#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CC2D1B	200014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	52819228	52819228	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr1:52819228G>C	ENST00000371586.2	-	24	2678	c.2540C>G	c.(2539-2541)aCt>aGt	p.T847S	RP11-155O18.6_ENST00000606527.1_RNA|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.T841S	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	847						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						CCAGTTCTCAGTGACCATCTG	0.592																																					p.T847S		.											.	CC2D1B-92	0			c.C2540G						.						48.0	46.0	47.0					1																	52819228		2203	4300	6503	SO:0001583	missense	200014	exon24			TTCTCAGTGACCA	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.2540C>G	1.37:g.52819228G>C	ENSP00000360642:p.Thr847Ser	48	0		46	22	NM_032449	0	0	29	58	29	Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	CCDS30714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.43|16.43	3.121445|3.121445	0.56613|0.56613	.|.	.|.	ENSG00000154222|ENSG00000154222	ENST00000450942|ENST00000371586;ENST00000284376	.|T;T	.|0.21543	.|2.0;2.0	4.97|4.97	4.06|4.06	0.47325|0.47325	.|.	.|0.215167	.|0.44483	.|D	.|0.000459	T|T	0.27524|0.27524	0.0676|0.0676	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|P;P	.|0.43477	.|0.808;0.757	.|P;B	.|0.46026	.|0.501;0.327	T|T	0.03051|0.03051	-1.1078|-1.1078	5|10	.|0.48119	.|T	.|0.1	-6.0069|-6.0069	13.5782|13.5782	0.61888|0.61888	0.0745:0.0:0.9255:0.0|0.0745:0.0:0.9255:0.0	.|.	.|841;847	.|Q5T0F9-2;Q5T0F9	.|.;C2D1B_HUMAN	V|S	761|847;841	.|ENSP00000360642:T847S;ENSP00000284376:T841S	.|ENSP00000284376:T841S	L|T	-|-	1|2	2|0	CC2D1B|CC2D1B	52591816|52591816	1.000000|1.000000	0.71417|0.71417	0.830000|0.830000	0.32933|0.32933	0.821000|0.821000	0.46438|0.46438	6.187000|6.187000	0.72039|0.72039	1.323000|1.323000	0.45263|0.45263	0.561000|0.561000	0.74099|0.74099	CTG|ACT	.		0.592	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449	
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	98058809	98058809	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr1:98058809T>A	ENST00000370192.3	-	10	1193	c.1093A>T	c.(1093-1095)Aaa>Taa	p.K365*		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	365					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ACAAAGCCTTTTCTGAAGACG	0.448																																					p.K365X		.											.	DPYD-278	0			c.A1093T						.						119.0	116.0	117.0					1																	98058809		2203	4300	6503	SO:0001587	stop_gained	1806	exon10			AGCCTTTTCTGAA	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1093A>T	1.37:g.98058809T>A	ENSP00000359211:p.Lys365*	116	0		140	53	NM_000110	0	0	0	0	0	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Nonsense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	T	39	7.840231	0.98519	.	.	ENSG00000188641	ENST00000370192	.	.	.	6.17	6.17	0.99709	.	0.048348	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.3061	15.3933	0.74767	0.0:0.0:0.0:1.0	.	.	.	.	X	365	.	ENSP00000359211:K365X	K	-	1	0	DPYD	97831397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.664000	0.68045	2.371000	0.80710	0.533000	0.62120	AAA	.		0.448	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
YY1AP1	55249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	155630357	155630357	+	Silent	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr1:155630357G>A	ENST00000295566.4	-	11	1505	c.1482C>T	c.(1480-1482)ctC>ctT	p.L494L	YY1AP1_ENST00000361831.5_Silent_p.L437L|YY1AP1_ENST00000355499.4_Silent_p.L448L|YY1AP1_ENST00000347088.5_Silent_p.L448L|YY1AP1_ENST00000368330.2_Silent_p.L448L|YY1AP1_ENST00000311573.5_Silent_p.L417L|YY1AP1_ENST00000368339.5_Silent_p.L586L|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000359205.5_Silent_p.L437L|YY1AP1_ENST00000407221.1_Silent_p.L417L|YY1AP1_ENST00000535662.1_Silent_p.L294L|YY1AP1_ENST00000404643.1_Silent_p.L428L|YY1AP1_ENST00000368340.5_Silent_p.L566L	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	494					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					GAGGAATCCGGAGCACCATTT	0.552																																					p.L586L		.											.	YY1AP1-93	0			c.C1758T						.						55.0	65.0	62.0					1																	155630357		2203	4300	6503	SO:0001819	synonymous_variant	55249	exon10			AATCCGGAGCACC	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.1482C>T	1.37:g.155630357G>A		135	1		148	40	NM_001198903	0	0	17	30	13	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Silent	SNP	ENST00000295566.4	37	CCDS1115.1																																																																																			.		0.552	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
RHBG	57127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156347130	156347130	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr1:156347130G>C	ENST00000368249.1	+	2	264	c.226G>C	c.(226-228)Ggc>Cgc	p.G76R	RHBG_ENST00000255013.3_Missense_Mutation_p.G7R|RHBG_ENST00000451864.2_Missense_Mutation_p.G7R|RHBG_ENST00000400992.2_Missense_Mutation_p.G7R|RHBG_ENST00000368246.2_Missense_Mutation_p.G76R|RHBG_ENST00000537040.1_Intron	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	76			G -> D (in dbSNP:rs2245623). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.5}.		ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CGTGGGCTTTGGCTTCCTCAT	0.637																																					p.G76R		.											.	RHBG-92	0			c.G226C						.						142.0	144.0	143.0					1																	156347130		2203	4300	6503	SO:0001583	missense	57127	exon2			GGCTTTGGCTTCC	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.226G>C	1.37:g.156347130G>C	ENSP00000357232:p.Gly76Arg	207	0		147	47	NM_020407	0	0	0	0	0	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	ENST00000368249.1	37		.	.	.	.	.	.	.	.	.	.	G	29.7	5.031766	0.93575	.	.	ENSG00000132677	ENST00000368249;ENST00000368246;ENST00000400992;ENST00000255013;ENST00000451864	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	4.86	4.86	0.63082	Ammonium transporter AmtB-like (3);	0.000000	0.85682	D	0.000000	D	0.91744	0.7389	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93736	0.7046	10	0.87932	D	0	-6.6399	16.7188	0.85405	0.0:0.0:1.0:0.0	.	76;7;113	Q9H310;Q9H310-3;Q5SZW5	RHBG_HUMAN;.;.	R	76;76;7;7;7	ENSP00000357232:G76R;ENSP00000357229:G76R;ENSP00000383777:G7R;ENSP00000255013:G7R;ENSP00000389836:G7R	ENSP00000255013:G7R	G	+	1	0	RHBG	154613754	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.365000	0.73090	2.512000	0.84698	0.561000	0.74099	GGC	.		0.637	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395	
TDRD5	163589	broad.mit.edu	37	1	179621298	179621298	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr1:179621298G>T	ENST00000367614.1	+	13	2485	c.2126G>T	c.(2125-2127)aGt>aTt	p.S709I	TDRD5_ENST00000444136.1_Missense_Mutation_p.S709I|TDRD5_ENST00000294848.8_Missense_Mutation_p.S709I	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	709					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CGAAAGATAAGTCCACAGTCA	0.368																																					p.S709I													.	TDRD5-94	0			c.G2126T						.						95.0	91.0	92.0					1																	179621298		2203	4300	6503	SO:0001583	missense	163589	exon13			AGATAAGTCCACA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2126G>T	1.37:g.179621298G>T	ENSP00000356586:p.Ser709Ile	39	0		76	4	NM_173533	0	0	0	0	0	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385165	0.25031	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.32753	2.74;2.74;2.85;1.44	4.55	1.53	0.23141	.	0.629622	0.14481	N	0.316979	T	0.18087	0.0434	L	0.40543	1.245	0.23889	N	0.99655	P;B	0.39424	0.673;0.391	B;B	0.33521	0.165;0.079	T	0.10520	-1.0626	10	0.23891	T	0.37	-31.3686	4.7749	0.13175	0.1919:0.0:0.6278:0.1802	.	709;709	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	I	709;709;709;165	ENSP00000356586:S709I;ENSP00000294848:S709I;ENSP00000406052:S709I;ENSP00000410744:S165I	ENSP00000294848:S709I	S	+	2	0	TDRD5	177887921	0.487000	0.25988	0.332000	0.25469	0.942000	0.58702	0.029000	0.13666	0.569000	0.29329	0.557000	0.71058	AGT	.		0.368	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
ADD3	120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	111860443	111860443	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr10:111860443C>G	ENST00000356080.4	+	2	399	c.32C>G	c.(31-33)aCc>aGc	p.T11S	ADD3_ENST00000497125.1_3'UTR|ADD3_ENST00000277900.8_Missense_Mutation_p.T11S|ADD3_ENST00000360162.3_Missense_Mutation_p.T11S	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	11						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GGCGTGATTACCACTCCTCCT	0.418																																					p.T11S		.											.	ADD3-157	0			c.C32G						.						84.0	70.0	74.0					10																	111860443		2203	4300	6503	SO:0001583	missense	120	exon2			TGATTACCACTCC	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.32C>G	10.37:g.111860443C>G	ENSP00000348381:p.Thr11Ser	77	0		72	28	NM_001121	0	0	0	0	0	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165457	0.78339	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.30714	1.52;1.52;1.52	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.76838	2.35	0.80722	D	1	P;B	0.51653	0.947;0.383	P;B	0.48400	0.576;0.155	T	0.32107	-0.9919	10	0.30078	T	0.28	-16.68	20.6397	0.99537	0.0:1.0:0.0:0.0	.	11;11	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	S	11	ENSP00000353286:T11S;ENSP00000348381:T11S;ENSP00000277900:T11S	ENSP00000277900:T11S	T	+	2	0	ADD3	111850433	1.000000	0.71417	0.988000	0.46212	0.954000	0.61252	7.481000	0.81124	2.880000	0.98712	0.650000	0.86243	ACC	.		0.418	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	10647666	10647666	+	Silent	SNP	C	C	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr11:10647666C>G	ENST00000436272.1	-	8	1212	c.1134G>C	c.(1132-1134)cgG>cgC	p.R378R	MRVI1_ENST00000552103.1_Silent_p.R314R|MRVI1_ENST00000527509.2_Silent_p.R314R|MRVI1_ENST00000531107.1_Silent_p.R397R|MRVI1_ENST00000545852.1_Silent_p.R90R|MRVI1_ENST00000423302.2_Silent_p.R405R|MRVI1_ENST00000547195.1_Silent_p.R314R|MRVI1_ENST00000541483.1_Intron|MRVI1_ENST00000421747.1_Silent_p.R396R|MRVI1_ENST00000558540.1_Silent_p.R90R|MRVI1_ENST00000424001.1_Silent_p.R90R|MRVI1_ENST00000534266.2_Silent_p.R90R			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	378					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTTTCTGCAGCCGGGGGCCAG	0.647																																					p.R405R		.											.	MRVI1-25	0			c.G1215C						.						16.0	18.0	18.0					11																	10647666		1874	4079	5953	SO:0001819	synonymous_variant	10335	exon9			CTGCAGCCGGGGG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1134G>C	11.37:g.10647666C>G		42	0		30	11	NM_130385	0	0	0	0	0	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																				.		0.647	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
HPS5	11234	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18309441	18309441	+	Splice_Site	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr11:18309441G>A	ENST00000349215.3	-	17	2837	c.2560C>T	c.(2560-2562)Cgg>Tgg	p.R854W	HPS5_ENST00000438420.2_Splice_Site_p.R740W|HPS5_ENST00000396253.3_Splice_Site_p.R740W|HPS5_ENST00000537258.1_5'Flank|HPS5_ENST00000352460.3_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	854					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						ACAACTTACCGGGTAGCATAA	0.363									Hermansky-Pudlak syndrome																												p.R854W		.											.	HPS5-133	0			c.C2560T						.						140.0	122.0	129.0					11																	18309441		2199	4293	6492	SO:0001630	splice_region_variant	11234	exon17	Familial Cancer Database	HPS, HPS1-8	CTTACCGGGTAGC	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.2561+1C>T	11.37:g.18309441G>A		53	0		53	24	NM_181507	0	0	0	0	0	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	ENST00000349215.3	37	CCDS7836.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.415187	0.42817	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215;ENST00000544218	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.36	-0.639	0.11497	.	0.091394	0.85682	D	0.000000	D	0.90017	0.6883	M	0.66939	2.045	0.48830	D	0.999711	D	0.76494	0.999	D	0.65443	0.935	D	0.88319	0.2961	10	0.87932	D	0	.	10.3165	0.43740	0.0768:0.0:0.2154:0.7078	.	854	Q9UPZ3	HPS5_HUMAN	W	740;740;854;40	ENSP00000379552:R740W;ENSP00000399590:R740W;ENSP00000265967:R854W;ENSP00000441781:R40W	ENSP00000265967:R854W	R	-	1	2	HPS5	18266017	0.959000	0.32827	0.725000	0.30721	0.174000	0.22865	1.548000	0.36201	-0.008000	0.14320	-0.475000	0.04921	CGG	.		0.363	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	Missense_Mutation
NPAT	4863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	108032024	108032024	+	Silent	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr11:108032024A>G	ENST00000278612.8	-	17	3894	c.3789T>C	c.(3787-3789)agT>agC	p.S1263S		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1263					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		CAGGTAAATCACTACTATCAG	0.443																																					p.S1263S		.											.	NPAT-117	0			c.T3789C						.						107.0	105.0	106.0					11																	108032024		1852	4092	5944	SO:0001819	synonymous_variant	4863	exon17			TAAATCACTACTA	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3789T>C	11.37:g.108032024A>G		164	0		132	54	NM_002519	0	0	2	4	2	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Silent	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.813585	0.00600	.	.	ENSG00000149308	ENST00000527296	.	.	.	3.92	-3.71	0.04424	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.44275	D	0.997137	.	.	.	.	.	.	T	0.37197	-0.9716	4	.	.	.	-0.1192	0.4805	0.00547	0.1833:0.2475:0.2586:0.3106	.	.	.	.	A	262	.	.	V	-	2	0	NPAT	107537234	0.001000	0.12720	0.012000	0.15200	0.023000	0.10783	-0.273000	0.08548	-0.420000	0.07427	-0.256000	0.11100	GTG	.		0.443	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	133790126	133790126	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr11:133790126C>A	ENST00000321016.8	-	18	3724	c.3494G>T	c.(3493-3495)gGc>gTc	p.G1165V	IGSF9B_ENST00000533871.2_Missense_Mutation_p.G1165V			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1165	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGTGTCCAGGCCAAATGTGCT	0.692																																					p.G1165V		.											.	IGSF9B-68	0			c.G3494T						.						30.0	34.0	33.0					11																	133790126		1905	4106	6011	SO:0001583	missense	22997	exon18			TCCAGGCCAAATG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3494G>T	11.37:g.133790126C>A	ENSP00000317980:p.Gly1165Val	108	0		99	39	NM_014987	0	0	0	0	0	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	C	15.82	2.946783	0.53186	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.65364	0.18;-0.15	5.08	5.08	0.68730	.	0.000000	0.45606	D	0.000349	T	0.50205	0.1602	N	0.19112	0.55	0.58432	D	0.999991	P	0.35774	0.519	B	0.34418	0.182	T	0.57225	-0.7848	10	0.62326	D	0.03	.	18.0591	0.89371	0.0:1.0:0.0:0.0	.	1165	Q9UPX0	TUTLB_HUMAN	V	1165;1007	ENSP00000317980:G1165V;ENSP00000436552:G1007V	ENSP00000317980:G1165V	G	-	2	0	IGSF9B	133295336	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.261000	0.65496	2.358000	0.79984	0.455000	0.32223	GGC	.		0.692	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	133794760	133794760	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr11:133794760C>T	ENST00000321016.8	-	15	2304	c.2074G>A	c.(2074-2076)Gat>Aat	p.D692N	IGSF9B_ENST00000533871.2_Missense_Mutation_p.D692N			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	692	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTGATCAGATCCTGCATGACG	0.587																																					p.D692N		.											.	IGSF9B-68	0			c.G2074A						.						114.0	123.0	120.0					11																	133794760		2090	4217	6307	SO:0001583	missense	22997	exon15			TCAGATCCTGCAT	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2074G>A	11.37:g.133794760C>T	ENSP00000317980:p.Asp692Asn	239	0		174	55	NM_014987	0	0	0	0	0	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	C	34	5.382681	0.95967	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.56941	0.43;0.43;0.43	5.02	5.02	0.67125	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.41500	D	0.000871	T	0.64505	0.2604	L	0.46157	1.445	0.53005	D	0.999967	P	0.42518	0.782	P	0.56278	0.795	T	0.62353	-0.6872	10	0.42905	T	0.14	.	18.7177	0.91682	0.0:1.0:0.0:0.0	.	692	Q9UPX0	TUTLB_HUMAN	N	692;534;692	ENSP00000317980:D692N;ENSP00000436552:D534N;ENSP00000436576:D692N	ENSP00000317980:D692N	D	-	1	0	IGSF9B	133299970	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.637000	0.83313	2.493000	0.84123	0.655000	0.94253	GAT	.		0.587	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
TROAP	10024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49717751	49717751	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:49717751A>C	ENST00000257909.3	+	3	344	c.268A>C	c.(268-270)Aac>Cac	p.N90H	RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000380327.5_Missense_Mutation_p.N90H|TROAP_ENST00000548311.1_Missense_Mutation_p.N90H|TROAP_ENST00000549275.1_Intron|TROAP_ENST00000550709.1_Missense_Mutation_p.N90H|TROAP_ENST00000551245.1_Missense_Mutation_p.N90H|TROAP_ENST00000547923.1_5'Flank|TROAP_ENST00000549534.1_3'UTR	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	90					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TCAGCCTCGGAACCCCTTGGA	0.602																																					p.N90H		.											.	TROAP-91	0			c.A268C						.						86.0	83.0	84.0					12																	49717751		2203	4300	6503	SO:0001583	missense	10024	exon3			CCTCGGAACCCCT	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.268A>C	12.37:g.49717751A>C	ENSP00000257909:p.Asn90His	157	1		136	34	NM_001100620	0	0	2	3	1	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979408	0.34942	.	.	ENSG00000135451	ENST00000551245;ENST00000380327;ENST00000548311;ENST00000550709;ENST00000257909;ENST00000547807;ENST00000551567	T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87	5.77	4.43	0.53597	.	0.417260	0.22706	N	0.056634	T	0.36524	0.0970	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.60160	0.987;0.986;0.987;0.987	P;P;P;P	0.60473	0.875;0.864;0.821;0.723	T	0.11036	-1.0604	10	0.72032	D	0.01	-0.9898	8.2741	0.31862	0.8997:0.0:0.1003:0.0	.	90;90;90;90	F8W130;Q12815;Q6PJU7;F8VSF9	.;TROAP_HUMAN;.;.	H	90	ENSP00000447509:N90H;ENSP00000369684:N90H;ENSP00000448313:N90H;ENSP00000449984:N90H;ENSP00000257909:N90H;ENSP00000446646:N90H;ENSP00000447244:N90H	ENSP00000257909:N90H	N	+	1	0	TROAP	48004018	0.998000	0.40836	0.800000	0.32199	0.062000	0.15995	2.669000	0.46825	2.199000	0.70637	0.533000	0.62120	AAC	.		0.602	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
KRT8	3856	hgsc.bcm.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	46	1		35	4	NM_001256282	0	0	96	96	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
RDH5	5959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56118170	56118170	+	Silent	SNP	A	A	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:56118170A>T	ENST00000257895.5	+	5	950	c.798A>T	c.(796-798)cgA>cgT	p.R266R	RP11-644F5.10_ENST00000550412.1_3'UTR|RDH5_ENST00000548082.1_Silent_p.R266R|RDH5_ENST00000547072.1_Silent_p.R169R	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	266					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	AGGTGAGCCGATGCCTGGAGC	0.592											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R266R		.											.	RDH5-91	0			c.A798T						.						153.0	129.0	137.0					12																	56118170		2203	4300	6503	SO:0001819	synonymous_variant	5959	exon5			GAGCCGATGCCTG	U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.798A>T	12.37:g.56118170A>T		162	1	1013	137	36	NM_001199771	0	0	298	431	133	O00179|Q8TAI2	Silent	SNP	ENST00000257895.5	37	CCDS31829.1																																																																																			.		0.592	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407493.1	NM_002905	
NACA	4666	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	57114205	57114205	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:57114205G>A	ENST00000454682.1	-	3	1390	c.1109C>T	c.(1108-1110)aCt>aTt	p.T370I	NACA_ENST00000356769.3_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Missense_Mutation_p.T370I|NACA_ENST00000552540.1_Intron|NACA_ENST00000551793.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	370	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GGCAGCCACAGTAGCAGGAAC	0.488			T	BCL6	NHL																																p.T370I		.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA-254	0			c.C1109T						.						60.0	55.0	56.0					12																	57114205		1568	3582	5150	SO:0001583	missense	4666	exon3			GCCACAGTAGCAG	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.1109C>T	12.37:g.57114205G>A	ENSP00000403817:p.Thr370Ile	42	0		46	27	NM_001113203	0	0	0	0	0		Missense_Mutation	SNP	ENST00000454682.1	37		.	.	.	.	.	.	.	.	.	.	G	14.65	2.598833	0.46318	.	.	ENSG00000196531	ENST00000454682;ENST00000550952	T;T	0.47869	0.83;0.9	3.29	3.29	0.37713	.	.	.	.	.	T	0.23171	0.0560	N	0.08118	0	0.09310	N	1	P;B	0.38978	0.652;0.358	B;B	0.30943	0.122;0.117	T	0.03750	-1.1007	9	0.26408	T	0.33	.	10.4563	0.44553	0.0:0.0:1.0:0.0	.	370;370	E9PAV3;F8VU71	.;.	I	370	ENSP00000403817:T370I;ENSP00000448035:T370I	ENSP00000403817:T370I	T	-	2	0	NACA	55400472	0.001000	0.12720	0.018000	0.16275	0.537000	0.34900	0.083000	0.14871	1.569000	0.49696	0.306000	0.20318	ACT	.		0.488	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
MBD6	114785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57918527	57918527	+	Silent	SNP	C	C	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:57918527C>A	ENST00000355673.3	+	4	494	c.138C>A	c.(136-138)tcC>tcA	p.S46S	MBD6_ENST00000431731.2_Silent_p.S46S|MBD6_ENST00000549231.1_3'UTR	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	46	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AGCTGTCTTCCTTGGAGCAAA	0.572																																					p.S46S		.											.	MBD6-516	0			c.C138A						.						83.0	76.0	78.0					12																	57918527		2203	4300	6503	SO:0001819	synonymous_variant	114785	exon4			GTCTTCCTTGGAG	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.138C>A	12.37:g.57918527C>A		106	0		132	45	NM_052897	0	0	12	15	3	Q8N3M0|Q8NA81|Q96Q00	Silent	SNP	ENST00000355673.3	37	CCDS8944.1																																																																																			.		0.572	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
WDR66	144406	broad.mit.edu	37	12	122398516	122398516	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr12:122398516A>G	ENST00000288912.4	+	14	3013	c.2159A>G	c.(2158-2160)tAc>tGc	p.Y720C	WDR66_ENST00000397454.2_Missense_Mutation_p.Y720C	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	720							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		GTGGCTGTTTACATGCTGGTG	0.433																																					p.Y720C	Esophageal Squamous(85;849 1794 49757 52143)												.	WDR66-92	0			c.A2159G						.						124.0	123.0	123.0					12																	122398516		1926	4142	6068	SO:0001583	missense	144406	exon14			CTGTTTACATGCT	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2159A>G	12.37:g.122398516A>G	ENSP00000288912:p.Tyr720Cys	143	0		194	3	NM_001178003	1	0	2	3	0	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	37	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.768449	0.49680	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.67345	0.86;-0.26	4.72	3.54	0.40534	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.136662	0.51477	D	0.000098	T	0.79009	0.4374	M	0.78916	2.43	0.35226	D	0.776497	D	0.89917	1.0	D	0.77557	0.99	D	0.83490	0.0069	10	0.87932	D	0	.	8.7806	0.34789	0.6981:0.0:0.0:0.3019	.	720	Q8TBY9	WDR66_HUMAN	C	720	ENSP00000288912:Y720C;ENSP00000380595:Y720C	ENSP00000288912:Y720C	Y	+	2	0	WDR66	120882899	1.000000	0.71417	0.021000	0.16686	0.016000	0.09150	4.265000	0.58865	0.717000	0.32145	0.533000	0.62120	TAC	.		0.433	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
MIR487A	619555	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	101521660	101521660	+	RNA	SNP	C	C	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr14:101521660C>G	ENST00000384827.1	+	0	80				MIR134_ENST00000385258.2_RNA|MIR382_ENST00000385009.2_RNA|MIR323B_ENST00000385269.2_RNA|MIR485_ENST00000385292.2_RNA	NR_030162.1				microRNA 487a																		GGCCCACTACCCAATACTATC	0.562																																					.													.	.	0			.						.						105.0	96.0	99.0					14																	101521660		1568	3582	5150			768214	.			CACTACCCAATAC			14q32.31	2011-09-12	2006-02-23	2008-12-18	ENSG00000207558	ENSG00000207558		"""ncRNAs / Micro RNAs"""	32343	non-coding RNA	RNA, micro			"""microRNA 487"""	MIRN487, MIRN487A			Standard	NR_030162		Approved	hsa-mir-487, hsa-mir-487a	uc021sdk.1				14.37:g.101521660C>G		66	0		80	22	.	0	0	0	0	0		RNA	SNP	ENST00000384827.1	37																																																																																				.		0.562	MIR487A-201	KNOWN	basic	miRNA	miRNA		NR_030162	
THBS1	7057	hgsc.bcm.edu	37	15	39880743	39880743	+	Silent	SNP	T	T	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr15:39880743T>G	ENST00000260356.5	+	10	1653	c.1488T>G	c.(1486-1488)ggT>ggG	p.G496G		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	496	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GAGGCTGGGGTCCTTGGTCAC	0.507																																					p.G496G		.											.	THBS1-653	0			c.T1488G						.						66.0	66.0	66.0					15																	39880743		2200	4297	6497	SO:0001819	synonymous_variant	7057	exon10			CTGGGGTCCTTGG		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1488T>G	15.37:g.39880743T>G		65	2		95	5	NM_003246	0	0	1	1	0	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	37	CCDS32194.1																																																																																			.		0.507	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
UBR1	197131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43299382	43299382	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr15:43299382C>T	ENST00000290650.4	-	30	3388	c.3310G>A	c.(3310-3312)Gaa>Aaa	p.E1104K	UBR1_ENST00000382177.2_3'UTR|UBR1_ENST00000568782.1_5'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1104					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ACCTCCTGTTCTTCTTGGCAA	0.473																																					p.E1104K		.											.	UBR1-91	0			c.G3310A						.						128.0	115.0	119.0					15																	43299382		2203	4299	6502	SO:0001583	missense	197131	exon30			CCTGTTCTTCTTG		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3310G>A	15.37:g.43299382C>T	ENSP00000290650:p.Glu1104Lys	121	0		137	49	NM_174916	0	0	0	0	0	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	34	5.388214	0.95988	.	.	ENSG00000159459	ENST00000290650	T	0.55760	0.5	4.99	4.99	0.66335	Zinc finger, RING/FYVE/PHD-type (1);	0.050391	0.85682	D	0.000000	T	0.71829	0.3386	M	0.71206	2.165	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.71066	-0.4700	10	0.40728	T	0.16	-8.6741	18.4574	0.90725	0.0:1.0:0.0:0.0	.	1104	Q8IWV7	UBR1_HUMAN	K	1104	ENSP00000290650:E1104K	ENSP00000290650:E1104K	E	-	1	0	UBR1	41086674	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.320000	0.79064	2.593000	0.87608	0.655000	0.94253	GAA	.		0.473	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
SPG11	80208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44951365	44951365	+	Silent	SNP	A	A	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr15:44951365A>T	ENST00000261866.7	-	3	595	c.579T>A	c.(577-579)ctT>ctA	p.L193L	SPG11_ENST00000535302.2_Silent_p.L193L|SPG11_ENST00000558319.1_Silent_p.L193L|SPG11_ENST00000559193.1_Silent_p.L193L|SPG11_ENST00000427534.2_Silent_p.L193L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	193					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CAGGCAAGGGAAGTGTGAAAC	0.398																																					p.L193L		.											.	SPG11-95	0			c.T579A						.						136.0	135.0	135.0					15																	44951365		2198	4298	6496	SO:0001819	synonymous_variant	80208	exon3			CAAGGGAAGTGTG		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.579T>A	15.37:g.44951365A>T		144	1		155	56	NM_025137	0	0	0	0	0	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1																																																																																			.		0.398	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
PKD1	5310	hgsc.bcm.edu	37	16	2155892	2155892	+	Silent	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:2155892A>G	ENST00000262304.4	-	20	8045	c.7837T>C	c.(7837-7839)Ttg>Ctg	p.L2613L	PKD1_ENST00000561991.1_5'UTR|PKD1_ENST00000423118.1_Silent_p.L2613L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2613	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.		Missing (in PKD1; unknown pathological significance). {ECO:0000269|PubMed:11571556}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2613L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACCAGGGCCAACGAGTACTCG	0.657																																					p.L2613L		.											.	PKD1-91	1	Substitution - coding silent(1)	lung(1)	c.T7837C						.						46.0	45.0	45.0					16																	2155892		1400	2465	3865	SO:0001819	synonymous_variant	5310	exon20			GGGCCAACGAGTA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7837T>C	16.37:g.2155892A>G		44	0		36	4	NM_000296	0	0	2	3	1	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.657	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
C16orf70	80262	broad.mit.edu;bcgsc.ca	37	16	67184131	67184131	+	IGR	SNP	G	G	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:67184131G>C	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Silent_p.R86R	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		CGCGCAAATAGCGGGCGAAGT	0.706																																					p.R86R													.	.	0			c.C258G						.						12.0	15.0	14.0					16																	67184131		1877	4071	5948	SO:0001628	intergenic_variant	84752	exon2			CAAATAGCGGGCG	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67184131G>C		21	0		17	5	NM_033309	0	0	0	1	1	Q9HA86	Silent	SNP	ENST00000219139.3	37	CCDS10828.1																																																																																			.		0.706	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
ZFHX3	463	hgsc.bcm.edu	37	16	72992635	72992635	+	Silent	SNP	T	T	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:72992635T>C	ENST00000268489.5	-	2	2082	c.1410A>G	c.(1408-1410)gaA>gaG	p.E470E	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	470	Poly-Glu.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cctccgcctcttcctcctcct	0.587																																					p.E470E		.											.	ZFHX3-72	0			c.A1410G						.						38.0	42.0	40.0					16																	72992635		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			CGCCTCTTCCTCC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1410A>G	16.37:g.72992635T>C		61	0		36	4	NM_006885	0	0	0	0	0	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			T|1.000;C|0.000		0.587	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	72992638	72992638	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:72992638C>T	ENST00000268489.5	-	2	2079	c.1407G>A	c.(1405-1407)gaG>gaA	p.E469E	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	469	Poly-Glu.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				ccgcctcttcctcctcctctt	0.587																																					p.E469E		.											.	ZFHX3-72	0			c.G1407A						.						38.0	41.0	40.0					16																	72992638		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			CTCTTCCTCCTCC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1407G>A	16.37:g.72992638C>T		59	0		38	9	NM_006885	0	0	0	0	0	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.587	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
OR1E1	8387	broad.mit.edu	37	17	3301701	3301701	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:3301701T>C	ENST00000322608.2	-	1	3	c.4A>G	c.(4-6)Atg>Gtg	p.M2V		NM_003553.2	NP_003544.2	P30953	OR1E1_HUMAN	olfactory receptor, family 1, subfamily E, member 1	2					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(2)|lung(5)	10						TTTTGTCCCATCATGCTCTGT	0.438																																					p.M2V													.	OR1E1-68	0			c.A4G						.						58.0	59.0	58.0					17																	3301701		2202	4300	6502	SO:0001583	missense	8387	exon1			GTCCCATCATGCT	U04642	CCDS11024.1	17p13.3	2012-08-09			ENSG00000180016	ENSG00000180016		"""GPCR / Class A : Olfactory receptors"""	8189	protein-coding gene	gene with protein product				OR1E9P, OR1E5, OR1E6		8004088, 1370859	Standard	NM_003553		Approved	OR17-2, HGM071, OR17-32, OR13-66	uc002fvj.1	P30953	OTTHUMG00000090643	ENST00000322608.2:c.4A>G	17.37:g.3301701T>C	ENSP00000313384:p.Met2Val	141	0		264	3	NM_003553	0	0	0	0	0	O43884|P47882|P47885|Q6IFA9|Q6IFM5|Q9UBJ1|Q9UM60	Missense_Mutation	SNP	ENST00000322608.2	37	CCDS11024.1	.	.	.	.	.	.	.	.	.	.	T	3.178	-0.168613	0.06461	.	.	ENSG00000180016	ENST00000322608	T	0.00573	6.48	3.26	0.843	0.18935	.	1.550200	0.03385	N	0.200962	T	0.00440	0.0014	N	0.10685	0.025	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45600	-0.9250	10	0.59425	D	0.04	.	3.8262	0.08855	0.2176:0.0:0.2254:0.557	.	2	P30953	OR1E1_HUMAN	V	2	ENSP00000313384:M2V	ENSP00000313384:M2V	M	-	1	0	OR1E1	3248451	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.362000	0.07602	0.134000	0.18681	0.456000	0.33151	ATG	.		0.438	OR1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207303.1	NM_003553	
MYH10	4628	broad.mit.edu	37	17	8416922	8416922	+	Silent	SNP	C	C	T	rs375330015		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:8416922C>T	ENST00000269243.4	-	21	2724	c.2586G>A	c.(2584-2586)ttG>ttA	p.L862L	MYH10_ENST00000396239.1_Silent_p.L883L|MYH10_ENST00000360416.3_Silent_p.L893L|MYH10_ENST00000379980.4_Silent_p.L878L|RNU7-43P_ENST00000516554.1_RNA	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	862					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CCTTCACCTTCAACAGCTCTT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		19613	0.001		0.0	False		,,,				2504	0.0				p.L893L													.	MYH10-92	0			c.G2679A						.	C		1,4405	4.2+/-10.8	0,1,2202	202.0	168.0	179.0		2586	4.2	1.0	17		179	0,8600		0,0,4300	no	coding-synonymous	MYH10	NM_005964.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		862/1977	8416922	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4628	exon23			CACCTTCAACAGC	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.2586G>A	17.37:g.8416922C>T		186	0		355	13	NM_001256012	0	0	4	4	0	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																			.		0.483	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MPRIP	23164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17030034	17030034	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:17030034G>A	ENST00000341712.4	+	4	286	c.286G>A	c.(286-288)Ggc>Agc	p.G96S	MPRIP_ENST00000395811.5_Missense_Mutation_p.G96S|MPRIP_ENST00000444976.1_Missense_Mutation_p.G96S|MPRIP_ENST00000395804.3_Missense_Mutation_p.G96S			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	96	Interaction with F-actin. {ECO:0000250}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						CCTTCCTCAGGGCACCATCAA	0.602																																					p.G96S		.											.	MPRIP-90	0			c.G286A						.						80.0	73.0	75.0					17																	17030034		2203	4300	6503	SO:0001583	missense	23164	exon4			CCTCAGGGCACCA	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.286G>A	17.37:g.17030034G>A	ENSP00000342379:p.Gly96Ser	96	0		127	36	NM_015134	0	0	13	21	8	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	33	5.203730	0.95033	.	.	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73	5.59	5.59	0.84812	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	D	0.97826	0.9286	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.993	D	0.98164	1.0448	9	0.66056	D	0.02	.	19.5944	0.95530	0.0:0.0:1.0:0.0	.	96;96	Q6WCQ1-2;Q6WCQ1	.;MPRIP_HUMAN	S	96	ENSP00000400189:G96S;ENSP00000379156:G96S;ENSP00000379149:G96S;ENSP00000342379:G96S	ENSP00000342379:G96S	G	+	1	0	MPRIP	16970759	1.000000	0.71417	0.993000	0.49108	0.756000	0.42949	9.414000	0.97362	2.642000	0.89623	0.561000	0.74099	GGC	.		0.602	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
PHF12	57649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27251080	27251080	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:27251080T>A	ENST00000332830.4	-	4	1372	c.562A>T	c.(562-564)Att>Ttt	p.I188F	RP11-20B24.5_ENST00000580782.1_RNA|RP11-20B24.5_ENST00000582631.1_RNA|PHF12_ENST00000577226.1_Missense_Mutation_p.I188F|PHF12_ENST00000268756.3_Missense_Mutation_p.I188F|PHF12_ENST00000582655.1_5'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TCCACGTCAATGATGTCTTCG	0.602																																					p.I188F		.											.	PHF12-91	0			c.A562T						.						83.0	65.0	71.0					17																	27251080		2203	4300	6503	SO:0001583	missense	57649	exon4			CGTCAATGATGTC	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.562A>T	17.37:g.27251080T>A	ENSP00000329933:p.Ile188Phe	63	0		89	51	NM_020889	0	0	4	7	3		Missense_Mutation	SNP	ENST00000332830.4	37	CCDS32598.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962952	0.53507	.	.	ENSG00000109118	ENST00000332830;ENST00000378879;ENST00000268756	D;D;D	0.94793	-3.48;-3.52;-3.52	5.8	4.72	0.59763	.	0.213282	0.49305	D	0.000141	D	0.93527	0.7934	L	0.44542	1.39	0.46260	D	0.998956	D;D;B;D	0.57899	0.968;0.981;0.437;0.968	P;P;B;P	0.54026	0.474;0.74;0.068;0.474	D	0.91577	0.5276	10	0.36615	T	0.2	-19.0128	10.4673	0.44616	0.0:0.0766:0.0:0.9234	.	170;188;188;188	B4DFE2;Q96QT6-2;Q2TAK2;Q96QT6	.;.;.;PHF12_HUMAN	F	188	ENSP00000329933:I188F;ENSP00000368157:I188F;ENSP00000268756:I188F	ENSP00000268756:I188F	I	-	1	0	PHF12	24275206	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.241000	0.43097	1.031000	0.39867	0.533000	0.62120	ATT	.		0.602	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	NM_020889	
KRT17	3872	broad.mit.edu	37	17	39777877	39777877	+	Missense_Mutation	SNP	G	G	T	rs560576342		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:39777877G>T	ENST00000311208.8	-	4	869	c.802C>A	c.(802-804)Cgc>Agc	p.R268S	JUP_ENST00000540235.1_Missense_Mutation_p.R427S	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	268	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				GCATCCTTGCGGTTCTTCTCT	0.592																																					p.R268S	Pancreas(92;1242 2086 39193 50508)												.	KRT17-92	0			c.C802A						.						113.0	100.0	105.0					17																	39777877		2203	4298	6501	SO:0001583	missense	3872	exon4			CCTTGCGGTTCTT	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.802C>A	17.37:g.39777877G>T	ENSP00000308452:p.Arg268Ser	153	0		197	8	NM_000422	0	0	0	0	0	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	37	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376396	0.82682	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	D;D	0.89681	-2.55;-2.55	3.82	3.82	0.43975	Prefoldin (1);Filament (1);	0.000000	0.47852	D	0.000202	D	0.95890	0.8662	H	0.95114	3.625	0.38398	D	0.94557	D	0.62365	0.991	D	0.68943	0.961	D	0.98465	1.0598	10	0.87932	D	0	.	16.2789	0.82658	0.0:0.0:1.0:0.0	.	268	Q04695	K1C17_HUMAN	S	268;427	ENSP00000308452:R268S;ENSP00000441751:R427S	ENSP00000441751:R427S	R	-	1	0	JUP;KRT17	37031403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.624000	0.54231	2.135000	0.66039	0.655000	0.94253	CGC	.		0.592	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
GJC1	10052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42882624	42882624	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:42882624C>G	ENST00000426548.1	-	3	831	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	GJC1_ENST00000592524.1_Missense_Mutation_p.E188Q|GJC1_ENST00000590758.1_Missense_Mutation_p.E188Q|GJC1_ENST00000330514.4_Missense_Mutation_p.E188Q	NM_001080383.1|NM_005497.3	NP_001073852.1|NP_005488.2	P36383	CXG1_HUMAN	gap junction protein, gamma 1, 45kDa	188					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle tissue development (GO:0048738)|cell development (GO:0048468)|cell-cell junction assembly (GO:0007043)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vasculogenesis (GO:0001570)|visual perception (GO:0007601)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion channel activity (GO:0005216)			NS(1)|kidney(1)|large_intestine(5)|liver(1)|lung(10)|prostate(1)	19		Prostate(33;0.0959)				AAACCCACCTCAAACACGGTC	0.493																																					p.E188Q		.											.	GJC1-248	0			c.G562C						.						188.0	173.0	178.0					17																	42882624		2203	4300	6503	SO:0001583	missense	10052	exon3			CCACCTCAAACAC	U03493	CCDS11487.1	17q21.31	2008-02-04	2007-11-06	2007-11-06		ENSG00000182963		"""Ion channels / Gap junction proteins (connexins)"""	4280	protein-coding gene	gene with protein product	"""connexin 45"""	608655	"""gap junction protein, alpha 7, 45kDa"""	GJA7		7966354	Standard	NM_005497		Approved	CX45	uc002ihl.3	P36383		ENST00000426548.1:c.562G>C	17.37:g.42882624C>G	ENSP00000411528:p.Glu188Gln	219	0		358	131	NM_005497	0	0	0	0	0	B3KW68|Q4VAY0	Missense_Mutation	SNP	ENST00000426548.1	37	CCDS11487.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201522	0.79015	.	.	ENSG00000182963	ENST00000426548;ENST00000330514	D;D	0.97850	-4.57;-4.57	5.52	5.52	0.82312	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98674	1.0689	10	0.87932	D	0	.	18.419	0.90582	0.0:1.0:0.0:0.0	.	188	P36383	CXG1_HUMAN	Q	188	ENSP00000411528:E188Q;ENSP00000333193:E188Q	ENSP00000333193:E188Q	E	-	1	0	GJC1	40238150	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.805000	0.86005	2.581000	0.87130	0.514000	0.50259	GAG	.		0.493	GJC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448661.1	NM_005497	
SAMD14	201191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48190273	48190273	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:48190273T>G	ENST00000330175.4	-	10	1555	c.1238A>C	c.(1237-1239)gAg>gCg	p.E413A	SAMD14_ENST00000503131.1_Missense_Mutation_p.E441A	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	413										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						CTTCTTGGCCTCCTGCTCTCG	0.697																																					p.E441A		.											.	SAMD14-68	0			c.A1322C						.						40.0	43.0	42.0					17																	48190273		2203	4300	6503	SO:0001583	missense	201191	exon11			TTGGCCTCCTGCT		CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.1238A>C	17.37:g.48190273T>G	ENSP00000329144:p.Glu413Ala	102	0		133	51	NM_174920	0	0	34	78	44	A5D8V1|Q8N2X0	Missense_Mutation	SNP	ENST00000330175.4	37	CCDS58562.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134428	0.56828	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	.	.	.	5.11	4.02	0.46733	.	0.370723	0.24490	N	0.038069	T	0.47544	0.1451	L	0.27053	0.805	0.27885	N	0.939546	D;B	0.63880	0.993;0.137	D;B	0.68192	0.956;0.046	T	0.37911	-0.9685	9	0.59425	D	0.04	-11.4398	10.0803	0.42386	0.0:0.0:0.1686:0.8313	.	413;441	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	A	413;425;441	.	ENSP00000285206:E425A	E	-	2	0	SAMD14	45545272	0.996000	0.38824	1.000000	0.80357	0.862000	0.49288	2.701000	0.47094	0.773000	0.33404	0.379000	0.24179	GAG	.		0.697	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366661.1	NM_174920	
CACNA1G	8913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48669448	48669448	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:48669448G>A	ENST00000359106.5	+	13	2905	c.2905G>A	c.(2905-2907)Gcg>Acg	p.A969T	CACNA1G_ENST00000507336.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A969T|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000515411.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A969T|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A969T|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A969T|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A969T|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A969T|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000358244.5_Missense_Mutation_p.A969T|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A969T|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A969T|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A969T	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	969					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGGCTTCCAGGCGGAGGTAAC	0.582																																					p.A969T		.											.	CACNA1G-67	0			c.G2905A						.						50.0	55.0	53.0					17																	48669448		2071	4210	6281	SO:0001583	missense	8913	exon13			TTCCAGGCGGAGG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.2905G>A	17.37:g.48669448G>A	ENSP00000352011:p.Ala969Thr	59	0		96	40	NM_001256360	0	0	0	0	0	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	g	14.26	2.482345	0.44147	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97186	-4.13;-4.12;-4.28;-4.08;-4.13;-4.12;-4.16;-4.26;-4.22;-4.24;-4.25;-4.11;-4.12;-4.2;-4.12;-4.07;-4.16;-4.12;-4.12;-4.16;-4.12;-4.12;-4.16;-4.11;-4.16;-4.17	5.08	1.63	0.23807	.	0.106565	0.64402	N	0.000006	D	0.88142	0.6357	N	0.02916	-0.46	0.33790	D	0.625335	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.22080	0.064;0.0;0.0;0.0;0.0;0.001;0.001;0.0;0.001;0.019;0.0;0.001;0.002;0.0;0.001;0.001;0.007;0.0;0.0;0.001;0.001;0.002;0.0;0.001;0.001;0.013	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.25987	0.017;0.005;0.001;0.005;0.001;0.006;0.004;0.001;0.004;0.013;0.001;0.017;0.02;0.001;0.004;0.007;0.029;0.005;0.001;0.008;0.003;0.007;0.001;0.007;0.001;0.065	T	0.82715	-0.0320	10	0.23891	T	0.37	.	5.465	0.16637	0.6206:0.0:0.3794:0.0	.	969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969;969	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	T	969	ENSP00000353990:A969T;ENSP00000339302:A969T;ENSP00000392390:A969T;ENSP00000347078:A969T;ENSP00000409759:A969T;ENSP00000425522:A969T;ENSP00000426261:A969T;ENSP00000425451:A969T;ENSP00000422407:A969T;ENSP00000426814:A969T;ENSP00000427238:A969T;ENSP00000423112:A969T;ENSP00000420918:A969T;ENSP00000426172:A969T;ENSP00000423045:A969T;ENSP00000427173:A969T;ENSP00000426098:A969T;ENSP00000425698:A969T;ENSP00000426232:A969T;ENSP00000423317:A969T;ENSP00000350979:A969T;ENSP00000352011:A969T;ENSP00000414388:A969T;ENSP00000423155:A969T;ENSP00000422268:A969T;ENSP00000421518:A969T	ENSP00000339302:A969T	A	+	1	0	CACNA1G	46024447	1.000000	0.71417	0.982000	0.44146	0.980000	0.70556	2.660000	0.46749	0.553000	0.29044	0.462000	0.41574	GCG	.		0.582	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
VEZF1	7716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56060465	56060465	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr17:56060465G>T	ENST00000581208.1	-	2	363	c.323C>A	c.(322-324)aCc>aAc	p.T108N	VEZF1_ENST00000584396.1_Missense_Mutation_p.T99N	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	108					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						CGTGGTGGGGGTTTTCTTTGG	0.547																																					p.T108N		.											.	VEZF1-136	0			c.C323A						.						91.0	91.0	91.0					17																	56060465		2203	4300	6503	SO:0001583	missense	7716	exon2			GTGGGGGTTTTCT	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.323C>A	17.37:g.56060465G>T	ENSP00000462337:p.Thr108Asn	131	1		146	61	NM_007146	0	0	1	1	0		Missense_Mutation	SNP	ENST00000581208.1	37	CCDS32687.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033269	0.54896	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.52092	0.1713	L	0.27053	0.805	0.80722	D	1	P	0.49185	0.92	B	0.44085	0.44	T	0.58142	-0.7688	9	0.66056	D	0.02	-9.6184	19.3617	0.94442	0.0:0.0:1.0:0.0	.	108	Q14119	VEZF1_HUMAN	N	108	.	ENSP00000258963:T108N	T	-	2	0	VEZF1	53415464	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.196000	0.94978	2.590000	0.87494	0.643000	0.83706	ACC	.		0.547	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
DYM	54808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	46645145	46645145	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr18:46645145G>A	ENST00000269445.6	-	15	2172	c.1715C>T	c.(1714-1716)tCa>tTa	p.S572L	DYM_ENST00000442713.2_Missense_Mutation_p.S382L|RP11-15F12.3_ENST00000585251.1_RNA	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	572					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						ATCCTGAAATGAAGGATGAGT	0.353																																					p.S572L		.											.	DYM-226	0			c.C1715T						.						136.0	120.0	126.0					18																	46645145		2203	4300	6503	SO:0001583	missense	54808	exon15			TGAAATGAAGGAT	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1715C>T	18.37:g.46645145G>A	ENSP00000269445:p.Ser572Leu	63	0		70	22	NM_017653	0	0	2	5	3	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	37	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094436	0.94149	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	D;D	0.81908	-1.55;-1.55	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.86981	0.6064	L	0.48362	1.52	0.80722	D	1	P;D;P	0.56287	0.879;0.975;0.481	B;P;B	0.56648	0.399;0.803;0.22	D	0.87691	0.2554	10	0.66056	D	0.02	-11.3305	19.412	0.94677	0.0:0.0:1.0:0.0	.	382;394;572	Q7RTS9-2;Q9NXS9;Q7RTS9	.;.;DYM_HUMAN	L	382;572	ENSP00000395942:S382L;ENSP00000269445:S572L	ENSP00000269445:S572L	S	-	2	0	DYM	44899143	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.827000	0.99397	2.601000	0.87937	0.650000	0.86243	TCA	.		0.353	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
TMPRSS9	360200	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2408353	2408353	+	Splice_Site	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:2408353G>A	ENST00000332578.3	+	7	740		c.e7-1			NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTCCTGCAGGTTCCAAGAC	0.652																																					.													.	TMPRSS9-91	0			c.741-1G>A						.						45.0	44.0	44.0					19																	2408353		2203	4300	6503	SO:0001630	splice_region_variant	360200	exon7			CCTGCAGGTTCCA	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.741-1G>A	19.37:g.2408353G>A		61	0		59	7	NM_182973	0	0	0	0	0	Q6ZND6|Q7Z411	Splice_Site	SNP	ENST00000332578.3	37	CCDS12088.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918286	0.33908	.	.	ENSG00000178297	ENST00000395264;ENST00000332578	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6211	0.76808	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMPRSS9	2359353	1.000000	0.71417	0.797000	0.32132	0.227000	0.25037	8.627000	0.90974	2.039000	0.60335	0.491000	0.48974	.	.		0.652	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	Intron
SSBP4	170463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18538728	18538728	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:18538728G>A	ENST00000270061.7	+	4	509	c.215G>A	c.(214-216)tGc>tAc	p.C72Y	SSBP4_ENST00000348495.6_Missense_Mutation_p.C72Y|SSBP4_ENST00000598159.2_3'UTR	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	72						nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						GACCTGTACTGCGCGGCGCCT	0.667																																					p.C72Y		.											.	SSBP4-90	0			c.G215A						.						77.0	70.0	72.0					19																	18538728		2203	4300	6503	SO:0001583	missense	170463	exon4			TGTACTGCGCGGC		CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.215G>A	19.37:g.18538728G>A	ENSP00000270061:p.Cys72Tyr	163	0		107	40	NM_001009998	0	0	25	43	18	Q9BWW5	Missense_Mutation	SNP	ENST00000270061.7	37	CCDS12378.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288142	0.40494	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	3.7	3.7	0.42460	.	0.000000	0.85682	U	0.000000	T	0.58921	0.2156	L	0.57536	1.79	0.58432	D	0.999999	B;B	0.25048	0.048;0.117	B;B	0.27715	0.077;0.082	T	0.64193	-0.6465	9	0.72032	D	0.01	-16.1844	12.9926	0.58627	0.0:0.0:1.0:0.0	.	72;72	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	Y	72	.	ENSP00000270061:C72Y	C	+	2	0	SSBP4	18399728	1.000000	0.71417	0.932000	0.37286	0.036000	0.12997	8.730000	0.91510	1.883000	0.54544	0.561000	0.74099	TGC	.		0.667	SSBP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466348.3	NM_032627	
SLC25A42	284439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19218750	19218750	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:19218750G>T	ENST00000318596.7	+	7	696	c.545G>T	c.(544-546)gGg>gTg	p.G182V	SLC25A42_ENST00000600275.1_3'UTR	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	182					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			AGAGAAGAGGGGCTGAAGACT	0.572																																					p.G182V		.											.	SLC25A42-90	0			c.G545T						.						119.0	105.0	110.0					19																	19218750		2203	4300	6503	SO:0001583	missense	284439	exon7			AAGAGGGGCTGAA		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.545G>T	19.37:g.19218750G>T	ENSP00000326693:p.Gly182Val	139	0		134	51	NM_178526	0	0	1	8	7	D2T2J5|O14553|O43378	Missense_Mutation	SNP	ENST00000318596.7	37	CCDS32966.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441353	0.83993	.	.	ENSG00000181035	ENST00000318596	D	0.95238	-3.65	5.26	5.26	0.73747	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.98701	0.9564	H	0.99435	4.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99686	1.1000	10	0.87932	D	0	-10.1963	17.8525	0.88751	0.0:0.0:1.0:0.0	.	182	Q86VD7	S2542_HUMAN	V	182	ENSP00000326693:G182V	ENSP00000326693:G182V	G	+	2	0	SLC25A42	19079750	1.000000	0.71417	0.987000	0.45799	0.753000	0.42808	8.259000	0.89855	2.449000	0.82847	0.491000	0.48974	GGG	.		0.572	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
ZNF254	9534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	24310237	24310237	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:24310237A>T	ENST00000357002.4	+	4	1550	c.1435A>T	c.(1435-1437)Aga>Tga	p.R479*	ZNF254_ENST00000342944.6_Nonsense_Mutation_p.R394*	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	479					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AACCCTAACTAGACATAAGAG	0.388																																					p.R479X		.											.	ZNF254-90	0			c.A1435T						.						62.0	62.0	62.0					19																	24310237		2203	4299	6502	SO:0001587	stop_gained	9534	exon4			CTAACTAGACATA	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1435A>T	19.37:g.24310237A>T	ENSP00000349494:p.Arg479*	107	0		74	21	NM_203282	0	0	0	3	3	A4QPC0|Q86XL7	Nonsense_Mutation	SNP	ENST00000357002.4	37	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	A	35	5.491375	0.96339	.	.	ENSG00000213096	ENST00000342944;ENST00000357002	.	.	.	1.07	-2.07	0.07276	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	3.7155	0.08437	0.6048:0.3952:0.0:0.0	.	.	.	.	X	394;479	.	ENSP00000445527:R394X	R	+	1	2	ZNF254	24102077	0.000000	0.05858	0.040000	0.18447	0.918000	0.54935	-0.462000	0.06704	-0.565000	0.06061	0.248000	0.18094	AGA	.		0.388	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
SPINT2	10653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38774304	38774304	+	Silent	SNP	G	G	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:38774304G>T	ENST00000301244.7	+	2	579	c.144G>T	c.(142-144)cgG>cgT	p.R48R	SPINT2_ENST00000587090.1_5'UTR|SPINT2_ENST00000454580.3_Intron	NM_021102.3	NP_066925.1	O43291	SPIT2_HUMAN	serine peptidase inhibitor, Kunitz type, 2	48	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.	Reactive bond. {ECO:0000250}.			cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)|lung(1)|ovary(1)	4	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GCAGATGCCGGGCCTCCATGC	0.562																																					p.R48R		.											.	SPINT2-90	0			c.G144T						.						170.0	144.0	153.0					19																	38774304		2203	4300	6503	SO:0001819	synonymous_variant	10653	exon2			ATGCCGGGCCTCC	U78095	CCDS12510.1, CCDS54261.1	19q13.2	2010-05-12	2005-08-17		ENSG00000167642	ENSG00000167642			11247	protein-coding gene	gene with protein product	"""placental bikunin"""	605124	"""serine protease inhibitor, Kunitz type, 2"""			9115294, 9346890	Standard	NM_021102		Approved	Kop, HAI-2	uc002ohr.2	O43291		ENST00000301244.7:c.144G>T	19.37:g.38774304G>T		211	0		208	55	NM_021102	0	0	37	73	36	A8K667|B4DLU1|O00271|O14895|Q5TZQ3|Q969E0	Silent	SNP	ENST00000301244.7	37	CCDS12510.1																																																																																			.		0.562	SPINT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458151.2		
CYP2S1	29785	broad.mit.edu	37	19	41712375	41712375	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:41712375C>T	ENST00000310054.4	+	9	1713	c.1497C>T	c.(1495-1497)tcC>tcT	p.S499S	CYP2S1_ENST00000542619.1_Silent_p.S224S	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	499					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						ACCTTCACTCCACCACGCAGA	0.607																																					p.S499S													.	CYP2S1-91	0			c.C1497T						.						99.0	92.0	95.0					19																	41712375		2203	4300	6503	SO:0001819	synonymous_variant	29785	exon9			TCACTCCACCACG	AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.1497C>T	19.37:g.41712375C>T		133	0		95	8	NM_030622	0	0	0	0	0	Q9BZ66	Silent	SNP	ENST00000310054.4	37	CCDS12573.1																																																																																			.		0.607	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		
ZNF471	57573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57037032	57037032	+	Silent	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:57037032A>G	ENST00000308031.5	+	5	1729	c.1596A>G	c.(1594-1596)caA>caG	p.Q532Q	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_3'UTR	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	532					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		ACCTTGCCCAACATCAGAAAA	0.398																																					p.Q532Q	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	.											.	ZNF471-154	0			c.A1596G						.						105.0	111.0	109.0					19																	57037032		2203	4300	6503	SO:0001819	synonymous_variant	57573	exon5			TGCCCAACATCAG	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1596A>G	19.37:g.57037032A>G		152	0		121	40	NM_020813	0	0	0	0	0	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Silent	SNP	ENST00000308031.5	37	CCDS12945.1																																																																																			.		0.398	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ADAM17	6868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	9645412	9645412	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:9645412T>G	ENST00000310823.3	-	12	1609	c.1427A>C	c.(1426-1428)aAa>aCa	p.K476T	RP11-400L8.2_ENST00000480764.1_RNA|RP11-400L8.2_ENST00000472619.1_RNA	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	476	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CCCACAAACTTTATTGCTGCG	0.438																																					p.K476T		.											.	ADAM17-659	0			c.A1427C						.						178.0	155.0	163.0					2																	9645412		2203	4300	6503	SO:0001583	missense	6868	exon12			CAAACTTTATTGC	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.1427A>C	2.37:g.9645412T>G	ENSP00000309968:p.Lys476Thr	120	0		154	72	NM_003183	0	0	0	1	1	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.056207	0.36277	.	.	ENSG00000151694	ENST00000310823	T	0.21191	2.02	5.66	3.33	0.38152	Blood coagulation inhibitor, Disintegrin (1);	0.226724	0.51477	D	0.000087	T	0.18718	0.0449	L	0.46670	1.46	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.03325	-1.1048	10	0.48119	T	0.1	.	9.5244	0.39156	0.0:0.1409:0.0:0.8591	.	476;476	B2RNB2;P78536	.;ADA17_HUMAN	T	476	ENSP00000309968:K476T	ENSP00000309968:K476T	K	-	2	0	ADAM17	9562863	1.000000	0.71417	0.994000	0.49952	0.915000	0.54546	3.947000	0.56652	0.444000	0.26612	0.460000	0.39030	AAA	.		0.438	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	21260848	21260848	+	Silent	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:21260848G>A	ENST00000233242.1	-	5	646	c.519C>T	c.(517-519)gcC>gcT	p.A173A	APOB_ENST00000399256.4_Silent_p.A173A	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	173	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACACTTGCTTGGCTTCTTCTG	0.458																																					p.A173A		.											.	APOB-175	0			c.C519T						.						128.0	129.0	129.0					2																	21260848		2203	4300	6503	SO:0001819	synonymous_variant	338	exon5			TTGCTTGGCTTCT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.519C>T	2.37:g.21260848G>A		140	0		173	94	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	24051776	24051776	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:24051776C>A	ENST00000238789.5	-	15	2105	c.1762G>T	c.(1762-1764)Gac>Tac	p.D588Y	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	588						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGATTCCAGTCCCTGGTATGG	0.333																																					p.D588Y		.											.	ATAD2B-68	0			c.G1762T						.						121.0	114.0	116.0					2																	24051776		1842	4090	5932	SO:0001583	missense	54454	exon15			TCCAGTCCCTGGT	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1762G>T	2.37:g.24051776C>A	ENSP00000238789:p.Asp588Tyr	97	0		138	59	NM_001242338	0	0	0	0	0	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944509	0.53079	.	.	ENSG00000119778	ENST00000238789;ENST00000458510	D;D	0.94931	-3.56;-1.77	4.7	4.7	0.59300	.	.	.	.	.	D	0.95023	0.8389	L	0.60957	1.885	0.49299	D	0.999776	D	0.54047	0.964	P	0.53912	0.737	D	0.95210	0.8324	9	0.72032	D	0.01	.	14.2998	0.66339	0.1494:0.8506:0.0:0.0	.	588	Q9ULI0	ATD2B_HUMAN	Y	588;26	ENSP00000238789:D588Y;ENSP00000392764:D26Y	ENSP00000238789:D588Y	D	-	1	0	ATAD2B	23905280	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.884000	0.56175	2.551000	0.86045	0.650000	0.86243	GAC	.		0.333	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
AGBL5	60509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27291539	27291539	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:27291539A>G	ENST00000360131.4	+	13	2441	c.2282A>G	c.(2281-2283)gAg>gGg	p.E761G		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	761					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACAAACCAGAGGCTGTCATG	0.512																																					p.E761G		.											.	AGBL5-154	0			c.A2282G						.						84.0	85.0	85.0					2																	27291539		2203	4300	6503	SO:0001583	missense	60509	exon13			AACCAGAGGCTGT	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2282A>G	2.37:g.27291539A>G	ENSP00000353249:p.Glu761Gly	117	0		180	52	NM_021831	0	0	12	20	8	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	A	10.83	1.459849	0.26248	.	.	ENSG00000084693	ENST00000360131	T	0.17370	2.28	5.61	4.46	0.54185	.	0.426245	0.25285	N	0.031768	T	0.10723	0.0262	N	0.19112	0.55	0.32634	N	0.521593	B	0.13145	0.007	B	0.09377	0.004	T	0.03641	-1.1017	10	0.87932	D	0	-0.026	7.4869	0.27439	0.9054:0.0:0.0946:0.0	.	761	Q8NDL9	CBPC5_HUMAN	G	761	ENSP00000353249:E761G	ENSP00000353249:E761G	E	+	2	0	AGBL5	27145043	1.000000	0.71417	1.000000	0.80357	0.237000	0.25408	2.781000	0.47750	2.123000	0.65237	0.459000	0.35465	GAG	.		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
PAX8	7849	bcgsc.ca	37	2	113984805	113984805	+	Silent	SNP	G	G	A	rs189229644	byFrequency	TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:113984805G>A	ENST00000429538.3	-	10	1310	c.1116C>T	c.(1114-1116)ccC>ccT	p.P372P	PAX8_ENST00000348715.5_Missense_Mutation_p.P346L|AC016683.6_ENST00000456685.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.P346L|PAX8_ENST00000397647.3_Intron|PAX8_ENST00000263335.7_Missense_Mutation_p.P269L	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	372					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						GTGGGTATCCGGGCAGCGTGG	0.612			T	PPARG	follicular thyroid		Thyroid dysgenesis						G|||	8	0.00159744	0.0	0.0043	5008	,	,		18400	0.004		0.0	False		,,,				2504	0.001				p.P346L	Ovarian(188;7 2067 9084 29802 29892)			Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8-684	0			c.C1037T						.						26.0	31.0	29.0					2																	113984805		2021	4167	6188	SO:0001819	synonymous_variant	7849	exon10			GTATCCGGGCAGC	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.1116C>T	2.37:g.113984805G>A		15	0		32	9	NM_013952	0	0	69	122	53	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	0|0	0.0|0.0	G|G	4.284|4.284	0.051899|0.051899	0.08291|0.08291	.|.	.|.	ENSG00000125618|ENSG00000125618	ENST00000263335;ENST00000348715;ENST00000263334|ENST00000465084;ENST00000468980	D;D;D|.	0.97976|.	-4.64;-4.55;-4.55|.	5.3|5.3	-2.97|-2.97	0.05530|0.05530	.|.	0.056682|.	0.64402|.	D|.	0.000001|.	T|T	0.25606|0.25606	0.0623|0.0623	.|.	.|.	.|.	0.31672|0.31672	N|N	0.644221|0.644221	B;B|.	0.09022|.	0.002;0.0|.	B;B|.	0.06405|.	0.002;0.0|.	T|T	0.41963|0.41963	-0.9479|-0.9479	9|4	0.25106|.	T|.	0.35|.	.|.	5.1393|5.1393	0.14950|0.14950	0.5248:0.0:0.2619:0.2132|0.5248:0.0:0.2619:0.2132	.|.	346;269|.	Q06710-3;Q06710-4|.	.;.|.	L|W	269;346;346|27;95	ENSP00000263335:P269L;ENSP00000314750:P346L;ENSP00000263334:P346L|.	ENSP00000263334:P346L|.	P|R	-|-	2|1	0|2	PAX8|PAX8	113701276|113701276	0.027000|0.027000	0.19231|0.19231	0.982000|0.982000	0.44146|0.44146	0.999000|0.999000	0.98932|0.98932	-1.187000|-1.187000	0.03067|0.03067	-0.463000|-0.463000	0.06973|0.06973	0.609000|0.609000	0.83330|0.83330	CCG|CGG	G|0.999;A|0.001		0.612	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
PKP4	8502	bcgsc.ca	37	2	159490676	159490676	+	Silent	SNP	G	G	T	rs200605632		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:159490676G>T	ENST00000389759.3	+	9	1549	c.1437G>T	c.(1435-1437)gcG>gcT	p.A479A	PKP4_ENST00000389757.3_Silent_p.A479A	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	479					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CTACCTACGCGGAGCCCTACA	0.458										HNSCC(62;0.18)																											p.A479A													.	PKP4-97	0			c.G1437T						.						124.0	126.0	125.0					2																	159490676		2203	4300	6503	SO:0001819	synonymous_variant	8502	exon9			CTACGCGGAGCCC	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1437G>T	2.37:g.159490676G>T		223	1		280	12	NM_001005476	0	0	4	4	0	Q86W91	Silent	SNP	ENST00000389759.3	37	CCDS33305.1																																																																																			G|0.999;A|0.000		0.458	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	218713795	218713795	+	Missense_Mutation	SNP	G	G	A	rs200862766		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:218713795G>A	ENST00000171887.4	-	17	1522	c.1070C>T	c.(1069-1071)aCg>aTg	p.T357M	TNS1_ENST00000430930.1_Missense_Mutation_p.T357M|TNS1_ENST00000419504.1_Missense_Mutation_p.T357M|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	357					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGGCCCCTGCGTGTGTCCCAC	0.577																																					p.T357M		.											.	TNS1-156	0			c.C1070T						.	G	MET/THR	0,4406		0,0,2203	89.0	89.0	89.0		1070	4.3	1.0	2		89	2,8598	2.2+/-6.3	0,2,4298	no	missense	TNS1	NM_022648.4	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	357/1736	218713795	2,13004	2203	4300	6503	SO:0001583	missense	7145	exon17			CCCTGCGTGTGTC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1070C>T	2.37:g.218713795G>A	ENSP00000171887:p.Thr357Met	189	0		198	38	NM_022648	0	0	1	1	0	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464168	0.63513	0.0	2.33E-4	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554	D;D;D;D;D	0.96334	-3.5;-3.49;-3.51;-3.83;-3.98	5.22	4.34	0.51931	.	0.767219	0.12422	N	0.470300	D	0.95255	0.8461	M	0.83603	2.65	0.80722	D	1	P;B;B;P;P	0.43519	0.809;0.423;0.345;0.704;0.704	B;B;B;B;B	0.32090	0.14;0.053;0.05;0.09;0.09	D	0.94356	0.7583	10	0.66056	D	0.02	.	14.202	0.65710	0.0727:0.0:0.9273:0.0	.	357;411;357;357;357	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	M	357;357;357;482;425	ENSP00000171887:T357M;ENSP00000408724:T357M;ENSP00000406016:T357M;ENSP00000405460:T482M;ENSP00000400383:T425M	ENSP00000171887:T357M	T	-	2	0	TNS1	218422040	1.000000	0.71417	0.991000	0.47740	0.969000	0.65631	7.726000	0.84824	1.404000	0.46819	0.655000	0.94253	ACG	G|0.999;A|0.001		0.577	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
UGT1A5	54579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234622277	234622277	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:234622277A>G	ENST00000373414.3	+	1	640	c.640A>G	c.(640-642)Atg>Gtg	p.M214V	UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Missense_Mutation_p.M214V|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	214						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		GGTCAAGAACATGCTCTACCC	0.483																																					p.M214V		.											.	UGT1A5-3	0			c.A640G						.						209.0	197.0	201.0					2																	234622277		2203	4300	6503	SO:0001583	missense	54579	exon1			AAGAACATGCTCT	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.640A>G	2.37:g.234622277A>G	ENSP00000362513:p.Met214Val	352	1		368	195	NM_019078	0	0	0	0	0	B8K294	Missense_Mutation	SNP	ENST00000373414.3	37	CCDS33404.1	.	.	.	.	.	.	.	.	.	.	A	9.408	1.079672	0.20309	.	.	ENSG00000240224	ENST00000373414	T	0.61040	0.14	4.77	-0.524	0.11920	.	0.585446	0.20090	N	0.099480	T	0.34221	0.0890	N	0.25201	0.72	0.26978	N	0.965428	B;B	0.13594	0.008;0.008	B;B	0.23150	0.044;0.044	T	0.12604	-1.0541	10	0.45353	T	0.12	.	1.3681	0.02205	0.4274:0.2431:0.2117:0.1179	.	214;214	Q5DSZ9;P35504	.;UD15_HUMAN	V	214	ENSP00000362513:M214V	ENSP00000362513:M214V	M	+	1	0	UGT1A5	234287016	0.000000	0.05858	0.992000	0.48379	0.655000	0.38815	-0.882000	0.04174	-0.055000	0.13244	0.459000	0.35465	ATG	.		0.483	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078	
RALGAPA2	57186	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	20491913	20491913	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr20:20491913A>T	ENST00000202677.7	-	33	4920	c.4913T>A	c.(4912-4914)tTg>tAg	p.L1638*		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1638	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GCGGGAGTCCAAATTTTTCAG	0.328																																					p.L1638X													.	RALGAPA2-24	0			c.T4913A						.						33.0	31.0	32.0					20																	20491913		1795	4058	5853	SO:0001587	stop_gained	57186	exon33			GAGTCCAAATTTT	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4913T>A	20.37:g.20491913A>T	ENSP00000202677:p.Leu1638*	18	0		24	11	NM_020343	0	0	0	1	1	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Nonsense_Mutation	SNP	ENST00000202677.7	37	CCDS46584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	47|47	13.108967|13.108967	0.99720|0.99720	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000417022;ENST00000202677|ENST00000430436;ENST00000427175	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	.|T	.|0.71298	.|0.3323	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73978	.|-0.3812	.|3	0.02654|.	T|.	1|.	.|.	15.6215|15.6215	0.76810|0.76810	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|R	68;1638|1455;49	.|.	ENSP00000202677:L1638X|.	L|W	-|-	2|1	0|0	RALGAPA2|RALGAPA2	20439913|20439913	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.927000|0.927000	0.56198|0.56198	9.273000|9.273000	0.95719|0.95719	2.093000|2.093000	0.63338|0.63338	0.460000|0.460000	0.39030|0.39030	TTG|TGG	.		0.328	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
SSTR4	6754	broad.mit.edu	37	20	23017198	23017198	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr20:23017198A>T	ENST00000255008.3	+	1	1142	c.1078A>T	c.(1078-1080)Atg>Ttg	p.M360L	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	360					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GGCAGGGTGCATGTGCCCCCC	0.657																																					p.M360L	Esophageal Squamous(15;850 1104 16640)												.	SSTR4-522	0			c.A1078T						.						37.0	43.0	41.0					20																	23017198		2127	4243	6370	SO:0001583	missense	6754	exon1			GGGTGCATGTGCC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.1078A>T	20.37:g.23017198A>T	ENSP00000255008:p.Met360Leu	108	0		108	6	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	A	0.199	-1.046780	0.01997	.	.	ENSG00000132671	ENST00000255008	T	0.63417	-0.04	3.65	1.32	0.21799	.	0.550833	0.15820	U	0.243030	T	0.40595	0.1123	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16630	-1.0396	10	0.27785	T	0.31	.	4.5158	0.11934	0.7291:0.0:0.0996:0.1712	.	360	P31391	SSR4_HUMAN	L	360	ENSP00000255008:M360L	ENSP00000255008:M360L	M	+	1	0	SSTR4	22965198	0.032000	0.19561	0.019000	0.16419	0.020000	0.10135	0.547000	0.23299	0.047000	0.15862	-0.250000	0.11733	ATG	.		0.657	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
FRG1B	284802	broad.mit.edu	37	20	29628283	29628283	+	Silent	SNP	G	G	C	rs200164543		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr20:29628283G>C	ENST00000278882.3	+	6	665	c.285G>C	c.(283-285)ggG>ggC	p.G95G	FRG1B_ENST00000358464.4_Silent_p.G95G|FRG1B_ENST00000439954.2_Silent_p.G100G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95								p.G95G(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGAAGCAGGGGACATAGAAG	0.378																																					.													.	FRG1B-22	4	Substitution - coding silent(4)	urinary_tract(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			AGCAGGGGACATA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.285G>C	20.37:g.29628283G>C		79	1		144	6	.	0	0	33	33	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.378	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
BPIFA2	140683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31761923	31761923	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr20:31761923C>T	ENST00000253362.2	+	4	487	c.341C>T	c.(340-342)gCt>gTt	p.A114V	BPIFA2_ENST00000354932.5_Missense_Mutation_p.A114V			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	114						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										GATGTCAAAGCTGAACCGATC	0.507																																					p.A114V		.											.	.	0			c.C341T						.						192.0	132.0	152.0					20																	31761923		2203	4300	6503	SO:0001583	missense	140683	exon4			TCAAAGCTGAACC	AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.341C>T	20.37:g.31761923C>T	ENSP00000253362:p.Ala114Val	119	0		136	38	NM_080574	0	0	0	0	0	Q9BQQ0	Missense_Mutation	SNP	ENST00000253362.2	37	CCDS13214.1	.	.	.	.	.	.	.	.	.	.	C	1.293	-0.607118	0.03717	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.04758	3.56;3.56	4.11	-1.34	0.09143	.	1.919610	0.02314	N	0.072384	T	0.03520	0.0101	N	0.20685	0.6	0.09310	N	1	P	0.39862	0.692	B	0.42692	0.395	T	0.35276	-0.9795	10	0.02654	T	1	-22.3913	3.4184	0.07384	0.1782:0.4121:0.0:0.4097	.	114	Q96DR5	BPIA2_HUMAN	V	114	ENSP00000253362:A114V;ENSP00000347012:A114V	ENSP00000253362:A114V	A	+	2	0	BPIFA2	31225584	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.978000	0.01494	-0.194000	0.10399	0.561000	0.74099	GCT	.		0.507	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574	
MX1	4599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	42807881	42807881	+	Missense_Mutation	SNP	G	G	A	rs150271063		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr21:42807881G>A	ENST00000398600.2	+	8	1248	c.223G>A	c.(223-225)Gtc>Atc	p.V75I	MX1_ENST00000455164.2_Missense_Mutation_p.V75I|MX1_ENST00000398598.3_Missense_Mutation_p.V75I|MX1_ENST00000288383.6_Missense_Mutation_p.V75I	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	75	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				AGCCATCGCCGTCATCGGGGA	0.607																																					p.V75I		.											.	MX1-515	0			c.G223A						.	G	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	81.0	80.0	80.0		223,223,223	4.5	1.0	21	dbSNP_134	80	5,8595	4.3+/-15.6	0,5,4295	no	missense,missense,missense	MX1	NM_001144925.1,NM_001178046.1,NM_002462.3	29,29,29	0,6,6497	AA,AG,GG		0.0581,0.0227,0.0461	probably-damaging,probably-damaging,probably-damaging	75/663,75/663,75/663	42807881	6,13000	2203	4300	6503	SO:0001583	missense	4599	exon8			ATCGCCGTCATCG		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.223G>A	21.37:g.42807881G>A	ENSP00000381601:p.Val75Ile	132	0		101	40	NM_001144925	0	0	4	4	0	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	G	32	5.146034	0.94603	2.27E-4	5.81E-4	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000424365;ENST00000417963;ENST00000441677;ENST00000288383	D;D;D;D;D;D	0.98192	-4.78;-4.78;-4.78;-3.97;-3.97;-3.22	4.48	4.48	0.54585	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	M	0.91459	3.21	0.80722	D	1	D	0.63046	0.992	P	0.60236	0.871	D	0.99501	1.0953	10	0.87932	D	0	-65.9432	16.5923	0.84769	0.0:0.0:1.0:0.0	.	75	P20591	MX1_HUMAN	I	75	ENSP00000381601:V75I;ENSP00000381599:V75I;ENSP00000410523:V75I;ENSP00000400923:V75I;ENSP00000402215:V75I;ENSP00000288383:V75I	ENSP00000288383:V75I	V	+	1	0	MX1	41729751	1.000000	0.71417	0.959000	0.39883	0.933000	0.57130	8.419000	0.90253	2.445000	0.82738	0.561000	0.74099	GTC	G|1.000;A|0.000		0.607	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195161.2		
BCR	613	ucsc.edu	37	22	23656859	23656859	+	Silent	SNP	T	T	A	rs55715766	byFrequency	TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr22:23656859T>A	ENST00000305877.8	+	22	4435	c.3684T>A	c.(3682-3684)ccT>ccA	p.P1228P	BCR_ENST00000359540.3_Silent_p.P1184P|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1228	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CCAGCCAGCCTATCACCATGA	0.612			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.P1228P				Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR-1349	0			c.T3684A						.						45.0	36.0	39.0					22																	23656859		2203	4296	6499	SO:0001819	synonymous_variant	613	exon22			CCAGCCTATCACC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3684T>A	22.37:g.23656859T>A		38	0		39	4	NM_004327	0	0	104	104	0	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																			T|0.999;C|0.001		0.612	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
SYNPR	132204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	63466530	63466530	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr3:63466530C>T	ENST00000295894.5	+	2	416	c.47C>T	c.(46-48)gCa>gTa	p.A16V	SYNPR_ENST00000460711.1_Missense_Mutation_p.A27V|SYNPR-AS1_ENST00000488201.1_RNA|SYNPR_ENST00000465156.1_Missense_Mutation_p.A16V|SYNPR_ENST00000478744.1_3'UTR|SYNPR_ENST00000478300.1_Missense_Mutation_p.A36V|SYNPR_ENST00000479198.1_Missense_Mutation_p.A16V	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin	16	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		TTTGCATTTGCAACATGCGGT	0.433																																					p.A36V	NSCLC(29;1052 1116 20025 32519)	.											.	.	0			c.C107T						.						160.0	161.0	160.0					3																	63466530		1945	4146	6091	SO:0001583	missense	132204	exon3			CATTTGCAACATG	AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.47C>T	3.37:g.63466530C>T	ENSP00000295894:p.Ala16Val	280	1		239	94	NM_001130003	0	0	0	0	0	B2R675|G5E9W4	Missense_Mutation	SNP	ENST00000295894.5	37	CCDS46860.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408930	0.83340	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000479198;ENST00000460711;ENST00000465156	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	5.38	5.38	0.77491	Marvel (1);MARVEL-like domain (1);	0.105267	0.64402	D	0.000004	D	0.87597	0.6217	M	0.90870	3.155	0.80722	D	1	D;D;D	0.60160	0.979;0.979;0.987	P;P;P	0.58013	0.831;0.831;0.74	D	0.90454	0.4441	10	0.87932	D	0	-3.3962	18.124	0.89580	0.0:1.0:0.0:0.0	.	27;16;36	B3KVD8;Q8TBG9;G5E9W4	.;SYNPR_HUMAN;.	V	36;16;16;27;16	ENSP00000418994:A36V;ENSP00000295894:A16V;ENSP00000418929:A16V;ENSP00000418701:A27V;ENSP00000418123:A16V	ENSP00000295894:A16V	A	+	2	0	SYNPR	63441570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.523000	0.85059	0.650000	0.86243	GCA	.		0.433	SYNPR-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351787.1		
ROBO2	6092	broad.mit.edu;bcgsc.ca	37	3	77542437	77542437	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr3:77542437T>G	ENST00000461745.1	+	5	1610	c.710T>G	c.(709-711)cTg>cGg	p.L237R	ROBO2_ENST00000332191.8_Missense_Mutation_p.L237R|ROBO2_ENST00000487694.3_Missense_Mutation_p.L253R	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	237	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CAGGTGGTACTGGAGGAAGAA	0.403																																					p.L237R													.	ROBO2-328	0			c.T710G						.						135.0	122.0	126.0					3																	77542437		1872	4114	5986	SO:0001583	missense	6092	exon5			TGGTACTGGAGGA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.710T>G	3.37:g.77542437T>G	ENSP00000417164:p.Leu237Arg	93	0		96	6	NM_002942	0	0	0	0	0	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.615646	0.87359	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.65916	-0.18;-0.18;-0.18	5.88	5.88	0.94601	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34411	U	0.003992	T	0.68220	0.2977	N	0.25060	0.705	0.42707	D	0.993639	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.998	T	0.70107	-0.4963	9	0.37606	T	0.19	.	16.2851	0.82714	0.0:0.0:0.0:1.0	.	253;237;237	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	R	253;253;253;237;237	ENSP00000417335:L253R;ENSP00000417164:L237R;ENSP00000327536:L237R	ENSP00000327536:L237R	L	+	2	0	ROBO2	77625127	1.000000	0.71417	0.990000	0.47175	0.960000	0.62799	7.982000	0.88131	2.252000	0.74401	0.402000	0.26972	CTG	.		0.403	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
PLOD2	5352	broad.mit.edu	37	3	145806381	145806381	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr3:145806381G>A	ENST00000360060.3	-	9	1174	c.997C>T	c.(997-999)Cat>Tat	p.H333Y	PLOD2_ENST00000494950.1_Missense_Mutation_p.H278Y|PLOD2_ENST00000282903.5_Missense_Mutation_p.H333Y|PLOD2_ENST00000461497.1_5'Flank|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	333					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ACTTTGTTATGAATAAAAAGT	0.294																																					p.H333Y													.	PLOD2-92	0			c.C997T						.						55.0	55.0	55.0					3																	145806381		2201	4296	6497	SO:0001583	missense	5352	exon9			TGTTATGAATAAA	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.997C>T	3.37:g.145806381G>A	ENSP00000353170:p.His333Tyr	37	0		30	8	NM_182943	0	0	0	0	0	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763173	0.69763	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950	D;D;D	0.84516	-1.86;-1.86;-1.86	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	L	0.48362	1.52	0.80722	D	1	D;D;B	0.76494	0.998;0.999;0.078	D;D;B	0.91635	0.99;0.999;0.1	D	0.87909	0.2696	10	0.30854	T	0.27	-8.4591	19.1315	0.93410	0.0:0.0:1.0:0.0	.	278;333;333	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	Y	333;333;278	ENSP00000282903:H333Y;ENSP00000353170:H333Y;ENSP00000420094:H278Y	ENSP00000282903:H333Y	H	-	1	0	PLOD2	147289071	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.441000	0.97557	2.523000	0.85059	0.650000	0.86243	CAT	.		0.294	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
P2RY1	5028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	152553966	152553966	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr3:152553966A>G	ENST00000305097.3	+	1	1231	c.395A>G	c.(394-396)cAt>cGt	p.H132R		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	132					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TTCATCTTTCATGTGAACCTC	0.507																																					p.H132R		.											.	P2RY1-500	0			c.A395G						.						79.0	76.0	77.0					3																	152553966		2203	4300	6503	SO:0001583	missense	5028	exon1			TCTTTCATGTGAA	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.395A>G	3.37:g.152553966A>G	ENSP00000304767:p.His132Arg	85	0		100	34	NM_002563	0	0	0	0	0		Missense_Mutation	SNP	ENST00000305097.3	37	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019475	0.75275	.	.	ENSG00000169860	ENST00000305097	T	0.71698	-0.59	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.82944	0.5147	M	0.79475	2.455	0.80722	D	1	D	0.58268	0.982	D	0.62955	0.909	D	0.85045	0.0925	10	0.66056	D	0.02	.	15.2728	0.73717	1.0:0.0:0.0:0.0	.	132	P47900	P2RY1_HUMAN	R	132	ENSP00000304767:H132R	ENSP00000304767:H132R	H	+	2	0	P2RY1	154036656	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	9.210000	0.95106	2.186000	0.69663	0.533000	0.62120	CAT	.		0.507	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
SH3TC1	54436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	8230107	8230107	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr4:8230107C>T	ENST00000245105.3	+	12	2753	c.2686C>T	c.(2686-2688)Ctg>Ttg	p.L896L	SH3TC1_ENST00000539824.1_Silent_p.L820L	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	896										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GGCTCGGGACCTGGGCCAGCA	0.692																																					p.L896L	NSCLC(145;2298 2623 35616 37297)	.											.	SH3TC1-154	0			c.C2686T						.						37.0	43.0	41.0					4																	8230107		2203	4299	6502	SO:0001819	synonymous_variant	54436	exon12			CGGGACCTGGGCC	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2686C>T	4.37:g.8230107C>T		102	0		116	57	NM_018986	0	0	4	11	7	Q4W5G5	Silent	SNP	ENST00000245105.3	37	CCDS3399.1																																																																																			.		0.692	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
DDX60L	91351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	169317122	169317122	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr4:169317122C>T	ENST00000511577.1	-	27	3892	c.3645G>A	c.(3643-3645)agG>agA	p.R1215R	DDX60L_ENST00000260184.7_Silent_p.R1215R|DDX60L_ENST00000505890.1_Silent_p.R1216R			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1215	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AGTCTTTATTCCTGGTAATTT	0.343																																					p.R1215R		.											.	DDX60L-69	0			c.G3645A						.						103.0	93.0	96.0					4																	169317122		1813	4069	5882	SO:0001819	synonymous_variant	91351	exon27			TTTATTCCTGGTA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3645G>A	4.37:g.169317122C>T		93	1		139	72	NM_001012967	0	0	0	0	0	Q96ND6	Silent	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	C	0.998	-0.691845	0.03303	.	.	ENSG00000181381	ENST00000514580	.	.	.	1.42	0.293	0.15742	.	.	.	.	.	T	0.24967	0.0606	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.25950	-1.0117	4	.	.	.	.	5.6565	0.17644	0.0:0.4727:0.5273:0.0	.	.	.	.	K	103	.	.	E	-	1	0	DDX60L	169553697	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.305000	0.19254	0.010000	0.14839	0.313000	0.20887	GAA	.		0.343	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
WDR70	55100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37381726	37381726	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr5:37381726C>T	ENST00000265107.4	+	3	270	c.114C>T	c.(112-114)gaC>gaT	p.D38D	WDR70_ENST00000504564.1_Silent_p.D38D	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	38							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCACATTTGACTTGGAAGCAA	0.378																																					p.D38D		.											.	WDR70-187	0			c.C114T						.						119.0	127.0	124.0					5																	37381726		2203	4300	6503	SO:0001819	synonymous_variant	55100	exon3			ATTTGACTTGGAA	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.114C>T	5.37:g.37381726C>T		166	0		220	71	NM_018034	0	0	1	1	0	Q9H053	Silent	SNP	ENST00000265107.4	37	CCDS34147.1																																																																																			.		0.378	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
TUBE1	51175	hgsc.bcm.edu	37	6	112408628	112408628	+	Missense_Mutation	SNP	A	A	C	rs199513778		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr6:112408628A>C	ENST00000368662.5	-	1	88	c.10T>G	c.(10-12)Tcg>Gcg	p.S4A	TUBE1_ENST00000604814.1_5'Flank|FAM229B_ENST00000604268.1_5'Flank|FAM229B_ENST00000368656.2_5'Flank	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	4					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	ACGACCACCGACTGGGTCATG	0.632													A|||	1	0.000199681	0.0	0.0	5008	,	,		16095	0.0		0.001	False		,,,				2504	0.0				p.S4A		.											.	TUBE1-91	0			c.T10G						.						13.0	13.0	13.0					6																	112408628		2036	3985	6021	SO:0001583	missense	51175	exon1			CCACCGACTGGGT	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.10T>G	6.37:g.112408628A>C	ENSP00000357651:p.Ser4Ala	1	1		3	2	NM_016262	0	0	0	0	0	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	ENST00000368662.5	37	CCDS5100.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739608	0.69304	.	.	ENSG00000074935	ENST00000368662;ENST00000368657	T	0.66815	-0.23	4.86	4.86	0.63082	Tubulin/FtsZ, GTPase domain (2);	0.259719	0.40385	N	0.001104	T	0.73621	0.3610	M	0.73430	2.235	0.58432	D	0.999991	D	0.62365	0.991	P	0.60286	0.872	T	0.77981	-0.2383	10	0.66056	D	0.02	.	14.5546	0.68091	1.0:0.0:0.0:0.0	.	4	Q9UJT0	TBE_HUMAN	A	4	ENSP00000357651:S4A	ENSP00000357646:S4A	S	-	1	0	TUBE1	112515321	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	6.872000	0.75536	2.168000	0.68352	0.397000	0.26171	TCG	.		0.632	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48506568	48506568	+	Silent	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr7:48506568C>T	ENST00000435803.1	+	44	12855	c.12831C>T	c.(12829-12831)aaC>aaT	p.N4277N	ABCA13_ENST00000544596.1_Intron	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4277			N -> D (in dbSNP:rs4917152).		transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GGGGCGACAACTTGGACCTCA	0.498																																					p.N4277N		.											.	ABCA13-521	0			c.C12831T						.						109.0	118.0	115.0					7																	48506568		2069	4210	6279	SO:0001819	synonymous_variant	154664	exon44			CGACAACTTGGAC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12831C>T	7.37:g.48506568C>T		144	2		237	82	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.498	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZNF680	340252	broad.mit.edu	37	7	63982808	63982808	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr7:63982808T>C	ENST00000309683.6	-	4	475	c.324A>G	c.(322-324)atA>atG	p.I108M	ZNF680_ENST00000476563.1_5'UTR	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				ATCCTCTCAGTATCACTTTTT	0.318																																					p.I108M													.	ZNF680-91	0			c.A324G						.						46.0	47.0	47.0					7																	63982808		2202	4288	6490	SO:0001583	missense	340252	exon4			TCTCAGTATCACT	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.324A>G	7.37:g.63982808T>C	ENSP00000309330:p.Ile108Met	75	0		136	5	NM_178558	0	0	1	1	0	B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	t	5.664	0.307088	0.10733	.	.	ENSG00000173041	ENST00000309683	T	0.05580	3.42	0.468	0.468	0.16732	.	.	.	.	.	T	0.12008	0.0292	M	0.76574	2.34	0.09310	N	1	D	0.56968	0.978	P	0.49012	0.598	T	0.15607	-1.0431	8	0.45353	T	0.12	.	.	.	.	.	108	Q8NEM1	ZN680_HUMAN	M	108	ENSP00000309330:I108M	ENSP00000309330:I108M	I	-	3	3	ZNF680	63620243	0.001000	0.12720	0.034000	0.17996	0.031000	0.12232	-0.161000	0.10026	0.413000	0.25759	0.402000	0.26972	ATA	.		0.318	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344568.1	NM_178558	
SLC13A1	6561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	122765636	122765636	+	Silent	SNP	A	A	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr7:122765636A>G	ENST00000194130.2	-	11	1266	c.1227T>C	c.(1225-1227)ccT>ccC	p.P409P	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	409					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TTTCTCCTGTAGGTGTAGTTT	0.368																																					p.P409P		.											.	SLC13A1-92	0			c.T1227C						.						123.0	129.0	127.0					7																	122765636		2203	4300	6503	SO:0001819	synonymous_variant	6561	exon11			TCCTGTAGGTGTA		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1227T>C	7.37:g.122765636A>G		192	0		384	147	NM_022444	0	0	0	0	0	Q9H5Z0	Silent	SNP	ENST00000194130.2	37	CCDS5786.1																																																																																			.		0.368	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
AKR1B15	441282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134260255	134260255	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr7:134260255G>T	ENST00000457545.2	+	7	857	c.597G>T	c.(595-597)ttG>ttT	p.L199F	AKR1B15_ENST00000423958.1_Missense_Mutation_p.L171F	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	199							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						AGAGGCTCTTGAACAAACCTG	0.463																																					p.L199F		.											.	AKR1B15-23	0			c.G597T						.						71.0	77.0	75.0					7																	134260255		2203	4300	6503	SO:0001583	missense	441282	exon7			GCTCTTGAACAAA		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.597G>T	7.37:g.134260255G>T	ENSP00000389289:p.Leu199Phe	164	0		265	97	NM_001080538	0	0	0	0	0	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484711	0.44147	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.21031	2.03;2.03	3.82	0.986	0.19784	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.42832	0.1220	M	0.80508	2.5	0.47308	D	0.999386	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.23619	-1.0183	9	0.87932	D	0	.	7.683	0.28524	0.2865:0.0:0.7135:0.0	.	171;199	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	F	199;171	ENSP00000389289:L199F;ENSP00000397009:L171F	ENSP00000397009:L171F	L	+	3	2	AKR1B15	133910795	0.998000	0.40836	0.832000	0.32986	0.573000	0.36030	0.344000	0.19962	-0.004000	0.14419	0.543000	0.68304	TTG	.		0.463	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
OXR1	55074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	107718929	107718929	+	Silent	SNP	T	T	C			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr8:107718929T>C	ENST00000442977.2	+	8	1282	c.1183T>C	c.(1183-1185)Tta>Cta	p.L395L	OXR1_ENST00000531443.1_Silent_p.L394L|OXR1_ENST00000445937.1_Silent_p.L394L|OXR1_ENST00000497705.1_Silent_p.L327L|OXR1_ENST00000312046.6_Silent_p.L387L|OXR1_ENST00000517566.2_Silent_p.L394L|OXR1_ENST00000452423.2_5'UTR	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	395					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TCCTGGTCACTTAAGATCTGA	0.368																																					p.L395L		.											.	OXR1-68	0			c.T1183C						.						86.0	89.0	88.0					8																	107718929		2203	4300	6503	SO:0001819	synonymous_variant	55074	exon8			GGTCACTTAAGAT	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.1183T>C	8.37:g.107718929T>C		63	0		71	19	NM_001198532	0	0	1	1	0	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	37	CCDS56548.1																																																																																			.		0.368	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	139737673	139737673	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr8:139737673C>T	ENST00000303045.6	-	24	2596	c.2150G>A	c.(2149-2151)gGa>gAa	p.G717E	COL22A1_ENST00000435777.1_Missense_Mutation_p.G717E	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	717	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACCAGGGGGTCCTGGAGGGCC	0.582										HNSCC(7;0.00092)																											p.G717E		.											.	COL22A1-103	0			c.G2150A						.						50.0	57.0	55.0					8																	139737673		2203	4300	6503	SO:0001583	missense	169044	exon24			GGGGGTCCTGGAG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2150G>A	8.37:g.139737673C>T	ENSP00000303153:p.Gly717Glu	131	0		127	44	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043885	0.55110	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.99353	-5.77;-5.14	4.8	4.8	0.61643	.	0.000000	0.49305	D	0.000157	D	0.99722	0.9892	H	0.99719	4.725	0.52099	D	0.999949	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96966	0.9705	10	0.87932	D	0	.	14.0818	0.64929	0.0:1.0:0.0:0.0	.	717;717	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	E	717;717;430	ENSP00000303153:G717E;ENSP00000387655:G717E	ENSP00000303153:G717E	G	-	2	0	COL22A1	139806855	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.436000	0.52856	2.567000	0.86603	0.655000	0.94253	GGA	.		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139371469	139371469	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr9:139371469G>A	ENST00000371706.3	-	1	98	c.65C>T	c.(64-66)gCa>gTa	p.A22V	SEC16A_ENST00000431893.2_Missense_Mutation_p.A22V|SEC16A_ENST00000290037.6_Missense_Mutation_p.A22V|SEC16A_ENST00000313050.7_Missense_Mutation_p.A200V			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	22					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGAAGGGGATGCTGCTGGGGT	0.652																																					p.A200V		.											.	.	0			c.C599T						.						47.0	53.0	51.0					9																	139371469		2113	4220	6333	SO:0001583	missense	9919	exon3			GGGGATGCTGCTG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.65C>T	9.37:g.139371469G>A	ENSP00000360771:p.Ala22Val	80	1		63	30	NM_014866	0	0	0	0	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	14.35	2.509363	0.44660	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.27256	1.87;1.68;1.68;1.68	5.39	5.39	0.77823	.	0.642215	0.15172	N	0.276561	T	0.33381	0.0861	L	0.54323	1.7	0.26691	N	0.97136	P;P;P	0.42296	0.666;0.775;0.775	B;B;B	0.42282	0.212;0.382;0.382	T	0.23119	-1.0197	10	0.66056	D	0.02	-7.54	18.5216	0.90954	0.0:0.0:1.0:0.0	.	200;22;22	F1T0I1;O15027-5;O15027-4	.;.;.	V	200;22;22;22	ENSP00000325827:A200V;ENSP00000360771:A22V;ENSP00000290037:A22V;ENSP00000387583:A22V	ENSP00000290037:A22V	A	-	2	0	SEC16A	138491290	0.015000	0.18098	0.007000	0.13788	0.065000	0.16274	1.962000	0.40442	2.692000	0.91855	0.655000	0.94253	GCA	.		0.652	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
ATP2A1	487	broad.mit.edu	37	16	28913640	28913640	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:28913640delC	ENST00000357084.3	+	17	2724	c.2457delC	c.(2455-2457)cgcfs	p.R819fs	ATP2A1_ENST00000395503.4_Frame_Shift_Del_p.R819fs|ATP2A1_ENST00000536376.1_Frame_Shift_Del_p.R694fs	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	819					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						TCATGGACCGCCCCCCCCGGA	0.657																																					p.R819fs													.	ATP2A1-93	0			c.2457delC						.		,	55,41,4168		0,0,55,0,41,2036	54.0	65.0	61.0		,	3.9	1.0	16		62	55,65,8132		0,0,55,0,65,4006	no	codingComplex,codingComplex	ATP2A1	NM_173201.3,NM_004320.4	,	0,0,110,0,106,6042	A1A1,A1A2,A1R,A2A2,A2R,RR		1.4542,2.2514,1.7258	,	,	28913640	110,106,12300	2197	4300	6497	SO:0001589	frameshift_variant	487	exon17			GGACCGCCCCCCC		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2457delC	16.37:g.28913640delC	ENSP00000349595:p.Arg819fs	183	0		129	7	NM_004320	0	0	0	0	0	A8K5J9|B3KY17|O14984	Frame_Shift_Del	DEL	ENST00000357084.3	37	CCDS10643.1																																																																																			.		0.657	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
ZFHX3	463	broad.mit.edu	37	16	72992645	72992647	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr16:72992645_72992647delTCT	ENST00000268489.5	-	2	2070_2072	c.1398_1400delAGA	c.(1396-1401)gaagag>gag	p.466_467EE>E	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	466	Poly-Glu.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				ttcctcctcctcttcctcctccg	0.586																																					p.466_467del													.	ZFHX3-72	0			c.1398_1400del						.																																			SO:0001651	inframe_deletion	463	exon2			TCCTCCTCTTCCT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1398_1400delAGA	16.37:g.72992645_72992647delTCT	ENSP00000268489:p.Glu471del	55	0		38	7	NM_006885	0	0	0	0	0	D3DWS8|O15101|Q13719	In_Frame_Del	DEL	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.586	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
USHBP1	83878	hgsc.bcm.edu;bcgsc.ca	37	19	17370111	17370111	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr19:17370111delC	ENST00000252597.3	-	7	1206	c.1033delG	c.(1033-1035)gccfs	p.A345fs	USHBP1_ENST00000431146.2_Frame_Shift_Del_p.A281fs	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						TACTGCAAGGCCAGATGCAAT	0.602																																					p.A345fs		.											.	USHBP1-91	0			c.1033delG						.						53.0	49.0	50.0					19																	17370111		2203	4300	6503	SO:0001589	frameshift_variant	83878	exon7			.	AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1033delG	19.37:g.17370111delC	ENSP00000252597:p.Ala345fs	50	0		41	12	NM_031941	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000252597.3	37	CCDS12353.1																																																																																			.		0.602	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	
ITSN2	50618	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	24509153	24509155	+	In_Frame_Del	DEL	TTC	TTC	-	rs201163358		TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:24509153_24509155delTTC	ENST00000355123.4	-	16	2232_2234	c.1789_1791delGAA	c.(1789-1791)gaadel	p.E597del	ITSN2_ENST00000361999.3_In_Frame_Del_p.E597del|ITSN2_ENST00000406921.3_In_Frame_Del_p.E597del	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	597					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCTAACTGTTCTTTAAGTCTT	0.286																																					p.597_597del		.											.	ITSN2-539	0			c.1789_1791del						.																																			SO:0001651	inframe_deletion	50618	exon16			.	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1789_1791delGAA	2.37:g.24509153_24509155delTTC	ENSP00000347244:p.Glu597del	67	0		120	24	NM_147152	0	0	0	0	0	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	In_Frame_Del	DEL	ENST00000355123.4	37	CCDS1710.2																																																																																			.		0.286	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
NDUFS1	4719	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	207006722	207006724	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:207006722_207006724delAGA	ENST00000233190.6	-	12	1469_1471	c.1203_1205delTCT	c.(1201-1206)cttctg>ctg	p.401_402LL>L	NDUFS1_ENST00000449699.1_In_Frame_Del_p.401_402LL>L|NDUFS1_ENST00000423725.1_In_Frame_Del_p.344_345LL>L|NDUFS1_ENST00000455934.2_In_Frame_Del_p.415_416LL>L|NDUFS1_ENST00000457011.1_In_Frame_Del_p.285_286LL>L|NDUFS1_ENST00000440274.1_In_Frame_Del_p.365_366LL>L|NDUFS1_ENST00000432169.1_In_Frame_Del_p.290_291LL>L	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	401					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTACCAACCAGAAGAACAACAT	0.325																																					p.415_416del		.											.	NDUFS1-91	0			c.1245_1247del						.																																			SO:0001651	inframe_deletion	4719	exon12			.		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.1203_1205delTCT	2.37:g.207006725_207006727delAGA	ENSP00000233190:p.Leu402del	101	0		138	21	NM_001199984	0	0	0	0	0	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	In_Frame_Del	DEL	ENST00000233190.6	37	CCDS2366.1																																																																																			.		0.325	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
LRRFIP1	9208	broad.mit.edu	37	2	238672176	238672176	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:238672176delA	ENST00000392000.4	+	11	1937	c.1820delA	c.(1819-1821)gaafs	p.E609fs	LRRFIP1_ENST00000289175.6_Frame_Shift_Del_p.E553fs|LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000244815.5_Frame_Shift_Del_p.E585fs	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	609			E -> K (in dbSNP:rs3739041).		innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		GAAATTAAGGAAGAAGAGCAG	0.373																																					p.E607fs													.	LRRFIP1-153	0			c.1820delA						.						49.0	51.0	51.0					2																	238672176		2203	4300	6503	SO:0001589	frameshift_variant	9208	exon11			TTAAGGAAGAAGA	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.1820delA	2.37:g.238672176delA	ENSP00000375857:p.Glu609fs	26	0		43	7	NM_001137552	0	0	0	0	0	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Frame_Shift_Del	DEL	ENST00000392000.4	37	CCDS46552.1																																																																																			.		0.373	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
MGAM	8972	broad.mit.edu	37	7	141794622	141794622	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr7:141794622delT	ENST00000549489.2	+	40	4824	c.4729delT	c.(4729-4731)tttfs	p.F1577fs	MGAM_ENST00000475668.2_Frame_Shift_Del_p.F2473fs	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1577	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTGGGGGCCTTTTACCCCTT	0.493																																					p.F1577fs													.	MGAM-70	0			c.4729delT						.						58.0	57.0	57.0					7																	141794622		1894	4106	6000	SO:0001589	frameshift_variant	8972	exon40			GGGGCCTTTTACC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4729delT	7.37:g.141794622delT	ENSP00000447378:p.Phe1577fs	66	0		134	7	NM_004668	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	ENST00000549489.2	37	CCDS47727.1																																																																																			.		0.493	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
TPD52	7163	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	80963849	80963851	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr8:80963849_80963851delGAT	ENST00000379097.3	-	4	779_781	c.417_419delATC	c.(415-420)acatct>act	p.S140del	TPD52_ENST00000518937.1_In_Frame_Del_p.S100del|TPD52_ENST00000523395.1_5'Flank|TPD52_ENST00000517427.1_In_Frame_Del_p.S140del|TPD52_ENST00000448733.2_In_Frame_Del_p.S140del|TPD52_ENST00000537855.1_In_Frame_Del_p.S140del|TPD52_ENST00000520527.1_In_Frame_Del_p.S140del|TPD52_ENST00000379096.5_In_Frame_Del_p.S100del|TPD52_ENST00000519303.2_5'UTR	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	140					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			TAAGGTTTCAGATGTCTTCTTGT	0.404																																					p.139_140del		.											.	TPD52-523	0			c.417_419del						.																																			SO:0001651	inframe_deletion	7163	exon4			.	U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.417_419delATC	8.37:g.80963849_80963851delGAT	ENSP00000368391:p.Ser140del	74	0		75	26	NM_001025252	0	0	0	0	0	B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	In_Frame_Del	DEL	ENST00000379097.3	37	CCDS34912.1																																																																																			.		0.404	TPD52-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379539.2	NM_005079	
ZNF658	26149	broad.mit.edu	37	9	40772391	40772392	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr9:40772391_40772392delCT	ENST00000602553.1	-	5	3177_3178	c.2883_2884delAG	c.(2881-2886)acagggfs	p.G962fs	ZNF658_ENST00000441795.1_Intron|ZNF658_ENST00000377626.3_Frame_Shift_Del_p.G962fs			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	962					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GATTTCTCCCCTGTGTGAATTC	0.436																																					p.961_962del													.	ZNF658-45	0			c.2883_2884del						.			0,2758		0,0,1379						2.2	0.0			6	5,5899		2,1,2949	no	frameshift	ZNF658	NM_033160.5		2,1,4328	A1A1,A1R,RR		0.0847,0.0,0.0577				5,8657				SO:0001589	frameshift_variant	26149	exon5			TCTCCCCTGTGTG	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.2883_2884delAG	9.37:g.40772391_40772392delCT	ENSP00000473484:p.Gly962fs	345	0		245	8	NM_033160	0	0	0	0	0	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Frame_Shift_Del	DEL	ENST00000602553.1	37	CCDS35023.1																																																																																			.		0.436	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
MYCN	4613	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	16082320	16082321	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:16082320_16082321insG	ENST00000281043.3	+	2	431_432	c.134_135insG	c.(133-138)ccggggfs	p.PG45fs	MYCNOS_ENST00000453400.1_RNA|MYCNOS_ENST00000420452.1_RNA|MYCNOS_ENST00000439180.1_RNA|MYCNOS_ENST00000419083.1_RNA|MYCNOS_ENST00000448719.1_RNA	NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	45					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TCGACCCCCCCGGGGGAGGACA	0.644			A		neuroblastoma																																p.P45fs		.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN-1271	0			c.134_135insG	GRCh37	CI084293	MYCN	I		.																																			SO:0001589	frameshift_variant	4613	exon2			.	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.139dupG	2.37:g.16082325_16082325dupG	ENSP00000281043:p.Pro45fs	47	0		49	23	NM_005378	0	0	0	0	0	Q53XS5|Q6LDT9	Frame_Shift_Ins	INS	ENST00000281043.3	37	CCDS1687.1																																																																																			.		0.644	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
UBR3	130507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	170843280	170843281	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr2:170843280_170843281insT	ENST00000272793.5	+	25	3810_3811	c.3760_3761insT	c.(3760-3762)gttfs	p.V1254fs	UBR3_ENST00000418381.1_Frame_Shift_Ins_p.V1254fs|UBR3_ENST00000392631.1_Frame_Shift_Ins_p.V75fs			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1254					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TACTGGATTAGTTGTACTGTTA	0.396																																					p.V1254fs		.											.	UBR3-68	0			c.3760_3761insT						.																																			SO:0001589	frameshift_variant	130507	exon25			.	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.3762dupT	2.37:g.170843282_170843282dupT	ENSP00000272793:p.Val1254fs	85	0		136	32	NM_172070	0	0	0	0	0	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Frame_Shift_Ins	INS	ENST00000272793.5	37																																																																																				.		0.396	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
TOPBP1	11073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	133329894	133329895	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr3:133329894_133329895insCT	ENST00000260810.5	-	25	4257_4258	c.4126_4127insAG	c.(4126-4128)agafs	p.R1376fs		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1376					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TTTTCTCCATCTCATTGCTGCA	0.356								Other conserved DNA damage response genes																													p.R1376fs	Ovarian(21;193 658 4424 15423 17362)	.											.	TOPBP1-540	0			c.4127_4128insAG						.																																			SO:0001589	frameshift_variant	11073	exon25			.	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.4126_4127insAG	3.37:g.133329894_133329895insCT	ENSP00000260810:p.Arg1376fs	230	0		249	88	NM_007027	0	0	0	0	0	B7Z7W8|Q7LGC1|Q9UEB9	Frame_Shift_Ins	INS	ENST00000260810.5	37	CCDS46919.1																																																																																			.		0.356	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	
LAP3	51056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	17586652	17586653	+	Missense_Mutation	DNP	AC	AC	GA			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr4:17586652_17586653AC>GA	ENST00000226299.4	+	6	871_872	c.597_598AC>GA	c.(595-600)gcACgc>gcGAgc	p.R200S	AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000606142.1_Missense_Mutation_p.R169S	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	200					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						AGAACTTGGCACGCCAATTGAT	0.475																																					p.R200S		.											.	LAP3	0			c.C598A						.																																			SO:0001583	missense	51056	exon6			TTGGCACGCCAAT	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	Exception_encountered	4.37:g.17586652_17586653delinsGA	ENSP00000226299:p.Arg200Ser	69.0	1.0		91.0	24.0		0	0	0	0	0	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	DNP	ENST00000226299.4	37	CCDS3422.1																																																																																			.		0.475	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
NDFIP1	80762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141524143	141524144	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-G7-6795-01A-11D-1961-08	TCGA-G7-6795-10A-01D-1962-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1af4c17e-514e-4b9d-bfcb-ed019430178f	0428b3c1-9f63-45bc-8457-3fffb9bcf9fb	g.chr5:141524143_141524144CC>AG	ENST00000253814.4	+	7	1040_1041	c.570_571CC>AG	c.(568-573)ctCCtg>ctAGtg	p.L191V		NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1	191					cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGGCTTTCTCCTGTTTCTCAG	0.356																																					p.L191V		.											.	NDFIP1	0			c.C571G						.																																			SO:0001583	missense	80762	exon7			TTTCTCCTGTTTC	BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	Exception_encountered	5.37:g.141524143_141524144delinsAG	ENSP00000253814:p.Leu191Val	194.0	1.0		207.0	51.0		0	0	0	0	0	B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	Missense_Mutation	DNP	ENST00000253814.4	37	CCDS4273.1																																																																																			.		0.356	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251859.2	NM_030571	
