6342	SO:0001583	missense	10826			AF159165	CCDS43390.1	5q31-q32	2013-03-04	2013-03-04	2013-03-04	ENSG00000170271	ENSG00000170271		"""Fatty acid hydroxylase domain containing"""	1334	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 4"""	C5orf4		10843801	Standard	NM_032385		Approved	FLJ13758	uc003lvs.4	Q96IV6	OTTHUMG00000164141	ENST00000326080.5:c.747G>A	5.37:g.154200918C>T	ENSP00000320604:p.Met249Ile		B4DIE1|Q9BSX6|Q9H8C7	Missense_Mutation	SNP	ENST00000326080.5	37	CCDS43390.1	.	.	.	.	.	.	.	.	.	.	C	9.091	1.001830	0.19121	.	.	ENSG00000170271	ENST00000326080;ENST00000517938	D;D	0.82711	-1.64;-1.64	5.24	0.171	0.15026	Fatty acid hydroxylase (1);	0.663319	0.16294	N	0.220794	T	0.46946	0.1419	N	0.00422	-1.515	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10314	-1.0635	10	0.27785	T	0.31	.	3.4258	0.07410	0.2074:0.3672:0.3034:0.122	.	249	Q96IV6	CE004_HUMAN	I	249;226	ENSP00000320604:M249I;ENSP00000430286:M226I	ENSP00000320604:M249I	M	-	3	0	C5orf4	154181111	0.114000	0.22134	0.071000	0.20095	0.553000	0.35397	0.234000	0.17930	-0.290000	0.09025	-0.175000	0.13238	ATG		0.542	FAXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377429.1		NM_032385	
CALD1	800	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	134618353	134618353	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr7:134618353A>T	ENST00000361675.2	+	5	1062	c.833A>T	c.(832-834)gAa>gTa	p.E278V	CALD1_ENST00000543443.1_Intron|CALD1_ENST00000417172.1_Intron|CALD1_ENST00000393118.2_Intron|CALD1_ENST00000422748.1_Intron|CALD1_ENST00000361901.2_Intron|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000495522.1_Intron|CALD1_ENST00000361388.2_Intron			Q05682	CALD1_HUMAN	caldesmon 1	278					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.E278V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GAAGAAAGAGAAAGAATTAAA	0.438																																																	1	Substitution - Missense(1)	kidney(1)											53.0	61.0	58.0					7																	134618353		2203	4300	6503	SO:0001583	missense	800			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.833A>T	7.37:g.134618353A>T	ENSP00000354826:p.Glu278Val		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027816	0.35797	.	.	ENSG00000122786	ENST00000361675	T	0.42513	0.97	4.75	3.53	0.40419	.	0.320649	0.21088	N	0.080365	T	0.43567	0.1253	M	0.67953	2.075	0.80722	D	1	P	0.38300	0.626	P	0.45232	0.474	T	0.36890	-0.9729	9	.	.	.	-15.2432	5.3706	0.16136	0.7606:0.0:0.0844:0.155	.	278	Q05682	CALD1_HUMAN	V	278	ENSP00000354826:E278V	.	E	+	2	0	CALD1	134268893	0.988000	0.35896	0.981000	0.43875	0.534000	0.34807	3.689000	0.54706	1.766000	0.52107	0.460000	0.39030	GAA		0.438	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1		NM_033138	
MBD1	4152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	47792751	47792751	+	IGR	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr18:47792751G>A	ENST00000591416.1	-	0	4905				CCDC11_ENST00000398545.4_Silent_p.T8T			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.T8T(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CCCGCTGTACGGTGCCAAACC	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	102.0	99.0					18																	47792751		1967	4160	6127	SO:0001628	intergenic_variant	220136			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669		18.37:g.47792751G>A			A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	ENST00000591416.1	37	CCDS11943.1																																																																																				0.637	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3		NM_015846	
CHST15	51363	hgsc.bcm.edu	37	10	125780753	125780753	+	Intron	DEL	G	G	-	rs528840982|rs398015013|rs5788645|rs550185991	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr10:125780753delG	ENST00000346248.5	-	6	1990				CHST15_ENST00000435907.1_Intron|CHST15_ENST00000421115.1_Frame_Shift_Del_p.R456fs	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						CGGGGGGTACGGGGGGGGGGG	0.542													|||unknown(HR)	4042	0.807109	0.764	0.8429	5008	,	,		9633	0.874		0.829	False		,,,				2504	0.7485																0													5.0	5.0	5.0					10																	125780753		1998	3907	5905	SO:0001627	intron_variant	51363			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1347+18C>-	10.37:g.125780753delG			O60338|O60474|Q86VM4	Frame_Shift_Del	DEL	ENST00000346248.5	37	CCDS7638.1																																																																																				0.542	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1		NM_015892	
CR1	1378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	207758216	207758216	+	Missense_Mutation	SNP	G	G	A	rs200621891		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:207758216G>A	ENST00000367049.4	+	33	5525	c.5525G>A	c.(5524-5526)cGt>cAt	p.R1842H	RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000400960.2_Missense_Mutation_p.R1392H|CR1_ENST00000367053.1_Missense_Mutation_p.R1392H|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367052.1_Missense_Mutation_p.R1392H|CR1_ENST00000367051.1_Missense_Mutation_p.R1392H	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1392	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1397H(3)|p.R1842H(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTTTCTGTTCGTGCTGGTCAG	0.488																																																	5	Substitution - Missense(5)	lung(2)|kidney(2)|large_intestine(1)						A	HIS/ARG,HIS/ARG	0,3914		0,0,1957	107.0	107.0	107.0		4175,5525	-4.0	0.0	1		107	1,8299		0,1,4149	no	missense,missense	CR1	NM_000573.3,NM_000651.4	29,29	0,1,6106	AA,AG,GG		0.012,0.0,0.0082	benign,benign	1392/2040,1842/2490	207758216	1,12213	1957	4150	6107	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5525G>A	1.37:g.207758216G>A	ENSP00000356016:p.Arg1842His		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	g	2.643	-0.283651	0.05642	0.0	1.2E-4	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.33654	1.4;1.52;1.4;1.4;1.54;1.4	3.03	-3.96	0.04106	.	.	.	.	.	T	0.28300	0.0699	N	0.19112	0.55	0.09310	N	1	D;D;B	0.76494	0.999;0.996;0.013	D;P;B	0.66602	0.945;0.504;0.003	T	0.14090	-1.0485	9	0.15066	T	0.55	.	0.1311	0.00074	0.2976:0.2403:0.1519:0.3102	.	1392;1392;1842	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	H	1392;1392;1392;1392;942;1842	ENSP00000356019:R1392H;ENSP00000356018:R1392H;ENSP00000356020:R1392H;ENSP00000383744:R1392H;ENSP00000436139:R942H;ENSP00000356016:R1842H	ENSP00000356016:R1842H	R	+	2	0	CR1	205824839	0.000000	0.05858	0.000000	0.03702	0.318000	0.28184	-0.184000	0.09698	-1.009000	0.03400	-1.770000	0.00663	CGT		0.488	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1		NM_000573	
CSPG4	1464	hgsc.bcm.edu	37	15	75982085	75982085	+	Missense_Mutation	SNP	C	C	T	rs79463888	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr15:75982085C>T	ENST00000308508.5	-	3	1413	c.1321G>A	c.(1321-1323)Gag>Aag	p.E441K		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	441	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GTGCCCCCCTCGGCCACCACC	0.637																																																	0													43.0	42.0	43.0					15																	75982085		2197	4292	6489	SO:0001583	missense	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1321G>A	15.37:g.75982085C>T	ENSP00000312506:p.Glu441Lys		D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	18.26	3.584924	0.65992	.	.	ENSG00000173546	ENST00000308508	T	0.31510	1.49	5.26	5.26	0.73747	.	0.170667	0.41001	D	0.000974	T	0.48642	0.1511	M	0.78049	2.395	0.80722	D	1	D	0.71674	0.998	P	0.56278	0.795	T	0.52041	-0.8628	10	0.59425	D	0.04	.	11.3564	0.49617	0.0:0.9168:0.0:0.0831	.	441	Q6UVK1	CSPG4_HUMAN	K	441	ENSP00000312506:E441K	ENSP00000312506:E441K	E	-	1	0	CSPG4	73769140	1.000000	0.71417	0.998000	0.56505	0.513000	0.34164	4.634000	0.61325	2.463000	0.83235	0.555000	0.69702	GAG		0.637	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1		NM_001897	
DPP10	57628	hgsc.bcm.edu;ucsc.edu	37	2	116101463	116101463	+	Missense_Mutation	SNP	C	C	G	rs143448690	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr2:116101463C>G	ENST00000410059.1	+	3	726	c.246C>G	c.(244-246)caC>caG	p.H82Q	DPP10_ENST00000409163.1_Missense_Mutation_p.H32Q|DPP10_ENST00000393147.2_Missense_Mutation_p.H86Q|DPP10_ENST00000310323.8_Missense_Mutation_p.H75Q	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	82						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTGTGCTTCACGATCCAGAGG	0.333																																																	0													86.0	88.0	87.0					2																	116101463		2203	4300	6503	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.246C>G	2.37:g.116101463C>G	ENSP00000386565:p.His82Gln		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191142	0.58017	.	.	ENSG00000175497	ENST00000436732;ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000419287;ENST00000476155	T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.97	0.861	0.19048	.	0.060067	0.64402	D	0.000003	T	0.56920	0.2018	M	0.62723	1.935	0.39874	D	0.973542	D;D;D;D	0.76494	0.986;0.999;0.991;0.976	P;D;P;P	0.76575	0.758;0.988;0.751;0.577	T	0.53380	-0.8447	10	0.25106	T	0.35	-16.7035	7.4259	0.27098	0.0:0.3484:0.0:0.6516	.	75;86;78;82	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	Q	32;82;32;78;86;75;32;32	ENSP00000391092:H32Q;ENSP00000386565:H82Q;ENSP00000387038:H32Q;ENSP00000376854:H78Q;ENSP00000376855:H86Q;ENSP00000309066:H75Q;ENSP00000402499:H32Q	ENSP00000309066:H75Q	H	+	3	2	DPP10	115817933	0.998000	0.40836	0.998000	0.56505	0.970000	0.65996	0.122000	0.15687	0.169000	0.19679	-0.438000	0.05819	CAC		0.333	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4		NM_020868	
DNAH7	56171	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	196620981	196620981	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr2:196620981T>G	ENST00000312428.6	-	62	11562	c.11462A>C	c.(11461-11463)gAa>gCa	p.E3821A	DNAH7_ENST00000409063.1_Missense_Mutation_p.E304A	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3821					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.E3821A(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AACCACTTCTTCAAGATCTGT	0.363																																																	1	Substitution - Missense(1)	kidney(1)											115.0	106.0	109.0					2																	196620981		1837	4092	5929	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11462A>C	2.37:g.196620981T>G	ENSP00000311273:p.Glu3821Ala		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.738749	0.89573	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.11169	2.8;2.8	5.23	5.23	0.72850	Dynein heavy chain (1);	0.188120	0.45606	D	0.000351	T	0.47801	0.1465	H	0.98542	4.26	0.80722	D	1	P	0.46656	0.882	P	0.59288	0.855	T	0.67381	-0.5685	10	0.87932	D	0	.	14.9369	0.70964	0.0:0.0:0.0:1.0	.	3821	Q8WXX0	DYH7_HUMAN	A	3821;304	ENSP00000311273:E3821A;ENSP00000386912:E304A	ENSP00000311273:E3821A	E	-	2	0	DNAH7	196329226	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.351000	0.79395	2.193000	0.70182	0.528000	0.53228	GAA		0.363	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		NM_018897	
DUSP5	1847	broad.mit.edu;hgsc.bcm.edu	37	10	112269965	112269966	+	Missense_Mutation	DNP	GT	GT	TC			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr10:112269965_112269966GT>TC	ENST00000369583.3	+	4	1220_1221	c.936_937GT>TC	c.(934-939)caGTac>caTCac	p.312_313QY>HH	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	312	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Q312H(2)|p.Y313H(2)		kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		AGCTCCTGCAGTACGAATCTGA	0.584																																																	4	Substitution - Missense(4)	kidney(4)																																								SO:0001583	missense	1847			U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	Exception_encountered	10.37:g.112269965_112269966delinsTC	ENSP00000358596:p.Q312_Y313delinsHH		Q12997|Q5T603	Missense_Mutation	SNP	ENST00000369583.3	37	CCDS7566.1																																																																																				0.584	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050333.1		NM_004419	
EHBP1L1	254102	broad.mit.edu;ucsc.edu	37	11	65348529	65348529	+	Splice_Site	SNP	A	A	C	rs199770292		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr11:65348529A>C	ENST00000309295.4	+	7	900	c.635A>C	c.(634-636)gAt>gCt	p.D212A		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	212						membrane (GO:0016020)		p.D212A(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CCATTCCCAGATCCCTCTCGA	0.647																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					11																	65348529		1974	4155	6129	SO:0001630	splice_region_variant	254102			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.635-1A>C	11.37:g.65348529A>C			Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	A	11.58	1.681806	0.29872	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.81415	-0.16;-1.49	5.01	2.65	0.31530	.	0.663342	0.13273	N	0.400395	T	0.64316	0.2587	L	0.34521	1.04	0.29440	N	0.859243	P	0.35328	0.495	B	0.27170	0.077	T	0.55166	-0.8183	9	.	.	.	.	4.8576	0.13566	0.7112:0.19:0.0988:0.0	.	212	Q8N3D4	EH1L1_HUMAN	A	212	ENSP00000312671:D212A;ENSP00000431996:D212A	.	D	+	2	0	EHBP1L1	65105105	0.969000	0.33509	0.011000	0.14972	0.071000	0.16799	2.306000	0.43673	0.254000	0.21573	-0.435000	0.05868	GAT		0.647	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1		XM_170658	Missense_Mutation
FBN1	2200	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	48748913	48748913	+	Silent	SNP	C	C	A	rs140649	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr15:48748913C>A	ENST00000316623.5	-	44	5798	c.5343G>T	c.(5341-5343)gtG>gtT	p.V1781V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1781	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.V1781V(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGTTGATACACACTCCATTTT	0.453																																																	1	Substitution - coding silent(1)	kidney(1)	GRCh37	CS077359	FBN1	S	rs140649						149.0	129.0	136.0					15																	48748913		2198	4296	6494	SO:0001819	synonymous_variant	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5343G>T	15.37:g.48748913C>A			B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																				0.453	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			
FLG	2312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	152279668	152279668	+	Missense_Mutation	SNP	G	G	T	rs182787187	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:152279668G>T	ENST00000368799.1	-	3	7729	c.7694C>A	c.(7693-7695)tCc>tAc	p.S2565Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2565	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2565Y(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTAAAACTGGATCCCCAGTT	0.582									Ichthyosis																																								1	Substitution - Missense(1)	kidney(1)											183.0	195.0	191.0					1																	152279668		2201	4300	6501	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7694C>A	1.37:g.152279668G>T	ENSP00000357789:p.Ser2565Tyr		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318041	0.23994	.	.	ENSG00000143631	ENST00000368799	T	0.09073	3.02	3.61	-1.31	0.09230	.	.	.	.	.	T	0.09730	0.0239	M	0.80982	2.52	0.09310	N	1	D	0.59357	0.985	P	0.61003	0.882	T	0.05338	-1.0891	9	0.56958	D	0.05	.	4.6943	0.12795	0.2169:0.3381:0.445:0.0	.	2565	P20930	FILA_HUMAN	Y	2565	ENSP00000357789:S2565Y	ENSP00000357789:S2565Y	S	-	2	0	FLG	150546292	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.277000	0.18734	-0.589000	0.05874	0.306000	0.20318	TCC		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1		NM_002016	
HOOK3	84376	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	42821725	42821725	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr8:42821725C>T	ENST00000307602.4	+	10	1089	c.889C>T	c.(889-891)Cag>Tag	p.Q297*		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	297					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.Q297*(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			AGATGAAGCTCAGTCTCTGAA	0.453			T	RET	papillary thyroid																																			Dom	yes		8	8p11.21	84376	hook homolog 3		E	1	Substitution - Nonsense(1)	kidney(1)											165.0	150.0	155.0					8																	42821725		2203	4300	6503	SO:0001587	stop_gained	84376			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.889C>T	8.37:g.42821725C>T	ENSP00000305699:p.Gln297*		D3DSY8|Q8NBH0|Q9BY13	Nonsense_Mutation	SNP	ENST00000307602.4	37	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	C	39	7.410522	0.98265	.	.	ENSG00000168172	ENST00000307602	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-18.8039	19.7375	0.96212	0.0:1.0:0.0:0.0	.	.	.	.	X	297	.	ENSP00000305699:Q297X	Q	+	1	0	HOOK3	42940882	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.773000	0.85462	2.834000	0.97654	0.650000	0.86243	CAG		0.453	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2		NM_032410	
KCNQ5	56479	broad.mit.edu;ucsc.edu	37	6	73904280	73904280	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr6:73904280C>A	ENST00000370398.1	+	14	2051	c.1942C>A	c.(1942-1944)Cct>Act	p.P648T	KCNQ5_ENST00000355635.3_Missense_Mutation_p.P649T|KCNQ5_ENST00000355194.4_Missense_Mutation_p.P648T|KCNQ5_ENST00000414165.2_Missense_Mutation_p.P538T|KCNQ5_ENST00000342056.2_Missense_Mutation_p.P667T|KCNQ5_ENST00000403813.2_Missense_Mutation_p.P639T|KCNQ5_ENST00000402622.2_Missense_Mutation_p.P658T	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	648					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.P648T(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CCAGATCCCACCTTTTGAATG	0.483																																					GBM(142;1375 1859 14391 23261 44706)												1	Substitution - Missense(1)	kidney(1)											93.0	88.0	90.0					6																	73904280		2203	4300	6503	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1942C>A	6.37:g.73904280C>A	ENSP00000359425:p.Pro648Thr		A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528261	0.27299	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99304	-5.53;-5.52;-5.53;-5.52;-5.53;-5.56;-5.72	5.47	4.61	0.57282	.	0.197005	0.45606	D	0.000357	D	0.96682	0.8917	L	0.43152	1.355	0.24021	N	0.996142	P;B;B;B;B	0.52692	0.955;0.05;0.013;0.05;0.016	P;B;B;B;B	0.49922	0.626;0.015;0.01;0.015;0.007	D	0.93377	0.6740	10	0.11485	T	0.65	.	10.8475	0.46751	0.0:0.7866:0.1397:0.0737	.	538;658;667;639;648	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	T	667;667;648;648;658;649;639;538	ENSP00000345055:P667T;ENSP00000347326:P648T;ENSP00000359425:P648T;ENSP00000385501:P658T;ENSP00000347853:P649T;ENSP00000384453:P639T;ENSP00000409861:P538T	ENSP00000345055:P667T	P	+	1	0	KCNQ5	73961001	0.980000	0.34600	0.998000	0.56505	0.997000	0.91878	3.226000	0.51254	1.312000	0.45043	0.561000	0.74099	CCT		0.483	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3		NM_019842	
IST1	9798	broad.mit.edu;hgsc.bcm.edu	37	16	71956438	71956438	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr16:71956438A>C	ENST00000378799.6	+	7	970	c.614A>C	c.(613-615)aAg>aCg	p.K205T	IST1_ENST00000538850.1_Missense_Mutation_p.K57T|IST1_ENST00000538565.1_3'UTR|IST1_ENST00000378798.5_Missense_Mutation_p.K205T|IST1_ENST00000329908.8_Missense_Mutation_p.K205T|IST1_ENST00000535424.1_Missense_Mutation_p.K218T|IST1_ENST00000544564.1_Missense_Mutation_p.K205T|IST1_ENST00000541571.2_Missense_Mutation_p.K205T|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000606369.1_Missense_Mutation_p.K57T			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	205	Interaction with VPS37B.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)	p.K205T(1)									GATGATGTGAAGAAAGGAGGC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											135.0	129.0	131.0					16																	71956438		2198	4300	6498	SO:0001583	missense	0			BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.614A>C	16.37:g.71956438A>C	ENSP00000368076:p.Lys205Thr		A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Missense_Mutation	SNP	ENST00000378799.6	37	CCDS59272.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.677772	0.68042	.	.	ENSG00000182149	ENST00000535424;ENST00000378799;ENST00000538963;ENST00000329908;ENST00000538850;ENST00000378798;ENST00000456820	.	.	.	5.54	5.54	0.83059	.	0.041579	0.85682	D	0.000000	T	0.53334	0.1790	L	0.42245	1.32	0.53005	D	0.999969	D;P;D;D	0.55800	0.973;0.763;0.96;0.973	P;P;P;P	0.54174	0.544;0.463;0.744;0.544	T	0.49978	-0.8881	9	0.27082	T	0.32	-20.031	9.3747	0.38275	0.9206:0.0:0.0794:0.0	.	205;205;205;218	P53990;P53990-2;P53990-3;A8KAH5	IST1_HUMAN;.;.;.	T	218;205;194;205;57;205;143	.	ENSP00000330408:K205T	K	+	2	0	KIAA0174	70513939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.237000	0.72345	2.110000	0.64415	0.533000	0.62120	AAG		0.517	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2		NM_014761	
MAMLD1	10046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	149638089	149638089	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chrX:149638089A>C	ENST00000370401.2	+	4	554	c.244A>C	c.(244-246)Aaa>Caa	p.K82Q	MAMLD1_ENST00000432680.2_Missense_Mutation_p.K57Q|MAMLD1_ENST00000426613.2_Missense_Mutation_p.K57Q|MAMLD1_ENST00000468306.1_3'UTR|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.K82Q			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	82					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.K57Q(1)|p.K9Q(1)|p.K82Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CTACCCTAATAAAATTAAGAG	0.488																																																	3	Substitution - Missense(3)	kidney(3)											88.0	90.0	89.0					X																	149638089		2203	4300	6503	SO:0001583	missense	10046			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.244A>C	X.37:g.149638089A>C	ENSP00000359428:p.Lys82Gln		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	A	13.17	2.157454	0.38119	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000358892;ENST00000262858;ENST00000426613	T;T;T;T	0.66460	0.2;-0.21;0.2;0.2	5.36	2.95	0.34219	.	0.357176	0.28700	N	0.014431	T	0.59770	0.2218	L	0.41236	1.265	0.80722	D	1	D;B;B;B	0.62365	0.991;0.141;0.1;0.141	P;B;B;B	0.53593	0.73;0.067;0.111;0.116	T	0.56786	-0.7921	10	0.30854	T	0.27	-4.5572	2.2327	0.04001	0.3437:0.3085:0.3478:0.0	.	44;57;57;82	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	Q	44;82;57;82;82;57	ENSP00000359428:K82Q;ENSP00000414517:K57Q;ENSP00000262858:K82Q;ENSP00000397438:K57Q	ENSP00000262858:K82Q	K	+	1	0	MAMLD1	149388747	1.000000	0.71417	0.976000	0.42696	0.986000	0.74619	3.292000	0.51772	0.667000	0.31107	0.486000	0.48141	AAA		0.488	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2		NM_005491	
MAPK15	225689	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	144800451	144800451	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr8:144800451T>A	ENST00000338033.4	+	4	384	c.265T>A	c.(265-267)Tac>Aac	p.Y89N	RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395107.4_Missense_Mutation_p.Y89N|MAPK15_ENST00000395108.2_Missense_Mutation_p.Y89N	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	89	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)	p.Y108N(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGGGACATTTACCTGGTGTT	0.627																																																	1	Substitution - Missense(1)	kidney(1)											61.0	48.0	53.0					8																	144800451		2203	4300	6503	SO:0001583	missense	225689			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.265T>A	8.37:g.144800451T>A	ENSP00000337691:p.Tyr89Asn		Q2TCF9|Q8N362	Missense_Mutation	SNP	ENST00000338033.4	37	CCDS6409.2	.	.	.	.	.	.	.	.	.	.	t	27.3	4.816240	0.90790	.	.	ENSG00000181085	ENST00000338033;ENST00000395107;ENST00000395108	T;T;T	0.69040	-0.37;-0.37;-0.37	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.133863	0.52532	D	0.000076	D	0.82990	0.5157	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86039	0.1518	10	0.87932	D	0	.	14.0488	0.64722	0.0:0.0:0.0:1.0	.	89	Q8TD08	MK15_HUMAN	N	89	ENSP00000337691:Y89N;ENSP00000378539:Y89N;ENSP00000378540:Y89N	ENSP00000337691:Y89N	Y	+	1	0	MAPK15	144872439	1.000000	0.71417	0.998000	0.56505	0.700000	0.40528	7.834000	0.86773	2.014000	0.59158	0.408000	0.27601	TAC		0.627	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1		NM_139021	
MAST2	23139	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	46497886	46497886	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:46497886C>T	ENST00000361297.2	+	25	3507	c.3224C>T	c.(3223-3225)tCc>tTc	p.S1075F	MAST2_ENST00000372009.2_Missense_Mutation_p.S1005F	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.S1075F(1)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					AGCCCCATGTCCCCACATTCT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											79.0	86.0	84.0					1																	46497886		2027	4191	6218	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3224C>T	1.37:g.46497886C>T	ENSP00000354671:p.Ser1075Phe			Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765138	0.90020	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.73789	-0.78;-0.28	4.76	4.76	0.60689	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	D	0.87853	0.6282	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.89753	0.3941	10	0.87932	D	0	-17.7103	18.3314	0.90270	0.0:1.0:0.0:0.0	.	1005;1075	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	F	1075;1005	ENSP00000354671:S1075F;ENSP00000361079:S1005F	ENSP00000354671:S1075F	S	+	2	0	MAST2	46270473	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.609000	0.82925	2.622000	0.88805	0.561000	0.74099	TCC		0.602	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1		NM_015112	
MCM4	4173	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	48889311	48889311	+	Silent	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr8:48889311G>T	ENST00000262105.2	+	16	2774	c.2565G>T	c.(2563-2565)gtG>gtT	p.V855V	MCM4_ENST00000523944.1_Silent_p.V855V|RNU6-519P_ENST00000410590.1_RNA	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	855					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.V855V(1)		biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TCCTGACAGTGACTGGGAAGA	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											151.0	136.0	141.0					8																	48889311		2203	4300	6503	SO:0001819	synonymous_variant	4173				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.2565G>T	8.37:g.48889311G>T			Q8NEH1|Q99658	Silent	SNP	ENST00000262105.2	37	CCDS6143.1																																																																																				0.498	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1		NM_005914	
NARF	26502	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	80436689	80436689	+	Silent	SNP	C	C	T	rs374759625		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr17:80436689C>T	ENST00000309794.11	+	6	732	c.534C>T	c.(532-534)taC>taT	p.Y178Y	NARF_ENST00000581743.1_3'UTR|NARF_ENST00000412079.2_Silent_p.Y50Y|RP13-991F5.2_ENST00000582249.1_RNA|NARF_ENST00000457415.3_Silent_p.Y178Y|NARF_ENST00000390006.4_Silent_p.Y119Y|NARF_ENST00000345415.7_Silent_p.Y130Y	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	178						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.Y178Y(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GGGTCCGATACGCCGAGCGGG	0.617																																																	1	Substitution - coding silent(1)	kidney(1)						C	,,,	0,4406		0,0,2203	44.0	40.0	41.0		357,390,534,534	-3.1	0.1	17		41	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NARF	NM_001038618.2,NM_001083608.1,NM_012336.3,NM_031968.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	119/398,130/409,178/457,178/503	80436689	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26502			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.534C>T	17.37:g.80436689C>T			A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Silent	SNP	ENST00000309794.11	37	CCDS32777.1																																																																																				0.617	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2		NM_031968	
NFATC4	4776	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24845237	24845237	+	Silent	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr14:24845237C>T	ENST00000250373.4	+	8	2127	c.1986C>T	c.(1984-1986)gtC>gtT	p.V662V	NFATC4_ENST00000555453.1_Silent_p.V650V|NFATC4_ENST00000422617.3_Silent_p.V650V|NFATC4_ENST00000555167.1_Silent_p.V197V|NFATC4_ENST00000424781.2_Silent_p.V675V|NFATC4_ENST00000557451.1_Silent_p.V592V|NFATC4_ENST00000554050.1_Silent_p.V662V|NFATC4_ENST00000554966.1_Silent_p.V675V|NFATC4_ENST00000557767.1_5'UTR|NFATC4_ENST00000553879.1_Silent_p.V592V|NFATC4_ENST00000555590.1_Silent_p.V675V|NFATC4_ENST00000413692.2_Silent_p.V725V|NFATC4_ENST00000539237.2_Silent_p.V694V|NFATC4_ENST00000554661.1_Silent_p.V592V|NFATC4_ENST00000556279.1_Silent_p.V694V|NFATC4_ENST00000555802.1_5'UTR|NFATC4_ENST00000553708.1_Silent_p.V662V|NFATC4_ENST00000554473.1_Silent_p.V197V|NFATC4_ENST00000554344.1_Silent_p.V592V|NFATC4_ENST00000556169.1_Silent_p.V650V|NFATC4_ENST00000555393.1_5'UTR|NFATC4_ENST00000554591.1_Silent_p.V725V|NFATC4_ENST00000553469.1_Silent_p.V694V|NFATC4_ENST00000556759.1_Silent_p.V197V	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	662	IPT/TIG.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)	p.V725V(1)|p.V662V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCCGGCCAGTCCAGGTCTACT	0.582																																																	2	Substitution - coding silent(2)	kidney(2)											111.0	122.0	118.0					14																	24845237		2203	4300	6503	SO:0001819	synonymous_variant	4776			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1986C>T	14.37:g.24845237C>T			B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	ENST00000250373.4	37	CCDS9629.1																																																																																				0.582	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6		NM_004554	
NFE2L3	9603	broad.mit.edu;hgsc.bcm.edu	37	7	26225394	26225394	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr7:26225394G>T	ENST00000056233.3	+	4	2335	c.2076G>T	c.(2074-2076)aaG>aaT	p.K692N		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	692					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K692N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AAAAGGGAAAGAGAAAGTGAG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											31.0	31.0	31.0					7																	26225394		2127	4264	6391	SO:0001583	missense	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.2076G>T	7.37:g.26225394G>T	ENSP00000056233:p.Lys692Asn		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	37	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861479	0.51482	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.44482	0.92	5.3	-1.74	0.08056	.	0.396664	0.29501	N	0.011969	T	0.36303	0.0962	M	0.76328	2.33	0.31892	N	0.61707	P	0.47841	0.901	B	0.40940	0.344	T	0.47812	-0.9088	10	0.87932	D	0	-12.36	6.1167	0.20130	0.4003:0.1195:0.4802:0.0	.	692	Q9Y4A8	NF2L3_HUMAN	N	692;397	ENSP00000056233:K692N	ENSP00000056233:K692N	K	+	3	2	NFE2L3	26191919	0.505000	0.26131	0.647000	0.29507	0.930000	0.56654	-0.337000	0.07852	-0.327000	0.08551	-0.229000	0.12294	AAG		0.403	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1			
OLFM4	10562	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	53603018	53603018	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr13:53603018G>T	ENST00000219022.2	+	1	125	c.47G>T	c.(46-48)gGc>gTc	p.G16V		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	16					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)	p.G16V(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TTCTTCCTTGGCCAAGCTGCA	0.592																																																	1	Substitution - Missense(1)	kidney(1)											118.0	121.0	120.0					13																	53603018		2203	4300	6503	SO:0001583	missense	10562			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.47G>T	13.37:g.53603018G>T	ENSP00000219022:p.Gly16Val		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863476	0.32884	.	.	ENSG00000102837	ENST00000219022	D	0.92249	-3.0	4.03	2.16	0.27623	.	1.111320	0.06809	N	0.790113	D	0.87877	0.6288	L	0.50333	1.59	0.09310	N	0.999997	P	0.44877	0.845	B	0.36719	0.231	T	0.78219	-0.2289	10	0.87932	D	0	.	6.3305	0.21266	0.2418:0.0:0.7582:0.0	.	16	Q6UX06	OLFM4_HUMAN	V	16	ENSP00000219022:G16V	ENSP00000219022:G16V	G	+	2	0	OLFM4	52501019	0.000000	0.05858	0.001000	0.08648	0.344000	0.29017	-0.313000	0.08103	0.575000	0.29434	0.655000	0.94253	GGC		0.592	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2		NM_006418	
OR52A4	390053	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	5142378	5142378	+	RNA	SNP	A	A	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr11:5142378A>G	ENST00000498233.1	-	0	1014							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L144P(1)		breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATAAGTGACTAGCTGTCGAGT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											73.0	66.0	68.0					11																	5142378		2201	4298	6499			390053					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142378A>G				Missense_Mutation	SNP	ENST00000498233.1	37		.	.	.	.	.	.	.	.	.	.	A	1.449	-0.565503	0.03939	.	.	ENSG00000248953	ENST00000380369	.	.	.	4.07	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.66607	0.2806	.	.	.	0.24066	N	0.995997	D	0.71674	0.998	D	0.76071	0.987	T	0.70178	-0.4943	6	0.87932	D	0	.	6.2324	0.20742	0.7511:0.1597:0.0892:0.0	.	144	A6NMU1	O52A4_HUMAN	P	144	.	ENSP00000369727:L144P	L	-	2	0	OR52A4	5098954	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.335000	0.07873	0.203000	0.20529	0.528000	0.53228	CTA		0.463	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1		NG_029079	
PABPC3	5042	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	25670501	25670501	+	Silent	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr13:25670501G>A	ENST00000281589.3	+	1	202	c.165G>A	c.(163-165)gcG>gcA	p.A55A		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	55	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.A55A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CCAACTACGCGTATGTGAACT	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											87.0	80.0	82.0					13																	25670501		2203	4300	6503	SO:0001819	synonymous_variant	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.165G>A	13.37:g.25670501G>A			Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																				0.547	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PCDHA8	56140	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140221437	140221437	+	Silent	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr5:140221437C>T	ENST00000531613.1	+	1	531	c.531C>T	c.(529-531)taC>taT	p.Y177Y	PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.Y177Y|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	177	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Y177Y(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCATGATTACTTCATGCTAG	0.468																																																	2	Substitution - coding silent(2)	kidney(2)											64.0	69.0	67.0					5																	140221437		2203	4300	6503	SO:0001819	synonymous_variant	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.531C>T	5.37:g.140221437C>T			B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																				0.468	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2		NM_018911	
PCDHGA7	56108	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140764005	140764005	+	Silent	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr5:140764005C>T	ENST00000518325.1	+	1	1539	c.1539C>T	c.(1537-1539)gtC>gtT	p.V513V	PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	513	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V513V(1)		NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACACTGGAGTCCTGTACGCGC	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	51.0	50.0					5																	140764005		2057	4229	6286	SO:0001819	synonymous_variant	56108			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.1539C>T	5.37:g.140764005C>T			B2RN87|Q9Y5D0	Silent	SNP	ENST00000518325.1	37	CCDS54927.1																																																																																				0.512	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1		NM_018920	
PIGR	5284	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	207110826	207110826	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:207110826C>A	ENST00000356495.4	-	4	842	c.659G>T	c.(658-660)tGc>tTc	p.C220F		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	220	Ig-like V-type 2.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.C220F(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCCAGCCTGGCAGAGATACTG	0.502																																																	1	Substitution - Missense(1)	kidney(1)											64.0	62.0	63.0					1																	207110826		2203	4300	6503	SO:0001583	missense	5284				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.659G>T	1.37:g.207110826C>A	ENSP00000348888:p.Cys220Phe		Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909642	0.72868	.	.	ENSG00000162896	ENST00000356495	T	0.35048	1.33	5.79	5.79	0.91817	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.159402	0.46145	D	0.000307	T	0.61874	0.2382	M	0.79614	2.46	0.52501	D	0.999957	D	0.89917	1.0	D	0.80764	0.994	T	0.64761	-0.6331	10	0.87932	D	0	-15.8995	15.5321	0.75970	0.0:1.0:0.0:0.0	.	220	P01833	PIGR_HUMAN	F	220	ENSP00000348888:C220F	ENSP00000348888:C220F	C	-	2	0	PIGR	205177449	0.998000	0.40836	0.811000	0.32455	0.015000	0.08874	3.900000	0.56295	2.743000	0.94032	0.655000	0.94253	TGC		0.502	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1		NM_002644	
PLB1	151056	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	28752601	28752601	+	Silent	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr2:28752601G>A	ENST00000327757.5	+	8	467	c.423G>A	c.(421-423)ttG>ttA	p.L141L	PLB1_ENST00000422425.2_Silent_p.L141L	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	141	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.L141L(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					ACAGAGACTTGTGGATTCAGG	0.498																																																	2	Substitution - coding silent(2)	kidney(2)											106.0	99.0	101.0					2																	28752601		2203	4300	6503	SO:0001819	synonymous_variant	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.423G>A	2.37:g.28752601G>A			A8KAX2|Q53S03|Q8IUP7|Q96DP9	Silent	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	G	2.802	-0.248939	0.05867	.	.	ENSG00000163803	ENST00000404858	.	.	.	5.87	-0.107	0.13592	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.21416	N	0.999694	.	.	.	.	.	.	T	0.30592	-0.9973	4	.	.	.	-18.7646	9.1216	0.36791	0.4641:0.0:0.5359:0.0	.	.	.	.	Y	140	.	.	C	+	2	0	PLB1	28606105	0.556000	0.26538	0.002000	0.10522	0.027000	0.11550	0.251000	0.18257	-0.069000	0.12931	-0.140000	0.14226	TGT		0.498	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			
POU2AF1	5450	broad.mit.edu;ucsc.edu	37	11	111228240	111228240	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr11:111228240G>C	ENST00000393067.3	-	4	900	c.386C>G	c.(385-387)cCc>cGc	p.P129R		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	129					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.P129R(1)		breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		CGTGTAGCTGGGGCACACGGG	0.602			T	BCL6	NHL																																			Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	1	Substitution - Missense(1)	kidney(1)											68.0	59.0	62.0					11																	111228240		2201	4297	6498	SO:0001583	missense	5450				CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.386C>G	11.37:g.111228240G>C	ENSP00000376786:p.Pro129Arg		B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	37	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005075	0.74932	.	.	ENSG00000110777	ENST00000393067	T	0.50277	0.75	4.95	4.95	0.65309	.	0.135348	0.49916	D	0.000122	T	0.56731	0.2005	L	0.48642	1.525	0.37866	D	0.929882	D	0.59357	0.985	P	0.58820	0.846	T	0.64275	-0.6446	10	0.87932	D	0	-4.2434	12.8574	0.57892	0.0:0.0:0.8368:0.1632	.	129	Q16633	OBF1_HUMAN	R	129	ENSP00000376786:P129R	ENSP00000376786:P129R	P	-	2	0	POU2AF1	110733450	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.634000	0.67833	2.302000	0.77476	0.492000	0.49549	CCC		0.602	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1		NM_006235	
PTPRQ	374462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	80887186	80887186	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr12:80887186A>G	ENST00000266688.5	+	15	1480	c.1480A>G	c.(1480-1482)Aaa>Gaa	p.K494E				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	540	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)	p.K494E(1)		breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CCATCCAGATAAAAACTTTCC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											95.0	88.0	90.0					12																	80887186		692	1591	2283	SO:0001583	missense	374462			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.1480A>G	12.37:g.80887186A>G	ENSP00000266688:p.Lys494Glu			Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.276|0.276	-0.989568|-0.989568	0.02162|0.02162	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.34667	.|1.35	5.09|5.09	-0.00375|-0.00375	0.14025|0.14025	.|Fibronectin, type III (2);	.|.	.|.	.|.	.|.	T|T	0.12774|0.12774	0.0310|0.0310	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.11329	.|0.006	T|T	0.33189|0.33189	-0.9878|-0.9878	4|8	.|0.02654	.|T	.|1	.|.	4.8971|4.8971	0.13755|0.13755	0.3786:0.1807:0.4407:0.0|0.3786:0.1807:0.4407:0.0	.|.	.|540	.|Q9UMZ3	.|PTPRQ_HUMAN	M|E	194|494	.|ENSP00000266688:K494E	.|ENSP00000266688:K494E	I|K	+|+	3|1	3|0	PTPRQ|PTPRQ	79411317|79411317	0.005000|0.005000	0.15991|0.15991	0.008000|0.008000	0.14137|0.14137	0.002000|0.002000	0.02628|0.02628	0.913000|0.913000	0.28611|0.28611	-0.017000|-0.017000	0.14103|0.14103	-1.087000|-1.087000	0.02190|0.02190	ATA|AAA		0.393	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001145026	
RBCK1	10616	broad.mit.edu;hgsc.bcm.edu	37	20	402784	402784	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr20:402784G>A	ENST00000356286.5	+	8	1636	c.931G>A	c.(931-933)Ggc>Agc	p.G311S	RBCK1_ENST00000382181.2_Missense_Mutation_p.G141S|RBCK1_ENST00000353660.3_Missense_Mutation_p.G269S	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1	311					negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G269S(1)|p.G311S(1)		kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				GTGCCTGCAGGGCACCATCCG	0.612																																																	2	Substitution - Missense(2)	kidney(2)											88.0	82.0	84.0					20																	402784		2203	4300	6503	SO:0001583	missense	10616			U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.931G>A	20.37:g.402784G>A	ENSP00000348632:p.Gly311Ser		O95623|Q86SL2|Q96BS3|Q9BYM9	Missense_Mutation	SNP	ENST00000356286.5	37	CCDS13000.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	19.61|19.61	3.859429|3.859429	0.71834|0.71834	.|.	.|.	ENSG00000125826|ENSG00000125826	ENST00000400244|ENST00000356286;ENST00000353660;ENST00000382181	.|T;T;T	.|0.71461	.|-0.57;-0.26;0.91	5.07|5.07	5.07|5.07	0.68467|0.68467	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.115728|0.115728	0.56097|0.56097	D|D	0.000024|0.000024	T|T	0.50837|0.50837	0.1639|0.1639	N|N	0.16656|0.16656	0.425|0.425	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.30824	.|0.296;0.235;0.056	.|B;B;B	.|0.28305	.|0.046;0.069;0.088	T|T	0.49634|0.49634	-0.8919|-0.8919	7|10	0.54805|0.08837	T|T	0.06|0.75	-24.3|-24.3	13.806|13.806	0.63233|0.63233	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|141;269;311	.|A6PVK0;Q9BYM8-3;Q9BYM8	.|.;.;HOIL1_HUMAN	E|S	257|311;269;141	.|ENSP00000348632:G311S;ENSP00000254960:G269S;ENSP00000371616:G141S	ENSP00000383103:G257E|ENSP00000254960:G269S	G|G	+|+	2|1	0|0	RBCK1|RBCK1	350784|350784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.399000|5.399000	0.66314|0.66314	2.640000|2.640000	0.89533|0.89533	0.462000|0.462000	0.41574|0.41574	GGG|GGC		0.612	RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077461.3		NM_031229	
SPAG4	6676	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	34207221	34207221	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr20:34207221G>T	ENST00000374273.3	+	9	1010	c.898G>T	c.(898-900)Gtt>Ttt	p.V300F		NM_003116.1	NP_003107.1	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	300	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|motile cilium (GO:0031514)	structural molecule activity (GO:0005198)	p.V300F(1)		NS(1)|cervix(5)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GCCGCCCACGGTTATCCTGGA	0.602																																																	1	Substitution - Missense(1)	kidney(1)											80.0	81.0	80.0					20																	34207221		2203	4300	6503	SO:0001583	missense	6676			AF043344	CCDS13259.1	20q11.2	2010-04-23			ENSG00000061656	ENSG00000061656			11214	protein-coding gene	gene with protein product	"""acrosomal protein ACR55"", ""Sad1 and UNC84 domain containing 4"", ""cancer/testis antigen 127"""	603038				9691178, 10373309	Standard	NM_003116		Approved	SUN4, CT127	uc002xdb.1	Q9NPE6	OTTHUMG00000032352	ENST00000374273.3:c.898G>T	20.37:g.34207221G>T	ENSP00000363391:p.Val300Phe		O43648	Missense_Mutation	SNP	ENST00000374273.3	37	CCDS13259.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567753	0.86439	.	.	ENSG00000061656	ENST00000374273;ENST00000454819	T;T	0.46819	0.86;0.86	4.87	4.87	0.63330	Sad1/UNC-like, C-terminal (2);	0.300114	0.32244	N	0.006371	T	0.61009	0.2313	M	0.81802	2.56	0.42183	D	0.99169	P;P	0.51147	0.782;0.942	P;P	0.51487	0.521;0.671	T	0.67968	-0.5533	10	0.87932	D	0	-3.323	13.7084	0.62654	0.0:0.0:1.0:0.0	.	175;300	C9JJZ6;Q9NPE6	.;SPAG4_HUMAN	F	300;175	ENSP00000363391:V300F;ENSP00000396670:V175F	ENSP00000363391:V300F	V	+	1	0	SPAG4	33670635	0.996000	0.38824	0.989000	0.46669	0.956000	0.61745	3.078000	0.50096	2.695000	0.91970	0.462000	0.41574	GTT		0.602	SPAG4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078896.1		NM_003116	
SPTA1	6708	broad.mit.edu;ucsc.edu	37	1	158609798	158609798	+	Splice_Site	SNP	C	C	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:158609798C>G	ENST00000368147.4	-	34	4918		c.e34-1			NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.?(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCAGTTGCTCCTAACCCAAGG	0.478																																																	1	Unknown(1)	kidney(1)											153.0	137.0	142.0					1																	158609798		1931	4139	6070	SO:0001630	splice_region_variant	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4738-1G>C	1.37:g.158609798C>G			Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Splice_Site	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730749	0.48939	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3266	0.82986	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTA1	156876422	1.000000	0.71417	0.255000	0.24374	0.020000	0.10135	6.089000	0.71384	2.882000	0.98803	0.655000	0.94253	.		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	Intron
TAS2R31	259290	broad.mit.edu;hgsc.bcm.edu	37	12	11183307	11183307	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr12:11183307G>T	ENST00000390675.2	-	1	699	c.628C>A	c.(628-630)Cag>Aag	p.Q210K	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	210					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.Q210K(1)		kidney(1)|lung(6)	7						CCATGGAGCTGCATCTTCTTG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											145.0	149.0	148.0					12																	11183307		2203	4300	6503	SO:0001583	missense	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.628C>A	12.37:g.11183307G>T	ENSP00000375093:p.Gln210Lys		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	8.037	0.762961	0.15914	.	.	ENSG00000256436	ENST00000390675	T	0.00801	5.68	2.62	1.69	0.24217	.	.	.	.	.	T	0.01320	0.0043	L	0.45698	1.435	0.09310	N	1	B	0.19445	0.036	B	0.29267	0.1	T	0.42949	-0.9421	9	0.51188	T	0.08	.	7.3273	0.26563	0.0:0.2756:0.7244:0.0	.	210	P59538	T2R31_HUMAN	K	210	ENSP00000375093:Q210K	ENSP00000375093:Q210K	Q	-	1	0	TAS2R31	11074574	0.041000	0.20044	0.076000	0.20297	0.072000	0.16883	1.101000	0.31037	0.433000	0.26313	0.194000	0.17425	CAG		0.428	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1		NM_176885	
TBX21	30009	hgsc.bcm.edu	37	17	45822284	45822285	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr17:45822284_45822285insG	ENST00000177694.1	+	6	1371_1372	c.1160_1161insG	c.(1159-1164)ctggggfs	p.LG387fs		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	387					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCTTACTGGCTGGGGGCCCCCC	0.614																																																	0										31,4231		0,31,2100						5.5	1.0			59	38,8208		0,38,4085	no	frameshift	TBX21	NM_013351.1		0,69,6185	A1A1,A1R,RR		0.4608,0.7274,0.5516				69,12439				SO:0001589	frameshift_variant	30009			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1165dupG	17.37:g.45822289_45822289dupG	ENSP00000177694:p.Leu387fs			Frame_Shift_Ins	INS	ENST00000177694.1	37	CCDS11514.1																																																																																				0.614	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1		NM_013351	
TMCO2	127391	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	40713786	40713786	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr1:40713786T>A	ENST00000372766.3	+	1	214	c.121T>A	c.(121-123)Ttg>Atg	p.L41M	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	41						integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L41M(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GCAAACAAGTTTGGGACTATT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											191.0	192.0	191.0					1																	40713786		2203	4300	6503	SO:0001583	missense	127391			AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.121T>A	1.37:g.40713786T>A	ENSP00000361852:p.Leu41Met			Missense_Mutation	SNP	ENST00000372766.3	37	CCDS30684.1	.	.	.	.	.	.	.	.	.	.	T	10.27	1.304010	0.23736	.	.	ENSG00000188800	ENST00000372766	.	.	.	5.34	1.71	0.24356	.	0.633028	0.13288	N	0.399182	T	0.35335	0.0928	L	0.29908	0.895	0.09310	N	1	P	0.52061	0.95	P	0.53809	0.735	T	0.14868	-1.0457	9	0.87932	D	0	0.314	6.6953	0.23195	0.0:0.2944:0.0:0.7056	.	41	Q7Z6W1	TMCO2_HUMAN	M	41	.	ENSP00000361852:L41M	L	+	1	2	TMCO2	40486373	0.696000	0.27757	0.653000	0.29593	0.001000	0.01503	0.457000	0.21875	0.137000	0.18759	-0.417000	0.06048	TTG		0.403	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015769.1		NM_001008740	
EMC3	55831	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10005828	10005828	+	Silent	SNP	G	G	A	rs113658691	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr3:10005828G>A	ENST00000245046.2	-	8	1169	c.711C>T	c.(709-711)gtC>gtT	p.V237V	RP11-1020A11.2_ENST00000602436.1_RNA	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	237						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.V237V(1)									GCTCTTCTTCGACATCATCTA	0.478													g|||	2	0.000399361	0.0015	0.0	5008	,	,		20028	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)						G		0,4406		0,0,2203	130.0	119.0	123.0		711	-5.3	1.0	3	dbSNP_132	123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TMEM111	NM_018447.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		237/262	10005828	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.711C>T	3.37:g.10005828G>A			B2R4Z9|Q53GH8|Q6ZMC2	Silent	SNP	ENST00000245046.2	37	CCDS2594.1																																																																																				0.478	EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250532.1		NM_018447	
XPO1	7514	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	61749804	61749804	+	Missense_Mutation	SNP	T	T	A	rs76607520		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr2:61749804T>A	ENST00000401558.2	-	4	970	c.243A>T	c.(241-243)caA>caT	p.Q81H	XPO1_ENST00000406957.1_Missense_Mutation_p.Q81H|XPO1_ENST00000404992.2_Missense_Mutation_p.Q81H	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	81	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.|Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)	p.Q81H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TTTCCAAAATTTGTAGTCCAT	0.348			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	1	Substitution - Missense(1)	kidney(1)											64.0	62.0	63.0					2																	61749804		2203	4300	6503	SO:0001583	missense	7514			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.243A>T	2.37:g.61749804T>A	ENSP00000384863:p.Gln81His		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.939439	0.52972	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957;ENST00000451765;ENST00000443240;ENST00000420673;ENST00000422552;ENST00000457483	T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.29;-0.29;-0.29;-0.29	5.46	0.312	0.15837	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	M	0.76838	2.35	0.53688	D	0.99997	P	0.47545	0.897	P	0.49226	0.603	T	0.69540	-0.5118	10	0.54805	T	0.06	-11.3942	10.4266	0.44383	0.0:0.4391:0.0:0.5609	.	81	O14980	XPO1_HUMAN	H	81	ENSP00000384863:Q81H;ENSP00000385942:Q81H;ENSP00000385559:Q81H;ENSP00000413853:Q81H;ENSP00000406428:Q81H;ENSP00000393484:Q81H;ENSP00000408190:Q81H;ENSP00000394951:Q81H	ENSP00000384863:Q81H	Q	-	3	2	XPO1	61603308	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	1.016000	0.29976	-0.178000	0.10672	0.455000	0.32223	CAA		0.348	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3		NM_003400	
ZFHX3	463	hgsc.bcm.edu	37	16	72991660	72991667	+	Frame_Shift_Del	DEL	CGGCGAGG	CGGCGAGG	-	rs143678779|rs10852515	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	CGGCGAGG	CGGCGAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr16:72991660_72991667delCGGCGAGG	ENST00000268489.5	-	2	3050_3057	c.2378_2385delCCTCGCCG	c.(2377-2385)ccctcgccgfs	p.PSP793fs	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	793					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TTGGTTTGGTCGGCGAGGGGGCCCCGCA	0.659																																																	0																																										SO:0001589	frameshift_variant	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2378_2385delCCTCGCCG	16.37:g.72991660_72991667delCGGCGAGG	ENSP00000268489:p.Pro793fs		D3DWS8|O15101|Q13719	Frame_Shift_Del	DEL	ENST00000268489.5	37	CCDS10908.1																																																																																				0.659	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1		NM_006885	
ZNF623	9831	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	144732657	144732657	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr8:144732657G>T	ENST00000501748.2	+	1	704	c.615G>T	c.(613-615)aaG>aaT	p.K205N	ZNF623_ENST00000458270.2_Missense_Mutation_p.K165N|ZNF623_ENST00000526926.1_Missense_Mutation_p.K165N	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K205N(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGGAGAAAAGCCCTTCAAAT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											105.0	93.0	97.0					8																	144732657		2203	4300	6503	SO:0001583	missense	9831			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.615G>T	8.37:g.144732657G>T	ENSP00000445979:p.Lys205Asn		A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	ENST00000501748.2	37	CCDS34957.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770564	0.49680	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.26067	1.76;1.76;1.76	4.34	-1.05	0.10036	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18593	0.0446	L	0.56340	1.77	0.28829	N	0.897242	B	0.31859	0.343	B	0.23574	0.047	T	0.21245	-1.0251	9	0.72032	D	0.01	-23.0382	3.7185	0.08448	0.2782:0.0:0.431:0.2908	.	205	O75123	ZN623_HUMAN	N	165;165;165;205;205	ENSP00000435232:K165N;ENSP00000411139:K165N;ENSP00000445979:K205N	ENSP00000330358:K165N	K	+	3	2	ZNF623	144803800	0.011000	0.17503	0.083000	0.20561	0.004000	0.04260	-0.328000	0.07945	-0.091000	0.12440	-0.890000	0.02929	AAG		0.468	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3		NM_014789	
Unknown	0	broad.mit.edu;hgsc.bcm.edu	37	7	63680408	63680408	+	IGR	SNP	T	T	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr7:63680408T>A								GUSBP6 (69309 upstream) : ZNF679 (8443 downstream)																							ACCCTACACATGTGAAGAATG	0.428																																																	0													32.0	35.0	34.0					7																	63680408		692	1591	2283	SO:0001628	intergenic_variant	730291																															7.37:g.63680408T>A				Missense_Mutation	SNP		37																																																																																				0	0.428									
DSPP	1834	broad.mit.edu	37	4	88536917	88536917	+	Missense_Mutation	SNP	G	G	A	rs199901845		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr4:88536917G>A	ENST00000282478.7	+	4	3136	c.3103G>A	c.(3103-3105)Gat>Aat	p.D1035N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1035N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1035	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D1035N(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.522																																																	1	Substitution - Missense(1)	kidney(1)											62.0	68.0	66.0					4																	88536917		1560	2750	4310	SO:0001583	missense	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3103G>A	4.37:g.88536917G>A	ENSP00000282478:p.Asp1035Asn		A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	5.819	0.335399	0.11013	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88664	-2.41;-2.41	1.43	0.544	0.17185	.	.	.	.	.	T	0.73999	0.3659	L	0.29908	0.895	0.18873	N	0.999989	B	0.30542	0.284	B	0.13407	0.009	T	0.59783	-0.7389	9	0.06494	T	0.89	-6.585	4.0989	0.10004	0.2347:0.0:0.7653:0.0	.	1035	Q9NZW4	DSPP_HUMAN	N	1035	ENSP00000382213:D1035N;ENSP00000282478:D1035N	ENSP00000282478:D1035N	D	+	1	0	DSPP	88755941	0.238000	0.23825	0.544000	0.28141	0.014000	0.08584	1.337000	0.33862	0.180000	0.19960	-0.791000	0.03333	GAT		0.522	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3		NM_014208	
DSPP	1834	broad.mit.edu	37	4	88536919	88536919	+	Silent	SNP	T	T	C	rs369387818		TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr4:88536919T>C	ENST00000282478.7	+	4	3138	c.3105T>C	c.(3103-3105)gaT>gaC	p.D1035D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1035D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1035	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D1035D(2)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcgatagcagtgaca	0.517																																																	2	Substitution - coding silent(2)	kidney(2)											63.0	70.0	67.0					4																	88536919		1560	2747	4307	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3105T>C	4.37:g.88536919T>C			A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																				0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3		NM_014208	
FAT1	2195	broad.mit.edu	37	4	187521052	187521052	+	Splice_Site	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr4:187521052C>T	ENST00000441802.2	-	22	12312	c.12103G>A	c.(12103-12105)Ggt>Agt	p.G4035S	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4035	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G4038S(1)|p.G4035S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CGGAGCCCACCTCCAGCAGGT	0.498										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												2	Substitution - Missense(2)	kidney(2)											38.0	39.0	39.0					4																	187521052		1956	4133	6089	SO:0001630	splice_region_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.12103+1G>A	4.37:g.187521052C>T				Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164803	0.78339	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	D	0.87256	-2.23	4.89	4.89	0.63831	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.90926	0.7148	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89559	0.3805	9	.	.	.	.	18.5924	0.91218	0.0:1.0:0.0:0.0	.	4035	Q14517	FAT1_HUMAN	S	4035;4037	ENSP00000406229:G4035S	.	G	-	1	0	FAT1	187758046	1.000000	0.71417	1.000000	0.80357	0.047000	0.14425	6.997000	0.76270	2.696000	0.92011	0.655000	0.94253	GGT		0.498	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3		NM_005245	Missense_Mutation
GJA3	2700	broad.mit.edu	37	13	20717063	20717063	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr13:20717063G>A	ENST00000241125.3	-	2	541	c.365C>T	c.(364-366)cCc>cTc	p.P122L		NM_021954.3	NP_068773.2	Q9Y6H8	CXA3_HUMAN	gap junction protein, alpha 3, 46kDa	122					cell-cell signaling (GO:0007267)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)	p.P122L(1)		NS(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		all_cancers(29;1.4e-21)|all_epithelial(30;8.75e-19)|all_lung(29;1.28e-17)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000554)|Epithelial(112;0.000872)|OV - Ovarian serous cystadenocarcinoma(117;0.0105)|Lung(94;0.0251)|LUSC - Lung squamous cell carcinoma(192;0.0784)		TGGCTCCTTGGGGCTGGGGCt	0.632																																																	1	Substitution - Missense(1)	kidney(1)											18.0	19.0	19.0					13																	20717063		2184	4288	6472	SO:0001583	missense	2700			AF075290	CCDS9289.1	13q12.11	2008-02-05	2007-01-16		ENSG00000121743	ENSG00000121743		"""Ion channels / Gap junction proteins (connexins)"""	4277	protein-coding gene	gene with protein product	"""connexin 46"""	121015	"""gap junction protein, alpha 3, 46kD (connexin 46)"", ""gap junction protein, alpha 3, 46kDa (connexin 46)"""	CZP3		10205266, 7342922	Standard	NM_021954		Approved	CX46	uc001umx.1	Q9Y6H8	OTTHUMG00000016510	ENST00000241125.3:c.365C>T	13.37:g.20717063G>A	ENSP00000241125:p.Pro122Leu		Q0VAB7|Q9H537	Missense_Mutation	SNP	ENST00000241125.3	37	CCDS9289.1	.	.	.	.	.	.	.	.	.	.	G	3.115	-0.181815	0.06340	.	.	ENSG00000121743	ENST00000241125	D	0.97404	-4.37	4.18	-4.06	0.03986	.	0.360716	0.27031	N	0.021275	D	0.88570	0.6472	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.79862	-0.1624	10	0.30078	T	0.28	.	8.7336	0.34514	0.0:0.2694:0.3091:0.4215	.	122	Q9Y6H8	CXA3_HUMAN	L	122	ENSP00000241125:P122L	ENSP00000241125:P122L	P	-	2	0	GJA3	19615063	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.525000	0.02231	-0.543000	0.06240	-0.305000	0.09177	CCC		0.632	GJA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044059.3		NM_021954	
HIP1R	9026	broad.mit.edu	37	12	123343703	123343703	+	Silent	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr12:123343703C>T	ENST00000253083.4	+	22	2379	c.2254C>T	c.(2254-2256)Ctg>Ttg	p.L752L		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	752					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)	p.L752L(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GCAGGCCAGCCTGGTGCGGAC	0.682																																																	1	Substitution - coding silent(1)	kidney(1)											13.0	13.0	13.0					12																	123343703		2182	4280	6462	SO:0001819	synonymous_variant	9026			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2254C>T	12.37:g.123343703C>T			A6NHQ6|Q6NXG8|Q9UED9	Silent	SNP	ENST00000253083.4	37	CCDS31922.1																																																																																				0.682	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1		NM_003959	
KCNQ5	56479	broad.mit.edu	37	6	73904281	73904281	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr6:73904281C>T	ENST00000370398.1	+	14	2052	c.1943C>T	c.(1942-1944)cCt>cTt	p.P648L	KCNQ5_ENST00000355635.3_Missense_Mutation_p.P649L|KCNQ5_ENST00000355194.4_Missense_Mutation_p.P648L|KCNQ5_ENST00000414165.2_Missense_Mutation_p.P538L|KCNQ5_ENST00000342056.2_Missense_Mutation_p.P667L|KCNQ5_ENST00000403813.2_Missense_Mutation_p.P639L|KCNQ5_ENST00000402622.2_Missense_Mutation_p.P658L	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	648					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.P648L(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CAGATCCCACCTTTTGAATGT	0.478																																					GBM(142;1375 1859 14391 23261 44706)												1	Substitution - Missense(1)	kidney(1)											93.0	88.0	90.0					6																	73904281		2203	4300	6503	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1943C>T	6.37:g.73904281C>T	ENSP00000359425:p.Pro648Leu		A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	C	7.986	0.752268	0.15778	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99207	-5.38;-5.38;-5.39;-5.38;-5.38;-5.41;-5.56	5.47	5.47	0.80525	.	0.197005	0.45606	D	0.000357	D	0.95462	0.8526	N	0.21373	0.66	0.34368	D	0.691726	B;B;B;B;B	0.26363	0.147;0.001;0.0;0.001;0.0	B;B;B;B;B	0.31547	0.132;0.002;0.001;0.002;0.001	D	0.93209	0.6598	10	0.18710	T	0.47	.	12.6473	0.56742	0.0:0.9243:0.0:0.0757	.	538;658;667;639;648	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	L	667;667;648;648;658;649;639;538	ENSP00000345055:P667L;ENSP00000347326:P648L;ENSP00000359425:P648L;ENSP00000385501:P658L;ENSP00000347853:P649L;ENSP00000384453:P639L;ENSP00000409861:P538L	ENSP00000345055:P667L	P	+	2	0	KCNQ5	73961002	0.983000	0.35010	0.996000	0.52242	0.997000	0.91878	3.667000	0.54547	2.563000	0.86464	0.561000	0.74099	CCT		0.478	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3		NM_019842	
KRTAP1-1	81851	broad.mit.edu	37	17	39197549	39197549	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr17:39197549G>C	ENST00000306271.4	-	1	164	c.101C>G	c.(100-102)tCc>tGc	p.S34C		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	34			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.|PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)		p.S34C(6)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCTGGCAGGAGCTGGTCTC	0.612																																																	6	Substitution - Missense(6)	kidney(4)|lung(1)|prostate(1)											49.0	62.0	58.0					17																	39197549		2018	4199	6217	SO:0001583	missense	81851			AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.101C>G	17.37:g.39197549G>C	ENSP00000305975:p.Ser34Cys		A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	G	0.085	-1.176298	0.01646	.	.	ENSG00000188581	ENST00000306271	T	0.16196	2.36	3.91	1.65	0.23941	.	.	.	.	.	T	0.01835	0.0058	N	0.00010	-3.04	0.22552	N	0.998996	B	0.02656	0.0	B	0.01281	0.0	T	0.40924	-0.9537	9	0.02654	T	1	.	7.8006	0.29172	0.1777:0.6415:0.1808:0.0	.	34	Q07627	KRA11_HUMAN	C	34	ENSP00000305975:S34C	ENSP00000305975:S34C	S	-	2	0	KRTAP1-1	36451075	1.000000	0.71417	0.987000	0.45799	0.816000	0.46133	1.227000	0.32576	0.919000	0.36945	-0.233000	0.12211	TCC		0.612	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1		NM_030967	
MUC4	4585	broad.mit.edu	37	3	195506597	195506597	+	Missense_Mutation	SNP	G	G	A	rs200685331	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr3:195506597G>A	ENST00000463781.3	-	2	12313	c.11854C>T	c.(11854-11856)Cct>Tct	p.P3952S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3952S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3952S(8)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTCA	0.602													.|||	94	0.01877	0.0068	0.0476	5008	,	,		9784	0.002		0.0467	False		,,,				2504	0.0031																8	Substitution - Missense(8)	kidney(4)|skin(2)|stomach(1)|endometrium(1)											14.0	11.0	12.0					3																	195506597		651	1454	2105	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11854C>T	3.37:g.195506597G>A	ENSP00000417498:p.Pro3952Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.614	-0.078859	0.07141	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.57;1.51	.	.	.	.	.	.	.	.	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B	0.22080	0.064	B	0.23419	0.046	T	0.25012	-1.0144	7	.	.	.	.	4.6062	0.12378	0.3343:0.0:0.6657:0.0	.	3824	E7ESK3	.	S	3952	ENSP00000417498:P3952S;ENSP00000420243:P3952S	.	P	-	1	0	MUC4	196991376	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-1.291000	0.02775	-2.068000	0.00884	-2.092000	0.00371	CCT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	broad.mit.edu	37	3	195507051	195507051	+	Silent	SNP	T	T	C			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr3:195507051T>C	ENST00000463781.3	-	2	11859	c.11400A>G	c.(11398-11400)tcA>tcG	p.S3800S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S3800S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S3800S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGTGT	0.597																																																	1	Substitution - coding silent(1)	kidney(1)											8.0	6.0	7.0					3																	195507051		641	1506	2147	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11400A>G	3.37:g.195507051T>C			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
OR5V1	81696	broad.mit.edu	37	6	29323659	29323659	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr6:29323659A>G	ENST00000377154.1	-	4	613	c.314T>C	c.(313-315)gTt>gCt	p.V105A	OR5V1_ENST00000543825.1_Missense_Mutation_p.V105A			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V105A(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TACAAAGAAAACAAATGCAAA	0.423																																					Ovarian(32;43 883 21137 32120 42650)												1	Substitution - Missense(1)	kidney(1)											66.0	68.0	68.0					6																	29323659		2203	4299	6502	SO:0001583	missense	81696				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.314T>C	6.37:g.29323659A>G	ENSP00000366359:p.Val105Ala		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	37	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	A	5.161	0.215201	0.09810	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00540	6.7;6.7	4.36	0.115	0.14643	GPCR, rhodopsin-like superfamily (1);	0.555826	0.13421	N	0.389171	T	0.00144	0.0004	L	0.27944	0.81	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.10776	-1.0615	10	0.18710	T	0.47	-13.9429	7.9862	0.30213	0.5056:0.373:0.0:0.1214	.	105	Q9UGF6	OR5V1_HUMAN	A	105	ENSP00000366359:V105A;ENSP00000443309:V105A	ENSP00000366356:V105A	V	-	2	0	OR5V1	29431638	0.000000	0.05858	0.319000	0.25293	0.034000	0.12701	0.081000	0.14823	0.264000	0.21851	0.438000	0.28831	GTT		0.423	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3			
PHLDA1	22822	broad.mit.edu	37	12	76424953	76424955	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr12:76424953_76424955delTGG	ENST00000266671.5	-	1	2757_2759	c.567_569delCCA	c.(565-570)caccag>cag	p.H189del	PHLDA1_ENST00000602540.1_In_Frame_Del_p.H48del|RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	189	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				ctgctgctgctggtgttgcagct	0.645																																																	0																																										SO:0001651	inframe_deletion	22822			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.567_569delCCA	12.37:g.76424953_76424955delTGG	ENSP00000266671:p.His189del		A1A4G9|Q15184|Q2TAN2|Q9NZ17	In_Frame_Del	DEL	ENST00000266671.5	37	CCDS31861.1																																																																																				0.645	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2		NM_007350	
MIR4477B	100616194	broad.mit.edu	37	9	68413581	68413581	+	RNA	SNP	G	G	C	rs1809619	byFrequency	TCGA-CJ-4641-01A-02D-1386-10	TCGA-CJ-4641-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c00265ac-c6cc-4349-ac30-e2e44582015a	18faa42a-cc27-47be-84d6-9ae798ac5172	g.chr9:68413581G>C	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		CCGGATCTAGGAAAGGTTGTG	0.602																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68413581G>C				RNA	SNP	ENST00000581659.1	37																																																																																					0.602	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
