#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	bcgsc.ca	37	1	6185908	6185908	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:6185908A>C	ENST00000262450.3	-	27	4188	c.4089T>G	c.(4087-4089)gaT>gaG	p.D1363E	CHD5_ENST00000378021.1_Missense_Mutation_p.D220E	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAGAGAGCTCATCCTGCCACT	0.567																																					p.D1363E													.	CHD5-719	0			c.T4089G						.						74.0	82.0	79.0					1																	6185908		2203	4300	6503	SO:0001583	missense	26038	exon27			GAGCTCATCCTGC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4089T>G	1.37:g.6185908A>C	ENSP00000262450:p.Asp1363Glu	98	7		81	22	NM_015557	0	0	0	0	0	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681550	0.47991	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.90004	-2.6;2.34	4.67	-6.85	0.01681	.	0.000000	0.64402	D	0.000002	T	0.76234	0.3959	N	0.20845	0.615	0.38804	D	0.955272	P;B	0.51057	0.941;0.048	B;B	0.41271	0.352;0.015	T	0.75761	-0.3204	10	0.24483	T	0.36	-26.8232	15.6639	0.77209	0.4799:0.0:0.5201:0.0	.	1363;220	Q8TDI0;Q5TG85	CHD5_HUMAN;.	E	1363;879;220;771;771;220	ENSP00000262450:D1363E;ENSP00000367260:D220E	ENSP00000262450:D1363E	D	-	3	2	CHD5	6108495	0.071000	0.21146	0.876000	0.34364	0.882000	0.50991	-0.451000	0.06795	-1.517000	0.01780	-1.386000	0.01163	GAT	.		0.567	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
AHDC1	27245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27875947	27875947	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:27875947T>G	ENST00000247087.5	-	5	3276	c.2680A>C	c.(2680-2682)Aag>Cag	p.K894Q	AHDC1_ENST00000374011.2_Missense_Mutation_p.K894Q			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	894							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGGCTGGCCTTGGCTCCCCGG	0.716																																					p.K894Q		.											.	AHDC1-90	0			c.A2680C						.						19.0	23.0	22.0					1																	27875947		2196	4287	6483	SO:0001583	missense	27245	exon6			TGGCCTTGGCTCC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.2680A>C	1.37:g.27875947T>G	ENSP00000247087:p.Lys894Gln	53	0		55	33	NM_001029882	0	0	8	23	15	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.943941	0.73672	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.55052	0.54;0.54	5.77	5.77	0.91146	.	0.088674	0.42548	D	0.000697	T	0.57504	0.2058	N	0.14661	0.345	0.46774	D	0.999191	D	0.76494	0.999	D	0.83275	0.996	T	0.64740	-0.6336	10	0.72032	D	0.01	-11.4835	15.0705	0.72034	0.0:0.0:0.0:1.0	.	894	Q5TGY3	AHDC1_HUMAN	Q	894	ENSP00000247087:K894Q;ENSP00000363123:K894Q	ENSP00000247087:K894Q	K	-	1	0	AHDC1	27748534	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.070000	0.76763	2.199000	0.70637	0.533000	0.62120	AAG	.		0.716	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
USP24	23358	hgsc.bcm.edu;broad.mit.edu	37	1	55569689	55569689	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:55569689T>C	ENST00000294383.6	-	42	4884	c.4885A>G	c.(4885-4887)Agt>Ggt	p.S1629G	USP24_ENST00000407756.1_Missense_Mutation_p.S1469G	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1629					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TTCGCTGTACTACACCTAGAA	0.328																																					p.S1629G		.											.	USP24-521	0			c.A4885G						.						43.0	40.0	41.0					1																	55569689		1867	4093	5960	SO:0001583	missense	23358	exon42			CTGTACTACACCT	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4885A>G	1.37:g.55569689T>C	ENSP00000294383:p.Ser1629Gly	11	0		21	6	NM_015306	0	0	0	0	0	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	15.27	2.782405	0.49891	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02323	4.34;4.34	6.05	6.05	0.98169	.	0.084787	0.85682	D	0.000000	T	0.03178	0.0093	N	0.25890	0.77	0.43152	D	0.994923	B	0.22003	0.063	B	0.22386	0.039	T	0.56944	-0.7895	10	0.23302	T	0.38	.	15.1642	0.72807	0.0:0.0:0.0:1.0	.	1469	B7WPF4	.	G	1629;1469	ENSP00000294383:S1629G;ENSP00000385700:S1469G	ENSP00000294383:S1629G	S	-	1	0	USP24	55342277	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.616000	0.83018	2.320000	0.78422	0.528000	0.53228	AGT	.		0.328	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:145367739A>G	ENST00000342960.5	+	83	10370	c.10335A>G	c.(10333-10335)aaA>aaG	p.K3445K	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K3445K(4)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.413																																					p.K3445K													.	.	4	Substitution - coding silent(4)	prostate(3)|kidney(1)	c.A10335G						.																																			SO:0001819	synonymous_variant	100132406	exon83			GGGGAAAAAAAGA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10335A>G	1.37:g.145367739A>G		164	1		128	4	NM_001039703	0	0	31	408	377	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	CCDS53355.1																																																																																			.		0.413	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
C1orf54	79630	broad.mit.edu	37	1	150246559	150246559	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:150246559T>C	ENST00000369102.1	+	4	886	c.116T>C	c.(115-117)gTc>gCc	p.V39A	C1orf54_ENST00000369099.3_Missense_Mutation_p.V39A|C1orf54_ENST00000369098.3_Missense_Mutation_p.V39A			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	39						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TATTATACAGTCACCCCCAGT	0.438																																					p.V39A													.	C1orf54-90	0			c.T116C						.						138.0	142.0	141.0					1																	150246559		2203	4300	6503	SO:0001583	missense	79630	exon2			ATACAGTCACCCC	BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.116T>C	1.37:g.150246559T>C	ENSP00000358098:p.Val39Ala	174	0		169	4	NM_024579	0	0	0	0	0	Q9H5P3	Missense_Mutation	SNP	ENST00000369102.1	37	CCDS948.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.115321	0.77323	.	.	ENSG00000118292	ENST00000369102;ENST00000369099;ENST00000369098	.	.	.	4.9	4.9	0.64082	.	0.484707	0.17387	N	0.176072	T	0.37156	0.0993	L	0.54323	1.7	0.32047	N	0.597459	P;P	0.49961	0.93;0.93	P;P	0.47915	0.561;0.561	T	0.42783	-0.9431	9	0.72032	D	0.01	-7.2786	11.0953	0.48141	0.0:0.0:0.0:1.0	.	39;39	Q5TB16;Q8WWF1	.;CA054_HUMAN	A	39	.	ENSP00000358094:V39A	V	+	2	0	C1orf54	148513183	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.432000	0.52824	2.184000	0.69523	0.533000	0.62120	GTC	.		0.438	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152279672	152279672	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:152279672C>A	ENST00000368799.1	-	3	7725	c.7690G>T	c.(7690-7692)Gga>Tga	p.G2564*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2564	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAACTGGATCCCCAGTTCCTG	0.582									Ichthyosis																												p.G2564X		.											.	FLG-106	0			c.G7690T						.						187.0	200.0	196.0					1																	152279672		2201	4300	6501	SO:0001587	stop_gained	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGGATCCCCAGTT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7690G>T	1.37:g.152279672C>A	ENSP00000357789:p.Gly2564*	424	1		433	213	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	46	12.137190	0.99639	.	.	ENSG00000143631	ENST00000368799	.	.	.	3.61	-1.65	0.08291	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	7.5003	0.27513	0.0:0.4216:0.4707:0.1077	.	.	.	.	X	2564	.	ENSP00000357789:G2564X	G	-	1	0	FLG	150546296	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.888000	0.28268	-0.164000	0.10927	0.306000	0.20318	GGA	.		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
MYOC	4653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171605341	171605341	+	Silent	SNP	G	G	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:171605341G>C	ENST00000037502.6	-	3	1310	c.1239C>G	c.(1237-1239)ctC>ctG	p.L413L		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	413	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGGTTTGTTCGAGTTCCAGAT	0.522																																					p.L413L		.											.	MYOC-226	0			c.C1239G						.						210.0	193.0	199.0					1																	171605341		2203	4300	6503	SO:0001819	synonymous_variant	4653	exon3			TTGTTCGAGTTCC	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1239C>G	1.37:g.171605341G>C		214	0		155	63	NM_000261	0	0	0	0	0	B2RD84|O00620|Q7Z6Q9	Silent	SNP	ENST00000037502.6	37	CCDS1297.1																																																																																			.		0.522	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228473855	228473855	+	Silent	SNP	G	G	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:228473855G>C	ENST00000422127.1	+	34	9125	c.9081G>C	c.(9079-9081)cgG>cgC	p.R3027R	OBSCN_ENST00000284548.11_Silent_p.R3027R|OBSCN_ENST00000570156.2_Silent_p.R3456R|OBSCN_ENST00000366709.4_Silent_p.R146R|OBSCN_ENST00000359599.6_Silent_p.R1874R|OBSCN_ENST00000366707.4_Silent_p.R146R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3027	Ig-like 30.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCCGTTGCCGGATCTCCCCGG	0.627																																					p.R3456R		.											.	OBSCN-403	0			c.G10368C						.						33.0	43.0	40.0					1																	228473855		2117	4218	6335	SO:0001819	synonymous_variant	84033	exon39			TTGCCGGATCTCC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9081G>C	1.37:g.228473855G>C		28	0		19	12	NM_001271223	0	0	6	8	2	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
WDR37	22884	hgsc.bcm.edu	37	10	1151150	1151150	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr10:1151150T>C	ENST00000358220.1	+	11	1190	c.1046T>C	c.(1045-1047)cTc>cCc	p.L349P	WDR37_ENST00000263150.4_Missense_Mutation_p.L349P			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	349										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ACTTTCCGCCTCTGGGATTTC	0.562																																					p.L349P		.											.	WDR37-90	0			c.T1046C						.						83.0	67.0	72.0					10																	1151150		2203	4300	6503	SO:0001583	missense	22884	exon11			TCCGCCTCTGGGA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1046T>C	10.37:g.1151150T>C	ENSP00000350954:p.Leu349Pro	54	0		41	3	NM_014023	0	0	14	14	0	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843266	0.91197	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.67345	-0.26;-0.26	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85483	0.5707	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88902	0.3353	10	0.87932	D	0	.	15.7724	0.78180	0.0:0.0:0.0:1.0	.	350;349	A8K976;Q9Y2I8	.;WDR37_HUMAN	P	349	ENSP00000350954:L349P;ENSP00000263150:L349P	ENSP00000263150:L349P	L	+	2	0	WDR37	1141150	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.736000	0.84948	2.133000	0.65898	0.459000	0.35465	CTC	.		0.562	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
PARG	8505	broad.mit.edu	37	10	51093329	51093329	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr10:51093329C>T	ENST00000402038.3	-	4	294	c.295G>A	c.(295-297)Gca>Aca	p.A99T		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	584	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)	p.A584T(1)		endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		TGAGCTTCTGCTTCTTCAAGT	0.318																																					p.A584T													.	PARG-948	1	Substitution - Missense(1)	kidney(1)	c.G1750A						.						235.0	183.0	198.0					10																	51093329		692	1589	2281	SO:0001583	missense	8505	exon8			CTTCTGCTTCTTC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.295G>A	10.37:g.51093329C>T	ENSP00000384408:p.Ala99Thr	81	1		113	5	NM_003631	0	0	0	0	0	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37		.	.	.	.	.	.	.	.	.	.	C	12.89	2.073258	0.36566	.	.	ENSG00000227345	ENST00000402038	.	.	.	3.88	2.96	0.34315	.	.	.	.	.	T	0.46678	0.1405	M	0.61703	1.905	.	.	.	B;B;P;P;P;B	0.41947	0.002;0.003;0.574;0.766;0.766;0.006	B;B;B;B;B;B	0.38616	0.006;0.006;0.191;0.179;0.277;0.01	T	0.56631	-0.7947	7	0.18710	T	0.47	-4.0352	11.9338	0.52862	0.0:0.9123:0.0:0.0877	.	502;584;135;99;124;584	Q86W56-2;Q86W56;A5YBK3;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.	T	99	.	ENSP00000384408:A99T	A	-	1	0	PARG	50763335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.907000	0.39897	0.952000	0.37798	0.407000	0.27541	GCA	.		0.318	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
ABLIM1	3983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	116225561	116225561	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr10:116225561A>G	ENST00000277895.5	-	12	1434	c.1337T>C	c.(1336-1338)aTg>aCg	p.M446T	ABLIM1_ENST00000369266.3_Missense_Mutation_p.M158T|ABLIM1_ENST00000533213.2_Missense_Mutation_p.M386T|ABLIM1_ENST00000369252.4_Missense_Mutation_p.M386T|ABLIM1_ENST00000392952.3_Missense_Mutation_p.M158T|ABLIM1_ENST00000369253.2_Missense_Mutation_p.M104T	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	446					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CCGATGGATCATCCGATCCCG	0.557																																					p.M446T		.											.	ABLIM1-153	0			c.T1337C						.						215.0	192.0	200.0					10																	116225561		2203	4300	6503	SO:0001583	missense	3983	exon12			TGGATCATCCGAT	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1337T>C	10.37:g.116225561A>G	ENSP00000277895:p.Met446Thr	178	0		174	88	NM_002313	0	0	31	83	52	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.82|10.82	1.459451|1.459451	0.26248|0.26248	.|.	.|.	ENSG00000099204|ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000392952;ENST00000369257;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369266;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253;ENST00000440467;ENST00000428430|ENST00000392955	T;T;T;T;T;T|.	0.54866|.	0.55;0.55;0.55;0.55;0.55;0.55|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.318695|.	0.42548|.	D|.	0.000696|.	T|.	0.38295|.	0.1035|.	N|N	0.08118|0.08118	0|0	0.36815|0.36815	D|D	0.88611|0.88611	B;B;B;B;B;B;B;B;B|.	0.15930|.	0.0;0.002;0.015;0.0;0.0;0.001;0.001;0.0;0.002|.	B;B;B;B;B;B;B;B;B|.	0.22386|.	0.002;0.005;0.039;0.002;0.001;0.004;0.003;0.001;0.009|.	T|.	0.45745|.	-0.9240|.	10|.	0.15499|.	T|.	0.54|.	.|.	14.3083|14.3083	0.66397|0.66397	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	370;130;386;414;446;158;414;370;104|.	B7Z4H1;B4DQA3;F8W8M4;A6NKJ2;O14639;O14639-5;B3KVH2;C9K0X4;O14639-4|.	.;.;.;.;ABLM1_HUMAN;.;.;.;.|.	T|R	446;386;158;104;414;386;474;370;158;370;370;474;158;111;130|355	ENSP00000358256:M386T;ENSP00000376679:M158T;ENSP00000433629:M386T;ENSP00000358270:M158T;ENSP00000414154:M111T;ENSP00000400934:M130T|.	ENSP00000277895:M474T|.	M|X	-|-	2|1	0|0	ABLIM1|ABLIM1	116215551|116215551	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.016000|6.016000	0.70798|0.70798	2.185000|2.185000	0.69588|0.69588	0.528000|0.528000	0.53228|0.53228	ATG|TGA	.		0.557	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
MUC2	4583	hgsc.bcm.edu	37	11	1092926	1092926	+	Missense_Mutation	SNP	C	C	G	rs377100070		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:1092926C>G	ENST00000441003.2	+	30	4772	c.4745C>G	c.(4744-4746)aCa>aGa	p.T1582R	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1583R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1582R(1)|p.T1583R(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.632																																					p.T1582R		.											.	MUC2-90	2	Substitution - Missense(2)	prostate(2)	c.C4745G						.	C	ARG/THR	24,3818		0,24,1897	77.0	115.0	102.0		4742	0.5	0.0	11		102	140,6992		0,140,3426	no	missense	MUC2	NM_002457.2	71	0,164,5323	GG,GC,CC		1.963,0.6247,1.4944	benign	1581/2813	1092926	164,10810	1921	3566	5487	SO:0001583	missense	4583	exon30			CCCCAACATCGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4745C>G	11.37:g.1092926C>G	ENSP00000415183:p.Thr1582Arg	1	0		25	3	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.792	-0.251014	0.05867	0.006247	0.01963	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14144	2.53;2.91	1.75	0.53	0.17102	.	18.926900	0.00496	U	0.000153	T	0.05227	0.0139	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.28364	-1.0046	9	0.45353	T	0.12	.	7.5493	0.27786	0.0:0.7315:0.2684:0.0	.	1582	E7EUV1	.	R	1582;1583	ENSP00000415183:T1582R;ENSP00000351956:T1583R	ENSP00000351956:T1583R	T	+	2	0	MUC2	1082926	0.001000	0.12720	0.001000	0.08648	0.035000	0.12851	0.551000	0.23361	1.016000	0.39470	0.121000	0.15741	ACA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
TRIM22	10346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	5717510	5717510	+	Silent	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:5717510C>T	ENST00000379965.3	+	2	325	c.48C>T	c.(46-48)ccC>ccT	p.P16P	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	16					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TGACCTGCCCCATCTGCCTGG	0.502																																					p.P16P	GBM(104;491 2336 5222)	.											.	TRIM22-90	0			c.C48T						.						87.0	92.0	90.0					11																	5717510		2201	4297	6498	SO:0001819	synonymous_variant	10346	exon2			CTGCCCCATCTGC	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.48C>T	11.37:g.5717510C>T		66	0		72	40	NM_001199573	0	0	40	84	44	Q05CQ0|Q15521	Silent	SNP	ENST00000379965.3	37	CCDS41612.1																																																																																			.		0.502	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074	
GPR137	56834	broad.mit.edu	37	11	64056826	64056826	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:64056826C>T	ENST00000313074.3	+	7	1348	c.1243C>T	c.(1243-1245)Ccg>Tcg	p.P415S	GPR137_ENST00000411458.1_Missense_Mutation_p.P473S|KCNK4_ENST00000394525.2_5'Flank|GPR137_ENST00000438980.2_3'UTR|GPR137_ENST00000377702.4_3'UTR|GPR137_ENST00000539851.1_3'UTR|KCNK4_ENST00000538767.1_5'Flank|RP11-783K16.10_ENST00000539086.1_RNA|KCNK4_ENST00000422670.2_5'Flank	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	415						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						TGAGCTTGTGCCGTCCCCCTA	0.647																																					p.P473S													.	GPR137-68	0			c.C1417T						.						61.0	61.0	61.0					11																	64056826		2201	4297	6498	SO:0001583	missense	56834	exon9			CTTGTGCCGTCCC	AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.1243C>T	11.37:g.64056826C>T	ENSP00000321698:p.Pro415Ser	140	0		130	4	NM_001170726	0	0	37	37	0	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Missense_Mutation	SNP	ENST00000313074.3	37	CCDS8066.1	.	.	.	.	.	.	.	.	.	.	C	9.310	1.055330	0.19907	.	.	ENSG00000173264	ENST00000411458;ENST00000313074	T;T	0.51574	0.7;0.85	5.27	3.38	0.38709	.	1.323320	0.05536	N	0.564845	T	0.30293	0.0760	N	0.08118	0	0.58432	D	0.999993	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.06991	-1.0796	10	0.49607	T	0.09	-0.0272	7.3883	0.26895	0.0:0.7394:0.1696:0.091	.	473;415	B4DTG7;Q96N19	.;G137A_HUMAN	S	473;415	ENSP00000411827:P473S;ENSP00000321698:P415S	ENSP00000321698:P415S	P	+	1	0	GPR137	63813402	0.698000	0.27777	0.584000	0.28653	0.551000	0.35334	1.531000	0.36018	0.718000	0.32166	0.561000	0.74099	CCG	.		0.647	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1	NM_020155	
ARHGEF17	9828	ucsc.edu;bcgsc.ca	37	11	73073120	73073120	+	Silent	SNP	G	G	T	rs200742689		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:73073120G>T	ENST00000263674.3	+	13	4880	c.4530G>T	c.(4528-4530)ccG>ccT	p.P1510P		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1510					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						ACAGCTGCCCGGAGCCCTCGC	0.662																																					p.P1510P													.	ARHGEF17-227	0			c.G4530T						.						29.0	31.0	30.0					11																	73073120		2200	4292	6492	SO:0001819	synonymous_variant	9828	exon13			CTGCCCGGAGCCC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4530G>T	11.37:g.73073120G>T		47	0		36	5	NM_014786	0	0	17	17	0	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	CCDS8221.1																																																																																			G|0.999;A|0.000		0.662	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
OR2AT4	341152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74800733	74800733	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:74800733G>A	ENST00000305159.3	-	1	66	c.26C>T	c.(25-27)tCa>tTa	p.S9L		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						GCCATCCACTGATTCATTACA	0.473																																					p.S9L		.											.	OR2AT4-69	0			c.C26T						.						50.0	52.0	51.0					11																	74800733		2200	4292	6492	SO:0001583	missense	341152	exon1			TCCACTGATTCAT	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.26C>T	11.37:g.74800733G>A	ENSP00000304846:p.Ser9Leu	88	0		89	43	NM_001005285	0	0	0	0	0	B9EGZ8	Missense_Mutation	SNP	ENST00000305159.3	37	CCDS31639.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970843	0.53614	.	.	ENSG00000171561	ENST00000305159	T	0.54675	0.56	4.58	4.58	0.56647	.	0.000000	0.28241	U	0.016072	T	0.31702	0.0805	N	0.08118	0	0.36873	D	0.88902	P	0.49783	0.928	B	0.37601	0.254	T	0.51903	-0.8646	10	0.87932	D	0	.	15.2827	0.73801	0.0:0.0:1.0:0.0	.	9	A6NND4	O2AT4_HUMAN	L	9	ENSP00000304846:S9L	ENSP00000304846:S9L	S	-	2	0	OR2AT4	74478381	0.991000	0.36638	0.999000	0.59377	0.919000	0.55068	2.954000	0.49113	2.533000	0.85409	0.462000	0.41574	TCA	.		0.473	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383734.1	NM_001005285	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76867021	76867021	+	Silent	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:76867021C>T	ENST00000409709.3	+	5	626	c.354C>T	c.(352-354)caC>caT	p.H118H	MYO7A_ENST00000409619.2_Silent_p.H107H|MYO7A_ENST00000409893.1_Silent_p.H118H|MYO7A_ENST00000458637.2_Silent_p.H118H	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	118	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CGCCAGAGCACATCCGCCAGT	0.562																																					p.H118H		.											.	MYO7A-138	0			c.C354T						.						35.0	39.0	38.0					11																	76867021		2139	4251	6390	SO:0001819	synonymous_variant	4647	exon5			AGAGCACATCCGC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.354C>T	11.37:g.76867021C>T		28	0		13	9	NM_001127179	0	0	0	0	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.562	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
GAB2	9846	broad.mit.edu	37	11	77991912	77991912	+	Silent	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:77991912G>A	ENST00000361507.4	-	2	196	c.111C>T	c.(109-111)ggC>ggT	p.G37G	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_5'UTR	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	37	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CGCTCATCCGGCCACTCCGCA	0.463																																					p.G37G													.	GAB2-663	0			c.C111T						.						83.0	84.0	83.0					11																	77991912		2200	4292	6492	SO:0001819	synonymous_variant	9846	exon2			CATCCGGCCACTC	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.111C>T	11.37:g.77991912G>A		158	0		154	7	NM_080491	0	0	10	10	0	A2RRM2|A6NEW9|A7MD36|O60317	Silent	SNP	ENST00000361507.4	37	CCDS8259.1																																																																																			.		0.463	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
METTL25	84190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	82752495	82752495	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr12:82752495G>A	ENST00000248306.3	+	1	220	c.151G>A	c.(151-153)Gtc>Atc	p.V51I	METTL25_ENST00000547357.1_3'UTR|CCDC59_ENST00000548126.1_5'UTR|CCDC59_ENST00000256151.7_5'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	51							methyltransferase activity (GO:0008168)										GGAGGAGCTGGTCGACTTGCC	0.602											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V51I		.											.	.	0			c.G151A						.						94.0	79.0	84.0					12																	82752495		2203	4300	6503	SO:0001583	missense	84190	exon1			GAGCTGGTCGACT	BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.151G>A	12.37:g.82752495G>A	ENSP00000248306:p.Val51Ile	83	0	1216	103	39	NM_032230	0	0	9	14	5	Q9H5Y3	Missense_Mutation	SNP	ENST00000248306.3	37	CCDS9024.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434382	0.43224	.	.	ENSG00000127720	ENST00000248306;ENST00000548200	T	0.36340	1.26	5.49	1.42	0.22433	.	0.278728	0.40222	N	0.001147	T	0.25494	0.0620	L	0.44542	1.39	0.26395	N	0.976518	B	0.13145	0.007	B	0.15052	0.012	T	0.15378	-1.0439	10	0.29301	T	0.29	-2.0635	7.0129	0.24873	0.2126:0.1248:0.6626:0.0	.	51	Q8N6Q8	CL026_HUMAN	I	51	ENSP00000248306:V51I	ENSP00000248306:V51I	V	+	1	0	C12orf26	81276626	0.991000	0.36638	0.064000	0.19789	0.869000	0.49853	0.289000	0.18957	0.294000	0.22547	0.650000	0.86243	GTC	.		0.602	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408192.1	NM_032230	
SBNO1	55206	broad.mit.edu	37	12	123780522	123780522	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr12:123780522G>A	ENST00000602398.1	-	32	4242	c.4115C>T	c.(4114-4116)gCg>gTg	p.A1372V	SBNO1_ENST00000602750.1_Missense_Mutation_p.A1371V|SBNO1_ENST00000420886.2_Missense_Mutation_p.A1372V|SBNO1_ENST00000267176.4_Missense_Mutation_p.A1371V			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1372					regulation of transcription, DNA-templated (GO:0006355)			p.A1371V(2)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CTGTTGGACCGCAAGCTGTTG	0.433																																					p.A1372V													.	SBNO1-292	2	Substitution - Missense(2)	lung(1)|prostate(1)	c.C4115T						.						340.0	303.0	316.0					12																	123780522		2203	4300	6503	SO:0001583	missense	55206	exon31			TGGACCGCAAGCT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.4115C>T	12.37:g.123780522G>A	ENSP00000473665:p.Ala1372Val	319	0		302	6	NM_001167856	0	0	21	21	0	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622923	0.87460	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.32515	1.45;1.45	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.959;0.981	T	0.12785	-1.0534	10	0.33940	T	0.23	-19.465	20.5792	0.99380	0.0:0.0:1.0:0.0	.	1372;1371	A3KN83;A3KN83-2	SBNO1_HUMAN;.	V	1372;1371	ENSP00000387361:A1372V;ENSP00000267176:A1371V	ENSP00000267176:A1371V	A	-	2	0	SBNO1	122346475	1.000000	0.71417	0.790000	0.31976	0.976000	0.68499	9.431000	0.97494	2.873000	0.98535	0.561000	0.74099	GCG	.		0.433	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
PROSER1	80209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39587414	39587414	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr13:39587414C>A	ENST00000352251.3	-	11	2808	c.1975G>T	c.(1975-1977)Gca>Tca	p.A659S	PROSER1_ENST00000350125.3_Missense_Mutation_p.A637S|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	659	Ser-rich.																CCTGACAATGCAGGATTAAGG	0.478																																					p.A659S		.											.	.	0			c.G1975T						.						131.0	122.0	125.0					13																	39587414		2203	4300	6503	SO:0001583	missense	80209	exon11			ACAATGCAGGATT	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1975G>T	13.37:g.39587414C>A	ENSP00000332034:p.Ala659Ser	151	0		99	50	NM_025138	0	0	12	22	10	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248685	0.22880	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.47528	0.84;0.84	5.27	2.55	0.30701	.	.	.	.	.	T	0.32793	0.0841	L	0.29908	0.895	0.09310	N	1	P;P	0.45531	0.86;0.775	B;B	0.38264	0.269;0.197	T	0.05971	-1.0853	8	.	.	.	-13.5541	10.4949	0.44772	0.0:0.7738:0.0:0.2262	.	637;659	A6NJ97;Q86XN7	.;PRSR1_HUMAN	S	659;637	ENSP00000332034:A659S;ENSP00000339123:A637S	.	A	-	1	0	PROSER1	38485414	0.982000	0.34865	0.377000	0.26055	0.533000	0.34776	2.976000	0.49289	0.711000	0.32018	0.561000	0.74099	GCA	.		0.478	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
TPT1	7178	ucsc.edu;bcgsc.ca	37	13	45911726	45911726	+	Intron	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr13:45911726G>T	ENST00000530705.1	-	6	817				SNORA31_ENST00000517242.1_RNA|TPT1_ENST00000529421.1_Intron|SNORA31_ENST00000362607.1_RNA|TPT1_ENST00000379056.1_Intron|TPT1_ENST00000379060.4_Intron|TPT1_ENST00000379055.1_Intron|RP11-290D2.6_ENST00000610057.1_RNA			P13693	TCTP_HUMAN	tumor protein, translationally-controlled 1						calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ectoderm development (GO:2000384)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|regulation of apoptotic process (GO:0042981)|response to virus (GO:0009615)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|multivesicular body (GO:0005771)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			lung(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000232)		AATTGTTCAAGGTCTATCAGT	0.453																																					.													.	.	0			.						.						70.0	64.0	65.0					13																	45911726		876	1991	2867	SO:0001627	intron_variant	677814	.			GTTCAAGGTCTAT	X16064	CCDS9397.1, CCDS66538.1, CCDS73566.1	13q14	2010-08-18			ENSG00000133112	ENSG00000133112			12022	protein-coding gene	gene with protein product		600763				2813067, 10343127	Standard	NM_001286273		Approved	TCTP, fortilin	uc001uzy.1	P13693	OTTHUMG00000016845	ENST00000530705.1:c.517-203C>A	13.37:g.45911726G>T		75	0		61	20	.	0	0	0	1	1	B2R7E5|Q6YLS2|Q7Z4J4|Q8TBK7|Q96EE2|Q9UC70	RNA	SNP	ENST00000530705.1	37	CCDS9397.1																																																																																			.		0.453	TPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044758.3		
DACH1	1602	hgsc.bcm.edu	37	13	72440673	72440673	+	Missense_Mutation	SNP	C	C	T	rs200162861		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr13:72440673C>T	ENST00000359684.2	-	1	234	c.235G>A	c.(235-237)Ggc>Agc	p.G79S	DACH1_ENST00000313174.7_Missense_Mutation_p.G79S|DACH1_ENST00000354591.4_Missense_Mutation_p.G79S|DACH1_ENST00000305425.4_Missense_Mutation_p.G79S			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	79	Poly-Gly.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		ccgccgccgccgccgccgccg	0.801																																					p.G79S		.											.	DACH1-135	0			c.G235A						.						1.0	1.0	1.0					13																	72440673		224	1002	1226	SO:0001583	missense	1602	exon1			CGCCGCCGCCGCC	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.235G>A	13.37:g.72440673C>T	ENSP00000352712:p.Gly79Ser	3	1		3	2	NM_080759	1	0	3	4	0	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37		.	.	.	.	.	.	.	.	.	.	c	9.793	1.178369	0.21787	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;D	0.87029	1.13;1.28;1.4;-2.2	3.05	3.05	0.35203	.	.	.	.	.	T	0.71787	0.3381	N	0.12182	0.205	0.25137	N	0.990525	B;B;B	0.18863	0.031;0.006;0.003	B;B;B	0.06405	0.002;0.001;0.001	T	0.55798	-0.8084	9	0.09843	T	0.71	-0.641	8.5869	0.33664	0.2302:0.7698:0.0:0.0	.	79;79;79	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	S	79	ENSP00000304994:G79S;ENSP00000318506:G79S;ENSP00000346604:G79S;ENSP00000352712:G79S	ENSP00000304994:G79S	G	-	1	0	DACH1	71338674	0.981000	0.34729	0.996000	0.52242	0.392000	0.30506	2.007000	0.40883	1.534000	0.49203	0.306000	0.20318	GGC	.		0.801	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
MYCBP2	23077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	77799654	77799654	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr13:77799654T>C	ENST00000544440.2	-	19	2676	c.2659A>G	c.(2659-2661)Aaa>Gaa	p.K887E	MYCBP2_ENST00000407578.2_Missense_Mutation_p.K925E|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.K887E					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTTGTGATTTTGCTTGCATCC	0.413																																					p.K925E		.											.	MYCBP2-236	0			c.A2773G						.						215.0	181.0	192.0					13																	77799654		2203	4300	6503	SO:0001583	missense	23077	exon19			TGATTTTGCTTGC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2659A>G	13.37:g.77799654T>C	ENSP00000444596:p.Lys887Glu	152	0		146	65	NM_015057	0	0	6	13	7		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	T	21.8	4.197089	0.79015	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.28666	1.61;1.6;1.61	5.96	5.96	0.96718	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	L	0.34521	1.04	0.58432	D	0.999998	P	0.52842	0.956	D	0.65010	0.931	T	0.38156	-0.9674	10	0.66056	D	0.02	.	16.4381	0.83884	0.0:0.0:0.0:1.0	.	887	O75592	MYCB2_HUMAN	E	887;925;887	ENSP00000349892:K887E;ENSP00000384288:K925E;ENSP00000444596:K887E	ENSP00000349892:K887E	K	-	1	0	MYCBP2	76697655	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.679000	0.84048	2.280000	0.76307	0.533000	0.62120	AAA	.		0.413	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
COCH	1690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31355476	31355476	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr14:31355476T>C	ENST00000396618.3	+	11	1491	c.1435T>C	c.(1435-1437)Tat>Cat	p.Y479H	COCH_ENST00000460581.2_Missense_Mutation_p.Y367H|COCH_ENST00000216361.4_Missense_Mutation_p.Y479H|COCH_ENST00000475087.1_Missense_Mutation_p.Y479H|RP11-829H16.3_ENST00000556786.1_RNA|RP11-829H16.3_ENST00000468444.2_RNA|COCH_ENST00000382493.4_Missense_Mutation_p.Y330H|RP11-829H16.3_ENST00000555421.1_RNA|RP11-829H16.3_ENST00000555108.1_RNA	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	479	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TGGGCAGTCCTATGATGATGT	0.453																																					p.Y479H		.											.	COCH-228	0			c.T1435C						.						62.0	61.0	61.0					14																	31355476		2203	4300	6503	SO:0001583	missense	1690	exon11			CAGTCCTATGATG		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.1435T>C	14.37:g.31355476T>C	ENSP00000379862:p.Tyr479His	87	1		77	36	NM_004086	0	0	0	0	0	A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	37	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451692	0.84209	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000460581;ENST00000382493	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.89	5.89	0.94794	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.85392	0.5686	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.977	D	0.86401	0.1742	10	0.66056	D	0.02	-15.6938	16.3156	0.82923	0.0:0.0:0.0:1.0	.	330;479;479	E7EN67;Q96IU6;O43405	.;.;COCH_HUMAN	H	479;479;479;367;330	ENSP00000216361:Y479H;ENSP00000379862:Y479H;ENSP00000451528:Y479H;ENSP00000451713:Y367H;ENSP00000371933:Y330H	ENSP00000216361:Y479H	Y	+	1	0	COCH	30425227	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.884000	0.87274	2.245000	0.73994	0.455000	0.32223	TAT	.		0.453	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
FERMT2	10979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	53360052	53360052	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr14:53360052T>C	ENST00000395631.2	-	4	701	c.485A>G	c.(484-486)gAg>gGg	p.E162G	FERMT2_ENST00000341590.3_Missense_Mutation_p.E162G|FERMT2_ENST00000343279.4_Missense_Mutation_p.E162G|FERMT2_ENST00000399304.3_Missense_Mutation_p.E162G|FERMT2_ENST00000553373.1_Missense_Mutation_p.E162G			Q96AC1	FERM2_HUMAN	fermitin family member 2	162					cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TTCAAGTGCCTCATCTTCAGA	0.413																																					p.E162G		.											.	FERMT2-68	0			c.A485G						.						137.0	135.0	136.0					14																	53360052		2203	4300	6503	SO:0001583	missense	10979	exon4			AGTGCCTCATCTT	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.485A>G	14.37:g.53360052T>C	ENSP00000378993:p.Glu162Gly	192	0		177	72	NM_001135000	0	0	21	31	10	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	37	CCDS9713.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518696	0.44763	.	.	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373;ENST00000399304;ENST00000554288;ENST00000555692	T;T;T;T;T;T;T	0.48201	0.82;0.82;0.84;0.82;0.82;0.82;1.41	5.77	5.77	0.91146	FERM, N-terminal (1);Band 4.1 domain (1);	0.051253	0.85682	D	0.000000	T	0.36082	0.0954	N	0.14661	0.345	0.51482	D	0.999927	B;B;B	0.26602	0.043;0.154;0.01	B;B;B	0.34038	0.087;0.174;0.099	T	0.18618	-1.0331	10	0.24483	T	0.36	.	16.0828	0.81017	0.0:0.0:0.0:1.0	.	162;162;162	Q96AC1-2;Q96AC1;B5TJY2	.;FERM2_HUMAN;.	G	162;162;104;162;162;162;57;118	ENSP00000378993:E162G;ENSP00000340391:E162G;ENSP00000450741:E104G;ENSP00000342858:E162G;ENSP00000451084:E162G;ENSP00000382243:E162G;ENSP00000451268:E57G	ENSP00000340391:E162G	E	-	2	0	FERMT2	52429802	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.957000	0.70323	2.199000	0.70637	0.528000	0.53228	GAG	.		0.413	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
MRPL46	26589	broad.mit.edu	37	15	89008985	89008985	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr15:89008985A>G	ENST00000312475.4	-	2	289	c.248T>C	c.(247-249)cTg>cCg	p.L83P	MRPS11_ENST00000325844.4_5'Flank|MRPS11_ENST00000353598.6_5'Flank|MRPL46_ENST00000559538.1_5'Flank	NM_022163.3	NP_071446.2	Q9H2W6	RM46_HUMAN	mitochondrial ribosomal protein L46	83						mitochondrion (GO:0005739)|ribosome (GO:0005840)	hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GTCTGAATACAGGCTTCTCTC	0.388																																					p.L83P													.	MRPL46-90	0			c.T248C						.						83.0	88.0	86.0					15																	89008985		2201	4299	6500	SO:0001583	missense	26589	exon2			GAATACAGGCTTC	AF210056	CCDS10341.1	15q25.3	2012-10-08	2001-12-10	2001-12-14	ENSG00000259494	ENSG00000259494		"""Mitochondrial ribosomal proteins / large subunits"""	1192	protein-coding gene	gene with protein product		611851	"""chromosome 15 open reading frame 4"""	C15orf4		11761714, 11551941	Standard	NM_022163		Approved	LIECG2, P2ECSL	uc002bmj.2	Q9H2W6	OTTHUMG00000148683	ENST00000312475.4:c.248T>C	15.37:g.89008985A>G	ENSP00000312311:p.Leu83Pro	174	0		129	3	NM_022163	0	0	7	7	0	B2RD75|Q9HBU8	Missense_Mutation	SNP	ENST00000312475.4	37	CCDS10341.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961915	0.53400	.	.	ENSG00000173867	ENST00000312475	T	0.46451	0.87	5.08	2.58	0.30949	.	0.386469	0.25555	N	0.029867	T	0.56337	0.1978	M	0.83774	2.66	0.34905	D	0.746853	D	0.58620	0.983	P	0.57057	0.812	T	0.67814	-0.5573	10	0.51188	T	0.08	.	8.0952	0.30824	0.631:0.2483:0.0:0.1206	.	83	Q9H2W6	RM46_HUMAN	P	83	ENSP00000312311:L83P	ENSP00000312311:L83P	L	-	2	0	MRPL46	86809989	0.090000	0.21635	0.346000	0.25655	0.943000	0.58893	1.092000	0.30927	1.029000	0.39812	0.533000	0.62120	CTG	.		0.388	MRPL46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309073.1	NM_022163	
CRAMP1L	57585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1718163	1718163	+	Silent	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr16:1718163C>T	ENST00000397412.3	+	18	3402	c.3303C>T	c.(3301-3303)atC>atT	p.I1101I	LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000293925.5_Silent_p.I1101I|CRAMP1L_ENST00000436138.3_Silent_p.I1098I|CRAMP1L_ENST00000262317.4_Silent_p.I479I			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1101	Ser-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						GCGACTCCATCATTGAGATCG	0.607																																					p.I1101I		.											.	.	0			c.C3303T						.						64.0	65.0	65.0					16																	1718163		2165	4268	6433	SO:0001819	synonymous_variant	57585	exon17			CTCCATCATTGAG	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3303C>T	16.37:g.1718163C>T		102	0		129	36	NM_020825	0	0	7	11	4	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	ENST00000397412.3	37	CCDS10440.2																																																																																			.		0.607	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
MKL2	57496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14342808	14342808	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr16:14342808C>G	ENST00000341243.5	+	11	2240	c.2240C>G	c.(2239-2241)aCt>aGt	p.T747S	MKL2_ENST00000318282.5_Missense_Mutation_p.T708S|MKL2_ENST00000574045.1_Missense_Mutation_p.T708S|MKL2_ENST00000571589.1_Missense_Mutation_p.T758S			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	747	Gln-rich.				blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGAATGCAGACTCAGCCTCAG	0.448																																					p.T708S		.											.	MKL2-95	0			c.C2123G						.						127.0	105.0	112.0					16																	14342808		2197	4300	6497	SO:0001583	missense	57496	exon13			TGCAGACTCAGCC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.2240C>G	16.37:g.14342808C>G	ENSP00000345841:p.Thr747Ser	92	1		109	69	NM_014048	0	0	10	21	11	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		.	.	.	.	.	.	.	.	.	.	C	9.285	1.049055	0.19827	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.43	5.43	0.79202	.	0.708129	0.14605	N	0.309376	T	0.43478	0.1249	L	0.46157	1.445	0.22954	N	0.99852	B;B	0.22683	0.018;0.073	B;B	0.24394	0.025;0.053	T	0.32079	-0.9920	9	0.09084	T	0.74	-0.2632	18.5657	0.91115	0.0:1.0:0.0:0.0	.	758;708	B4DGT8;Q9ULH7-4	.;.	S	708;747	.	ENSP00000339086:T708S	T	+	2	0	MKL2	14250309	0.591000	0.26824	0.921000	0.36526	0.984000	0.73092	3.533000	0.53561	2.709000	0.92574	0.655000	0.94253	ACT	.		0.448	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
RPGRIP1L	23322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53636027	53636027	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr16:53636027C>A	ENST00000379925.3	-	27	3959	c.3909G>T	c.(3907-3909)caG>caT	p.Q1303H	RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.Q1269H|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.Q1223H	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	1303					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TGTAGACAGACTGGAGGGCAT	0.468																																					p.Q1303H		.											.	RPGRIP1L-91	0			c.G3909T						.						115.0	94.0	101.0					16																	53636027		2198	4300	6498	SO:0001583	missense	23322	exon27			GACAGACTGGAGG		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.3909G>T	16.37:g.53636027C>A	ENSP00000369257:p.Gln1303His	89	0		107	72	NM_015272	0	0	2	9	7	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	0.956	-0.704864	0.03255	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.63913	-0.07;-0.07	5.86	2.79	0.32731	.	0.807726	0.11522	N	0.555606	T	0.33527	0.0866	N	0.08118	0	0.80722	D	1	B;P;P	0.38250	0.13;0.49;0.624	B;B;B	0.31812	0.136;0.136;0.129	T	0.14671	-1.0464	10	0.46703	T	0.11	-0.5926	2.457	0.04532	0.1189:0.437:0.269:0.175	.	1257;1303;1223	B7ZKJ9;Q68CZ1;Q68CZ1-2	.;FTM_HUMAN;.	H	1303;1223	ENSP00000369257:Q1303H;ENSP00000262135:Q1223H	ENSP00000262135:Q1223H	Q	-	3	2	RPGRIP1L	52193528	0.184000	0.23200	0.813000	0.32504	0.392000	0.30506	0.388000	0.20735	0.840000	0.34995	-0.142000	0.14014	CAG	.		0.468	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
ELMO3	79767	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	67236330	67236330	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr16:67236330T>G	ENST00000360833.1	+	13	1457	c.1400T>G	c.(1399-1401)aTg>aGg	p.M467R	ELMO3_ENST00000393997.2_Missense_Mutation_p.M484R|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000477898.1_Missense_Mutation_p.M318R			Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	431	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|phagocytosis (GO:0006909)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				cervix(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		TTCTCACCCATGTTCTTCGGC	0.597																																					p.M484R		.											.	ELMO3-90	0			c.T1451G						.						84.0	86.0	85.0					16																	67236330		2198	4300	6498	SO:0001583	missense	79767	exon14			CACCCATGTTCTT		CCDS10833.2	16q22.1	2010-03-18	2006-01-20		ENSG00000102890	ENSG00000102890		"""Engulfment and cell motility proteins"""	17289	protein-coding gene	gene with protein product		606422	"""engulfment and cell motility 3 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_024712		Approved	FLJ13824, CED12, ELMO-3, CED-12	uc002esa.3	Q96BJ8	OTTHUMG00000133570	ENST00000360833.1:c.1400T>G	16.37:g.67236330T>G	ENSP00000354077:p.Met467Arg	203	0		239	22	NM_024712	0	0	117	125	8	B4DV86|Q9H8A5	Missense_Mutation	SNP	ENST00000360833.1	37		.	.	.	.	.	.	.	.	.	.	T	17.46	3.395742	0.62177	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.29397	1.57;1.57	5.66	5.66	0.87406	Engulfment/cell motility, ELMO (2);	0.165679	0.64402	D	0.000003	T	0.42131	0.1189	M	0.67397	2.05	0.80722	D	1	P;D;D	0.55172	0.822;0.97;0.97	P;P;P	0.48552	0.577;0.581;0.581	T	0.44174	-0.9345	10	0.87932	D	0	-28.916	14.7211	0.69308	0.0:0.0:0.0:1.0	.	431;467;484	Q96BJ8;F8W9E7;Q96BJ8-3	ELMO3_HUMAN;.;.	R	467;484	ENSP00000354077:M467R;ENSP00000377566:M484R	ENSP00000354077:M467R	M	+	2	0	ELMO3	65793831	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	8.040000	0.89188	2.160000	0.67779	0.533000	0.62120	ATG	.		0.597	ELMO3-001	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000257667.2	NM_024712	
CDK5RAP3	80279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	46051766	46051766	+	Splice_Site	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr17:46051766G>A	ENST00000338399.4	+	5	392	c.286G>A	c.(286-288)Gat>Aat	p.D96N	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Splice_Site_p.D121N	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	96					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						TCTTACTCAGGATTGGCAGGA	0.493																																					p.D96N		.											.	CDK5RAP3-226	0			c.G286A						.						171.0	171.0	171.0					17																	46051766		1981	4164	6145	SO:0001630	splice_region_variant	80279	exon5			ACTCAGGATTGGC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.286-1G>A	17.37:g.46051766G>A		143	0		144	15	NM_176096	0	0	2	3	1	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	ENST00000338399.4	37	CCDS42356.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898300	0.91962	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	T;T	0.54866	0.55;0.55	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	M	0.90977	3.165	0.80722	D	1	B	0.31241	0.315	B	0.35312	0.2	T	0.68511	-0.5389	9	.	.	.	-8.6694	18.4593	0.90732	0.0:0.0:1.0:0.0	.	96	Q96JB5	CK5P3_HUMAN	N	121;96	ENSP00000438886:D121N;ENSP00000344683:D96N	.	D	+	1	0	CDK5RAP3	43406765	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.231000	0.95317	2.670000	0.90874	0.655000	0.94253	GAT	.		0.493	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	Missense_Mutation
APPBP2	10513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58525181	58525181	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr17:58525181C>A	ENST00000083182.3	-	13	1806	c.1519G>T	c.(1519-1521)Ggt>Tgt	p.G507C		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	507					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TAGCCCTCACCAAAAAGTTTC	0.308																																					p.G507C		.											.	APPBP2-226	0			c.G1519T						.						55.0	57.0	56.0					17																	58525181		2203	4300	6503	SO:0001583	missense	10513	exon13			CCTCACCAAAAAG	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1519G>T	17.37:g.58525181C>A	ENSP00000083182:p.Gly507Cys	145	0		149	62	NM_006380	0	0	9	18	9	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611670	0.66558	.	.	ENSG00000062725	ENST00000083182	D	0.90385	-2.66	5.5	5.5	0.81552	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.95175	0.8436	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95322	0.8421	10	0.87932	D	0	-12.3778	19.4753	0.94985	0.0:1.0:0.0:0.0	.	507	Q92624	APBP2_HUMAN	C	507	ENSP00000083182:G507C	ENSP00000083182:G507C	G	-	1	0	APPBP2	55879963	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.453000	0.80700	2.611000	0.88343	0.650000	0.86243	GGT	.		0.308	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380	
TRAPPC8	22878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	29488737	29488737	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr18:29488737T>G	ENST00000283351.4	-	7	1437	c.1102A>C	c.(1102-1104)Att>Ctt	p.I368L	TRAPPC8_ENST00000582513.1_Missense_Mutation_p.I368L|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.I314L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	368					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AATTGCCTAATTGTTTTCTCT	0.284																																					p.I368L		.											.	TRAPPC8-159	0			c.A1102C						.						45.0	43.0	44.0					18																	29488737		2203	4297	6500	SO:0001583	missense	22878	exon7			GCCTAATTGTTTT	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1102A>C	18.37:g.29488737T>G	ENSP00000283351:p.Ile368Leu	84	0		73	31	NM_014939	0	0	10	19	9	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	T	13.35	2.211203	0.39102	.	.	ENSG00000153339	ENST00000283351	T	0.19806	2.12	5.7	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	L	0.39147	1.195	0.53005	D	0.99996	P;D	0.55605	0.655;0.972	P;P	0.56216	0.557;0.794	T	0.01228	-1.1412	10	0.23302	T	0.38	.	11.1138	0.48249	0.0:0.0717:0.0:0.9283	.	368;368	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	L	368	ENSP00000283351:I368L	ENSP00000283351:I368L	I	-	1	0	TRAPPC8	27742735	1.000000	0.71417	0.998000	0.56505	0.710000	0.40934	7.231000	0.78106	2.181000	0.69327	0.459000	0.35465	ATT	.		0.284	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
CNDP2	55748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	72179734	72179734	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr18:72179734C>A	ENST00000324262.4	+	7	1025	c.709C>A	c.(709-711)Cat>Aat	p.H237N	CNDP2_ENST00000579847.1_Missense_Mutation_p.H237N|CNDP2_ENST00000324301.8_Missense_Mutation_p.H153N	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	237					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GGGCTCGGTGCATGAGGCCAT	0.562																																					p.H237N		.											.	CNDP2-93	0			c.C709A						.						255.0	196.0	216.0					18																	72179734		2203	4300	6503	SO:0001583	missense	55748	exon7			TCGGTGCATGAGG	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.709C>A	18.37:g.72179734C>A	ENSP00000325548:p.His237Asn	131	0		108	39	NM_018235	1	0	351	658	306	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100562	0.37048	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.56776	0.44;0.44	5.14	3.33	0.38152	Peptidase M20, dimerisation (1);	0.047588	0.85682	D	0.000000	T	0.59582	0.2204	M	0.73962	2.25	0.80722	D	1	B;B;B	0.25743	0.133;0.021;0.002	B;B;B	0.40410	0.328;0.267;0.084	T	0.59757	-0.7394	10	0.38643	T	0.18	-19.4529	11.6458	0.51261	0.0:0.8542:0.0:0.1458	.	142;153;237	B4DPF1;Q96KP4-2;Q96KP4	.;.;CNDP2_HUMAN	N	237;153	ENSP00000325548:H237N;ENSP00000325756:H153N	ENSP00000325548:H237N	H	+	1	0	CNDP2	70330714	0.989000	0.36119	0.949000	0.38748	0.779000	0.44077	1.712000	0.37940	1.169000	0.42739	0.655000	0.94253	CAT	.		0.562	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
ZNF236	7776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74561610	74561610	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr18:74561610G>A	ENST00000253159.8	+	2	376	c.178G>A	c.(178-180)Gag>Aag	p.E60K	ZNF236_ENST00000320610.9_Missense_Mutation_p.E62K	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	60					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GAGGGATCACGAGCGAAATGA	0.358																																					p.E60K		.											.	ZNF236-94	0			c.G178A						.						65.0	62.0	63.0					18																	74561610		1875	4104	5979	SO:0001583	missense	7776	exon2			GATCACGAGCGAA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.178G>A	18.37:g.74561610G>A	ENSP00000253159:p.Glu60Lys	94	0		88	38	NM_007345	0	0	0	0	0	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244485	0.79912	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.16743	2.32;2.32	5.65	5.65	0.86999	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.28499	0.0705	N	0.20483	0.58	0.46725	D	0.999171	D;D	0.89917	1.0;0.998	D;P	0.91635	0.999;0.766	T	0.05305	-1.0893	10	0.20519	T	0.43	.	19.7319	0.96186	0.0:0.0:1.0:0.0	.	60;60	Q9NWI2;Q9UL36	.;ZN236_HUMAN	K	60	ENSP00000253159:E60K;ENSP00000444524:E60K	ENSP00000253159:E60K	E	+	1	0	ZNF236	72690598	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.692000	0.68256	2.668000	0.90789	0.655000	0.94253	GAG	.		0.358	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ABHD17A	81926	hgsc.bcm.edu	37	19	1881550	1881550	+	Silent	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:1881550G>A	ENST00000292577.7	-	2	449	c.16C>T	c.(16-18)Ctg>Ttg	p.L6L	ABHD17A_ENST00000250974.9_Silent_p.L6L|ABHD17A_ENST00000590661.1_Silent_p.L6L	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	6						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										AGCTCACTCAGCGACAGCCCA	0.761																																					p.L6L		.											.	FAM108A1-90	0			c.C16T						.																																			SO:0001819	synonymous_variant	81926	exon2			CACTCAGCGACAG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.16C>T	19.37:g.1881550G>A		25	2		38	4	NM_031213	0	0	12	12	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.761	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		213	4		223	1	NM_031203	0	0	1	1	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
MYO1F	4542	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8609279	8609279	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:8609279C>A	ENST00000338257.8	-	14	1693	c.1426G>T	c.(1426-1428)Gac>Tac	p.D476Y	AC092316.2_ENST00000581156.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	476	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						AGTGTCTGGTCTGCTCCCCCG	0.677																																					p.D476Y		.											.	MYO1F-93	0			c.G1426T						.						22.0	31.0	28.0					19																	8609279		2096	4212	6308	SO:0001583	missense	4542	exon14			TCTGGTCTGCTCC	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1426G>T	19.37:g.8609279C>A	ENSP00000344871:p.Asp476Tyr	55	0		49	24	NM_012335	0	0	5	5	0	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	c	20.5	4.009105	0.75046	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.92099	-2.97	3.49	3.49	0.39957	Myosin head, motor domain (2);	0.133964	0.47455	U	0.000236	D	0.97081	0.9046	H	0.96576	3.845	0.80722	D	1	D	0.58620	0.983	D	0.67725	0.953	D	0.98150	1.0441	10	0.87932	D	0	.	13.73	0.62781	0.0:1.0:0.0:0.0	.	476	O00160	MYO1F_HUMAN	Y	521;476	ENSP00000344871:D476Y	ENSP00000304899:D521Y	D	-	1	0	MYO1F	8515279	1.000000	0.71417	0.989000	0.46669	0.860000	0.49131	5.743000	0.68655	1.781000	0.52344	0.290000	0.19541	GAC	.		0.677	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
CACNA1A	773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	13397703	13397703	+	Missense_Mutation	SNP	C	C	T	rs200850308		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:13397703C>T	ENST00000360228.5	-	20	3166	c.3167G>A	c.(3166-3168)cGc>cAc	p.R1056H	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1057H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1057					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGTCTTGGCGGCCCAGGTC	0.642																																					p.R1057H		.											.	CACNA1A-67	0			c.G3170A						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,3700		0,0,1850	19.0	22.0	21.0		3179,3170,3167,3170,3179	5.2	1.0	19		21	1,8013		0,1,4006	yes	missense,missense,missense,missense,missense	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	29,29,29,29,29	0,1,5856	TT,TC,CC		0.0125,0.0,0.0085	benign,benign,benign,benign,benign	1060/2267,1057/2262,1056/2507,1057/2264,1060/2513	13397703	1,11713	1850	4007	5857	SO:0001583	missense	773	exon20			TCTTGGCGGCCCA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3167G>A	19.37:g.13397703C>T	ENSP00000353362:p.Arg1056His	69	0		54	8	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754278	0.49362	0.0	1.25E-4	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96168	-3.93	5.19	5.19	0.71726	.	0.663946	0.14837	N	0.295520	D	0.95108	0.8415	L	0.43152	1.355	0.42961	D	0.9944	B;B;D	0.65815	0.343;0.239;0.995	B;B;P	0.51016	0.021;0.034;0.656	D	0.94508	0.7716	10	0.44086	T	0.13	.	17.4837	0.87682	0.0:1.0:0.0:0.0	.	1057;1060;1056	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	H	1056;1060;1057;1057	ENSP00000353362:R1056H	ENSP00000317661:R1057H	R	-	2	0	CACNA1A	13258703	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.265000	0.51561	2.427000	0.82271	0.555000	0.69702	CGC	.		0.642	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
ZNF780B	163131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40541550	40541550	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:40541550G>T	ENST00000434248.1	-	5	1281	c.1216C>A	c.(1216-1218)Caa>Aaa	p.Q406K	ZNF780B_ENST00000221355.6_Missense_Mutation_p.Q258K	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTCTGGTGTTGAATAAGGTTT	0.358																																					p.Q406K		.											.	ZNF780B-47	0			c.C1216A						.						100.0	107.0	105.0					19																	40541550		2203	4300	6503	SO:0001583	missense	163131	exon5			GGTGTTGAATAAG	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1216C>A	19.37:g.40541550G>T	ENSP00000391641:p.Gln406Lys	190	0		176	79	NM_001005851	0	0	1	1	0	B9EH00	Missense_Mutation	SNP	ENST00000434248.1	37	CCDS46077.1	.	.	.	.	.	.	.	.	.	.	G	1.025	-0.683570	0.03353	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.35048	1.33;1.33	2.29	1.07	0.20283	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21307	0.0513	N	0.01081	-1.03	0.09310	N	1	D	0.57571	0.98	D	0.69824	0.966	T	0.17930	-1.0353	9	0.05833	T	0.94	.	8.391	0.32528	0.0:0.2421:0.7579:0.0	.	406	Q9Y6R6	Z780B_HUMAN	K	406;258	ENSP00000391641:Q406K;ENSP00000221355:Q258K	ENSP00000221355:Q258K	Q	-	1	0	ZNF780B	45233390	0.000000	0.05858	0.006000	0.13384	0.003000	0.03518	-5.529000	0.00115	1.103000	0.41568	0.313000	0.20887	CAA	.		0.358	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851	
RPL18	6141	ucsc.edu	37	19	49118705	49118705	+	Splice_Site	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:49118705C>T	ENST00000549920.1	-	7	884		c.e7-1		RPL18_ENST00000549273.1_3'UTR|FAM83E_ENST00000263266.3_5'Flank|RPL18_ENST00000552588.1_Splice_Site|FAM83E_ENST00000595110.1_5'Flank|RPL18_ENST00000550645.1_Splice_Site	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		GACGTAGGGTCTGTGGGGAGA	0.592																																					.													.	RPL18-90	0			c.405-1G>A						.						61.0	72.0	68.0					19																	49118705		2203	4299	6502	SO:0001630	splice_region_variant	6141	exon7			TAGGGTCTGTGGG	L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.492-1G>A	19.37:g.49118705C>T		205	0		200	1	NM_001270490	0	0	1	1	0	F8VWC5|Q8WTZ6	Splice_Site	SNP	ENST00000549920.1	37	CCDS12726.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714067	0.89112	.	.	ENSG00000063177	ENST00000549920;ENST00000084795;ENST00000550645;ENST00000552588;ENST00000546623;ENST00000550973	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7247	0.69336	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPL18	53810517	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.911000	0.75746	2.631000	0.89168	0.655000	0.94253	.	.		0.592	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405732.2	NM_000979	Intron
ZNF320	162967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53384942	53384942	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:53384942A>G	ENST00000595635.1	-	8	938	c.437T>C	c.(436-438)tTg>tCg	p.L146S	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.L146S|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TCGCAAATGCAAATGAAATCT	0.348																																					p.L146S		.											.	ZNF320-91	0			c.T437C						.						117.0	113.0	114.0					19																	53384942		2203	4300	6503	SO:0001583	missense	162967	exon4			AAATGCAAATGAA	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.437T>C	19.37:g.53384942A>G	ENSP00000473091:p.Leu146Ser	218	0		185	80	NM_207333	0	0	36	69	33	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	37	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.115473	0.00349	.	.	ENSG00000182986	ENST00000391781	T	0.12361	2.69	1.39	0.0569	0.14321	.	.	.	.	.	T	0.04998	0.0134	N	0.11427	0.14	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.43245	-0.9403	9	0.02654	T	1	.	5.4228	0.16409	0.2247:0.0:0.7753:0.0	.	146	A2RRD8	ZN320_HUMAN	S	146	ENSP00000375660:L146S	ENSP00000375660:L146S	L	-	2	0	ZNF320	58076754	0.000000	0.05858	0.001000	0.08648	0.155000	0.21991	-0.162000	0.10012	-0.124000	0.11724	0.163000	0.16589	TTG	.		0.348	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
ZSCAN22	342945	broad.mit.edu;bcgsc.ca	37	19	58849878	58849878	+	Missense_Mutation	SNP	G	G	A	rs558607664		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr19:58849878G>A	ENST00000329665.4	+	3	809	c.662G>A	c.(661-663)cGt>cAt	p.R221H		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	221					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CAGCGTGGCCGTGAATCTGGT	0.512																																					p.R221H													.	ZSCAN22-91	0			c.G662A						.						154.0	159.0	158.0					19																	58849878		2203	4300	6503	SO:0001583	missense	342945	exon3			GTGGCCGTGAATC	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.662G>A	19.37:g.58849878G>A	ENSP00000332433:p.Arg221His	273	1		275	8	NM_181846	0	0	3	3	0	Q15922|Q7Z3L8	Missense_Mutation	SNP	ENST00000329665.4	37	CCDS12975.1	.	.	.	.	.	.	.	.	.	.	G	6.106	0.387827	0.11581	.	.	ENSG00000182318	ENST00000329665	T	0.08458	3.09	3.72	-4.75	0.03239	.	.	.	.	.	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47573	-0.9107	9	0.15499	T	0.54	.	6.0075	0.19554	0.5667:0.2768:0.1565:0.0	.	221	P10073	ZSC22_HUMAN	H	221	ENSP00000332433:R221H	ENSP00000332433:R221H	R	+	2	0	ZSCAN22	63541690	0.000000	0.05858	0.001000	0.08648	0.170000	0.22686	-0.814000	0.04486	-0.604000	0.05760	0.313000	0.20887	CGT	.		0.512	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32667276	32667276	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:32667276A>C	ENST00000421745.2	+	18	4222	c.4088A>C	c.(4087-4089)cAt>cCt	p.H1363P		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1363					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTGGAGTTCATTCAAATGGA	0.383																																					p.H1363P	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.A4088C						.						62.0	61.0	61.0					2																	32667276		2203	4300	6503	SO:0001583	missense	57448	exon18			GAGTTCATTCAAA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4088A>C	2.37:g.32667276A>C	ENSP00000393596:p.His1363Pro	74	0		69	37	NM_016252	0	0	2	5	3	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	14.04	2.417748	0.42918	.	.	ENSG00000115760	ENST00000421745	T	0.74209	-0.82	5.4	5.4	0.78164	.	0.220885	0.39083	N	0.001466	T	0.66317	0.2777	L	0.29908	0.895	0.40728	D	0.982722	B	0.22604	0.072	B	0.25291	0.059	T	0.65697	-0.6105	10	0.59425	D	0.04	.	15.4322	0.75108	1.0:0.0:0.0:0.0	.	1363	Q9NR09	BIRC6_HUMAN	P	1363	ENSP00000393596:H1363P	ENSP00000393596:H1363P	H	+	2	0	BIRC6	32520780	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.513000	0.60476	2.039000	0.60335	0.519000	0.50382	CAT	.		0.383	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
HNRNPLL	92906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	38791355	38791355	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:38791355T>A	ENST00000449105.3	-	13	1937	c.1598A>T	c.(1597-1599)aAg>aTg	p.K533M	HNRNPLL_ENST00000378915.3_Missense_Mutation_p.K499M|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.K499M|HNRNPLL_ENST00000409636.1_Missense_Mutation_p.K528M|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.K533M			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	533					mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										AAAGCAAAGCTTCAATGTATA	0.289																																					p.K533M		.											.	HNRPLL-91	0			c.A1598T						.						86.0	94.0	91.0					2																	38791355		2203	4298	6501	SO:0001583	missense	92906	exon13			CAAAGCTTCAATG	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.1598A>T	2.37:g.38791355T>A	ENSP00000390625:p.Lys533Met	164	0		142	69	NM_138394	0	0	31	55	24	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	37		.	.	.	.	.	.	.	.	.	.	T	19.35	3.810102	0.70797	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328	.	.	.	5.83	5.83	0.93111	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.80592	0.4652	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.994;0.994;0.996	T	0.83330	-0.0013	9	0.87932	D	0	.	16.194	0.82011	0.0:0.0:0.0:1.0	.	528;533;533	C9J9G0;D6W592;Q8WVV9	.;.;HNRLL_HUMAN	M	533;528;499;499	.	ENSP00000368195:K499M	K	-	2	0	HNRPLL	38644859	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.360000	0.79487	2.225000	0.72522	0.460000	0.39030	AAG	.		0.289	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
SLC3A1	6519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44508525	44508525	+	Splice_Site	SNP	G	G	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:44508525G>C	ENST00000260649.6	+	3	686		c.e3-1		SLC3A1_ENST00000409741.1_Splice_Site|SLC3A1_ENST00000409387.1_Splice_Site|SLC3A1_ENST00000410056.3_Splice_Site|SLC3A1_ENST00000409229.3_Splice_Site	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TTACTCATTAGGTTTAAAATT	0.353																																					.		.											.	SLC3A1-90	0			c.611-1G>C						.						64.0	63.0	63.0					2																	44508525		2203	4300	6503	SO:0001630	splice_region_variant	6519	exon3			TCATTAGGTTTAA		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.611-1G>C	2.37:g.44508525G>C		90	0		74	32	NM_000341	0	0	1	3	2	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Splice_Site	SNP	ENST00000260649.6	37	CCDS1819.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112058	0.37242	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000410056;ENST00000409741;ENST00000409229;ENST00000541289	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.147	0.86768	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC3A1	44362029	1.000000	0.71417	0.999000	0.59377	0.336000	0.28762	9.024000	0.93689	2.323000	0.78572	0.551000	0.68910	.	.		0.353	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341	Intron
FSHR	2492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	49190328	49190328	+	Silent	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:49190328G>A	ENST00000406846.2	-	10	1751	c.1632C>T	c.(1630-1632)gtC>gtT	p.V544V	FSHR_ENST00000541117.1_Silent_p.V280V|FSHR_ENST00000346173.3_Silent_p.V482V|FSHR_ENST00000304421.4_Silent_p.V518V	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	544					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AGCCACAGATGACCACAAAGG	0.532									Gonadal Dysgenesis, 46 XX																												p.V544V		.											.	FSHR-527	0			c.C1632T						.						141.0	111.0	121.0					2																	49190328		2203	4300	6503	SO:0001819	synonymous_variant	2492	exon10	Familial Cancer Database		ACAGATGACCACA		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1632C>T	2.37:g.49190328G>A		46	0		38	18	NM_000145	0	0	0	0	0	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	ENST00000406846.2	37	CCDS1843.1																																																																																			.		0.532	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
MRPS5	64969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95753148	95753148	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:95753148C>G	ENST00000272418.2	-	12	1455	c.1247G>C	c.(1246-1248)gGa>gCa	p.G416A		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	416					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						GCGCTTCATTCCCTGTGCAGT	0.572																																					p.G416A		.											.	MRPS5-92	0			c.G1247C						.						103.0	96.0	99.0					2																	95753148		2203	4300	6503	SO:0001583	missense	64969	exon12			TTCATTCCCTGTG	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.1247G>C	2.37:g.95753148C>G	ENSP00000272418:p.Gly416Ala	100	0		84	41	NM_031902	0	0	38	74	36	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318910	0.60524	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.98	5.1	0.69264	.	0.052056	0.85682	D	0.000000	T	0.75781	0.3896	M	0.63843	1.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.78175	-0.2306	9	0.72032	D	0.01	-16.5572	13.0098	0.58725	0.0:0.9224:0.0:0.0776	.	416	P82675	RT05_HUMAN	A	416	.	ENSP00000272418:G416A	G	-	2	0	MRPS5	95116875	1.000000	0.71417	0.990000	0.47175	0.070000	0.16714	6.883000	0.75595	1.560000	0.49568	0.650000	0.86243	GGA	.		0.572	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902	
IL1RL2	8808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102836361	102836361	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:102836361A>C	ENST00000264257.2	+	8	1001	c.875A>C	c.(874-876)gAa>gCa	p.E292A	IL1RL2_ENST00000441515.2_Missense_Mutation_p.E174A|IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Missense_Mutation_p.E292A	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	292	Ig-like C2-type 3.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TCTTTTCGGGAACATAATTTG	0.358																																					p.E292A		.											.	IL1RL2-92	0			c.A875C						.						103.0	98.0	100.0					2																	102836361		2203	4300	6503	SO:0001583	missense	8808	exon8			TTCGGGAACATAA	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.875A>C	2.37:g.102836361A>C	ENSP00000264257:p.Glu292Ala	93	0		98	40	NM_003854	0	0	3	3	0	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	37	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	A	5.529	0.282573	0.10458	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	T;T;T	0.13901	2.55;2.55;2.55	5.09	2.7	0.31948	.	1.166780	0.05889	N	0.627921	T	0.11495	0.0280	L	0.36672	1.1	0.09310	N	1	B;B	0.25312	0.057;0.123	B;B	0.22753	0.028;0.041	T	0.41342	-0.9514	10	0.17369	T	0.5	.	6.8812	0.24174	0.8123:0.0:0.1877:0.0	.	174;292	A4FU63;Q9HB29	.;ILRL2_HUMAN	A	292;174;292	ENSP00000264257:E292A;ENSP00000413348:E174A;ENSP00000442184:E292A	ENSP00000264257:E292A	E	+	2	0	IL1RL2	102202793	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.965000	0.29319	0.357000	0.24183	-0.256000	0.11100	GAA	.		0.358	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
RND3	390	broad.mit.edu	37	2	151328205	151328205	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:151328205C>A	ENST00000375734.2	-	4	668	c.419G>T	c.(418-420)cGg>cTg	p.R140L	RND3_ENST00000409557.1_Missense_Mutation_p.R11L|RND3_ENST00000263895.4_Missense_Mutation_p.R140L|RND3_ENST00000472416.1_5'UTR	NM_001254738.1	NP_001241667.1	P61587	RND3_HUMAN	Rho family GTPase 3	140					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R140Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.106)		AACATCTGTCCGCAGATCAGA	0.403																																					p.R140L													.	RND3-659	1	Substitution - Missense(1)	lung(1)	c.G419T						.						102.0	96.0	98.0					2																	151328205		2203	4300	6503	SO:0001583	missense	390	exon4			TCTGTCCGCAGAT		CCDS2190.1	2q23.3	2008-02-05	2005-01-24	2005-01-27	ENSG00000115963	ENSG00000115963			671	protein-coding gene	gene with protein product		602924	"""ras homolog gene family, member E"""	ARHE		8649376	Standard	NM_001254738		Approved	RhoE, Rho8	uc002txe.3	P61587	OTTHUMG00000131859	ENST00000375734.2:c.419G>T	2.37:g.151328205C>A	ENSP00000364886:p.Arg140Leu	99	0		126	4	NM_001254738	0	0	46	47	1	D3DP95|P52199	Missense_Mutation	SNP	ENST00000375734.2	37	CCDS2190.1	.	.	.	.	.	.	.	.	.	.	C	36	5.654258	0.96724	.	.	ENSG00000115963	ENST00000375734;ENST00000263895;ENST00000409557	T;T;T	0.77620	-1.11;-1.11;-1.11	5.76	5.76	0.90799	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88797	0.6534	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	0.978;1.0;1.0	D;D;D	0.97110	0.969;1.0;1.0	D	0.89414	0.3705	10	0.87932	D	0	-17.2601	18.9641	0.92689	0.0:1.0:0.0:0.0	.	11;139;140	B4DSG7;D3DP96;P61587	.;.;RND3_HUMAN	L	140;140;11	ENSP00000364886:R140L;ENSP00000263895:R140L;ENSP00000386576:R11L	ENSP00000263895:R140L	R	-	2	0	RND3	151036451	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.796000	0.85898	2.713000	0.92767	0.655000	0.94253	CGG	.		0.403	RND3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254809.1	NM_005168	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179517427	179517427	+	Intron	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:179517427T>G	ENST00000591111.1	-	157	34747				TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K12999T|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGAGGGCACTTTCTTTTCAGG	0.378																																					p.K12999T		.											.	TTN-636	0			c.A38996C						.						216.0	222.0	220.0					2																	179517427		876	1991	2867	SO:0001627	intron_variant	7273	exon201			GGCACTTTCTTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34523-159A>C	2.37:g.179517427T>G		240	0		210	95	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37																																																																																				.		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FAM171B	165215	hgsc.bcm.edu	37	2	187559029	187559029	+	Silent	SNP	A	A	G	rs549897920|rs56669143	byFrequency	TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:187559029A>G	ENST00000304698.5	+	1	332	c.129A>G	c.(127-129)caA>caG	p.Q43Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	43	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCCTCATCcaacagcagcagc	0.642																																					p.Q43Q		.											.	FAM171B-141	0			c.A129G						.						18.0	20.0	19.0					2																	187559029		2201	4300	6501	SO:0001819	synonymous_variant	165215	exon1			CATCCAACAGCAG	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.129A>G	2.37:g.187559029A>G		34	1		22	4	NM_177454	0	0	0	0	0	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			.		0.642	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
WNT10A	80326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219754716	219754716	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:219754716G>C	ENST00000258411.3	+	3	1020	c.387G>C	c.(385-387)gaG>gaC	p.E129D	WNT10A_ENST00000483911.1_3'UTR	NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	129					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTTTCCGAGAGAGCGCTTTTG	0.582																																					p.E129D		.											.	WNT10A-523	0			c.G387C						.						96.0	86.0	90.0					2																	219754716		2203	4300	6503	SO:0001583	missense	80326	exon3			CCGAGAGAGCGCT	AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.387G>C	2.37:g.219754716G>C	ENSP00000258411:p.Glu129Asp	115	0		119	44	NM_025216	0	0	0	0	0	Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	ENST00000258411.3	37	CCDS2426.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993868	0.74703	.	.	ENSG00000135925	ENST00000258411	D	0.84944	-1.92	4.7	3.82	0.43975	.	0.000000	0.85682	D	0.000000	D	0.94627	0.8268	H	0.97564	4.03	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.95446	0.8530	10	0.72032	D	0.01	.	12.015	0.53309	0.085:0.0:0.915:0.0	.	129	Q9GZT5	WN10A_HUMAN	D	129	ENSP00000258411:E129D	ENSP00000258411:E129D	E	+	3	2	WNT10A	219462960	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.220000	0.42908	1.338000	0.45544	0.655000	0.94253	GAG	.		0.582	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256730.2	NM_025216	
KIZ-AS1	101929591	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	21142793	21142793	+	RNA	SNP	T	T	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr20:21142793T>A	ENST00000591761.1	-	0	5142				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							GAAAGGCATCTCTTCAGATTG	0.433																																					.													.	.	0			.						.						86.0	87.0	87.0					20																	21142793		1964	4155	6119			55857	.			GGCATCTCTTCAG																													20.37:g.21142793T>A		92	0		175	132	.	0	0	7	20	13		Silent	SNP	ENST00000591761.1	37																																																																																				.		0.433	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2		
LAMA5	3911	broad.mit.edu	37	20	60895706	60895706	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr20:60895706A>C	ENST00000252999.3	-	50	6734	c.6668T>G	c.(6667-6669)cTg>cGg	p.L2223R		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2223	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.L2223R(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCGGGGGCCCAGGGGGCTCCG	0.706																																					p.L2223R													.	LAMA5-93	1	Substitution - Missense(1)	kidney(1)	c.T6668G						.																																			SO:0001583	missense	3911	exon50			GGGCCCAGGGGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6668T>G	20.37:g.60895706A>C	ENSP00000252999:p.Leu2223Arg	27	4		39	8	NM_005560	0	0	65	74	9	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	1.825	-0.471240	0.04445	.	.	ENSG00000130702	ENST00000252999	T	0.10860	2.83	4.01	-3.35	0.04928	Laminin I (1);	1.233460	0.05846	U	0.620293	T	0.06781	0.0173	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.43278	-0.9401	10	0.13470	T	0.59	.	6.2822	0.21013	0.5127:0.1317:0.3557:0.0	.	2223	O15230	LAMA5_HUMAN	R	2223	ENSP00000252999:L2223R	ENSP00000252999:L2223R	L	-	2	0	LAMA5	60329101	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-2.320000	0.01119	-0.781000	0.04548	-0.402000	0.06365	CTG	.		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22656582	22656582	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr21:22656582G>T	ENST00000400546.1	+	3	448	c.199G>T	c.(199-201)Gta>Tta	p.V67L	NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000535285.1_Missense_Mutation_p.V92L|NCAM2_ENST00000284894.7_Intron	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	67	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AACACAGAGGGTAGTAGTGCA	0.398																																					p.V67L		.											.	NCAM2-94	0			c.G199T						.						132.0	122.0	125.0					21																	22656582		1859	4101	5960	SO:0001583	missense	4685	exon3			CAGAGGGTAGTAG		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.199G>T	21.37:g.22656582G>T	ENSP00000383392:p.Val67Leu	71	0		70	24	NM_004540	0	0	0	1	1	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109633	0.37242	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.67345	-0.26;-0.26	5.58	4.7	0.59300	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.104866	0.64402	D	0.000003	T	0.57562	0.2062	L	0.37630	1.12	0.29058	N	0.884114	P;D	0.56968	0.799;0.978	B;P	0.44447	0.251;0.45	T	0.54510	-0.8283	10	0.09338	T	0.73	-17.3832	16.3191	0.82939	0.0715:0.0:0.9285:0.0	.	92;67	B7Z841;O15394	.;NCAM2_HUMAN	L	67;92	ENSP00000383392:V67L;ENSP00000441887:V92L	ENSP00000383392:V67L	V	+	1	0	NCAM2	21578453	1.000000	0.71417	0.498000	0.27564	0.836000	0.47400	3.223000	0.51231	0.735000	0.32537	-1.094000	0.02160	GTA	.		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
TTC3	7267	broad.mit.edu	37	21	38536463	38536463	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr21:38536463G>A	ENST00000399017.2	+	32	6028	c.3281G>A	c.(3280-3282)cGc>cAc	p.R1094H	TTC3_ENST00000355666.1_Missense_Mutation_p.R1094H|TTC3_ENST00000354749.2_Missense_Mutation_p.R1094H|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1094					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TATGTTGTCCGCAATAAGAAG	0.393																																					p.R1094H	Ovarian(38;194 1649 35661)												.	TTC3-590	0			c.G3281A						.						84.0	77.0	79.0					21																	38536463		2203	4300	6503	SO:0001583	missense	7267	exon32			TTGTCCGCAATAA	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3281G>A	21.37:g.38536463G>A	ENSP00000381981:p.Arg1094His	94	0		96	4	NM_001001894	0	0	42	42	0	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.52|15.52	2.858057|2.858057	0.51376|0.51376	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000411496|ENST00000418766;ENST00000438055;ENST00000355666;ENST00000399017;ENST00000354749	.|T;T;T;T;T	.|0.12255	.|2.7;2.7;3.05;3.05;3.05	4.92|4.92	2.66|2.66	0.31614|0.31614	.|.	.|0.390747	.|0.20615	.|N	.|0.088890	T|T	0.26048|0.26048	0.0635|0.0635	L|L	0.57536|0.57536	1.79|1.79	0.22666|0.22666	N|N	0.998871|0.998871	.|D;D	.|0.89917	.|1.0;0.999	.|D;P	.|0.74023	.|0.982;0.869	T|T	0.02546|0.02546	-1.1143|-1.1143	5|10	.|0.52906	.|T	.|0.07	-5.9888|-5.9888	4.9199|4.9199	0.13865|0.13865	0.3454:0.0:0.6546:0.0|0.3454:0.0:0.6546:0.0	.|.	.|152;1094	.|Q5GIT6;P53804	.|.;TTC3_HUMAN	T|H	250|1094;1076;1094;1094;1094	.|ENSP00000403943:R1094H;ENSP00000391891:R1076H;ENSP00000347889:R1094H;ENSP00000381981:R1094H;ENSP00000346791:R1094H	.|ENSP00000346791:R1094H	A|R	+|+	1|2	0|0	TTC3|TTC3	37458333|37458333	0.000000|0.000000	0.05858|0.05858	0.882000|0.882000	0.34594|0.34594	0.975000|0.975000	0.68041|0.68041	0.380000|0.380000	0.20602|0.20602	1.204000|1.204000	0.43247|0.43247	0.591000|0.591000	0.81541|0.81541	GCA|CGC	.		0.393	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
BCL2L13	23786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18138590	18138590	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr22:18138590C>T	ENST00000317582.5	+	2	460	c.113C>T	c.(112-114)tCa>tTa	p.S38L	BCL2L13_ENST00000493680.1_Missense_Mutation_p.S38L|BCL2L13_ENST00000399782.1_Missense_Mutation_p.S38L|BCL2L13_ENST00000337612.5_5'UTR|BCL2L13_ENST00000355028.3_Missense_Mutation_p.S38L|BCL2L13_ENST00000418951.2_Missense_Mutation_p.S38L|BCL2L13_ENST00000543133.1_5'UTR|BCL2L13_ENST00000538149.1_Missense_Mutation_p.H26Y	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	38					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		CATCTTTCCTCACCCCAAGGT	0.358																																					p.S38L		.											.	BCL2L13-652	0			c.C113T						.						94.0	83.0	87.0					22																	18138590		2203	4300	6503	SO:0001583	missense	23786	exon2			TTTCCTCACCCCA	AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.113C>T	22.37:g.18138590C>T	ENSP00000318883:p.Ser38Leu	82	0		34	33	NM_001270732	0	0	0	0	0	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Missense_Mutation	SNP	ENST00000317582.5	37	CCDS13746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.60|12.60	1.986267|1.986267	0.35036|0.35036	.|.	.|.	ENSG00000099968|ENSG00000099968	ENST00000538149|ENST00000399782;ENST00000317582;ENST00000493680;ENST00000355028;ENST00000418951	T|T;T;T;T;T	0.40756|0.05513	1.02|3.43;3.43;3.43;3.43;3.43	5.68|5.68	2.49|2.49	0.30216|0.30216	.|.	.|0.492205	.|0.20751	.|N	.|0.086347	T|T	0.04952|0.04952	0.0133|0.0133	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	B|B;B;B	0.06786|0.11235	0.001|0.004;0.001;0.001	B|B;B;B	0.12156|0.13407	0.007|0.009;0.003;0.004	T|T	0.39418|0.39418	-0.9615|-0.9615	9|10	0.87932|0.38643	D|T	0|0.18	-0.0021|-0.0021	8.7678|8.7678	0.34713|0.34713	0.0:0.7614:0.0:0.2386|0.0:0.7614:0.0:0.2386	.|.	26|38;38;38	B7Z238|E9PDD6;Q9BXK5;Q9BXK5-2	.|.;B2L13_HUMAN;.	Y|L	26|38	ENSP00000441344:H26Y|ENSP00000382682:S38L;ENSP00000318883:S38L;ENSP00000434764:S38L;ENSP00000347133:S38L;ENSP00000410019:S38L	ENSP00000441344:H26Y|ENSP00000318883:S38L	H|S	+|+	1|2	0|0	BCL2L13|BCL2L13	16518590|16518590	0.012000|0.012000	0.17670|0.17670	0.956000|0.956000	0.39512|0.39512	0.989000|0.989000	0.77384|0.77384	0.630000|0.630000	0.24553|0.24553	0.343000|0.343000	0.23821|0.23821	0.591000|0.591000	0.81541|0.81541	CAC|TCA	.		0.358	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1	NM_015367	
PI4KA	5297	bcgsc.ca	37	22	21073055	21073055	+	Silent	SNP	G	G	A	rs530508978	byFrequency	TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr22:21073055G>A	ENST00000572273.1	-	44	5228	c.4998C>T	c.(4996-4998)tcC>tcT	p.S1666S	PI4KA_ENST00000414196.3_Silent_p.S476S|PI4KA_ENST00000255882.6_Silent_p.S1724S			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1666	Pleckstrin homology (PH) domain conferring phosphoinositide binding specificity. {ECO:0000250}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TCGCTGGGCCGGACAAGGAGC	0.517																																					p.S1724S	GBM(136;1332 1831 3115 23601 50806)												.	PI4KA-454	0			c.C5172T						.						86.0	80.0	82.0					22																	21073055		2203	4300	6503	SO:0001819	synonymous_variant	5297	exon44			TGGGCCGGACAAG	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.4998C>T	22.37:g.21073055G>A		71	0		50	4	NM_058004	8	0	22	30	0	Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37																																																																																				.		0.517	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
NR1D2	9975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	24003534	24003534	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:24003534T>G	ENST00000312521.4	+	5	903	c.584T>G	c.(583-585)aTg>aGg	p.M195R	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	195	Hinge.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						CAAAGTGCAATGAAGACCATG	0.413																																					p.M195R		.											.	NR1D2-227	0			c.T584G						.						72.0	63.0	66.0					3																	24003534		2203	4300	6503	SO:0001583	missense	9975	exon5			GTGCAATGAAGAC	BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.584T>G	3.37:g.24003534T>G	ENSP00000310006:p.Met195Arg	70	0		60	26	NM_005126	0	0	10	16	6	B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	ENST00000312521.4	37	CCDS33718.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347423	0.82022	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.92647	-3.08	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.95411	0.8510	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95294	0.8397	10	0.52906	T	0.07	.	16.4614	0.84056	0.0:0.0:0.0:1.0	.	195	Q14995	NR1D2_HUMAN	R	195	ENSP00000310006:M195R	ENSP00000310006:M195R	M	+	2	0	NR1D2	23978538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.635000	0.83286	2.285000	0.76669	0.533000	0.62120	ATG	.		0.413	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341017.3		
SCN11A	11280	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38889146	38889146	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:38889146C>T	ENST00000302328.3	-	26	4613	c.4415G>A	c.(4414-4416)cGa>cAa	p.R1472Q	SCN11A_ENST00000456224.3_Missense_Mutation_p.R1434Q|SCN11A_ENST00000450244.1_Missense_Mutation_p.R1472Q	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1472					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTCAGGATTCGGCCAATCCG	0.498																																					p.R1472Q													.	SCN11A-99	0			c.G4415A						.						44.0	49.0	48.0					3																	38889146		2203	4300	6503	SO:0001583	missense	11280	exon26			AGGATTCGGCCAA	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4415G>A	3.37:g.38889146C>T	ENSP00000307599:p.Arg1472Gln	47	0		37	4	NM_014139	0	0	0	0	0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	36	5.839006	0.97009	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.99607	-6.27;-6.27;-6.27	5.81	5.81	0.92471	Ion transport (1);	0.069151	0.64402	D	0.000010	D	0.99857	0.9933	H	0.99130	4.44	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.96576	0.9427	10	0.87932	D	0	.	20.0787	0.97763	0.0:1.0:0.0:0.0	.	1472	Q9UI33	SCNBA_HUMAN	Q	1472;1472;1434	ENSP00000307599:R1472Q;ENSP00000400945:R1472Q;ENSP00000416757:R1434Q	ENSP00000307599:R1472Q	R	-	2	0	SCN11A	38864150	1.000000	0.71417	0.962000	0.40283	0.998000	0.95712	7.789000	0.85783	2.750000	0.94351	0.637000	0.83480	CGA	.		0.498	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
TGM4	7047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	44935102	44935102	+	Missense_Mutation	SNP	G	G	A	rs147559877		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:44935102G>A	ENST00000296125.4	+	5	532	c.464G>A	c.(463-465)cGc>cAc	p.R155H		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	155					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GAGGACGAGCGCAAAGAGTAC	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15581	0.0		0.0	False		,,,				2504	0.0				p.R155H		.											.	TGM4-91	0			c.G464A						.	G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	129.0	115.0	120.0		464	-1.3	0.0	3	dbSNP_134	120	0,8600		0,0,4300	no	missense	TGM4	NM_003241.3	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	155/685	44935102	2,13004	2203	4300	6503	SO:0001583	missense	7047	exon5			ACGAGCGCAAAGA	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.464G>A	3.37:g.44935102G>A	ENSP00000296125:p.Arg155His	90	0		82	36	NM_003241	0	0	0	0	0	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455059	0.43634	4.54E-4	0.0	ENSG00000163810	ENST00000296125	D	0.92099	-2.97	2.32	-1.33	0.09172	.	0.000000	0.40818	U	0.001008	D	0.95056	0.8399	M	0.90870	3.155	0.09310	N	0.999991	D	0.89917	1.0	D	0.79784	0.993	D	0.88191	0.2877	10	0.66056	D	0.02	.	4.1154	0.10079	0.3177:0.0:0.5237:0.1586	.	155	P49221	TGM4_HUMAN	H	155	ENSP00000296125:R155H	ENSP00000296125:R155H	R	+	2	0	TGM4	44910106	0.694000	0.27738	0.000000	0.03702	0.008000	0.06430	1.522000	0.35921	-0.584000	0.05913	-0.518000	0.04402	CGC	G|1.000;A|0.000		0.507	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
LZTFL1	54585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45874547	45874547	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:45874547T>G	ENST00000296135.6	-	5	625	c.451A>C	c.(451-453)Aac>Cac	p.N151H	LZTFL1_ENST00000536047.1_Missense_Mutation_p.N134H|LZTFL1_ENST00000490463.1_5'UTR|LZTFL1_ENST00000539217.1_Missense_Mutation_p.N147H	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	151	Interaction with BSS9.				establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		ATTACCTTGTTTAGGAGTTCT	0.393																																					p.N151H		.											.	LZTFL1-90	0			c.A451C						.						100.0	99.0	99.0					3																	45874547		2203	4300	6503	SO:0001583	missense	54585	exon5			CCTTGTTTAGGAG	AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.451A>C	3.37:g.45874547T>G	ENSP00000296135:p.Asn151His	134	0		98	35	NM_020347	0	0	0	0	0	B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Missense_Mutation	SNP	ENST00000296135.6	37	CCDS2731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.78|16.78	3.217504|3.217504	0.58560|0.58560	.|.	.|.	ENSG00000163818|ENSG00000163818	ENST00000440576|ENST00000296135;ENST00000536047;ENST00000539217	.|T;T;T	.|0.24151	.|1.87;1.87;1.87	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.131960	.|0.64402	.|D	.|0.000002	T|T	0.28333|0.28333	0.0700|0.0700	L|L	0.58302|0.58302	1.8|1.8	0.54753|0.54753	D|D	0.999989|0.999989	.|B	.|0.12013	.|0.005	.|B	.|0.16289	.|0.015	T|T	0.03166|0.03166	-1.1065|-1.1065	5|10	.|0.38643	.|T	.|0.18	-17.4947|-17.4947	14.7592|14.7592	0.69593|0.69593	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|151	.|Q9NQ48	.|LZTL1_HUMAN	T|H	108|151;134;147	.|ENSP00000296135:N151H;ENSP00000439522:N134H;ENSP00000441784:N147H	.|ENSP00000296135:N151H	K|N	-|-	2|1	0|0	LZTFL1|LZTFL1	45849551|45849551	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	7.333000|7.333000	0.79214|0.79214	2.074000|2.074000	0.62210|0.62210	0.528000|0.528000	0.53228|0.53228	AAA|AAC	.		0.393	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257326.3	NM_020347	
USP4	7375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49362339	49362339	+	Silent	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:49362339T>C	ENST00000265560.4	-	5	667	c.621A>G	c.(619-621)ctA>ctG	p.L207L	USP4_ENST00000416417.1_Silent_p.L207L|USP4_ENST00000415188.1_Silent_p.L207L|USP4_ENST00000351842.4_Silent_p.L207L	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	207	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		GACCCTGGTATAGCCCAGCAT	0.547																																					p.L207L		.											.	USP4-660	0			c.A621G						.						154.0	156.0	155.0					3																	49362339		2203	4300	6503	SO:0001819	synonymous_variant	7375	exon5			CTGGTATAGCCCA	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.621A>G	3.37:g.49362339T>C		276	0		204	99	NM_199443	0	0	2	3	1	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Silent	SNP	ENST00000265560.4	37	CCDS2793.1																																																																																			.		0.547	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
CNTN3	5067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	74350871	74350871	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:74350871G>T	ENST00000263665.6	-	14	1899	c.1872C>A	c.(1870-1872)aaC>aaA	p.N624K		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	624	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGGGCTATGGTTGTCTTTAC	0.468																																					p.N624K		.											.	CNTN3-137	0			c.C1872A						.						309.0	273.0	285.0					3																	74350871		2203	4300	6503	SO:0001583	missense	5067	exon14			GCTATGGTTGTCT	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1872C>A	3.37:g.74350871G>T	ENSP00000263665:p.Asn624Lys	125	0		103	48	NM_020872	0	0	1	6	5	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579172	0.65878	.	.	ENSG00000113805	ENST00000263665	T	0.56611	0.45	5.98	2.16	0.27623	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.091203	0.85682	D	0.000000	T	0.71576	0.3356	M	0.89030	3	0.38345	D	0.944171	P	0.46020	0.871	P	0.61132	0.884	T	0.76044	-0.3103	10	0.87932	D	0	.	10.2822	0.43545	0.4578:0.0:0.5422:0.0	.	624	Q9P232	CNTN3_HUMAN	K	624	ENSP00000263665:N624K	ENSP00000263665:N624K	N	-	3	2	CNTN3	74433561	0.972000	0.33761	0.988000	0.46212	0.988000	0.76386	0.098000	0.15189	0.415000	0.25817	0.591000	0.81541	AAC	.		0.468	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
PIK3CB	5291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	138456588	138456588	+	Silent	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:138456588T>C	ENST00000477593.1	-	5	835	c.762A>G	c.(760-762)gtA>gtG	p.V254V	PIK3CB_ENST00000289153.2_Silent_p.V254V			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	254	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	AAACATATTCTACTCTCCCGC	0.318																																					p.V254V		.											.	PIK3CB-1311	0			c.A762G						.						96.0	88.0	91.0					3																	138456588		2203	4300	6503	SO:0001819	synonymous_variant	5291	exon4			ATATTCTACTCTC		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.762A>G	3.37:g.138456588T>C		118	0		108	56	NM_006219	0	0	10	21	11	D3DNF0|Q24JU2	Silent	SNP	ENST00000477593.1	37	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	T	0.792	-0.758451	0.03019	.	.	ENSG00000051382	ENST00000462294	.	.	.	5.82	-3.54	0.04653	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.8436	11.0692	0.47993	0.1175:0.6147:0.0:0.2678	.	.	.	.	W	122	.	.	X	-	2	0	PIK3CB	139939278	0.887000	0.30362	0.907000	0.35723	0.002000	0.02628	-0.157000	0.10085	-0.658000	0.05366	-1.216000	0.01612	TAG	.		0.318	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
RNF168	165918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	196214405	196214405	+	Silent	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:196214405G>T	ENST00000318037.3	-	3	1017	c.423C>A	c.(421-423)gcC>gcA	p.A141A		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	141	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		ATTCTTCACTGGCTTTGTTTT	0.443																																					p.A141A		.											.	RNF168-90	0			c.C423A						.						223.0	208.0	213.0					3																	196214405		2203	4300	6503	SO:0001819	synonymous_variant	165918	exon3			TTCACTGGCTTTG	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.423C>A	3.37:g.196214405G>T		231	0		215	105	NM_152617	0	0	8	16	8	Q8NA67|Q96NS4	Silent	SNP	ENST00000318037.3	37	CCDS3317.1																																																																																			.		0.443	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
DRD5	1816	hgsc.bcm.edu	37	4	9784112	9784112	+	Silent	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr4:9784112T>C	ENST00000304374.2	+	1	855	c.459T>C	c.(457-459)acT>acC	p.T153T		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	153					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GCAAGATGACTCAGCGCATGG	0.602																																					p.T153T		.											.	DRD5-91	0			c.T459C						.						38.0	37.0	37.0					4																	9784112		2203	4300	6503	SO:0001819	synonymous_variant	1816	exon1			GATGACTCAGCGC	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.459T>C	4.37:g.9784112T>C		54	0		38	2	NM_000798	0	0	0	0	0	B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	CCDS3405.1																																																																																			.		0.602	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
TLR6	10333	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	38830116	38830116	+	Missense_Mutation	SNP	C	C	A	rs3796508	byFrequency	TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr4:38830116C>A	ENST00000381950.1	-	1	1044	c.979G>T	c.(979-981)Gtg>Ttg	p.V327L	TLR6_ENST00000436693.2_Missense_Mutation_p.V327L			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	327			V -> M (in dbSNP:rs3796508). {ECO:0000269|PubMed:21618349, ECO:0000269|Ref.3}.		activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCAGAAAACACGGTGTACAAA	0.343																																					p.V327L		.											.	TLR6-524	0			c.G979T						.						68.0	72.0	71.0					4																	38830116		2203	4300	6503	SO:0001583	missense	10333	exon2			AAAACACGGTGTA		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.979G>T	4.37:g.38830116C>A	ENSP00000371376:p.Val327Leu	80	0		72	33	NM_006068	0	0	0	0	0	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	37	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.699200	0.00725	.	.	ENSG00000174130	ENST00000436693;ENST00000381950;ENST00000508542	T;T	0.07216	3.21;3.21	5.08	0.624	0.17659	.	0.875863	0.09937	N	0.736454	T	0.03959	0.0111	N	0.22421	0.69	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.46400	-0.9194	10	0.07482	T	0.82	.	0.9789	0.01432	0.1458:0.2038:0.2868:0.3636	.	327	Q9Y2C9	TLR6_HUMAN	L	327	ENSP00000389600:V327L;ENSP00000371376:V327L	ENSP00000371376:V327L	V	-	1	0	TLR6	38506511	0.000000	0.05858	0.152000	0.22495	0.301000	0.27625	-0.736000	0.04882	0.168000	0.19655	0.491000	0.48974	GTG	C|0.981;T|0.019		0.343	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
YTHDC1	91746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	69203291	69203291	+	Splice_Site	SNP	T	T	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr4:69203291T>G	ENST00000344157.4	-	3	793	c.458A>C	c.(457-459)gAg>gCg	p.E153A	YTHDC1_ENST00000579690.1_Splice_Site_p.E153A|YTHDC1_ENST00000355665.3_Splice_Site_p.E153A	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	153					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						ATTTACTACCTCAGAACCATC	0.403																																					p.E153A		.											.	YTHDC1-92	0			c.A458C						.						48.0	47.0	47.0					4																	69203291		2200	4300	6500	SO:0001630	splice_region_variant	91746	exon3			ACTACCTCAGAAC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.459+1A>C	4.37:g.69203291T>G		78	0		75	38	NM_001031732	0	0	1	7	6	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.287484	0.40494	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.30448	1.68;1.53	5.29	5.29	0.74685	.	0.369189	0.29396	N	0.012273	T	0.24084	0.0583	L	0.27053	0.805	0.52099	D	0.999947	B;B	0.32573	0.376;0.0	B;B	0.34722	0.188;0.001	T	0.06826	-1.0805	10	0.49607	T	0.09	.	11.8336	0.52309	0.0:0.0:0.1463:0.8537	.	153;153	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	A	153	ENSP00000339245:E153A;ENSP00000347888:E153A	ENSP00000339245:E153A	E	-	2	0	YTHDC1	68885886	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.195000	0.58400	1.981000	0.57761	0.477000	0.44152	GAG	.		0.403	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	Missense_Mutation
ENAM	10117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71510231	71510231	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr4:71510231C>T	ENST00000396073.3	+	9	3369	c.3088C>T	c.(3088-3090)Cca>Tca	p.P1030S	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1030					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			AGGCTCCAATCCAGAAGGCAT	0.433																																					p.P1030S		.											.	ENAM-93	0			c.C3088T						.						119.0	104.0	109.0					4																	71510231		2203	4300	6503	SO:0001583	missense	10117	exon9			TCCAATCCAGAAG	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3088C>T	4.37:g.71510231C>T	ENSP00000379383:p.Pro1030Ser	127	0		129	59	NM_031889	0	0	1	4	3	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416036	0.25552	.	.	ENSG00000132464	ENST00000396073	T	0.37411	1.2	5.97	5.11	0.69529	.	0.116712	0.39407	N	0.001380	T	0.49660	0.1570	M	0.81802	2.56	0.30657	N	0.754852	P	0.50272	0.933	P	0.49477	0.612	T	0.60596	-0.7232	10	0.62326	D	0.03	-10.6665	12.7104	0.57086	0.1631:0.8369:0.0:0.0	.	1030	Q9NRM1	ENAM_HUMAN	S	1030	ENSP00000379383:P1030S	ENSP00000379383:P1030S	P	+	1	0	ENAM	71729095	0.747000	0.28283	0.848000	0.33437	0.024000	0.10985	1.284000	0.33249	2.836000	0.97738	0.655000	0.94253	CCA	.		0.433	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
ANXA3	306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79512751	79512751	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr4:79512751C>T	ENST00000264908.6	+	7	836	c.457C>T	c.(457-459)Cgg>Tgg	p.R153W	ANXA3_ENST00000512884.1_Missense_Mutation_p.R114W|ANXA3_ENST00000503570.2_Missense_Mutation_p.R114W	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	153					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TGGTGACTTCCGGAAAGCTCT	0.343																																					p.R153W	GBM(2;126 157 27790 28920 42492)	.											.	ANXA3-90	0			c.C457T						.						135.0	139.0	138.0					4																	79512751		2203	4300	6503	SO:0001583	missense	306	exon7			GACTTCCGGAAAG	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.457C>T	4.37:g.79512751C>T	ENSP00000264908:p.Arg153Trp	271	0		287	114	NM_005139	0	0	132	223	91	B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	37	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142653	0.77888	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000514171	T;T;T;T	0.03831	3.79;3.79;3.79;3.79	5.21	4.3	0.51218	Annexin repeat, conserved site (1);	0.348448	0.28901	N	0.013775	T	0.23410	0.0566	M	0.90759	3.145	0.46260	D	0.998954	D	0.89917	1.0	D	0.69142	0.962	T	0.00593	-1.1654	10	0.87932	D	0	.	10.6705	0.45755	0.3225:0.6775:0.0:0.0	.	153	P12429	ANXA3_HUMAN	W	153;114;114;153	ENSP00000264908:R153W;ENSP00000423068:R114W;ENSP00000421015:R114W;ENSP00000421512:R153W	ENSP00000264908:R153W	R	+	1	2	ANXA3	79731775	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.345000	0.33953	2.708000	0.92522	0.585000	0.79938	CGG	.		0.343	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139	
MTRR	4552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	7873543	7873543	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:7873543G>A	ENST00000264668.2	+	3	298	c.268G>A	c.(268-270)Gga>Aga	p.G90R	MTRR_ENST00000502509.1_Intron|MTRR_ENST00000440940.2_Missense_Mutation_p.G63R|MTRR_ENST00000341013.6_Intron	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	90	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CACGGGCACCGGAGACCCACC	0.478																																					p.G90R		.											.	MTRR-91	0			c.G268A						.						158.0	161.0	160.0					5																	7873543		2203	4300	6503	SO:0001583	missense	4552	exon3			GGCACCGGAGACC	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.268G>A	5.37:g.7873543G>A	ENSP00000264668:p.Gly90Arg	217	1		305	81	NM_024010	0	0	11	15	4	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701195	0.88924	.	.	ENSG00000124275	ENST00000264668;ENST00000440940;ENST00000502550;ENST00000512217	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.67	4.8	0.61643	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98911	1.0780	10	0.87932	D	0	-22.8766	14.7195	0.69294	0.0693:0.0:0.9307:0.0	.	90	Q9UBK8	MTRR_HUMAN	R	90;63;63;63	ENSP00000264668:G90R;ENSP00000402510:G63R;ENSP00000424599:G63R;ENSP00000421318:G63R	ENSP00000264668:G90R	G	+	1	0	MTRR	7926543	1.000000	0.71417	0.874000	0.34290	0.973000	0.67179	7.942000	0.87708	1.405000	0.46838	0.655000	0.94253	GGA	.		0.478	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
TRIO	7204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	14471560	14471560	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:14471560C>T	ENST00000344204.4	+	38	5921	c.5897C>T	c.(5896-5898)tCt>tTt	p.S1966F	TRIO_ENST00000537187.1_Missense_Mutation_p.S1966F	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1966					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AAATCCAGCTCTTTAAAGAGA	0.438																																					p.S1966F		.											.	TRIO-562	0			c.C5897T						.						73.0	70.0	71.0					5																	14471560		2203	4300	6503	SO:0001583	missense	7204	exon38			CCAGCTCTTTAAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5897C>T	5.37:g.14471560C>T	ENSP00000339299:p.Ser1966Phe	106	0		124	89	NM_007118	0	0	7	13	6	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936293	0.52972	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000541447	T;T	0.68479	-0.33;-0.33	5.39	5.39	0.77823	Dbl homology (DH) domain (2);	0.056462	0.64402	D	0.000001	T	0.48150	0.1484	N	0.03608	-0.345	0.47737	D	0.999501	B;B	0.14805	0.011;0.0	B;B	0.15052	0.012;0.001	T	0.45293	-0.9271	10	0.52906	T	0.07	.	19.2167	0.93781	0.0:1.0:0.0:0.0	.	1966;1966	O75962-5;O75962	.;TRIO_HUMAN	F	1966;1966;1653;46	ENSP00000339299:S1966F;ENSP00000446348:S1966F	ENSP00000339299:S1966F	S	+	2	0	TRIO	14524560	1.000000	0.71417	0.951000	0.38953	0.965000	0.64279	5.667000	0.68067	2.537000	0.85549	0.650000	0.86243	TCT	.		0.438	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
RICTOR	253260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38954924	38954924	+	Nonsense_Mutation	SNP	A	A	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:38954924A>C	ENST00000357387.3	-	27	2679	c.2649T>G	c.(2647-2649)taT>taG	p.Y883*	RICTOR_ENST00000503698.1_5'UTR|RICTOR_ENST00000296782.5_Nonsense_Mutation_p.Y883*	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CTAGTTGTCCATAAAGGTGTA	0.313																																					p.Y883X		.											.	RICTOR-849	0			c.T2649G						.						121.0	118.0	119.0					5																	38954924		2203	4300	6503	SO:0001587	stop_gained	253260	exon27			TTGTCCATAAAGG		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2649T>G	5.37:g.38954924A>C	ENSP00000349959:p.Tyr883*	132	0		255	148	NM_152756	0	0	4	5	1		Nonsense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	A	38	7.042770	0.98021	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	.	.	.	5.79	3.38	0.38709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3188	9.8756	0.41202	0.8005:0.0:0.1995:0.0	.	.	.	.	X	883	.	ENSP00000296782:Y883X	Y	-	3	2	RICTOR	38990681	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.863000	0.48396	0.449000	0.26747	0.477000	0.44152	TAT	.		0.313	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	67588178	67588178	+	Silent	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:67588178A>G	ENST00000521381.1	+	8	1624	c.1008A>G	c.(1006-1008)ggA>ggG	p.G336G	PIK3R1_ENST00000396611.1_Silent_p.G336G|PIK3R1_ENST00000336483.5_Silent_p.G66G|PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000274335.5_Silent_p.G336G|PIK3R1_ENST00000521657.1_Silent_p.G336G|PIK3R1_ENST00000320694.8_Silent_p.G36G	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	336	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GGTACTGGGGAGATATCTCGA	0.393			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.G336G		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.A1008G						.						153.0	143.0	146.0					5																	67588178		2203	4300	6503	SO:0001819	synonymous_variant	5295	exon8			CTGGGGAGATATC	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1008A>G	5.37:g.67588178A>G		177	0		225	74	NM_181523	0	0	0	0	0	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.393	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	67591286	67591286	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:67591286A>T	ENST00000521381.1	+	14	2400	c.1784A>T	c.(1783-1785)aAc>aTc	p.N595I	PIK3R1_ENST00000396611.1_Missense_Mutation_p.N595I|PIK3R1_ENST00000336483.5_Missense_Mutation_p.N325I|PIK3R1_ENST00000523872.1_Missense_Mutation_p.N232I|PIK3R1_ENST00000274335.5_Missense_Mutation_p.N595I|PIK3R1_ENST00000521657.1_Missense_Mutation_p.N595I|PIK3R1_ENST00000320694.8_Missense_Mutation_p.N295I	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	595					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.M582_D605>I(4)|p.Y580fs*1(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AAGAAGTTGAACGAGTGGTTG	0.368			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.N595I		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	7	Complex - deletion inframe(4)|Whole gene deletion(1)|Deletion - Frameshift(1)|Unknown(1)	large_intestine(4)|lung(1)|ovary(1)|central_nervous_system(1)	c.A1784T						.						152.0	156.0	155.0					5																	67591286		2203	4300	6503	SO:0001583	missense	5295	exon14			AGTTGAACGAGTG	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1784A>T	5.37:g.67591286A>T	ENSP00000428056:p.Asn595Ile	87	0		126	39	NM_181523	0	0	111	168	57	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.587453	0.86851	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000523872	T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49	4.84	4.84	0.62591	.	0.042090	0.85682	D	0.000000	T	0.57257	0.2041	M	0.82923	2.615	0.80722	D	1	D;P;P;D	0.67145	0.991;0.811;0.901;0.996	P;P;P;D	0.67725	0.892;0.844;0.844;0.953	T	0.65084	-0.6254	10	0.87932	D	0	-28.7516	14.6086	0.68498	1.0:0.0:0.0:0.0	.	265;325;295;595	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	I	595;595;595;595;295;325;232	ENSP00000428056:N595I;ENSP00000429277:N595I;ENSP00000379855:N595I;ENSP00000274335:N595I;ENSP00000323512:N295I;ENSP00000338554:N325I;ENSP00000430098:N232I	ENSP00000274335:N595I	N	+	2	0	PIK3R1	67627042	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	9.087000	0.94110	2.036000	0.60181	0.377000	0.23210	AAC	.		0.368	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
KIAA0825	285600	bcgsc.ca	37	5	93856363	93856363	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:93856363T>C	ENST00000329378.7	-	5	809	c.560A>G	c.(559-561)cAa>cGa	p.Q187R	KIAA0825_ENST00000513200.3_Missense_Mutation_p.Q187R|KIAA0825_ENST00000312498.7_Missense_Mutation_p.Q187R|KIAA0825_ENST00000427991.2_Missense_Mutation_p.Q187R	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	187										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TAAAATTTTTTGCTGTGAATT	0.318																																					p.Q187R													.	KIAA0825-91	0			c.A560G						.						105.0	109.0	108.0					5																	93856363		2203	4300	6503	SO:0001583	missense	285600	exon5			ATTTTTTGCTGTG	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.560A>G	5.37:g.93856363T>C	ENSP00000331385:p.Gln187Arg	105	0		161	26	NM_173665	0	0	1	1	0	O94914|Q6ZNN2	Missense_Mutation	SNP	ENST00000329378.7	37	CCDS4070.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084971	0.36758	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498;ENST00000329378	T;T;D;D	0.85773	0.86;0.86;-2.03;-2.03	5.51	5.51	0.81932	.	1.945680	0.01632	N	0.023587	D	0.85199	0.5642	L	0.54323	1.7	0.30939	N	0.726027	P;P	0.42692	0.675;0.787	B;B	0.39258	0.295;0.295	T	0.74293	-0.3712	10	0.59425	D	0.04	.	11.5917	0.50949	0.0:0.0:0.1489:0.8511	.	187;187	Q8IV33;Q8IV33-2	K0825_HUMAN;.	R	187	ENSP00000424618:Q187R;ENSP00000400288:Q187R;ENSP00000312205:Q187R;ENSP00000331385:Q187R	ENSP00000312205:Q187R	Q	-	2	0	KIAA0825	93882119	0.998000	0.40836	1.000000	0.80357	0.921000	0.55340	2.676000	0.46883	2.091000	0.63221	0.477000	0.44152	CAA	.		0.318	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371180.2	NM_173665	
ACSL6	23305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131324510	131324510	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:131324510T>A	ENST00000379240.1	-	6	718	c.565A>T	c.(565-567)Atc>Ttc	p.I189F	ACSL6_ENST00000357096.1_Missense_Mutation_p.I154F|ACSL6_ENST00000296869.4_Missense_Mutation_p.I214F|ACSL6_ENST00000543479.1_Missense_Mutation_p.I189F|ACSL6_ENST00000379272.2_Missense_Mutation_p.I189F|ACSL6_ENST00000379244.1_Missense_Mutation_p.I189F|ACSL6_ENST00000431707.1_Missense_Mutation_p.I154F|ACSL6_ENST00000379255.1_Missense_Mutation_p.I154F|ACSL6_ENST00000544770.1_Missense_Mutation_p.I98F|ACSL6_ENST00000379249.3_Missense_Mutation_p.I189F|ACSL6_ENST00000379264.2_Missense_Mutation_p.I214F|ACSL6_ENST00000379246.1_Missense_Mutation_p.I200F			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	189					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTATTGATGATGTAGCGGATA	0.572																																					p.I214F		.											.	ACSL6-229	0			c.A640T						.						114.0	112.0	113.0					5																	131324510		2203	4300	6503	SO:0001583	missense	23305	exon6			TGATGATGTAGCG	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.565A>T	5.37:g.131324510T>A	ENSP00000368542:p.Ile189Phe	220	0		304	104	NM_001009185	0	0	0	0	0	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37		.	.	.	.	.	.	.	.	.	.	T	20.8	4.053835	0.75960	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479;ENST00000434099;ENST00000430403	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.79	5.79	0.91817	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.81399	0.4814	H	0.98446	4.235	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.993;0.995;0.999;0.996;0.988;0.995;0.995	D	0.88843	0.3314	10	0.87932	D	0	.	16.1224	0.81369	0.0:0.0:0.0:1.0	.	189;189;179;189;154;214;214	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	F	189;214;189;154;154;214;200;189;98;189;154;189;154;189	ENSP00000368551:I189F;ENSP00000368566:I214F;ENSP00000368574:I189F;ENSP00000349608:I154F;ENSP00000368557:I154F;ENSP00000296869:I214F;ENSP00000368548:I200F;ENSP00000368546:I189F;ENSP00000445154:I98F;ENSP00000368542:I189F;ENSP00000413329:I154F;ENSP00000442124:I189F;ENSP00000397507:I154F;ENSP00000398423:I189F	ENSP00000296869:I214F	I	-	1	0	ACSL6	131352409	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	7.953000	0.87836	2.208000	0.71279	0.533000	0.62120	ATC	.		0.572	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
BTNL8	79908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	180374575	180374575	+	Missense_Mutation	SNP	G	G	A	rs371555886		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:180374575G>A	ENST00000340184.4	+	4	943	c.737G>A	c.(736-738)gGc>gAc	p.G246D	BTNL8_ENST00000400707.3_Missense_Mutation_p.G121D|BTNL8_ENST00000511704.1_Missense_Mutation_p.G130D|BTNL8_ENST00000505126.1_Missense_Mutation_p.G39D|BTNL8_ENST00000231229.4_Missense_Mutation_p.G246D|BTNL8_ENST00000508408.1_Missense_Mutation_p.G246D|BTNL8_ENST00000533815.2_Missense_Mutation_p.G62D	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	246					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCTGCTGTGGCCTATTTTTT	0.443																																					p.G246D		.											.	BTNL8-24	0			c.G737A						.	G	ASP/GLY,ASP/GLY,ASP/GLY,ASP/GLY,ASP/GLY,ASP/GLY	0,4406		0,0,2203	231.0	240.0	237.0		737,389,737,362,185,737	-2.9	0.0	5		237	1,8591	1.2+/-3.3	0,1,4295	yes	missense,missense,missense,missense,missense,missense	BTNL8	NM_001040462.2,NM_001159707.1,NM_001159708.1,NM_001159709.1,NM_001159710.1,NM_024850.2	94,94,94,94,94,94	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	246/501,130/385,246/341,121/376,62/317,246/348	180374575	1,12997	2203	4296	6499	SO:0001583	missense	79908	exon4			GCTGTGGCCTATT	AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.737G>A	5.37:g.180374575G>A	ENSP00000342197:p.Gly246Asp	570	0		755	485	NM_001159708	0	0	0	0	0	A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Missense_Mutation	SNP	ENST00000340184.4	37	CCDS43413.1	.	.	.	.	.	.	.	.	.	.	G	6.384	0.438919	0.12104	0.0	1.16E-4	ENSG00000113303	ENST00000231229;ENST00000340184;ENST00000400707;ENST00000508408;ENST00000511704;ENST00000505126;ENST00000533815	T;T;T;T;T;T;T	0.61274	4.8;1.28;0.63;4.8;0.62;0.12;0.19	1.52	-2.87	0.05700	.	.	.	.	.	T	0.52224	0.1721	L	0.34521	1.04	0.09310	N	1	D;D;P;P;P	0.64830	0.982;0.994;0.808;0.808;0.838	P;P;B;B;B	0.59221	0.769;0.854;0.159;0.159;0.367	T	0.44034	-0.9354	9	0.35671	T	0.21	.	3.793	0.08728	0.0:0.2104:0.2868:0.5028	.	121;130;246;246;246	E9PG07;E9PEF6;F2Z2B2;A6NEX6;Q6UX41	.;.;.;.;BTNL8_HUMAN	D	246;246;121;246;130;39;62	ENSP00000231229:G246D;ENSP00000342197:G246D;ENSP00000383543:G121D;ENSP00000424585:G246D;ENSP00000425207:G130D;ENSP00000427441:G39D;ENSP00000435098:G62D	ENSP00000231229:G246D	G	+	2	0	BTNL8	180307181	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.641000	0.05434	-0.893000	0.03930	0.436000	0.28706	GGC	.		0.443	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1	NM_024850	
MTCH1	23787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	36949411	36949411	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr6:36949411T>A	ENST00000373627.5	-	2	483	c.359A>T	c.(358-360)aAt>aTt	p.N120I	MTCH1_ENST00000538808.1_Intron|MTCH1_ENST00000373616.5_Missense_Mutation_p.N120I	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	120					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCCCAGCACATTGGTCCCAAG	0.562																																					p.N120I		.											.	MTCH1-227	0			c.A359T						.						59.0	52.0	54.0					6																	36949411		2203	4300	6503	SO:0001583	missense	23787	exon2			AGCACATTGGTCC	AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.359A>T	6.37:g.36949411T>A	ENSP00000362730:p.Asn120Ile	71	0		21	21	NM_014341	0	0	3	232	229	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Missense_Mutation	SNP	ENST00000373627.5	37		.	.	.	.	.	.	.	.	.	.	T	19.24	3.788911	0.70337	.	.	ENSG00000137409	ENST00000373616;ENST00000373627;ENST00000337855;ENST00000373550;ENST00000460219	T;T;T	0.48201	0.82;0.82;0.82	4.87	2.42	0.29668	Mitochondrial carrier domain (2);	0.078934	0.49305	D	0.000154	T	0.43787	0.1263	L	0.49126	1.545	0.80722	D	1	D;D;D	0.69078	0.997;0.991;0.99	D;P;P	0.63597	0.916;0.843;0.891	T	0.45527	-0.9255	10	0.72032	D	0.01	-3.3591	7.5839	0.27980	0.0:0.1805:0.0:0.8195	.	102;120;120	Q8IW90;Q9NZJ7;Q9NZJ7-2	.;MTCH1_HUMAN;.	I	120;120;56;56;104	ENSP00000362718:N120I;ENSP00000362730:N120I;ENSP00000419739:N104I	ENSP00000338712:N56I	N	-	2	0	MTCH1	37057389	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	4.282000	0.58971	0.713000	0.32060	0.402000	0.26972	AAT	.		0.562	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040396.1	NM_014341	
C7orf43	55262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99753405	99753405	+	Silent	SNP	G	G	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr7:99753405G>A	ENST00000316937.3	-	9	1469	c.1284C>T	c.(1282-1284)gcC>gcT	p.A428A	C7orf43_ENST00000419841.1_Silent_p.A196A|C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000457641.1_Silent_p.A159A|C7orf43_ENST00000394035.2_Silent_p.A4A|MIR4658_ENST00000584344.1_RNA	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	428										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGGAGTCCAGGGCAGCCTGCA	0.637																																					p.A428A		.											.	C7orf43-90	0			c.C1284T						.						53.0	50.0	51.0					7																	99753405		2203	4300	6503	SO:0001819	synonymous_variant	55262	exon9			GTCCAGGGCAGCC		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1284C>T	7.37:g.99753405G>A		102	1		101	50	NM_018275	0	0	10	19	9	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Silent	SNP	ENST00000316937.3	37	CCDS5687.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981597	0.34942	.	.	ENSG00000146826	ENST00000456769	.	.	.	5.66	0.404	0.16355	.	.	.	.	.	T	0.50343	0.1610	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35025	-0.9805	4	.	.	.	-21.6416	4.7431	0.13024	0.2529:0.2971:0.4501:0.0	.	.	.	.	S	334	.	.	P	-	1	0	C7orf43	99591341	0.997000	0.39634	0.998000	0.56505	0.961000	0.63080	0.253000	0.18296	0.054000	0.16065	-0.258000	0.10820	CCT	.		0.637	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
LRRN3	54674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	110763780	110763780	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr7:110763780A>G	ENST00000422987.3	+	2	1783	c.952A>G	c.(952-954)Aac>Gac	p.N318D	IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.N318D|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.N318D|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	318					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AGAAGCTACTAACAACCCTAG	0.418																																					p.N318D		.											.	LRRN3-154	0			c.A952G						.						85.0	88.0	87.0					7																	110763780		2203	4300	6503	SO:0001583	missense	54674	exon2			GCTACTAACAACC	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.952A>G	7.37:g.110763780A>G	ENSP00000412417:p.Asn318Asp	106	0		107	59	NM_018334	0	0	0	0	0	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814302	0.70912	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.59083	0.29;0.29;0.29	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000002	T	0.63663	0.2530	N	0.20845	0.615	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.64351	-0.6428	10	0.37606	T	0.19	.	16.4311	0.83844	1.0:0.0:0.0:0.0	.	318	Q9H3W5	LRRN3_HUMAN	D	318	ENSP00000312001:N318D;ENSP00000397312:N318D;ENSP00000412417:N318D	ENSP00000312001:N318D	N	+	1	0	LRRN3	110551016	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	9.339000	0.96797	2.277000	0.76020	0.528000	0.53228	AAC	.		0.418	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
TNPO3	23534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128626935	128626935	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr7:128626935T>A	ENST00000265388.5	-	12	1681	c.1538A>T	c.(1537-1539)aAg>aTg	p.K513M	TNPO3_ENST00000482320.1_Missense_Mutation_p.K447M|TNPO3_ENST00000393245.1_Missense_Mutation_p.K547M|TNPO3_ENST00000471234.1_Intron|TNPO3_ENST00000471166.1_Missense_Mutation_p.K547M			Q9Y5L0	TNPO3_HUMAN	transportin 3	513					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						AGCCAGGGGCTTTTCACACAG	0.453																																					p.K513M	Pancreas(147;583 2585 39696 52331)	.											.	TNPO3-228	0			c.A1538T						.						79.0	81.0	80.0					7																	128626935		2203	4300	6503	SO:0001583	missense	23534	exon12			AGGGGCTTTTCAC	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.1538A>T	7.37:g.128626935T>A	ENSP00000265388:p.Lys513Met	123	0		128	77	NM_012470	0	0	18	35	17	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	ENST00000265388.5	37	CCDS5809.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118999	0.77323	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471166	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);	0.154879	0.56097	D	0.000021	T	0.67924	0.2945	L	0.36672	1.1	0.48571	D	0.999679	D;P	0.63046	0.992;0.895	P;P	0.55999	0.789;0.497	T	0.70920	-0.4741	10	0.66056	D	0.02	-17.8899	10.4289	0.44395	0.0:0.0:0.1635:0.8365	.	547;513	C9J7E5;Q9Y5L0	.;TNPO3_HUMAN	M	547;513;447;547	ENSP00000376936:K547M;ENSP00000265388:K513M;ENSP00000420089:K447M;ENSP00000418267:K547M	ENSP00000265388:K513M	K	-	2	0	TNPO3	128414171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.677000	0.61634	2.279000	0.76181	0.533000	0.62120	AAG	.		0.453	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470	
C8orf76	84933	broad.mit.edu	37	8	124243792	124243792	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr8:124243792G>T	ENST00000276704.4	-	4	614	c.563C>A	c.(562-564)tCt>tAt	p.S188Y	C8orf76_ENST00000521310.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Missense_Mutation_p.S156Y	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	188										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CTGTTTCTGAGATGACGCAAG	0.438																																					p.S188Y													.	C8orf76-228	0			c.C563A						.						145.0	153.0	150.0					8																	124243792		2203	4300	6503	SO:0001583	missense	84933	exon4			TTCTGAGATGACG	AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.563C>A	8.37:g.124243792G>T	ENSP00000276704:p.Ser188Tyr	217	0		196	6	NM_032847	0	0	25	29	4	Q53HC1	Missense_Mutation	SNP	ENST00000276704.4	37	CCDS6341.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758786	0.69763	.	.	ENSG00000189376	ENST00000276704;ENST00000357082	.	.	.	5.48	4.6	0.57074	.	0.599351	0.18054	N	0.153184	T	0.58991	0.2161	M	0.68952	2.095	0.28752	N	0.901361	P;D	0.58620	0.911;0.983	P;P	0.54759	0.76;0.653	T	0.58340	-0.7653	9	0.62326	D	0.03	-1.0579	12.0576	0.53544	0.0805:0.0:0.9195:0.0	.	156;188	Q96EF9;Q96K31	.;CH076_HUMAN	Y	188;156	.	ENSP00000276704:S188Y	S	-	2	0	C8orf76	124312973	1.000000	0.71417	0.753000	0.31225	0.940000	0.58332	2.322000	0.43814	1.325000	0.45301	0.655000	0.94253	TCT	.		0.438	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847	
PLEC	5339	broad.mit.edu	37	8	144995793	144995793	+	Silent	SNP	C	C	T	rs372807129		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr8:144995793C>T	ENST00000322810.4	-	32	8776	c.8607G>A	c.(8605-8607)gcG>gcA	p.A2869A	PLEC_ENST00000527096.1_Silent_p.A2755A|PLEC_ENST00000436759.2_Silent_p.A2759A|PLEC_ENST00000354958.2_Silent_p.A2710A|PLEC_ENST00000356346.3_Silent_p.A2718A|PLEC_ENST00000354589.3_Silent_p.A2732A|PLEC_ENST00000398774.2_Silent_p.A2700A|PLEC_ENST00000345136.3_Silent_p.A2732A|PLEC_ENST00000357649.2_Silent_p.A2736A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2869	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGGCCGCCTGCGCCTCCAGCA	0.667																																					p.A2869A													.	PLEC-141	0			c.G8607A						.						26.0	32.0	30.0					8																	144995793		2070	4177	6247	SO:0001819	synonymous_variant	5339	exon32			CGCCTGCGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8607G>A	8.37:g.144995793C>T		54	0		55	3	NM_201380	0	0	72	72	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.667	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
GBA2	57704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35739010	35739010	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:35739010A>G	ENST00000378103.3	-	11	2307	c.1784T>C	c.(1783-1785)aTt>aCt	p.I595T	GBA2_ENST00000378094.4_Missense_Mutation_p.I595T|GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000545786.1_Missense_Mutation_p.I601T|GBA2_ENST00000467252.1_5'UTR	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	595					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGGTCCCCAATATCATGGGG	0.572																																					p.I595T		.											.	GBA2-94	0			c.T1784C						.						78.0	76.0	77.0					9																	35739010		2203	4300	6503	SO:0001583	missense	57704	exon11			TCCCCAATATCAT	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1784T>C	9.37:g.35739010A>G	ENSP00000367343:p.Ile595Thr	52	0		33	18	NM_020944	0	0	0	1	1	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.156258	0.57259	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.69	5.69	0.88448	Six-hairpin glycosidase-like (1);Glucosylceramidase (1);	0.259629	0.44285	D	0.000468	T	0.64571	0.2610	L	0.58101	1.795	0.80722	D	1	B;P;P	0.35493	0.449;0.493;0.505	B;B;B	0.41374	0.241;0.079;0.355	T	0.67518	-0.5650	9	0.62326	D	0.03	-8.062	14.5115	0.67791	1.0:0.0:0.0:0.0	.	601;595;595	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	T	595;595;601	.	ENSP00000367334:I595T	I	-	2	0	GBA2	35729010	1.000000	0.71417	0.973000	0.42090	0.994000	0.84299	8.924000	0.92827	2.171000	0.68590	0.459000	0.35465	ATT	.		0.572	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
ZNF169	169841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	97063238	97063238	+	Silent	SNP	C	C	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:97063238C>T	ENST00000395395.2	+	5	1488	c.1398C>T	c.(1396-1398)ggC>ggT	p.G466G	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GTGGGCGTGGCTTTGGTCAGA	0.577																																					p.G466G		.											.	ZNF169-92	0			c.C1398T						.						73.0	66.0	68.0					9																	97063238		2203	4300	6503	SO:0001819	synonymous_variant	169841	exon5			GCGTGGCTTTGGT	U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1398C>T	9.37:g.97063238C>T		87	0		79	38	NM_194320	0	0	5	8	3	A2AGP5|A8K127|Q6PI28	Silent	SNP	ENST00000395395.2	37	CCDS6709.2																																																																																			.		0.577	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	
C9orf84	158401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	114503767	114503767	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:114503767A>T	ENST00000318737.4	-	9	1099	c.971T>A	c.(970-972)tTt>tAt	p.F324Y	C9orf84_ENST00000394777.4_Missense_Mutation_p.F285Y|C9orf84_ENST00000374283.5_Missense_Mutation_p.F388Y|C9orf84_ENST00000374287.3_Missense_Mutation_p.F324Y|C9orf84_ENST00000394779.3_Missense_Mutation_p.F285Y	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	324										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGTAAGCAAAAATGGGTTCAA	0.323																																					p.F324Y		.											.	C9orf84-92	0			c.T971A						.						66.0	65.0	65.0					9																	114503767		2202	4299	6501	SO:0001583	missense	158401	exon9			AGCAAAAATGGGT	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.971T>A	9.37:g.114503767A>T	ENSP00000322108:p.Phe324Tyr	75	0		103	53	NM_173521	0	0	0	0	0	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	A	12.21	1.869763	0.33069	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000374287;ENST00000318737;ENST00000374283	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.56	3.41	0.39046	.	1.021630	0.07826	N	0.960679	T	0.46483	0.1395	L	0.32530	0.975	0.09310	N	1	P;P;P;P	0.45827	0.718;0.844;0.867;0.867	P;P;B;P	0.49829	0.447;0.528;0.439;0.623	T	0.32745	-0.9895	10	0.62326	D	0.03	-0.5524	6.8232	0.23868	0.8939:0.0:0.1061:0.0	.	285;388;324;285	A6PVK7;Q5VXU9-2;Q5VXU9;A2A2V3	.;.;CI084_HUMAN;.	Y	285;285;324;324;388	ENSP00000378259:F285Y;ENSP00000378257:F285Y;ENSP00000363405:F324Y;ENSP00000322108:F324Y;ENSP00000363401:F388Y	ENSP00000322108:F324Y	F	-	2	0	C9orf84	113543588	0.140000	0.22579	0.106000	0.21319	0.691000	0.40173	0.554000	0.23407	0.876000	0.35872	0.455000	0.32223	TTT	.		0.323	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
GSN	2934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	124074615	124074615	+	Splice_Site	SNP	A	A	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:124074615A>T	ENST00000373818.4	+	5	735		c.e5-1		GSN_ENST00000373823.3_Splice_Site|GSN_ENST00000436847.1_Splice_Site|GSN_ENST00000341272.2_Splice_Site|GSN_ENST00000545652.1_Splice_Site|GSN_ENST00000412819.1_Splice_Site|GSN_ENST00000449733.1_Splice_Site|GSN_ENST00000394353.2_Splice_Site|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373808.2_Splice_Site|GSN_ENST00000373807.1_5'UTR	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TCTGTCTTCCAGAACATCCAC	0.612																																					.		.											.	GSN-154	0			c.514-2A>T						.						97.0	100.0	99.0					9																	124074615		2203	4300	6503	SO:0001630	splice_region_variant	2934	exon6			TCTTCCAGAACAT	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.667-1A>T	9.37:g.124074615A>T		159	1		157	9	NM_198252	0	0	0	0	0	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Splice_Site	SNP	ENST00000373818.4	37	CCDS6828.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.988296	0.74589	.	.	ENSG00000148180	ENST00000373823;ENST00000432226;ENST00000449773;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0966	0.72238	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GSN	123114436	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	9.281000	0.95811	2.178000	0.69098	0.533000	0.62120	.	.		0.612	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1	NM_000177	Intron
TUBB4B	10383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	140137389	140137389	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:140137389T>C	ENST00000340384.4	+	4	867	c.719T>C	c.(718-720)cTg>cCg	p.L240P		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	240					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	ACCACCTGCCTGCGCTTCCCA	0.592																																					p.L240P		.											.	.	0			c.T719C						.						30.0	31.0	31.0					9																	140137389		2200	4290	6490	SO:0001583	missense	10383	exon4			CCTGCCTGCGCTT	BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.719T>C	9.37:g.140137389T>C	ENSP00000341289:p.Leu240Pro	42	0		52	24	NM_006088	0	0	173	314	141	A2BFA2|P05217	Missense_Mutation	SNP	ENST00000340384.4	37	CCDS7039.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029097	0.54790	.	.	ENSG00000188229	ENST00000340384	T	0.71934	-0.61	5.57	5.57	0.84162	.	0.000000	0.53938	D	0.000043	D	0.91955	0.7452	H	0.99919	4.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95434	0.8519	10	0.87932	D	0	.	14.5794	0.68274	0.0:0.0:0.0:1.0	.	240	P68371	TBB4B_HUMAN	P	240	ENSP00000341289:L240P	ENSP00000341289:L240P	L	+	2	0	TUBB2C	139257210	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.111000	0.71541	2.122000	0.65172	0.533000	0.62120	CTG	.		0.592	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254715.1	NM_006088	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123519705	123519705	+	Silent	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chrX:123519705G>T	ENST00000371130.3	-	28	5940	c.5877C>A	c.(5875-5877)acC>acA	p.T1959T	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Silent_p.T1966T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1959					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCAGATGCAGGGTCTGTAGCA	0.488																																					p.T1966T		.											.	.	0			c.C5898A						.						173.0	144.0	154.0					X																	123519705		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon29			ATGCAGGGTCTGT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5877C>A	X.37:g.123519705G>T		154	0		124	21	NM_001163278	0	0	2	2	0	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.		0.488	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
ZDHHC9	51114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	128963040	128963040	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chrX:128963040G>T	ENST00000357166.6	-	4	636	c.245C>A	c.(244-246)aCa>aAa	p.T82K	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.T82K	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	82					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CCTCAACAGTGTAGCCATGGA	0.522																																					p.T82K		.											.	ZDHHC9-131	0			c.C245A						.						127.0	102.0	110.0					X																	128963040		2203	4300	6503	SO:0001583	missense	51114	exon3			AACAGTGTAGCCA	AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.245C>A	X.37:g.128963040G>T	ENSP00000349689:p.Thr82Lys	85	0		84	82	NM_001008222	0	0	0	49	49	B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	CCDS35395.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.36|19.36	3.812188|3.812188	0.70797|0.70797	.|.	.|.	ENSG00000188706|ENSG00000188706	ENST00000433917|ENST00000357166;ENST00000371064;ENST00000406492	.|T;T;T	.|0.25085	.|1.82;1.82;1.82	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	.|0.088515	.|0.85682	.|D	.|0.000000	T|T	0.39572|0.39572	0.1083|0.1083	M|M	0.75777|0.75777	2.31|2.31	0.51482|0.51482	D|D	0.999924|0.999924	.|P	.|0.41041	.|0.736	.|P	.|0.44422	.|0.449	T|T	0.16305|0.16305	-1.0407|-1.0407	5|10	.|0.36615	.|T	.|0.2	-7.38|-7.38	18.76|18.76	0.91847|0.91847	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|82	.|Q9Y397	.|ZDHC9_HUMAN	N|K	42|82	.|ENSP00000349689:T82K;ENSP00000360103:T82K;ENSP00000383991:T82K	.|ENSP00000349689:T82K	H|T	-|-	1|2	0|0	ZDHHC9|ZDHHC9	128790721|128790721	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.891000|0.891000	0.51852|0.51852	4.787000|4.787000	0.62432|0.62432	2.375000|2.375000	0.81037|0.81037	0.594000|0.594000	0.82650|0.82650	CAC|ACA	.		0.522	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032	
INCENP	3619	broad.mit.edu	37	11	61916013	61916015	+	In_Frame_Del	DEL	AGA	AGA	-	rs79863590		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr11:61916013_61916015delAGA	ENST00000394818.3	+	16	2472_2474	c.2270_2272delAGA	c.(2269-2274)gagaag>gag	p.K761del	INCENP_ENST00000278849.4_In_Frame_Del_p.K757del	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	761					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GAACTGGAGGAGAAGAAGAAGAA	0.655																																					p.757_758del													.	INCENP-227	0			c.2270_2272del						.																																			SO:0001651	inframe_deletion	3619	exon16			TGGAGGAGAAGAA	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2270_2272delAGA	11.37:g.61916022_61916024delAGA	ENSP00000378295:p.Lys761del	6	0		15	7	NM_001040694	0	0	0	0	0	A8MQD2|Q5Y192	In_Frame_Del	DEL	ENST00000394818.3	37	CCDS44624.1																																																																																			.		0.655	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
LINS	55180	hgsc.bcm.edu;bcgsc.ca	37	15	101109778	101109778	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr15:101109778delT	ENST00000314742.8	-	7	2161	c.1939delA	c.(1939-1941)agtfs	p.S647fs	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	647										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						GTCTGTTTACTGTTAGCTAAA	0.473																																					p.S647fs		.											.	LINS-92	0			c.1939delA						.						103.0	100.0	101.0					15																	101109778		2203	4300	6503	SO:0001589	frameshift_variant	55180	exon7			.	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1939delA	15.37:g.101109778delT	ENSP00000318423:p.Ser647fs	183	0		113	22	NM_001040616	0	0	0	0	0	Q96FW2|Q9NVQ3	Frame_Shift_Del	DEL	ENST00000314742.8	37	CCDS10385.1																																																																																			.		0.473	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
DHX57	90957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	39030017	39030017	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:39030017delT	ENST00000295373.6	-	23	3983	c.3857delA	c.(3856-3858)aagfs	p.K1286fs		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1286							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				AGTTTTTATCTTCTCGTGGTA	0.468																																					p.K1286fs	Melanoma(191;1090 2095 4375 23729 47341)	.											.	DHX57-228	0			c.3857delA						.						165.0	163.0	164.0					2																	39030017		2203	4300	6503	SO:0001589	frameshift_variant	90957	exon23			.	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3857delA	2.37:g.39030017delT	ENSP00000295373:p.Lys1286fs	237	0		195	83	NM_198963	0	0	0	0	0	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Frame_Shift_Del	DEL	ENST00000295373.6	37	CCDS1800.1																																																																																			.		0.468	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
XIRP2	129446	hgsc.bcm.edu;bcgsc.ca	37	2	168115244	168115247	+	Frame_Shift_Del	DEL	TTTC	TTTC	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	TTTC	TTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:168115244_168115247delTTTC	ENST00000409728.1	+	11	2376_2379	c.2287_2290delTTTC	c.(2287-2292)tttcttfs	p.FL763fs	XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000420519.1_Frame_Shift_Del_p.FL763fs|XIRP2_ENST00000409605.1_Frame_Shift_Del_p.FL508fs|XIRP2_ENST00000409043.1_Frame_Shift_Del_p.FL730fs|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409756.2_Frame_Shift_Del_p.FL730fs|XIRP2_ENST00000295237.9_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1281					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TATTTTAGAATTTCTTGATCTATT	0.299																																					p.763_764del		.											.	XIRP2-104	0			c.2287_2290del						.																																			SO:0001589	frameshift_variant	129446	exon11			.	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2287_2290delTTTC	2.37:g.168115244_168115247delTTTC	ENSP00000386619:p.Phe763fs	110	0		92	51	NM_001199143	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Del	DEL	ENST00000409728.1	37	CCDS56143.1																																																																																			.		0.299	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
CASP10	843	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	202073930	202073931	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr2:202073930_202073931delTG	ENST00000272879.5	+	9	1244_1245	c.1060_1061delTG	c.(1060-1062)tgtfs	p.C354fs	CASP10_ENST00000346817.5_Frame_Shift_Del_p.C311fs|CASP10_ENST00000286186.6_Frame_Shift_Del_p.C354fs|CASP10_ENST00000313728.7_Frame_Shift_Del_p.C287fs|CASP10_ENST00000448480.1_Frame_Shift_Del_p.C311fs|CASP10_ENST00000360132.3_3'UTR|CASP10_ENST00000492363.1_3'UTR	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	354					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						CTTCGTGTTCTGTATTCTGACC	0.515																																					p.354_354del		.											.	CASP10-1086	0			c.1060_1061del						.																																			SO:0001589	frameshift_variant	843	exon9			.	U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.1060_1061delTG	2.37:g.202073930_202073931delTG	ENSP00000272879:p.Cys354fs	218	0		186	90	NM_032977	0	0	0	0	0	Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Frame_Shift_Del	DEL	ENST00000272879.5	37	CCDS2338.1																																																																																			.		0.515	CASP10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256273.1	NM_032977	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	30067890	30067905	+	Frame_Shift_Del	DEL	AGGCTGCTGCAGATGA	AGGCTGCTGCAGATGA	-	rs74315492|rs74315498		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	AGGCTGCTGCAGATGA	AGGCTGCTGCAGATGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr22:30067890_30067905delAGGCTGCTGCAGATGA	ENST00000338641.4	+	11	1516_1531	c.1075_1090delAGGCTGCTGCAGATGA	c.(1075-1092)aggctgctgcagatgaaafs	p.RLLQMK359fs	NF2_ENST00000361676.4_Frame_Shift_Del_p.RLLQMK317fs|NF2_ENST00000361452.4_Frame_Shift_Del_p.RLLQMK318fs|NF2_ENST00000397789.3_Frame_Shift_Del_p.RLLQMK359fs|NF2_ENST00000361166.4_Frame_Shift_Del_p.RLLQMK359fs|NF2_ENST00000334961.7_Frame_Shift_Del_p.RLLQMK276fs|NF2_ENST00000353887.4_Frame_Shift_Del_p.RLLQMK276fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000403435.1_Splice_Site_p.GC334fs|NF2_ENST00000403999.3_Frame_Shift_Del_p.RLLQMK359fs|NF2_ENST00000347330.5_Intron	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	359	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.Q362*(4)|p.?(3)|p.M363fs*12(2)|p.L361fs*6(1)|p.M334fs*4(1)|p.L361fs*3(1)|p.M334_Q362del(1)|p.K364fs*5(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GTTGGAGAGGAGGCTGCTGCAGATGAAAGAAGAAGC	0.565			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.359_364del		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	14	Deletion - Frameshift(6)|Substitution - Nonsense(4)|Unknown(3)|Deletion - In frame(1)	meninges(5)|soft_tissue(4)|large_intestine(1)|central_nervous_system(1)|endometrium(1)|skin(1)|stomach(1)	c.1075_1090del	GRCh37	CM066148|CM930517	NF2	M	rs74315492|rs74315498	.																																			SO:0001589	frameshift_variant	4771	exon11	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	.	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1075_1090delAGGCTGCTGCAGATGA	22.37:g.30067890_30067905delAGGCTGCTGCAGATGA	ENSP00000344666:p.Arg359fs	100	0		35	23	NM_000268	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.565	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
KIAA0825	285600	broad.mit.edu;bcgsc.ca	37	5	93856355	93856362	+	Frame_Shift_Del	DEL	AAATTTTT	AAATTTTT	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	AAATTTTT	AAATTTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:93856355_93856362delAAATTTTT	ENST00000329378.7	-	5	810_817	c.561_568delAAAAATTT	c.(559-570)caaaaaattttafs	p.QKIL187fs	KIAA0825_ENST00000513200.3_Frame_Shift_Del_p.QKIL187fs|KIAA0825_ENST00000312498.7_Frame_Shift_Del_p.QKIL187fs|KIAA0825_ENST00000427991.2_Frame_Shift_Del_p.QKIL187fs	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	187										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TTTTTCAATAAAATTTTTTGCTGTGAAT	0.322																																					p.187_190del													.	KIAA0825-91	0			c.561_568del						.																																			SO:0001589	frameshift_variant	285600	exon5			TCAATAAAATTTT	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.561_568delAAAAATTT	5.37:g.93856355_93856362delAAATTTTT	ENSP00000331385:p.Gln187fs	107	0		170	24	NM_173665	0	0	0	0	0	O94914|Q6ZNN2	Frame_Shift_Del	DEL	ENST00000329378.7	37	CCDS4070.1																																																																																			.		0.322	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371180.2	NM_173665	
KIAA0825	285600	hgsc.bcm.edu	37	5	93856355	93856363	+	In_Frame_Del	DEL	AAATTTTTT	AAATTTTTT	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	AAATTTTTT	AAATTTTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:93856355_93856363delAAATTTTTT	ENST00000329378.7	-	5	809_817	c.560_568delAAAAAATTT	c.(559-570)caaaaaatttta>cta	p.QKI187del	KIAA0825_ENST00000513200.3_In_Frame_Del_p.QKI187del|KIAA0825_ENST00000312498.7_In_Frame_Del_p.QKI187del|KIAA0825_ENST00000427991.2_In_Frame_Del_p.QKI187del	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	187										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TTTTTCAATAAAATTTTTTGCTGTGAATT	0.321																																					p.187_190del		.											.	KIAA0825-91	0			c.560_568del						.																																			SO:0001651	inframe_deletion	285600	exon5			.	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.560_568delAAAAAATTT	5.37:g.93856355_93856363delAAATTTTTT	ENSP00000331385:p.Gln187_Ile189del	114	0		172	26	NM_173665	0	0	0	0	0	O94914|Q6ZNN2	In_Frame_Del	DEL	ENST00000329378.7	37	CCDS4070.1																																																																																			.		0.321	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371180.2	NM_173665	
MRPL22	29093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	154330411	154330411	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:154330411delT	ENST00000523037.1	+	3	149	c.108delT	c.(106-108)agtfs	p.S36fs	MRPL22_ENST00000265229.8_Intron|MRPL22_ENST00000439747.3_Frame_Shift_Del_p.S62fs|MRPL22_ENST00000522038.1_Frame_Shift_Del_p.S42fs	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	36					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCACACAAGTGCTTCTCTTG	0.398																																					p.S36fs		.											.	MRPL22-90	0			c.108delT						.						124.0	122.0	123.0					5																	154330411		2203	4300	6503	SO:0001589	frameshift_variant	29093	exon3			.	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.108delT	5.37:g.154330411delT	ENSP00000431040:p.Ser36fs	128	0		184	125	NM_014180	0	0	0	0	0	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Frame_Shift_Del	DEL	ENST00000523037.1	37	CCDS4331.1																																																																																			.		0.398	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
SNX10	29887	hgsc.bcm.edu;bcgsc.ca	37	7	26412183	26412200	+	Stop_Codon_Del	DEL	GGAATCCTGAAAAATAAT	GGAATCCTGAAAAATAAT	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	GGAATCCTGAAAAATAAT	GGAATCCTGAAAAATAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr7:26412183_26412200delGGAATCCTGAAAAATAAT	ENST00000338523.4	+	0	784_801				AC004540.4_ENST00000451264.1_RNA|SNX10_ENST00000409838.1_Stop_Codon_Del|SNX10_ENST00000409367.1_Stop_Codon_Del|SNX10_ENST00000396376.1_Stop_Codon_Del|AC004540.4_ENST00000451368.1_RNA|SNX10_ENST00000446848.2_Stop_Codon_Del|SNX10_ENST00000462993.1_3'UTR	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						CAGCTCCGCAGGAATCCTGAAAAATAATTCTAATGTTA	0.367																																					p.199_202del		.											.	SNX10-226	0			c.597_868del						.																																			SO:0001567	stop_retained_variant	29887	exon7			.	AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	Exception_encountered	7.37:g.26412183_26412200delGGAATCCTGAAAAATAAT		190	0		154	45	NM_001199835	0	0	0	0	0	E9PFH5|Q8IYT5	Frame_Shift_Del	DEL	ENST00000338523.4	37	CCDS5399.1																																																																																			.		0.367	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214120.1		
GBAS	2631	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	56045954	56045955	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr7:56045954_56045955delAC	ENST00000322090.3	+	2	257_258	c.228_229delAC	c.(226-231)ttacagfs	p.Q77fs	GBAS_ENST00000487370.1_3'UTR|GBAS_ENST00000446778.1_Frame_Shift_Del_p.Q77fs	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	77					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TATACAAATTACAGTGTGAGTG	0.361																																					p.76_77del		.											.	GBAS-514	0			c.228_229del						.																																			SO:0001589	frameshift_variant	2631	exon2			.	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.228_229delAC	7.37:g.56045954_56045955delAC	ENSP00000313050:p.Gln77fs	187	0		148	80	NM_001483	0	0	0	0	0	C9IYJ3|O43801|Q53X96	Frame_Shift_Del	DEL	ENST00000322090.3	37	CCDS5521.1																																																																																			.		0.361	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483	
STMN4	81551	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	27097566	27097566	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr8:27097566delT	ENST00000265770.7	-	5	568	c.432delA	c.(430-432)aaafs	p.K144fs	STMN4_ENST00000522908.1_Frame_Shift_Del_p.K171fs|STMN4_ENST00000350889.4_Frame_Shift_Del_p.K171fs|STMN4_ENST00000519997.1_Frame_Shift_Del_p.K135fs|STMN4_ENST00000519614.1_Frame_Shift_Del_p.K144fs|STMN4_ENST00000523048.1_Frame_Shift_Del_p.K171fs			Q9H169	STMN4_HUMAN	stathmin-like 4	144	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	TCTGGGCCAGTTTTTCCTTAG	0.517																																					p.K171fs		.											.	STMN4-154	0			c.513delA						.						233.0	213.0	220.0					8																	27097566		2203	4300	6503	SO:0001589	frameshift_variant	81551	exon6			.		CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.432delA	8.37:g.27097566delT	ENSP00000265770:p.Lys144fs	186	0		173	76	NM_030795	0	0	0	0	0	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Frame_Shift_Del	DEL	ENST00000265770.7	37																																																																																				.		0.517	STMN4-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000375941.1	NM_030795	
AMBP	259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	116837296	116837296	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:116837296delG	ENST00000265132.3	-	3	543	c.281delC	c.(280-282)acgfs	p.T94fs		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	94					cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	AGCTCCAGACGTCTCCTCACA	0.453																																					p.T94fs		.											.	AMBP-91	0			c.281delC						.						143.0	125.0	131.0					9																	116837296		2203	4300	6503	SO:0001589	frameshift_variant	259	exon3			.	X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.281delC	9.37:g.116837296delG	ENSP00000265132:p.Thr94fs	98	0		99	46	NM_001633	0	0	0	0	0	P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Frame_Shift_Del	DEL	ENST00000265132.3	37	CCDS6800.1																																																																																			.		0.453	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053758.2	NM_001633	
RABGAP1	23637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	125772734	125772738	+	Frame_Shift_Del	DEL	TTCAG	TTCAG	-	rs201077208		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	TTCAG	TTCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:125772734_125772738delTTCAG	ENST00000373647.4	+	11	1610_1614	c.1476_1480delTTCAG	c.(1474-1482)ccttcagttfs	p.SV493fs		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	493					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						CAGCCAGTCCTTCAGTTCGCCTGCC	0.4																																					p.492_494del		.											.	RABGAP1-500	0			c.1476_1480del						.																																			SO:0001589	frameshift_variant	23637	exon11			.	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1476_1480delTTCAG	9.37:g.125772734_125772738delTTCAG	ENSP00000362751:p.Ser493fs	73	0		71	25	NM_012197	0	0	0	0	0	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Frame_Shift_Del	DEL	ENST00000373647.4	37	CCDS6848.2																																																																																			.		0.400	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
ZER1	10444	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131515779	131515779	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr9:131515779delA	ENST00000291900.2	-	4	816	c.410delT	c.(409-411)ttcfs	p.F137fs	ZER1_ENST00000494461.1_5'UTR	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	137					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						TGTACAGCCGAAGAGGCTCAA	0.557																																					p.F137fs		.											.	ZER1-91	0			c.410delT						.						54.0	57.0	56.0					9																	131515779		2203	4300	6503	SO:0001589	frameshift_variant	10444	exon4			.	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.410delT	9.37:g.131515779delA	ENSP00000291900:p.Phe137fs	77	0		57	26	NM_006336	0	0	0	0	0	O00156|Q5T272|Q5T273	Frame_Shift_Del	DEL	ENST00000291900.2	37	CCDS6910.1																																																																																			.		0.557	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
RLF	6018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	40705390	40705391	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr1:40705390_40705391insT	ENST00000372771.4	+	8	5043_5044	c.5016_5017insT	c.(5017-5019)aaafs	p.K1673fs		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1673					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			GGGGAACTTTGAAATGTAATCA	0.411																																					p.L1672fs		.											.	RLF-93	0			c.5016_5017insT						.																																			SO:0001589	frameshift_variant	6018	exon8			.		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	Exception_encountered	1.37:g.40705390_40705391insT	ENSP00000361857:p.Lys1673fs	130	0		103	54	NM_012421	0	0	0	0	0	Q14CQ1|Q9NU60	Frame_Shift_Ins	INS	ENST00000372771.4	37	CCDS448.1																																																																																			.		0.411	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
ZC3H13	23091	broad.mit.edu;bcgsc.ca	37	13	46543501	46543502	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr13:46543501_46543502insT	ENST00000242848.4	-	14	3525_3526	c.3177_3178insA	c.(3175-3180)aaagaafs	p.E1060fs	ZC3H13_ENST00000282007.3_Frame_Shift_Ins_p.E1060fs|ZC3H13_ENST00000378921.2_Frame_Shift_Ins_p.E16fs			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1060							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		GCTGTATCTTCTTTTTTCTGGG	0.475																																					p.E1060fs	Esophageal Squamous(187;747 2077 11056 31291 44172)												.	ZC3H13-92	0			c.3178_3179insA						.																																			SO:0001589	frameshift_variant	23091	exon14			TATCTTCTTTTTT	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3178dupA	13.37:g.46543507_46543507dupT	ENSP00000242848:p.Glu1060fs	151	0		189	21	NM_015070	0	0	0	0	0	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Frame_Shift_Ins	INS	ENST00000242848.4	37																																																																																				.		0.475	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
MBIP	51562	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	36770005	36770006	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr14:36770005_36770006insT	ENST00000416007.4	-	8	999_1000	c.912_913insA	c.(910-915)aaagttfs	p.V305fs	MBIP_ENST00000318473.7_Frame_Shift_Ins_p.V305fs|MBIP_ENST00000359527.7_Frame_Shift_Ins_p.S272fs	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	305	Interaction with MAP3K12.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		GGTGGTTGAACTTTTCTTCTTT	0.243																																					p.V305fs		.											.	MBIP-658	0			c.913_914insA						.																																			SO:0001589	frameshift_variant	51562	exon8			.	BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.913dupA	14.37:g.36770009_36770009dupT	ENSP00000399718:p.Val305fs	36	0		21	11	NM_016586	0	0	0	0	0	Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Frame_Shift_Ins	INS	ENST00000416007.4	37	CCDS9658.1																																																																																			.		0.243	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276685.2	NM_016586	
CNTNAP4	85445	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	76587277	76587278	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr16:76587277_76587278insGC	ENST00000476707.1	+	21	3688_3689	c.3549_3550insGC	c.(3550-3552)gcafs	p.A1184fs	CNTNAP4_ENST00000377504.4_Frame_Shift_Ins_p.A1132fs|RP11-58C22.1_ENST00000563764.1_5'Flank|CNTNAP4_ENST00000478060.1_Frame_Shift_Ins_p.A1108fs|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Frame_Shift_Ins_p.A1180fs			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1181	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CCCCTCTGAAGGCAGCTCTGCA	0.604																																					p.K1107fs		.											.	CNTNAP4-70	0			c.3321_3322insGC						.																																			SO:0001589	frameshift_variant	85445	exon21			.	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3550_3551dupGC	16.37:g.76587278_76587279dupGC	ENSP00000417628:p.Ala1184fs	21	0		43	25	NM_138994	0	0	0	0	0	E9PFZ6|Q86YZ7	Frame_Shift_Ins	INS	ENST00000476707.1	37																																																																																				.		0.604	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
GAGE2D	729408	broad.mit.edu	37	X	49208295	49208296	+	In_Frame_Ins	INS	-	-	TAT	rs372553636		TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chrX:49208295_49208296insTAT	ENST00000404720.2	+	2	96_97	c.24_25insTAT	c.(25-27)tat>TATtat	p.9_9Y>YY		NM_001098407.1|NM_012196.1	NP_001091877.1|NP_036328.1	Q9UEU5	GGE2D_HUMAN	G antigen 2D	9					cellular defense response (GO:0006968)												GAAGATCGACCTATCGGCCTAG	0.465														477	0.126358	0.031	0.098	3775	,	,		26951	0.0972		0.1441	False		,,,				2504	0.1278				p.T8delinsTY													.	.	0			c.24_25insTAT						.			10,505,1500		1,1,3,4,46,330,82,490,187						-1.1	0.0			8	27,1244,2482		1,3,16,6,128,539,446,675,577	no	codingComplex	GAGE2D	NM_001098407.1		2,4,19,10,174,869,528,1165,764	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		33.8662,25.5583,30.9639				37,1749,3982				SO:0001652	inframe_insertion	729447	exon2			ATCGACCTATCGG			Xp11.23	2012-10-02			ENSG00000240257				31959	protein-coding gene	gene with protein product		300735					Standard	NM_001098407		Approved	GAGE8		Q9UEU5	OTTHUMG00000067393	ENST00000404720.2:c.25_27dupTAT	X.37:g.49208296_49208298dupTAT	ENSP00000386110:p.Tyr9dup	644	0		596	4	NM_001127212	0	0	0	0	0	A6NG46|A6NNR8|B7ZL76|Q4V325	In_Frame_Ins	INS	ENST00000404720.2	37	CCDS43941.1																																																																																			.		0.465	GAGE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144212.1	NM_001098407	
PARL	55486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183551347	183551348	+	Missense_Mutation	DNP	CT	CT	GG			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr3:183551347_183551348CT>GG	ENST00000317096.4	-	9	1020_1021	c.960_961AG>CC	c.(958-963)acAGca>acCCca	p.A321P	PARL_ENST00000311101.5_Missense_Mutation_p.A271P|PARL_ENST00000435888.1_Missense_Mutation_p.A237P	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	321					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATCATTCCTGCTGTATCCATGG	0.446																																					p.A321P		.											.	PARL	0			c.A960C						.																																			SO:0001583	missense	55486	exon9			TCCTGCTGTATCC	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.960_961delinsGG	3.37:g.183551347_183551348delinsGG	ENSP00000325421:p.Ala321Pro	132.0	1.0		101.0	43.0		0	0	0	0	0	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	DNP	ENST00000317096.4	37	CCDS3248.1																																																																																			.		0.446	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
ATP10B	23120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	160113261	160113262	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-EV-5902-01A-11D-1589-08	TCGA-EV-5902-10A-01D-1589-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	05c0e7bb-5be8-4e8d-9724-8063e99cc058	c49e0138-d7e1-4094-9d2d-b41239dea126	g.chr5:160113261_160113262GG>TC	ENST00000327245.5	-	6	1140_1141	c.294_295CC>GA	c.(292-297)ttCCtg>ttGAtg	p.98_99FL>LM	ATP10B_ENST00000518411.1_5'UTR|CTC-529G1.1_ENST00000524198.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	98					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCAGGAACAGGAAATAGAGGT	0.45																																					p.FL98LM		.											.	ATP10B	0			c.C294G						.																																			SO:0001583	missense	23120	exon6			GAACAGGAAATAG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.294_295delinsTC	5.37:g.160113261_160113262delinsTC	ENSP00000313600:p.F98_L99delinsLM	38.0	0.0		57.0	12.0		0	0	0	0	0	Q9H725	Missense_Mutation	DNP	ENST00000327245.5	37	CCDS43394.1																																																																																			.		0.450	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
