#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf94	84970	ucsc.edu	37	1	34677972	34677972	+	Silent	SNP	A	A	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr1:34677972A>G	ENST00000488417.1	+	6	1806	c.1686A>G	c.(1684-1686)ggA>ggG	p.G562G	C1orf94_ENST00000373374.3_Silent_p.G372G	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	562										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				TAATGGCAGGAGATGGACCGC	0.567																																					p.G562G													.	C1orf94-90	0			c.A1686G						.						83.0	73.0	77.0					1																	34677972		2203	4300	6503	SO:0001819	synonymous_variant	84970	exon6			GGCAGGAGATGGA	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1686A>G	1.37:g.34677972A>G		65	1		45	5	NM_001134734	0	0	0	0	0	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	ENST00000488417.1	37	CCDS44108.1																																																																																			.		0.567	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
RNF115	27246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145688091	145688091	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr1:145688091T>A	ENST00000369291.5	+	9	990	c.786T>A	c.(784-786)caT>caA	p.H262Q		NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						TGTTTCAGCATGACACATGTC	0.418																																					p.H262Q		.											.	RNF115-91	0			c.T786A						.						117.0	112.0	114.0					1																	145688091		2203	4300	6503	SO:0001583	missense	27246	exon9			TCAGCATGACACA	AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.786T>A	1.37:g.145688091T>A	ENSP00000358297:p.His262Gln	171	0		139	48	NM_014455	0	0	0	0	0		Missense_Mutation	SNP	ENST00000369291.5	37	CCDS922.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.651541	0.67472	.	.	ENSG00000121848	ENST00000369291	T	0.41758	0.99	5.65	0.199	0.15175	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	L	0.38733	1.17	0.54753	D	0.999989	D	0.71674	0.998	D	0.69824	0.966	T	0.27971	-1.0058	10	0.72032	D	0.01	-5.7379	9.6735	0.40026	0.0:0.5176:0.0:0.4824	.	262	Q9Y4L5	RN115_HUMAN	Q	262	ENSP00000358297:H262Q	ENSP00000358297:H262Q	H	+	3	2	RNF115	144399448	0.949000	0.32298	0.997000	0.53966	0.972000	0.66771	-0.007000	0.12810	-0.112000	0.11979	0.533000	0.62120	CAT	.		0.418	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038554.2	NM_014455	
ANP32E	81611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150201557	150201557	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr1:150201557T>G	ENST00000314136.8	-	4	710	c.341A>C	c.(340-342)aAt>aCt	p.N114T	ANP32E_ENST00000533654.1_Intron|ANP32E_ENST00000369119.3_Missense_Mutation_p.N66T|ANP32E_ENST00000436748.2_Missense_Mutation_p.N73T|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369116.4_Intron|ANP32E_ENST00000369115.2_Intron	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	114					histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTTTTCAAATTTTTAAGATT	0.264																																					p.N114T		.											.	ANP32E-90	0			c.A341C						.						34.0	35.0	34.0					1																	150201557		2202	4300	6502	SO:0001583	missense	81611	exon4			TTCAAATTTTTAA	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.341A>C	1.37:g.150201557T>G	ENSP00000324074:p.Asn114Thr	72	1		56	23	NM_030920	0	0	0	0	0	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	ENST00000314136.8	37	CCDS946.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.030304	0.54790	.	.	ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000436748;ENST00000532744	T;T;T;T	0.13307	2.6;2.6;7.97;2.6	5.97	3.58	0.41010	.	0.126247	0.64402	D	0.000001	T	0.13713	0.0332	L	0.60012	1.86	0.80722	D	1	D;B;D	0.61080	0.989;0.15;0.978	P;B;P	0.59221	0.854;0.295;0.776	T	0.01909	-1.1249	10	0.52906	T	0.07	.	6.1046	0.20067	0.1475:0.1013:0.0:0.7512	.	73;114;66	E9PEA6;Q9BTT0;Q5TB20	.;AN32E_HUMAN;.	T	114;66;73;64	ENSP00000324074:N114T;ENSP00000358115:N66T;ENSP00000393718:N73T;ENSP00000432684:N64T	ENSP00000324074:N114T	N	-	2	0	ANP32E	148468181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.568000	0.36418	1.023000	0.39654	0.533000	0.62120	AAT	.		0.264	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920	
NHLH1	4807	broad.mit.edu;bcgsc.ca	37	1	160340735	160340735	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr1:160340735G>A	ENST00000302101.5	+	2	660	c.214G>A	c.(214-216)Gcc>Acc	p.A72T		NM_005598.3	NP_005589.1	Q02575	HEN1_HUMAN	nescient helix loop helix 1	72					cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ccggcgccgcgccACAGCCAA	0.731																																					p.A72T													.	NHLH1-69	0			c.G214A						.						15.0	18.0	17.0					1																	160340735		2197	4289	6486	SO:0001583	missense	4807	exon2			CGCCGCGCCACAG	BC013789	CCDS1204.1	1q22	2013-05-21			ENSG00000171786	ENSG00000171786		"""Basic helix-loop-helix proteins"""	7817	protein-coding gene	gene with protein product		162360		HEN1			Standard	NM_005598		Approved	NSCL, NSCL1, bHLHa35	uc001fwa.2	Q02575	OTTHUMG00000033121	ENST00000302101.5:c.214G>A	1.37:g.160340735G>A	ENSP00000302189:p.Ala72Thr	25	0		15	4	NM_005598	0	0	0	0	0		Missense_Mutation	SNP	ENST00000302101.5	37	CCDS1204.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300368	0.81136	.	.	ENSG00000171786	ENST00000302101	D	0.95756	-3.8	4.05	4.05	0.47172	Helix-loop-helix DNA-binding (2);	0.000000	0.52532	D	0.000061	T	0.82056	0.4954	N	0.12182	0.205	0.58432	D	0.999999	P	0.36199	0.543	B	0.17098	0.017	D	0.84431	0.0577	10	0.30078	T	0.28	-19.7981	15.3083	0.74011	0.0:0.0:1.0:0.0	.	72	Q02575	HEN1_HUMAN	T	72	ENSP00000302189:A72T	ENSP00000302189:A72T	A	+	1	0	NHLH1	158607359	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.506000	0.73712	2.238000	0.73509	0.655000	0.94253	GCC	.		0.731	NHLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080676.1	NM_005598	
ARHGAP30	257106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161021130	161021130	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr1:161021130C>A	ENST00000368013.3	-	10	1714	c.1394G>T	c.(1393-1395)gGc>gTc	p.G465V	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.G288V|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.G465V	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	465					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			aaggccagggccagggccagg	0.612																																					p.G465V		.											.	ARHGAP30-25	0			c.G1394T						.						29.0	31.0	30.0					1																	161021130		2203	4298	6501	SO:0001583	missense	257106	exon10			CCAGGGCCAGGGC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1394G>T	1.37:g.161021130C>A	ENSP00000356992:p.Gly465Val	51	0		57	20	NM_001025598	0	0	41	41	0	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633427	0.47049	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.48201	2.6;2.35;0.82	3.83	3.83	0.44106	.	0.323164	0.22031	N	0.065593	T	0.37461	0.1004	L	0.27053	0.805	0.49389	D	0.999786	B;D	0.61697	0.354;0.99	B;P	0.57152	0.074;0.814	T	0.37407	-0.9707	10	0.72032	D	0.01	.	11.4473	0.50131	0.0:1.0:0.0:0.0	.	465;465	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	V	465;465;317;288	ENSP00000356995:G465V;ENSP00000356992:G465V;ENSP00000356994:G288V	ENSP00000356992:G465V	G	-	2	0	ARHGAP30	159287754	0.992000	0.36948	0.997000	0.53966	0.998000	0.95712	3.749000	0.55150	2.131000	0.65755	0.555000	0.69702	GGC	.		0.612	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61836183	61836183	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr10:61836183T>C	ENST00000280772.2	-	37	4647	c.4456A>G	c.(4456-4458)Aga>Gga	p.R1486G	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1486					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GGGAGGGATCTTGTTGCTCCT	0.418																																					p.R1486G		.											.	ANK3-107	0			c.A4456G						.						86.0	86.0	86.0					10																	61836183		2203	4300	6503	SO:0001583	missense	288	exon37			GGGATCTTGTTGC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4456A>G	10.37:g.61836183T>C	ENSP00000280772:p.Arg1486Gly	55	0		58	27	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.410662	0.62399	.	.	ENSG00000151150	ENST00000280772	T	0.70045	-0.45	5.69	5.69	0.88448	.	0.000000	0.46145	D	0.000309	T	0.71484	0.3345	L	0.57536	1.79	0.80722	D	1	D	0.56521	0.976	P	0.50109	0.631	T	0.74763	-0.3555	10	0.59425	D	0.04	.	15.9352	0.79698	0.0:0.0:0.0:1.0	.	1486	Q12955	ANK3_HUMAN	G	1486	ENSP00000280772:R1486G	ENSP00000280772:R1486G	R	-	1	2	ANK3	61506189	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.167000	0.68274	0.477000	0.44152	AGA	.		0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
MSS51	118490	hgsc.bcm.edu;broad.mit.edu	37	10	75185676	75185676	+	Missense_Mutation	SNP	C	C	T	rs143815503	byFrequency	TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr10:75185676C>T	ENST00000372912.1	-	4	964	c.962G>A	c.(961-963)gGc>gAc	p.G321D	AL353731.1_ENST00000584907.1_RNA|MSS51_ENST00000299432.2_Missense_Mutation_p.G321D			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	321					social behavior (GO:0035176)		metal ion binding (GO:0046872)										CTGAATTGTGCCAGGTTCCAG	0.547																																					p.G321D		.											.	.	0			c.G962A						.						76.0	70.0	72.0					10																	75185676		2203	4300	6503	SO:0001583	missense	118490	exon5			ATTGTGCCAGGTT	AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.962G>A	10.37:g.75185676C>T	ENSP00000362003:p.Gly321Asp	55	0		56	4	NM_001024593	0	0	1	1	0	A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Missense_Mutation	SNP	ENST00000372912.1	37	CCDS31221.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004490	0.74932	.	.	ENSG00000166343	ENST00000299432;ENST00000372912	T;T	0.47869	0.83;0.83	5.64	3.73	0.42828	.	0.228496	0.46758	D	0.000274	T	0.41858	0.1177	L	0.59436	1.845	0.41812	D	0.989971	B;B	0.27140	0.169;0.027	B;B	0.28553	0.091;0.018	T	0.34601	-0.9822	10	0.32370	T	0.25	-6.4632	9.5419	0.39257	0.0:0.7782:0.143:0.0788	.	100;321	Q4VC12-2;Q4VC12	.;ZMY17_HUMAN	D	321	ENSP00000299432:G321D;ENSP00000362003:G321D	ENSP00000299432:G321D	G	-	2	0	ZMYND17	74855682	1.000000	0.71417	0.995000	0.50966	0.964000	0.63967	2.882000	0.48546	1.627000	0.50400	0.650000	0.86243	GGC	C|1.000;A|0.000		0.547	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048652.3	NM_178451	
LDB3	11155	hgsc.bcm.edu	37	10	88476182	88476182	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr10:88476182G>C	ENST00000361373.4	+	9	1351	c.1330G>C	c.(1330-1332)Gcc>Ccc	p.A444P	LDB3_ENST00000458213.2_Missense_Mutation_p.A334P|LDB3_ENST00000263066.6_Missense_Mutation_p.A334P|LDB3_ENST00000429277.2_Missense_Mutation_p.A449P|LDB3_ENST00000352360.5_Missense_Mutation_p.A187P	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						ccctgcccctgcctacacccc	0.652																																					p.A449P		.											.	LDB3-92	0			c.G1345C						.						25.0	24.0	24.0					10																	88476182		2192	4264	6456	SO:0001583	missense	11155	exon10			GCCCCTGCCTACA	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1330G>C	10.37:g.88476182G>C	ENSP00000355296:p.Ala444Pro	9	0		15	3	NM_001171610	0	0	0	0	0		Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208962	0.39003	.	.	ENSG00000122367	ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	T;T;T;T;T	0.54071	0.78;0.63;0.6;0.63;0.59	4.32	2.05	0.26809	.	0.805872	0.10145	N	0.710390	T	0.29389	0.0732	N	0.03608	-0.345	0.80722	D	1	B;B;B;D;B	0.53885	0.001;0.437;0.0;0.963;0.0	B;B;B;P;B	0.46796	0.001;0.143;0.002;0.527;0.001	T	0.04400	-1.0954	10	0.21540	T	0.41	.	4.7296	0.12957	0.1602:0.2243:0.6155:0.0	.	449;381;187;444;334	B4E3K3;F5H0C2;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	P	449;334;187;334;444	ENSP00000401437:A449P;ENSP00000409148:A334P;ENSP00000263067:A187P;ENSP00000263066:A334P;ENSP00000355296:A444P	ENSP00000263066:A334P	A	+	1	0	LDB3	88466162	0.931000	0.31567	0.999000	0.59377	0.787000	0.44495	0.960000	0.29253	0.761000	0.33130	0.650000	0.86243	GCC	.		0.652	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
IFIT1B	439996	broad.mit.edu	37	10	91143275	91143275	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr10:91143275G>C	ENST00000371809.3	+	2	285	c.205G>C	c.(205-207)Gag>Cag	p.E69Q	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	69										endometrium(2)|large_intestine(3)|lung(8)	13						AGGCCAGAATGAGGAAGCCCT	0.448																																					p.E69Q													.	IFIT1B-90	0			c.G205C						.						87.0	87.0	87.0					10																	91143275		2203	4300	6503	SO:0001583	missense	439996	exon2			CAGAATGAGGAAG		CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.205G>C	10.37:g.91143275G>C	ENSP00000360874:p.Glu69Gln	104	0		132	3	NM_001010987	0	0	0	0	0	A7E245	Missense_Mutation	SNP	ENST00000371809.3	37	CCDS31242.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397772	0.42512	.	.	ENSG00000204010	ENST00000371809	D	0.94537	-3.45	4.61	-0.804	0.10882	Tetratricopeptide-like helical (1);	0.385721	0.27613	U	0.018591	D	0.89784	0.6815	L	0.41027	1.25	0.09310	N	1	P	0.39551	0.678	P	0.44696	0.458	T	0.81876	-0.0731	10	0.28530	T	0.3	.	4.9756	0.14138	0.3147:0.2608:0.4244:0.0	.	69	Q5T764	IFT1B_HUMAN	Q	69	ENSP00000360874:E69Q	ENSP00000360874:E69Q	E	+	1	0	IFIT1B	91133255	0.017000	0.18338	0.001000	0.08648	0.874000	0.50279	0.199000	0.17237	-0.188000	0.10499	0.557000	0.71058	GAG	.		0.448	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049296.3	NM_001010987	
MALAT1	378938	broad.mit.edu;bcgsc.ca	37	11	65270998	65270998	+	lincRNA	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr11:65270998G>A	ENST00000534336.1	+	0	5766					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ATGATGTGCTGTTAGAATCAG	0.303																																					.													.	.	0			.						.						140.0	141.0	141.0					11																	65270998		874	1988	2862			378938	.			TGTGCTGTTAGAA	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270998G>A		174	0		159	12	.	0	0	53	59	6		RNA	SNP	ENST00000534336.1	37																																																																																				.		0.303	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
NCAPD2	9918	bcgsc.ca	37	12	6619468	6619468	+	Intron	SNP	A	A	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr12:6619468A>T	ENST00000315579.5	+	4	1061				NCAPD2_ENST00000545962.1_Intron|SCARNA10_ENST00000459255.1_RNA	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AAGGTCTGTAATCTTGGTGGG	0.428																																					.													.	.	0			.						.						227.0	211.0	216.0					12																	6619468		876	1991	2867	SO:0001627	intron_variant	692148	.			TCTGTAATCTTGG	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.262+169A>T	12.37:g.6619468A>T		201	0		225	9	.	0	0	0	0	0	D3DUR4|Q8N6U3	RNA	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																			.		0.428	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
GUCY2C	2984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14796597	14796597	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr12:14796597C>T	ENST00000261170.3	-	17	1977	c.1841G>A	c.(1840-1842)cGt>cAt	p.R614H		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	614	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AGATTTCAGACGACCATGGAC	0.398																																					p.R614H		.											.	GUCY2C-338	0			c.G1841A						.						162.0	153.0	156.0					12																	14796597		2203	4300	6503	SO:0001583	missense	2984	exon17			TTCAGACGACCAT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1841G>A	12.37:g.14796597C>T	ENSP00000261170:p.Arg614His	247	0		217	51	NM_004963	0	0	1	1	0	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110733	0.77210	.	.	ENSG00000070019	ENST00000261170	T	0.61980	0.06	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56232	0.1971	L	0.28458	0.855	0.80722	D	1	P	0.38767	0.646	B	0.39562	0.303	T	0.59862	-0.7374	10	0.54805	T	0.06	.	19.3191	0.94231	0.0:1.0:0.0:0.0	.	614	P25092	GUC2C_HUMAN	H	614	ENSP00000261170:R614H	ENSP00000261170:R614H	R	-	2	0	GUCY2C	14687864	1.000000	0.71417	0.800000	0.32199	0.988000	0.76386	4.932000	0.63476	2.549000	0.85964	0.650000	0.86243	CGT	.		0.398	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
KDM2B	84678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121947832	121947832	+	Silent	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr12:121947832C>T	ENST00000377071.4	-	11	1257	c.1185G>A	c.(1183-1185)agG>agA	p.R395R	KDM2B_ENST00000377069.4_Silent_p.R364R|KDM2B_ENST00000538046.2_Silent_p.R305R|KDM2B_ENST00000536437.1_Silent_p.R278R|KDM2B_ENST00000542973.1_5'Flank	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	395					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TGCTGGGCTTCCTCGGGGCAT	0.577																																					p.R395R		.											.	KDM2B-638	0			c.G1185A						.						34.0	38.0	37.0					12																	121947832		1945	4141	6086	SO:0001819	synonymous_variant	84678	exon11			GGGCTTCCTCGGG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1185G>A	12.37:g.121947832C>T		99	0		70	24	NM_032590	0	0	0	0	0	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	ENST00000377071.4	37	CCDS41850.1																																																																																			.		0.577	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	23909472	23909472	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr13:23909472A>T	ENST00000382292.3	-	9	8816	c.8543T>A	c.(8542-8544)tTc>tAc	p.F2848Y	SACS_ENST00000382298.3_Missense_Mutation_p.F2848Y|SACS_ENST00000402364.1_Missense_Mutation_p.F2098Y			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2848					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACCACGTGGGAAAAGAGTAAT	0.408																																					p.F2848Y		.											.	SACS-298	0			c.T8543A						.						85.0	83.0	84.0					13																	23909472		2203	4299	6502	SO:0001583	missense	26278	exon10			CGTGGGAAAAGAG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8543T>A	13.37:g.23909472A>T	ENSP00000371729:p.Phe2848Tyr	139	0		155	57	NM_014363	0	0	10	18	8	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889154	0.91889	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87491	-2.1;-2.26;-2.1	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.88819	0.6540	L	0.40543	1.245	0.43588	D	0.995931	D	0.59357	0.985	P	0.59221	0.854	D	0.87733	0.2580	10	0.33940	T	0.23	.	15.58	0.76425	1.0:0.0:0.0:0.0	.	2848	Q9NZJ4	SACS_HUMAN	Y	2848;2098;2848	ENSP00000371729:F2848Y;ENSP00000385844:F2098Y;ENSP00000371735:F2848Y	ENSP00000371729:F2848Y	F	-	2	0	SACS	22807472	1.000000	0.71417	0.920000	0.36463	0.995000	0.86356	8.962000	0.93254	2.084000	0.62774	0.449000	0.29647	TTC	.		0.408	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
B3GALTL	145173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	31821210	31821210	+	Silent	SNP	A	A	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr13:31821210A>G	ENST00000343307.4	+	5	470	c.321A>G	c.(319-321)gcA>gcG	p.A107A		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	107					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		AAGAAGGTGCATGGACCATAC	0.418																																					p.A107A		.											.	B3GALTL-92	0			c.A321G						.						166.0	132.0	144.0					13																	31821210		2203	4300	6503	SO:0001819	synonymous_variant	145173	exon5			AGGTGCATGGACC	AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.321A>G	13.37:g.31821210A>G		73	0		105	30	NM_194318	0	0	8	9	1	A8K5F8|Q5W0H2|Q6NUI3	Silent	SNP	ENST00000343307.4	37	CCDS9341.1																																																																																			.		0.418	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044396.3	NM_194318	
AHNAK2	113146	ucsc.edu	37	14	105418145	105418145	+	Missense_Mutation	SNP	G	G	A	rs375277628	byFrequency	TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr14:105418145G>A	ENST00000333244.5	-	7	3762	c.3643C>T	c.(3643-3645)Ccc>Tcc	p.P1215S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1215						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCGGAAGGGGGCTGAATGCTG	0.647													.|||	6	0.00119808	0.0	0.0	5008	,	,		15037	0.0		0.001	False		,,,				2504	0.0051				p.P1215S													.	AHNAK2-47	0			c.C3643T						.	G	SER/PRO	2,3852		0,2,1925	96.0	70.0	79.0		3643	1.6	0.0	14		79	3,7607		0,3,3802	no	missense	AHNAK2	NM_138420.2	74	0,5,5727	AA,AG,GG		0.0394,0.0519,0.0436	benign	1215/5796	105418145	5,11459	1927	3805	5732	SO:0001583	missense	113146	exon7			AAGGGGGCTGAAT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3643C>T	14.37:g.105418145G>A	ENSP00000353114:p.Pro1215Ser	158	1		136	1	NM_138420	0	1	98	122	23	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	9.389	1.074896	0.20227	5.19E-4	3.94E-4	ENSG00000185567	ENST00000333244	T	0.00840	5.63	4.55	1.58	0.23477	.	.	.	.	.	T	0.00695	0.0023	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46512	-0.9186	9	0.08837	T	0.75	.	5.6981	0.17867	0.0766:0.3467:0.4538:0.1229	.	1215	Q8IVF2	AHNK2_HUMAN	S	1215	ENSP00000353114:P1215S	ENSP00000353114:P1215S	P	-	1	0	AHNAK2	104489190	.	.	0.009000	0.14445	0.004000	0.04260	.	.	0.383000	0.24910	-1.447000	0.01057	CCC	.		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ZNF106	64397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42717056	42717056	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr15:42717056A>C	ENST00000263805.4	-	13	5423	c.5097T>G	c.(5095-5097)caT>caG	p.H1699Q	ZNF106_ENST00000565380.1_Missense_Mutation_p.H927Q|ZNF106_ENST00000565611.1_Missense_Mutation_p.H884Q|RNU6-188P_ENST00000364207.1_RNA|ZNF106_ENST00000565660.1_5'Flank	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1699					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGGTTTTGCTATGGCCCTCCA	0.522																																					p.H1699Q		.											.	ZFP106-515	0			c.T5097G						.						75.0	62.0	67.0					15																	42717056		2203	4299	6502	SO:0001583	missense	64397	exon13			TTTGCTATGGCCC	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.5097T>G	15.37:g.42717056A>C	ENSP00000263805:p.His1699Gln	55	0		31	14	NM_022473	0	0	22	31	9	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779019	0.70107	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.81415	-1.49	5.44	-5.28	0.02755	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	M	0.86805	2.84	0.51233	D	0.999915	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	D	0.89321	0.3640	10	0.87932	D	0	-15.4983	17.6295	0.88103	0.1114:0.0:0.8886:0.0	.	927;1699;927	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	Q	1699;927	ENSP00000263805:H1699Q	ENSP00000263805:H1699Q	H	-	3	2	ZFP106	40504348	0.990000	0.36364	0.928000	0.36995	0.984000	0.73092	0.230000	0.17852	-0.844000	0.04184	-1.151000	0.01829	CAT	.		0.522	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	81230320	81230320	+	Splice_Site	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr15:81230320G>A	ENST00000394685.3	+	25	3826	c.3407G>A	c.(3406-3408)gGg>gAg	p.G1136E	KIAA1199_ENST00000356249.5_Splice_Site_p.G1136E|KIAA1199_ENST00000220244.3_Splice_Site_p.G1136E|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		1136					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GAGGACTCAGGGTGAGCAGGC	0.547																																					p.G1136E		.											.	KIAA1199-93	0			c.G3407A						.						38.0	33.0	35.0					15																	81230320		2203	4300	6503	SO:0001630	splice_region_variant	57214	exon24			ACTCAGGGTGAGC																												ENST00000394685.3:c.3407+1G>A	15.37:g.81230320G>A		23	0		28	14	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	33	5.227247	0.95173	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.50813	0.73;0.73;0.73	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72934	-0.4141	10	0.41790	T	0.15	-33.8466	19.3153	0.94211	0.0:0.0:1.0:0.0	.	1136	Q8WUJ3	K1199_HUMAN	E	1136	ENSP00000220244:G1136E;ENSP00000378177:G1136E;ENSP00000348583:G1136E	ENSP00000220244:G1136E	G	+	2	0	KIAA1199	79017375	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	9.063000	0.93927	2.559000	0.86315	0.655000	0.94253	GGG	.		0.547	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		Missense_Mutation
AXIN1	8312	broad.mit.edu	37	16	354433	354433	+	Silent	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr16:354433G>A	ENST00000262320.3	-	5	1496	c.1125C>T	c.(1123-1125)taC>taT	p.Y375Y	AXIN1_ENST00000354866.3_Silent_p.Y375Y|AXIN1_ENST00000481769.1_5'UTR	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	375	Interaction with GSK3B. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.?(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TCGGCACCCGGTACGTGCGCT	0.617																																					p.Y375Y													.	AXIN1-684	1	Unknown(1)	liver(1)	c.C1125T						.						27.0	27.0	27.0					16																	354433		2199	4290	6489	SO:0001819	synonymous_variant	8312	exon5			CACCCGGTACGTG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1125C>T	16.37:g.354433G>A		56	0		45	3	NM_181050	0	0	5	5	0	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Silent	SNP	ENST00000262320.3	37	CCDS10405.1																																																																																			.		0.617	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
ROGDI	79641	hgsc.bcm.edu	37	16	4849745	4849745	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr16:4849745T>C	ENST00000322048.7	-	6	752	c.374A>G	c.(373-375)tAc>tGc	p.Y125C	ROGDI_ENST00000586336.1_5'UTR	NM_024589.2	NP_078865.1	Q9GZN7	ROGDI_HUMAN	rogdi homolog (Drosophila)	125					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	intracellular (GO:0005622)|nucleus (GO:0005634)				endometrium(2)|lung(1)|ovary(1)|skin(1)	5						GGTAAGCAGGTAAATGGCTTG	0.627																																					p.Y125C		.											.	ROGDI-92	0			c.A374G						.						107.0	84.0	92.0					16																	4849745		2197	4300	6497	SO:0001583	missense	79641	exon6			AGCAGGTAAATGG	AK026039	CCDS10523.1	16p13.3	2014-09-17			ENSG00000067836	ENSG00000067836			29478	protein-coding gene	gene with protein product		614574				11230166	Standard	NM_024589		Approved	FLJ22386	uc002cxv.4	Q9GZN7	OTTHUMG00000129479	ENST00000322048.7:c.374A>G	16.37:g.4849745T>C	ENSP00000322832:p.Tyr125Cys	41	0		31	2	NM_024589	0	0	79	79	0	Q6IA00	Missense_Mutation	SNP	ENST00000322048.7	37	CCDS10523.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.683056	0.68157	.	.	ENSG00000067836	ENST00000322048	T	0.42513	0.97	4.91	4.91	0.64330	.	0.134555	0.52532	D	0.000077	T	0.50309	0.1608	L	0.44542	1.39	0.49798	D	0.999821	D	0.63046	0.992	P	0.57371	0.819	T	0.50684	-0.8799	10	0.51188	T	0.08	-43.9912	13.5501	0.61728	0.0:0.0:0.0:1.0	.	125	Q9GZN7	ROGDI_HUMAN	C	125	ENSP00000322832:Y125C	ENSP00000322832:Y125C	Y	-	2	0	ROGDI	4789746	1.000000	0.71417	0.992000	0.48379	0.802000	0.45316	4.942000	0.63547	1.845000	0.53610	0.459000	0.35465	TAC	.		0.627	ROGDI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251643.3	NM_024589	
FBRS	64319	hgsc.bcm.edu;broad.mit.edu	37	16	30676958	30676958	+	Splice_Site	SNP	G	G	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr16:30676958G>C	ENST00000287468.5	+	5	407		c.e5-1		FBRS_ENST00000395073.2_Splice_Site|FBRS_ENST00000356166.6_Splice_Site|FBRS_ENST00000568722.1_Intron	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin											ovary(1)	1			Colorectal(24;0.103)			CCCTTTCCCAGAGCACGAACC	0.652																																					.		.											.	FBRS-23	0			c.145-1G>C						.						21.0	22.0	22.0					16																	30676958		1984	4156	6140	SO:0001630	splice_region_variant	64319	exon5			TTCCCAGAGCACG	AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000287468.5:c.145-1G>C	16.37:g.30676958G>C		10	0		12	2	NM_001105079	0	0	3	3	0	B4DP86|Q96CI9|Q9H9X4	Splice_Site	SNP	ENST00000287468.5	37		.	.	.	.	.	.	.	.	.	.	G	16.21	3.058130	0.55325	.	.	ENSG00000156860	ENST00000356166;ENST00000287468	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6054	0.76664	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBRS	30584459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.886000	0.63149	2.419000	0.82065	0.591000	0.81541	.	.		0.652	FBRS-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_022452	Intron
ALOX12	239	broad.mit.edu	37	17	6905026	6905026	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr17:6905026C>A	ENST00000251535.6	+	8	1110	c.1057C>A	c.(1057-1059)Caa>Aaa	p.Q353K	RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399540.2_3'UTR|AC027763.2_ENST00000574377.1_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	353	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						TTCAGATTTCCAACTGCACGA	0.592																																					p.Q353K													.	ALOX12-226	0			c.C1057A						.						123.0	111.0	115.0					17																	6905026		2203	4300	6503	SO:0001583	missense	239	exon8			GATTTCCAACTGC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1057C>A	17.37:g.6905026C>A	ENSP00000251535:p.Gln353Lys	192	0		224	5	NM_000697	0	0	2	2	0	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	37	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057271	0.76074	.	.	ENSG00000108839	ENST00000251535	T	0.76578	-1.03	4.9	4.9	0.64082	Lipoxygenase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.87657	0.6232	M	0.88570	2.965	0.44995	D	0.998011	P	0.49253	0.921	P	0.56648	0.803	D	0.88947	0.3384	10	0.52906	T	0.07	-10.0858	15.9493	0.79820	0.0:1.0:0.0:0.0	.	353	P18054	LOX12_HUMAN	K	353	ENSP00000251535:Q353K	ENSP00000251535:Q353K	Q	+	1	0	ALOX12	6845750	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	2.872000	0.48467	2.699000	0.92147	0.573000	0.79308	CAA	.		0.592	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
LRRC37A3	374819	ucsc.edu	37	17	62855652	62855652	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr17:62855652T>C	ENST00000584306.1	-	11	5142	c.4612A>G	c.(4612-4614)Aag>Gag	p.K1538E	LRRC37A3_ENST00000400877.3_Missense_Mutation_p.K576E|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.K656E|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.K1538E|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.K515E	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1538						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CATTCTATCTTGGATGCCTTT	0.522																																					p.K1538E													.	LRRC37A3-90	0			c.A4612G						.						165.0	172.0	169.0					17																	62855652		2202	4294	6496	SO:0001583	missense	374819	exon11			CTATCTTGGATGC	AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4612A>G	17.37:g.62855652T>C	ENSP00000464535:p.Lys1538Glu	313	7		459	14	NM_199340	0	0	19	61	42	Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	ENST00000584306.1	37	CCDS32708.1	.	.	.	.	.	.	.	.	.	.	.	10.65	1.408868	0.25378	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.51817	0.69;0.69;0.69	2.39	1.1	0.20463	.	.	.	.	.	T	0.56978	0.2022	M	0.65498	2.005	0.09310	N	1	P;D	0.53151	0.941;0.958	B;P	0.60682	0.323;0.878	T	0.42103	-0.9471	9	0.59425	D	0.04	.	4.8525	0.13543	0.0:0.0:0.3244:0.6756	.	656;1538	B4DG20;O60309	.;L37A3_HUMAN	E	619;576;515;1538	ENSP00000383674:K576E;ENSP00000335617:K515E;ENSP00000325713:K1538E	ENSP00000325713:K1538E	K	-	1	0	LRRC37A3	60286114	0.000000	0.05858	0.025000	0.17156	0.011000	0.07611	0.003000	0.13083	1.098000	0.41479	0.155000	0.16302	AAG	.		0.522	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340	
ABCA5	23461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	67283846	67283846	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr17:67283846C>T	ENST00000392676.3	-	15	2013	c.1949G>A	c.(1948-1950)cGa>cAa	p.R650Q	ABCA5_ENST00000392677.2_Missense_Mutation_p.R650Q|ABCA5_ENST00000588877.1_Missense_Mutation_p.R650Q			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	650	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TACAATATGTCGAGAACAGGG	0.408																																					p.R650Q		.											.	ABCA5-93	0			c.G1949A						.						113.0	109.0	110.0					17																	67283846		2203	4300	6503	SO:0001583	missense	23461	exon14			ATATGTCGAGAAC	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1949G>A	17.37:g.67283846C>T	ENSP00000376443:p.Arg650Gln	121	1		193	101	NM_018672	0	0	4	15	11	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	36	5.706333	0.96821	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.39997	1.05;1.05	5.63	5.63	0.86233	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.186313	0.36815	N	0.002382	T	0.70150	0.3191	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.72707	-0.4212	9	.	.	.	.	19.2741	0.94023	0.0:1.0:0.0:0.0	.	650;650	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	Q	650	ENSP00000376444:R650Q;ENSP00000376443:R650Q	.	R	-	2	0	ABCA5	64795441	1.000000	0.71417	0.982000	0.44146	0.925000	0.55904	7.391000	0.79828	2.641000	0.89580	0.585000	0.79938	CGA	.		0.408	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
POLRMT	5442	broad.mit.edu	37	19	621842	621842	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr19:621842C>T	ENST00000588649.2	-	10	1940	c.1856G>A	c.(1855-1857)gGc>gAc	p.G619D	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	619					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCAGGATGCCGATCTGGGG	0.687																																					p.G619D													.	POLRMT-92	0			c.G1856A						.						22.0	25.0	24.0					19																	621842		2199	4293	6492	SO:0001583	missense	5442	exon10			AGGATGCCGATCT		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1856G>A	19.37:g.621842C>T	ENSP00000465759:p.Gly619Asp	49	0		28	3	NM_005035	0	0	0	0	0	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	19.54	3.847427	0.71603	.	.	ENSG00000099821	ENST00000215591	T	0.56444	0.46	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	M	0.79926	2.475	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	T	0.76841	-0.2810	10	0.56958	D	0.05	-44.8841	16.5929	0.84772	0.0:1.0:0.0:0.0	.	619	O00411	RPOM_HUMAN	D	619	ENSP00000215591:G619D	ENSP00000215591:G619D	G	-	2	0	POLRMT	572842	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	7.412000	0.80091	2.398000	0.81561	0.455000	0.32223	GGC	.		0.687	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
PDE4A	5141	hgsc.bcm.edu	37	19	10541704	10541704	+	Intron	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr19:10541704C>A	ENST00000352831.6	+	1	430				PDE4A_ENST00000440014.2_5'Flank|PDE4A_ENST00000592685.1_Intron|PDE4A_ENST00000293683.5_Missense_Mutation_p.R62S|PDE4A_ENST00000380702.2_Intron	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TTTCCGCAGACGCCTTCGGCT	0.731																																					p.R62S		.											.	PDE4A-523	0			c.C184A						.						10.0	10.0	10.0					19																	10541704		1557	3562	5119	SO:0001627	intron_variant	5141	exon1			CGCAGACGCCTTC		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.320+9944C>A	19.37:g.10541704C>A		8	0		14	4	NM_001111308	0	0	7	12	5	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	c	18.49	3.635976	0.67130	.	.	ENSG00000065989	ENST00000293683	T	0.68479	-0.33	3.48	3.48	0.39840	.	.	.	.	.	T	0.48840	0.1522	N	0.20986	0.625	0.80722	D	1	P	0.44478	0.836	B	0.40444	0.329	T	0.39231	-0.9624	9	0.19147	T	0.46	.	10.7182	0.46026	0.0:1.0:0.0:0.0	.	62	P27815-2	.	S	62	ENSP00000293683:R62S	ENSP00000293683:R62S	R	+	1	0	PDE4A	10402704	0.429000	0.25530	0.993000	0.49108	0.604000	0.37047	1.697000	0.37784	1.966000	0.57179	0.537000	0.68136	CGC	.		0.731	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
RAB3A	5864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18313494	18313494	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr19:18313494G>C	ENST00000222256.4	-	2	235	c.57C>G	c.(55-57)ttC>ttG	p.F19L	AC068499.10_ENST00000596473.1_RNA|RAB3A_ENST00000464076.3_Intron|AC068499.10_ENST00000599416.2_RNA|AC068499.10_ENST00000594805.3_RNA	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	19					axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						ACATGTAGTCGAAGTTCTGAT	0.582											OREG0025360	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F19L		.											.	RAB3A-227	0			c.C57G						.						257.0	217.0	230.0					19																	18313494		2203	4300	6503	SO:0001583	missense	5864	exon2			GTAGTCGAAGTTC		CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.57C>G	19.37:g.18313494G>C	ENSP00000222256:p.Phe19Leu	246	0	724	195	56	NM_002866	0	0	4	8	4	A8K0J4|Q9NYE1	Missense_Mutation	SNP	ENST00000222256.4	37	CCDS12372.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017822	0.75161	.	.	ENSG00000105649	ENST00000222256	T	0.79141	-1.24	4.4	0.678	0.17969	.	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	N	0.25890	0.77	0.80722	D	1	D	0.65815	0.995	P	0.59889	0.865	T	0.70490	-0.4857	10	0.87932	D	0	-19.6435	5.4616	0.16619	0.5735:0.0:0.4265:0.0	.	19	P20336	RAB3A_HUMAN	L	19	ENSP00000222256:F19L	ENSP00000222256:F19L	F	-	3	2	RAB3A	18174494	0.677000	0.27577	1.000000	0.80357	0.984000	0.73092	-0.040000	0.12104	0.318000	0.23185	0.313000	0.20887	TTC	.		0.582	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268056.2	NM_002866	
ZNF155	7711	broad.mit.edu	37	19	44501505	44501505	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr19:44501505G>A	ENST00000270014.2	+	5	1624	c.1496G>A	c.(1495-1497)cGt>cAt	p.R499H	RP11-15A1.7_ENST00000586860.1_RNA|RP11-15A1.7_ENST00000589021.1_RNA|ZNF155_ENST00000590615.1_Missense_Mutation_p.R499H|ZNF155_ENST00000407951.2_Missense_Mutation_p.R510H	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	499					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R499H(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				AGGACATACCGTAAAGACCAG	0.453																																					p.R510H	NSCLC(61;554 1277 20909 42067 42312)												.	ZNF155-154	1	Substitution - Missense(1)	kidney(1)	c.G1529A						.						89.0	91.0	91.0					19																	44501505		2203	4300	6503	SO:0001583	missense	7711	exon6			CATACCGTAAAGA	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.1496G>A	19.37:g.44501505G>A	ENSP00000270014:p.Arg499His	127	0		107	4	NM_001260488	0	0	11	11	0	A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	SNP	ENST00000270014.2	37	CCDS12634.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468786	0.43839	.	.	ENSG00000204920	ENST00000407951;ENST00000270014	T;T	0.15256	2.44;2.44	2.36	1.31	0.21738	Zinc finger, C2H2 (1);	.	.	.	.	T	0.17365	0.0417	L	0.35542	1.07	0.09310	N	1	D;D	0.57899	0.981;0.981	P;P	0.49361	0.608;0.608	T	0.12656	-1.0539	9	0.72032	D	0.01	.	7.8091	0.29219	0.0:0.0:0.2272:0.7728	.	510;499	B4DM95;Q12901	.;ZN155_HUMAN	H	510;499	ENSP00000385163:R510H;ENSP00000270014:R499H	ENSP00000270014:R499H	R	+	2	0	ZNF155	49193345	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	0.433000	0.21477	0.338000	0.23692	-0.397000	0.06425	CGT	.		0.453	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445	
VPS54	51542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	64199372	64199372	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr2:64199372T>A	ENST00000272322.4	-	4	539	c.385A>T	c.(385-387)Aag>Tag	p.K129*	VPS54_ENST00000354504.3_Nonsense_Mutation_p.K12*|VPS54_ENST00000409558.4_Nonsense_Mutation_p.K117*			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	129					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TCATGAATCTTCTCTCTCTAA	0.303																																					p.K129X		.											.	VPS54-90	0			c.A385T						.						69.0	67.0	68.0					2																	64199372		2202	4292	6494	SO:0001587	stop_gained	51542	exon4			GAATCTTCTCTCT	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.385A>T	2.37:g.64199372T>A	ENSP00000272322:p.Lys129*	52	0		63	22	NM_016516	0	0	0	0	0	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Nonsense_Mutation	SNP	ENST00000272322.4	37	CCDS33208.1	.	.	.	.	.	.	.	.	.	.	T	42	9.754681	0.99256	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	.	.	.	5.66	5.66	0.87406	.	0.089994	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8882	0.79269	0.0:0.0:0.0:1.0	.	.	.	.	X	12;129;117;117;129	.	ENSP00000272322:K129X	K	-	1	0	VPS54	64052876	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.116000	0.64661	2.166000	0.68216	0.454000	0.30748	AAG	.		0.303	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
ARID5A	10865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97216937	97216937	+	Silent	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr2:97216937G>A	ENST00000357485.3	+	7	750	c.672G>A	c.(670-672)ggG>ggA	p.G224G	ARID5A_ENST00000454558.2_Silent_p.G156G	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	224					chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						TGGCCTCTGGGTCTTCTGTGT	0.602																																					p.G224G		.											.	ARID5A-226	0			c.G672A						.						56.0	61.0	60.0					2																	97216937		2203	4300	6503	SO:0001819	synonymous_variant	10865	exon7			CTCTGGGTCTTCT	M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.672G>A	2.37:g.97216937G>A		131	0		108	27	NM_212481	0	0	22	24	2	Q6NX37	Silent	SNP	ENST00000357485.3	37	CCDS33251.1																																																																																			.		0.602	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338888.2	NM_212481	
CNNM4	26504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97427340	97427340	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr2:97427340C>A	ENST00000377075.2	+	1	702	c.604C>A	c.(604-606)Ctc>Atc	p.L202I		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	202	DUF21.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						ATTTTCTGGCCTCAACCTCGG	0.587																																					p.L202I		.											.	CNNM4-154	0			c.C604A						.						85.0	92.0	89.0					2																	97427340		2203	4300	6503	SO:0001583	missense	26504	exon1			TCTGGCCTCAACC	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.604C>A	2.37:g.97427340C>A	ENSP00000366275:p.Leu202Ile	157	0		125	47	NM_020184	0	0	26	41	15	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	c	20.6	4.021298	0.75275	.	.	ENSG00000158158	ENST00000377075	D	0.89485	-2.52	4.85	4.85	0.62838	Domain of unknown function DUF21 (1);	0.077015	0.50627	D	0.000112	D	0.94925	0.8359	M	0.92122	3.275	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.95382	0.8474	10	0.87932	D	0	-12.6701	10.4274	0.44387	0.0:0.908:0.0:0.092	.	202	Q6P4Q7	CNNM4_HUMAN	I	202	ENSP00000366275:L202I	ENSP00000366275:L202I	L	+	1	0	CNNM4	96791067	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	3.112000	0.50368	2.234000	0.73211	0.556000	0.70494	CTC	.		0.587	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
PRPF40A	55660	hgsc.bcm.edu	37	2	153532998	153532998	+	Missense_Mutation	SNP	T	T	C	rs372660010		TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr2:153532998T>C	ENST00000410080.1	-	10	1493	c.952A>G	c.(952-954)Acc>Gcc	p.T318A		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	345					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						ATAGCAGGGGTACTAGTAAGT	0.378																																					p.T318A		.											.	PRPF40A-68	0			c.A952G						.	T	ALA/THR	0,3770		0,0,1885	81.0	77.0	78.0		952	3.6	1.0	2		78	1,8221		0,1,4110	no	missense	PRPF40A	NM_017892.3	58	0,1,5995	CC,CT,TT		0.0122,0.0,0.0083	possibly-damaging	318/931	153532998	1,11991	1885	4111	5996	SO:0001583	missense	55660	exon10			CAGGGGTACTAGT	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.952A>G	2.37:g.153532998T>C	ENSP00000386458:p.Thr318Ala	23	0		24	2	NM_017892	0	0	64	64	0	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	T	4.743	0.138086	0.09083	0.0	1.22E-4	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961;ENST00000545856;ENST00000493468	T	0.30182	1.54	4.77	3.61	0.41365	.	0.488453	0.23416	N	0.048404	T	0.12732	0.0309	N	0.14661	0.345	0.34226	D	0.676017	B;B;B	0.30193	0.272;0.049;0.028	B;B;B	0.17722	0.019;0.015;0.016	T	0.20472	-1.0274	10	0.07813	T	0.8	-1.5293	7.4308	0.27126	0.0:0.1016:0.0:0.8984	.	345;327;318	O75400;O75400-3;E9PFS0	PR40A_HUMAN;.;.	A	318;327;214;265;345;320	ENSP00000386458:T318A	ENSP00000348770:T327A	T	-	1	0	PRPF40A	153241244	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	0.937000	0.28951	0.934000	0.37316	0.455000	0.32223	ACC	.		0.378	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
CSNK2A1	1457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	468205	468205	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr20:468205C>T	ENST00000217244.3	-	12	1214	c.839G>A	c.(838-840)cGa>cAa	p.R280Q	CSNK2A1_ENST00000400227.3_Missense_Mutation_p.R280Q|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.R280Q|CSNK2A1_ENST00000400217.2_Missense_Mutation_p.R144Q	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			GCGTTCCCATCGCTTTCGAGA	0.502																																					p.R280Q		.											.	CSNK2A1-791	0			c.G839A						.						85.0	76.0	80.0					20																	468205		2203	4300	6503	SO:0001583	missense	1457	exon11			TCCCATCGCTTTC	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.839G>A	20.37:g.468205C>T	ENSP00000217244:p.Arg280Gln	69	0		70	21	NM_001895	0	0	98	193	95	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	ENST00000217244.3	37	CCDS13003.1	.	.	.	.	.	.	.	.	.	.	C	33	5.233597	0.95207	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973;ENST00000400217	T;T;T;T	0.43294	3.29;3.29;3.29;0.95	5.24	5.24	0.73138	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	N	0.17594	0.5	0.80722	D	1	D	0.89917	1.0	D	0.65140	0.932	T	0.51426	-0.8707	10	0.52906	T	0.07	-6.9053	17.9724	0.89117	0.0:1.0:0.0:0.0	.	280	P68400	CSK21_HUMAN	Q	280;280;280;280;144	ENSP00000383086:R280Q;ENSP00000339247:R280Q;ENSP00000217244:R280Q;ENSP00000383076:R144Q	ENSP00000217244:R280Q	R	-	2	0	CSNK2A1	416205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.601000	0.82783	2.713000	0.92767	0.585000	0.79938	CGA	.		0.502	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
CRYZL1	9946	broad.mit.edu	37	21	34974552	34974552	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr21:34974552T>C	ENST00000381554.3	-	8	650	c.565A>G	c.(565-567)Aga>Gga	p.R189G	AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000290244.5_Missense_Mutation_p.R174G|CRYZL1_ENST00000361534.2_Missense_Mutation_p.R213G|CRYZL1_ENST00000381540.3_Missense_Mutation_p.R189G|CRYZL1_ENST00000445393.1_Missense_Mutation_p.R151G	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	189					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						ATGGGAGGTCTGAATCTTTCA	0.373																																					p.R189G													.	CRYZL1-90	0			c.A565G						.						142.0	132.0	135.0					21																	34974552		2203	4300	6503	SO:0001583	missense	9946	exon8			GAGGTCTGAATCT	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.565A>G	21.37:g.34974552T>C	ENSP00000370966:p.Arg189Gly	89	1		91	3	NM_145858	0	0	0	0	0	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	37	CCDS13633.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.942777|3.942777	0.73672|0.73672	.|.	.|.	ENSG00000205758|ENSG00000205758	ENST00000440526|ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000414079;ENST00000426935	.|T;T;T;T;T;T;T	.|0.29917	.|5.33;5.33;5.33;1.83;5.33;5.33;1.55	4.98|4.98	-2.68|-2.68	0.06041|0.06041	.|Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	.|0.115715	.|0.64402	.|D	.|0.000007	T|T	0.13329|0.13329	0.0323|0.0323	N|N	0.00569|0.00569	-1.365|-1.365	0.30079|0.30079	N|N	0.809379|0.809379	.|B;P	.|0.45634	.|0.171;0.863	.|B;P	.|0.54856	.|0.174;0.762	T|T	0.39210|0.39210	-0.9625|-0.9625	5|10	.|0.39692	.|T	.|0.17	-6.7286|-6.7286	9.2606|9.2606	0.37610|0.37610	0.1262:0.0:0.5228:0.351|0.1262:0.0:0.5228:0.351	.|.	.|189;213	.|O95825;A6NHJ8	.|QORL1_HUMAN;.	R|G	132|189;174;189;151;213;189;49;137	.|ENSP00000370966:R189G;ENSP00000290244:R174G;ENSP00000370951:R189G;ENSP00000399730:R151G;ENSP00000355075:R213G;ENSP00000409387:R49G;ENSP00000387660:R137G	.|ENSP00000290244:R174G	Q|R	-|-	2|1	0|2	CRYZL1|CRYZL1	33896422|33896422	0.876000|0.876000	0.30132|0.30132	0.008000|0.008000	0.14137|0.14137	0.603000|0.603000	0.37013|0.37013	0.722000|0.722000	0.25925|0.25925	-0.656000|-0.656000	0.05380|0.05380	-0.313000|-0.313000	0.08912|0.08912	CAG|AGA	.		0.373	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858	
HMOX1	3162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	35779129	35779129	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr22:35779129G>T	ENST00000216117.8	+	2	393	c.54G>T	c.(52-54)aaG>aaT	p.K18N		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	18					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	AGGCCCTGAAGGAGGCCACCA	0.577																																					p.K18N		.											.	HMOX1-91	0			c.G54T						.						85.0	78.0	80.0					22																	35779129		2203	4300	6503	SO:0001583	missense	3162	exon2			CCTGAAGGAGGCC		CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.54G>T	22.37:g.35779129G>T	ENSP00000216117:p.Lys18Asn	156	0		94	29	NM_002133	0	0	25	30	5		Missense_Mutation	SNP	ENST00000216117.8	37	CCDS13914.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982022	0.74474	.	.	ENSG00000100292	ENST00000412893;ENST00000216117	T;T	0.26957	1.7;1.7	6.06	2.67	0.31697	Haem oxygenase-like, multi-helical (2);	0.000000	0.85682	D	0.000000	T	0.54515	0.1863	M	0.91300	3.195	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.60367	-0.7277	10	0.87932	D	0	-50.6157	9.0075	0.36120	0.338:0.0:0.662:0.0	.	18	P09601	HMOX1_HUMAN	N	18	ENSP00000413316:K18N;ENSP00000216117:K18N	ENSP00000216117:K18N	K	+	3	2	HMOX1	34109129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.625000	0.37029	0.909000	0.36697	0.655000	0.94253	AAG	.		0.577	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320657.1		
SUN2	25777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	39146253	39146253	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr22:39146253A>G	ENST00000405510.1	-	6	855	c.497T>C	c.(496-498)cTc>cCc	p.L166P	SUN2_ENST00000411587.2_Missense_Mutation_p.L155P|SUN2_ENST00000216064.4_Missense_Mutation_p.L166P|RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000405018.1_Missense_Mutation_p.L187P|SUN2_ENST00000406622.1_Missense_Mutation_p.L166P	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	166					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CACCATCCAGAGTAAGGAGCC	0.602																																					p.L187P		.											.	SUN2-154	0			c.T560C						.						47.0	52.0	50.0					22																	39146253		2203	4300	6503	SO:0001583	missense	25777	exon5			ATCCAGAGTAAGG	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.497T>C	22.37:g.39146253A>G	ENSP00000385740:p.Leu166Pro	82	0		66	22	NM_001199579	0	0	105	177	72	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Missense_Mutation	SNP	ENST00000405510.1	37	CCDS13978.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.41|14.41	2.527820|2.527820	0.44969|0.44969	.|.	.|.	ENSG00000100242|ENSG00000100242	ENST00000405510;ENST00000216064;ENST00000405018;ENST00000406622;ENST00000411587;ENST00000438058;ENST00000456894;ENST00000420859|ENST00000430185	T;T;T;T;T;T;T;T|.	0.40756|.	2.3;2.3;2.31;2.3;2.16;1.03;1.23;1.02|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.691574|.	0.13508|.	N|.	0.382686|.	T|T	0.49029|0.49029	0.1533|0.1533	N|N	0.19112|0.19112	0.55|0.55	0.41384|0.41384	D|D	0.987572|0.987572	P;D;D;D;D|.	0.57257|.	0.826;0.979;0.963;0.971;0.963|.	B;P;P;P;P|.	0.50617|.	0.347;0.642;0.642;0.646;0.521|.	T|T	0.46762|0.46762	-0.9168|-0.9168	10|5	0.87932|.	D|.	0|.	-3.5021|-3.5021	13.3916|13.3916	0.60827|0.60827	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	155;201;166;187;166|.	B4DIU6;B4E2A6;Q2T9F7;B0QY62;Q9UH99|.	.;.;.;.;SUN2_HUMAN|.	P|P	166;166;187;166;155;120;166;120|23	ENSP00000385740:L166P;ENSP00000216064:L166P;ENSP00000385616:L187P;ENSP00000383992:L166P;ENSP00000395601:L155P;ENSP00000406941:L120P;ENSP00000415588:L166P;ENSP00000408834:L120P|.	ENSP00000216064:L166P|.	L|S	-|-	2|1	0|0	SUN2|SUN2	37476199|37476199	0.307000|0.307000	0.24500|0.24500	0.729000|0.729000	0.30791|0.30791	0.137000|0.137000	0.21094|0.21094	1.454000|1.454000	0.35178|0.35178	2.032000|2.032000	0.59987|0.59987	0.528000|0.528000	0.53228|0.53228	CTC|TCT	.		0.602	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1	XM_039332	
PSMD6	9861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	64004274	64004274	+	Splice_Site	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:64004274C>A	ENST00000295901.4	-	5	967		c.e5+1		PSMD6_ENST00000394431.2_Splice_Site|PSMD6_ENST00000482510.1_Splice_Site|RP11-245J9.6_ENST00000605919.1_RNA|RP11-245J9.4_ENST00000462717.1_RNA|PSMD6_ENST00000492933.1_Splice_Site	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		CCTATCCTTACCTAATGATTG	0.388																																					.		.											.	PSMD6-91	0			c.985+1G>T						.						78.0	71.0	73.0					3																	64004274		2203	4300	6503	SO:0001630	splice_region_variant	9861	exon7			TCCTTACCTAATG	AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.826+1G>T	3.37:g.64004274C>A		44	0		34	12	NM_001271779	0	0	0	2	2	A8K2E0|E9PHI9|Q6UV22	Splice_Site	SNP	ENST00000295901.4	37	CCDS2901.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577357	0.65878	.	.	ENSG00000163636	ENST00000295901;ENST00000480205;ENST00000492933;ENST00000394431;ENST00000482510	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3633	0.98874	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PSMD6	63979314	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	6.088000	0.71371	2.826000	0.97356	0.561000	0.74099	.	.		0.388	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352082.1	NM_014814	Intron
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	97202865	97202865	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:97202865A>C	ENST00000514100.1	+	7	580	c.338A>C	c.(337-339)gAt>gCt	p.D113A	EPHA6_ENST00000502694.1_Missense_Mutation_p.D113A|EPHA6_ENST00000442602.2_Missense_Mutation_p.D87A|EPHA6_ENST00000389672.5_Missense_Mutation_p.D721A	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	627	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AAGGAGATTGATCCCTCAAGA	0.383																																					p.D721A		.											.	EPHA6-1561	0			c.A2162C						.						99.0	101.0	100.0					3																	97202865		1865	4106	5971	SO:0001583	missense	285220	exon10			AGATTGATCCCTC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.338A>C	3.37:g.97202865A>C	ENSP00000421711:p.Asp113Ala	42	0		46	26	NM_001080448	0	0	0	0	0	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		.	.	.	.	.	.	.	.	.	.	A	22.3	4.273321	0.80580	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.32	5.32	0.75619	Protein kinase-like domain (1);	.	.	.	.	T	0.54615	0.1869	M	0.89785	3.06	0.80722	D	1	D;D;D;D	0.89917	0.999;0.962;1.0;1.0	P;P;D;D	0.85130	0.907;0.598;0.997;0.962	T	0.65438	-0.6168	9	0.87932	D	0	.	15.3417	0.74303	1.0:0.0:0.0:0.0	.	87;626;113;113	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	A	721;113;113;87	ENSP00000374323:D721A;ENSP00000421711:D113A;ENSP00000423950:D113A;ENSP00000403100:D87A	ENSP00000374323:D721A	D	+	2	0	EPHA6	98685555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.958000	0.93099	2.026000	0.59711	0.454000	0.30748	GAT	.		0.383	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
PHC3	80012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	169847187	169847187	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:169847187G>A	ENST00000494943.1	-	8	1105	c.1037C>T	c.(1036-1038)cCa>cTa	p.P346L	PHC3_ENST00000495893.2_Missense_Mutation_p.P358L|PHC3_ENST00000467570.1_Missense_Mutation_p.P305L			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	346	Gln-rich.|Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GGATGGGGGTGGGTCTTGAGT	0.488																																					p.P358L		.											.	PHC3-227	0			c.C1073T						.						205.0	205.0	205.0					3																	169847187		2024	4175	6199	SO:0001583	missense	80012	exon8			GGGGGTGGGTCTT		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1037C>T	3.37:g.169847187G>A	ENSP00000420271:p.Pro346Leu	127	0		156	45	NM_024947	0	0	20	27	7	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	ENST00000494943.1	37		.	.	.	.	.	.	.	.	.	.	G	12.23	1.875524	0.33162	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570;ENST00000484931	T;T	0.32515	1.45;1.47	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000001	T	0.37046	0.0989	L	0.55481	1.735	0.80722	D	1	B;P;B;B	0.47302	0.008;0.893;0.0;0.0	B;P;B;B	0.44811	0.006;0.461;0.0;0.002	T	0.08046	-1.0741	10	0.35671	T	0.21	-10.2153	18.6641	0.91483	0.0:0.0:1.0:0.0	.	305;305;346;358	B4E2T1;E7EX82;Q8NDX5;Q8NDX5-7	.;.;PHC3_HUMAN;.	L	346;358;305;184	ENSP00000420271:P346L;ENSP00000420294:P358L	ENSP00000419089:P305L	P	-	2	0	PHC3	171329881	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.385000	0.66231	2.514000	0.84764	0.561000	0.74099	CCA	.		0.488	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	
PDGFRA	5156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	55139834	55139834	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr4:55139834G>A	ENST00000257290.5	+	10	1826	c.1495G>A	c.(1495-1497)Gtg>Atg	p.V499M	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	499	Ig-like C2-type 5.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.V499M(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GACCATCGCCGTGCGATGCCT	0.557			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.V499M	Pancreas(151;208 1913 7310 23853 37092)	.		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA-9497	1	Substitution - Missense(1)	breast(1)	c.G1495A						.						85.0	83.0	83.0					4																	55139834		2203	4300	6503	SO:0001583	missense	5156	exon10	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	ATCGCCGTGCGAT	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1495G>A	4.37:g.55139834G>A	ENSP00000257290:p.Val499Met	126	0		79	25	NM_006206	0	0	22	22	0	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863494	0.51482	.	.	ENSG00000134853	ENST00000257290	T	0.77750	-1.12	5.9	5.9	0.94986	Immunoglobulin-like fold (1);	0.000000	0.29529	U	0.011898	D	0.86401	0.5924	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.75020	0.985;0.882	D	0.86433	0.1762	10	0.56958	D	0.05	.	13.4661	0.61254	0.0709:0.0:0.9291:0.0	.	499;499	P16234-3;P16234	.;PGFRA_HUMAN	M	499	ENSP00000257290:V499M	ENSP00000257290:V499M	V	+	1	0	PDGFRA	54834591	1.000000	0.71417	0.136000	0.22124	0.003000	0.03518	6.915000	0.75770	2.788000	0.95919	0.650000	0.86243	GTG	.		0.557	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
TERT	7015	broad.mit.edu	37	5	1268651	1268651	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr5:1268651C>A	ENST00000310581.5	-	9	2623	c.2566G>T	c.(2566-2568)Ggg>Tgg	p.G856W	TERT_ENST00000296820.5_Missense_Mutation_p.G795V|TERT_ENST00000508104.2_Missense_Mutation_p.G795V|TERT_ENST00000334602.6_Missense_Mutation_p.G856W	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	856	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	CGCCGAATCCCCGCAAACAGC	0.602									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.G856W													.	TERT-1272	0			c.G2566T						.						54.0	52.0	53.0					5																	1268651		2203	4300	6503	SO:0001583	missense	7015	exon9	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	GAATCCCCGCAAA	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2566G>T	5.37:g.1268651C>A	ENSP00000309572:p.Gly856Trp	48	0		35	3	NM_001193376	0	0	0	0	0	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	37	CCDS3861.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.71|12.71	2.019452|2.019452	0.35606|0.35606	.|.	.|.	ENSG00000164362|ENSG00000164362	ENST00000296820;ENST00000508104|ENST00000310581;ENST00000334602	D;D|D;D	0.97016|0.98419	-4.21;-4.21|-4.92;-4.92	4.26|4.26	4.26|4.26	0.50523|0.50523	.|Reverse transcriptase (2);	0.130499|0.130499	0.52532|0.52532	D|D	0.000072|0.000072	D|D	0.98698|0.98698	0.9563|0.9563	M|M	0.81942|0.81942	2.565|2.565	0.34527|0.34527	D|D	0.708733|0.708733	.|D;D	.|0.89917	.|0.998;1.0	.|D;D	.|0.91635	.|0.964;0.999	D|D	0.99969|0.99969	1.1929|1.1929	8|10	0.26408|0.37606	T|T	0.33|0.19	-12.8165|-12.8165	13.6164|13.6164	0.62110|0.62110	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|856;856	.|O14746-3;O14746	.|.;TERT_HUMAN	V|W	795|856	ENSP00000296820:G795V;ENSP00000426042:G795V|ENSP00000309572:G856W;ENSP00000334346:G856W	ENSP00000296820:G795V|ENSP00000309572:G856W	G|G	-|-	2|1	0|0	TERT|TERT	1321651|1321651	0.009000|0.009000	0.17119|0.17119	0.006000|0.006000	0.13384|0.13384	0.006000|0.006000	0.05464|0.05464	1.381000|1.381000	0.34362|0.34362	1.932000|1.932000	0.55993|0.55993	0.561000|0.561000	0.74099|0.74099	GGG|GGG	.		0.602	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
LPCAT1	79888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1488543	1488543	+	Silent	SNP	A	A	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr5:1488543A>T	ENST00000283415.3	-	5	762	c.630T>A	c.(628-630)acT>acA	p.T210T		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	210					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGTTTGTACAAGTTCCTTCTG	0.323																																					p.T210T		.											.	LPCAT1-92	0			c.T630A						.						87.0	90.0	89.0					5																	1488543		2203	4300	6503	SO:0001819	synonymous_variant	79888	exon5			TGTACAAGTTCCT	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.630T>A	5.37:g.1488543A>T		152	0		107	47	NM_024830	0	0	17	27	10	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Silent	SNP	ENST00000283415.3	37	CCDS3864.1																																																																																			.		0.323	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830	
NSUN2	54888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	6620280	6620280	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr5:6620280C>T	ENST00000264670.6	-	7	1065	c.754G>A	c.(754-756)Gat>Aat	p.D252N	NSUN2_ENST00000505264.1_5'UTR|NSUN2_ENST00000539938.1_Missense_Mutation_p.D16N|NSUN2_ENST00000506139.1_Missense_Mutation_p.D217N	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	252					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCGTCCACATCTATCTGGAGC	0.493																																					p.D252N		.											.	NSUN2-91	0			c.G754A						.						108.0	105.0	106.0					5																	6620280		2203	4300	6503	SO:0001583	missense	54888	exon7			CCACATCTATCTG	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.754G>A	5.37:g.6620280C>T	ENSP00000264670:p.Asp252Asn	125	0		122	40	NM_017755	0	0	22	42	20	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273421	0.23221	.	.	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.38560	1.16;2.97;1.13	6.02	6.02	0.97574	.	0.084604	0.85682	D	0.000000	T	0.20740	0.0499	N	0.02985	-0.445	0.51767	D	0.999935	B;B	0.15930	0.015;0.005	B;B	0.20384	0.022;0.029	T	0.18808	-1.0325	10	0.12766	T	0.61	-53.9111	14.6603	0.68865	0.0:0.9312:0.0:0.0688	.	217;252	B4DQW2;Q08J23	.;NSUN2_HUMAN	N	252;16;217	ENSP00000264670:D252N;ENSP00000444338:D16N;ENSP00000420957:D217N	ENSP00000264670:D252N	D	-	1	0	NSUN2	6673280	0.863000	0.29885	0.538000	0.28064	0.018000	0.09664	2.600000	0.46240	2.865000	0.98341	0.655000	0.94253	GAT	.		0.493	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82836813	82836813	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr5:82836813A>G	ENST00000265077.3	+	8	8556	c.7991A>G	c.(7990-7992)gAt>gGt	p.D2664G	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.D1677G|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2664	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGCCAACTAGATCACATGGGC	0.453																																					p.D2664G		.											.	VCAN-238	0			c.A7991G						.						126.0	122.0	123.0					5																	82836813		2203	4300	6503	SO:0001583	missense	1462	exon8			AACTAGATCACAT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7991A>G	5.37:g.82836813A>G	ENSP00000265077:p.Asp2664Gly	157	0		153	45	NM_004385	0	0	613	918	305	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	2.766	-0.256719	0.05829	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.35605	1.3;1.3	6.04	2.03	0.26663	.	0.465278	0.21973	N	0.066435	T	0.30324	0.0761	L	0.53249	1.67	0.09310	N	1	B;B	0.17268	0.021;0.012	B;B	0.15484	0.013;0.006	T	0.19582	-1.0301	10	0.35671	T	0.21	.	9.0589	0.36423	0.7098:0.0:0.2902:0.0	.	1677;2664	P13611-2;P13611	.;CSPG2_HUMAN	G	2664;1677	ENSP00000265077:D2664G;ENSP00000340062:D1677G	ENSP00000265077:D2664G	D	+	2	0	VCAN	82872569	0.001000	0.12720	0.002000	0.10522	0.019000	0.09904	0.608000	0.24223	0.540000	0.28808	-0.375000	0.07067	GAT	.		0.453	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
SLC22A5	6584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131729504	131729504	+	Splice_Site	SNP	G	G	A	rs386134226		TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr5:131729504G>A	ENST00000245407.3	+	9	1807		c.e9+1		SLC22A5_ENST00000435065.2_Splice_Site	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5						carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	GAGTCAAAGGGTAAGAAGACC	0.542																																					.		.											.	SLC22A5-90	0			c.1586+1G>A						.						200.0	186.0	191.0					5																	131729504		2203	4300	6503	SO:0001630	splice_region_variant	6584	exon9			CAAAGGGTAAGAA	AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.1586+1G>A	5.37:g.131729504G>A		211	0		154	61	NM_003060	0	0	0	1	1	A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Splice_Site	SNP	ENST00000245407.3	37	CCDS4154.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828787	0.90955	.	.	ENSG00000197375	ENST00000245407;ENST00000435065	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC22A5	131757403	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.442000	0.97566	2.941000	0.99782	0.655000	0.94253	.	.		0.542	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132631.1	NM_003060	Intron
PPP1R10	5514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30577691	30577691	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr6:30577691G>T	ENST00000376511.2	-	3	583	c.31C>A	c.(31-33)Ctt>Att	p.L11I	PPP1R10_ENST00000484449.1_5'Flank	NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	11	Interaction with TOX4. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						CCCTTGAGAAGTTCTTTGGGG	0.468																																					p.L11I		.											.	PPP1R10-660	0			c.C31A						.						112.0	107.0	109.0					6																	30577691		2203	4300	6503	SO:0001583	missense	5514	exon3			TGAGAAGTTCTTT	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.31C>A	6.37:g.30577691G>T	ENSP00000365694:p.Leu11Ile	106	0		97	33	NM_002714	0	0	20	38	18	O00405	Missense_Mutation	SNP	ENST00000376511.2	37	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785297	0.70337	.	.	ENSG00000204569	ENST00000376511;ENST00000537132	T	0.54675	0.56	5.65	5.65	0.86999	.	0.119294	0.64402	D	0.000018	T	0.33876	0.0878	L	0.37850	1.14	0.43399	D	0.995525	B	0.30236	0.274	B	0.26416	0.069	T	0.21008	-1.0258	10	0.52906	T	0.07	-18.5396	18.8591	0.92265	0.0:0.0:1.0:0.0	.	11	Q96QC0	PP1RA_HUMAN	I	11	ENSP00000365694:L11I	ENSP00000365694:L11I	L	-	1	0	PPP1R10	30685670	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.210000	0.65214	2.825000	0.97269	0.655000	0.94253	CTT	.		0.468	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714	
URGCP	55665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	43918184	43918184	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr7:43918184A>C	ENST00000453200.1	-	6	1371	c.878T>G	c.(877-879)tTc>tGc	p.F293C	URGCP_ENST00000497914.1_5'UTR|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000443736.1_Missense_Mutation_p.F250C|URGCP_ENST00000402306.3_Missense_Mutation_p.F284C|URGCP_ENST00000447717.3_Missense_Mutation_p.F250C|URGCP_ENST00000223341.7_Missense_Mutation_p.F250C|URGCP_ENST00000336086.6_Missense_Mutation_p.F250C			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	293					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCGATGCCAGAAGCAGTCCCA	0.602																																					p.F293C		.											.	URGCP-94	0			c.T878G						.						43.0	47.0	45.0					7																	43918184		1981	4149	6130	SO:0001583	missense	55665	exon6			TGCCAGAAGCAGT		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.878T>G	7.37:g.43918184A>C	ENSP00000396918:p.Phe293Cys	70	0		75	21	NM_001077663	0	0	34	50	16	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914953	0.72983	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.43688	1.02;1.02;0.95;1.02;0.94;1.02	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.67720	0.2923	M	0.85945	2.785	0.49483	D	0.999796	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73665	-0.3911	10	0.87932	D	0	-32.908	13.5869	0.61937	1.0:0.0:0.0:0.0	.	284;293	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	C	250;250;284;250;293;250	ENSP00000223341:F250C;ENSP00000336872:F250C;ENSP00000384955:F284C;ENSP00000392136:F250C;ENSP00000396918:F293C;ENSP00000402803:F250C	ENSP00000223341:F250C	F	-	2	0	URGCP	43884709	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.761000	0.91691	2.104000	0.64026	0.402000	0.26972	TTC	.		0.602	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
BAZ1B	9031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	72907199	72907199	+	Silent	SNP	T	T	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr7:72907199T>C	ENST00000339594.4	-	5	962	c.624A>G	c.(622-624)ggA>ggG	p.G208G	BAZ1B_ENST00000404251.1_Silent_p.G208G	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	208	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				ATTTCCTTTCTCCTTTTTTTA	0.328																																					p.G208G	Esophageal Squamous(112;1167 1561 21085 43672 48228)	.											.	BAZ1B-159	0			c.A624G						.						129.0	125.0	127.0					7																	72907199		2203	4299	6502	SO:0001819	synonymous_variant	9031	exon5			CCTTTCTCCTTTT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.624A>G	7.37:g.72907199T>C		51	0		112	26	NM_032408	0	0	48	77	29	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1																																																																																			.		0.328	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
ZFHX4	79776	hgsc.bcm.edu	37	8	77618779	77618779	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr8:77618779A>G	ENST00000521891.2	+	2	2904	c.2456A>G	c.(2455-2457)gAg>gGg	p.E819G	ZFHX4_ENST00000455469.2_Missense_Mutation_p.E819G|ZFHX4_ENST00000518282.1_Missense_Mutation_p.E819G|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E819G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	819					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCGGAAGCAGAGCTTTATCAG	0.507										HNSCC(33;0.089)																											p.E819G		.											.	ZFHX4-98	0			c.A2456G						.						20.0	20.0	20.0					8																	77618779		2018	4177	6195	SO:0001583	missense	79776	exon2			AAGCAGAGCTTTA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2456A>G	8.37:g.77618779A>G	ENSP00000430497:p.Glu819Gly	23	0		15	2	NM_024721	0	0	1	1	0	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	12.39	1.922655	0.33908	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.56776	0.48;0.46;0.44;0.44	4.91	4.91	0.64330	.	0.000000	0.43579	U	0.000548	T	0.70150	0.3191	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.984	D;D;D;P	0.78314	0.979;0.991;0.991;0.885	T	0.74131	-0.3764	10	0.87932	D	0	.	14.9861	0.71348	1.0:0.0:0.0:0.0	.	819;819;819;819	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	G	819	ENSP00000430497:E819G;ENSP00000399605:E819G;ENSP00000050961:E819G;ENSP00000430848:E819G	ENSP00000050961:E819G	E	+	2	0	ZFHX4	77781334	1.000000	0.71417	0.996000	0.52242	0.913000	0.54294	9.048000	0.93830	2.179000	0.69175	0.477000	0.44152	GAG	.		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144997708	144997708	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr8:144997708T>A	ENST00000322810.4	-	31	6969	c.6800A>T	c.(6799-6801)cAg>cTg	p.Q2267L	PLEC_ENST00000345136.3_Missense_Mutation_p.Q2130L|PLEC_ENST00000436759.2_Missense_Mutation_p.Q2157L|PLEC_ENST00000357649.2_Missense_Mutation_p.Q2134L|PLEC_ENST00000527096.1_Missense_Mutation_p.Q2153L|PLEC_ENST00000354958.2_Missense_Mutation_p.Q2108L|PLEC_ENST00000398774.2_Missense_Mutation_p.Q2098L|PLEC_ENST00000354589.3_Missense_Mutation_p.Q2130L|PLEC_ENST00000356346.3_Missense_Mutation_p.Q2116L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2267	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCCTGTGCCTGAGCCCGGGC	0.741																																					p.Q2267L		.											.	PLEC-141	0			c.A6800T						.						8.0	10.0	10.0					8																	144997708		1949	4030	5979	SO:0001583	missense	5339	exon31			TGTGCCTGAGCCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6800A>T	8.37:g.144997708T>A	ENSP00000323856:p.Gln2267Leu	27	0		24	5	NM_201380	0	0	41	57	16	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	T	4.904	0.167918	0.09339	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78816	-1.17;-1.17;-1.2;-1.21;-1.14;-1.17;-1.17;-1.14;-1.17	4.98	3.77	0.43336	.	0.288111	0.26875	U	0.022050	T	0.62684	0.2448	N	0.16790	0.44	0.32967	D	0.521856	B;B;B;B;B;B;B;B	0.13594	0.008;0.008;0.008;0.005;0.008;0.008;0.008;0.008	B;B;B;B;B;B;B;B	0.12156	0.007;0.007;0.007;0.003;0.007;0.007;0.007;0.007	T	0.64935	-0.6290	10	0.66056	D	0.02	.	10.4644	0.44598	0.1462:0.0:0.0:0.8538	.	2157;2116;2108;2267;2098;2130;2134;2130	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	L	2130;2134;2130;2098;2267;2108;2116;2157;2153	ENSP00000344848:Q2130L;ENSP00000350277:Q2134L;ENSP00000346602:Q2130L;ENSP00000381756:Q2098L;ENSP00000323856:Q2267L;ENSP00000347044:Q2108L;ENSP00000348702:Q2116L;ENSP00000388180:Q2157L;ENSP00000434583:Q2153L	ENSP00000323856:Q2267L	Q	-	2	0	PLEC	145069696	0.350000	0.24878	0.725000	0.30721	0.062000	0.15995	1.232000	0.32636	0.690000	0.31570	0.368000	0.22195	CAG	.		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ABCA2	20	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139908396	139908396	+	Silent	SNP	G	G	C			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr9:139908396G>C	ENST00000371605.3	-	27	4479	c.4332C>G	c.(4330-4332)gtC>gtG	p.V1444V	ABCA2_ENST00000265662.5_Silent_p.V1445V|ABCA2_ENST00000341511.6_Silent_p.V1445V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1444					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGAAGCGTTTGACCAGCAGCC	0.672																																					p.V1475V		.											.	ABCA2-90	0			c.C4425G						.						44.0	56.0	52.0					9																	139908396		2147	4225	6372	SO:0001819	synonymous_variant	20	exon28			GCGTTTGACCAGC	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4332C>G	9.37:g.139908396G>C		37	0		33	11	NM_212533	0	0	37	70	33	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	37																																																																																				.		0.672	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
DDX3X	1654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	41202004	41202004	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chrX:41202004G>A	ENST00000399959.2	+	6	1313	c.458G>A	c.(457-459)gGa>gAa	p.G153E	DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Missense_Mutation_p.G137E|DDX3X_ENST00000542215.1_Missense_Mutation_p.G197E|DDX3X_ENST00000478993.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	153	Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CTCTTTTCTGGAGGCAACACT	0.363										HNSCC(61;0.18)																											p.G153E		.											.	DDX3X-715	0			c.G458A						.						102.0	93.0	96.0					X																	41202004		2049	4205	6254	SO:0001583	missense	1654	exon6			TTTCTGGAGGCAA	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.458G>A	X.37:g.41202004G>A	ENSP00000382840:p.Gly153Glu	146	0		145	54	NM_001193416	0	0	0	3	3	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.209130	0.39003	.	.	ENSG00000215301	ENST00000399959;ENST00000457138;ENST00000542215	T;T;T	0.42513	2.21;2.18;0.97	5.75	5.75	0.90469	.	0.050157	0.85682	D	0.000000	T	0.38799	0.1054	L	0.45228	1.405	0.80722	D	1	B;B;B;B;B	0.11235	0.004;0.002;0.001;0.004;0.004	B;B;B;B;B	0.10450	0.005;0.005;0.003;0.005;0.005	T	0.15407	-1.0438	10	0.20046	T	0.44	-0.7141	18.9517	0.92643	0.0:0.0:1.0:0.0	.	153;137;153;165;153	B4DLU5;B4E3E8;B5BTY4;Q59GX6;O00571	.;.;.;.;DDX3X_HUMAN	E	153;137;197	ENSP00000382840:G153E;ENSP00000392494:G137E;ENSP00000439799:G197E	ENSP00000382840:G153E	G	+	2	0	DDX3X	41086948	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.723000	0.61965	2.424000	0.82194	0.600000	0.82982	GGA	.		0.363	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
BSN	8927	hgsc.bcm.edu	37	3	49698758	49698759	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:49698758_49698759delCT	ENST00000296452.4	+	6	9594_9595	c.9480_9481delCT	c.(9478-9483)aactatfs	p.NY3160fs		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3160					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGCCCACCAACTATGAGGTGAT	0.604																																					p.3160_3161del		.											.	BSN-97	0			c.9480_9481del						.																																			SO:0001589	frameshift_variant	8927	exon6			.	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.9480_9481delCT	3.37:g.49698758_49698759delCT	ENSP00000296452:p.Asn3160fs	95	0		36	10	NM_003458	0	0	0	0	0	O43161|Q7LGH3	Frame_Shift_Del	DEL	ENST00000296452.4	37	CCDS2800.1																																																																																			.		0.604	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
CD86	942	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	121825262	121825263	+	Frame_Shift_Del	DEL	AT	AT	-	rs375108955		TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:121825262_121825263delAT	ENST00000330540.2	+	4	734_735	c.618_619delAT	c.(616-621)tcattcfs	p.F207fs	CD86_ENST00000469710.1_Frame_Shift_Del_p.F125fs|CD86_ENST00000264468.5_Intron|CD86_ENST00000393627.2_Frame_Shift_Del_p.F201fs|CD86_ENST00000493101.1_Frame_Shift_Del_p.F95fs	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	207	Ig-like C2-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	TGTCTGTTTCATTCCCTGATGT	0.391																																					p.206_207del	GBM(67;1379 1389 36064 39806)	.											.	CD86-92	0			c.618_619del						.																																			SO:0001589	frameshift_variant	942	exon4			.		CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.618_619delAT	3.37:g.121825262_121825263delAT	ENSP00000332049:p.Phe207fs	263	0		362	177	NM_175862	0	0	0	0	0	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Frame_Shift_Del	DEL	ENST00000330540.2	37	CCDS3009.1																																																																																			.		0.391	CD86-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355671.1	NM_006889	
CEP63	80254	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	134250746	134250746	+	Frame_Shift_Del	DEL	G	G	-	rs544307188		TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr3:134250746delG	ENST00000337090.3	+	4	455	c.282delG	c.(280-282)atgfs	p.M94fs	CEP63_ENST00000383229.3_Frame_Shift_Del_p.M94fs|CEP63_ENST00000332047.5_Frame_Shift_Del_p.M94fs|CEP63_ENST00000513612.2_Frame_Shift_Del_p.M94fs|CEP63_ENST00000606977.1_Frame_Shift_Del_p.M94fs|CEP63_ENST00000354446.3_Frame_Shift_Del_p.M94fs|CEP63_ENST00000504013.1_3'UTR			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	94					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AGATGACCATGGAATATAAGC	0.353																																					p.M94fs		.											.	CEP63-493	0			c.282delG						.						171.0	168.0	169.0					3																	134250746		2203	4300	6503	SO:0001589	frameshift_variant	80254	exon4			.	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.282delG	3.37:g.134250746delG	ENSP00000336524:p.Met94fs	79	0		80	41	NM_001042383	0	0	0	0	0	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Frame_Shift_Del	DEL	ENST00000337090.3	37	CCDS3086.1																																																																																			.		0.353	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	NM_025180	
CCDC129	223075	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	31683522	31683527	+	In_Frame_Del	DEL	GACTTT	GACTTT	-			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	GACTTT	GACTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr7:31683522_31683527delGACTTT	ENST00000407970.3	+	11	2576_2581	c.2538_2543delGACTTT	c.(2536-2544)acgactttg>acg	p.TL847del	CCDC129_ENST00000451887.2_In_Frame_Del_p.TL873del|CCDC129_ENST00000319386.3_In_Frame_Del_p.TL699del|CCDC129_ENST00000409210.1_In_Frame_Del_p.TL755del	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	847										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGTTCATGACGACTTTGAAAGCCCTT	0.549																																					p.872_874del		.											.	.	0			c.2616_2621del						.																																			SO:0001651	inframe_deletion	223075	exon11			.	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2538_2543delGACTTT	7.37:g.31683522_31683527delGACTTT	ENSP00000384416:p.Thr847_Leu848del	64	0		121	26	NM_001257968	0	0	0	0	0	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	In_Frame_Del	DEL	ENST00000407970.3	37	CCDS5435.2																																																																																			.		0.549	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
DNAJC2	27000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102963052	102963053	+	Nonsense_Mutation	DNP	AT	AT	TA			TCGA-EV-5901-01A-11D-1589-08	TCGA-EV-5901-10A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	846543e9-145b-4332-9043-5817b55e2208	8623db0f-675b-4d34-ba2b-5c12aa3e9b7b	g.chr7:102963052_102963053AT>TA	ENST00000379263.3	-	9	1088_1089	c.838_839AT>TA	c.(838-840)ATa>TAa	p.I280*	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Nonsense_Mutation_p.I280*	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	280					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						GAACTTTTTTATCCTTGGATCA	0.337																																					p.I280*		.											.	DNAJC2	0			c.A838T						.																																			SO:0001587	stop_gained	27000	exon9			TTTTTATCCTTGG	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.838_839delinsTA	7.37:g.102963052_102963053delinsTA	ENSP00000368565:p.Ile280*	53.0	0.0		60.0	33.0		0	0	0	0	0	A4VCI0|Q9BVX1	Nonsense_Mutation	DNP	ENST00000379263.3	37	CCDS43628.1																																																																																			.		0.337	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
