#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MAP3K6	9064	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27687435	27687435	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:27687435C>T	ENST00000493901.1	-	15	2136	c.1897G>A	c.(1897-1899)Gag>Aag	p.E633K	MAP3K6_ENST00000374040.3_Missense_Mutation_p.E625K|MAP3K6_ENST00000357582.2_Missense_Mutation_p.E633K	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	633					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCCGCGCCCTCCGCCTCCTCC	0.736																																					p.E633K		.											.	MAP3K6-1523	0			c.G1897A						.						10.0	14.0	13.0					1																	27687435		2139	4246	6385	SO:0001583	missense	9064	exon14			CGCCCTCCGCCTC	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.1897G>A	1.37:g.27687435C>T	ENSP00000419591:p.Glu633Lys	71	0		102	35	NM_004672	0	0	0	0	0	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	37	CCDS299.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901459	0.33535	.	.	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	T;T;T	0.68025	-0.3;-0.3;-0.3	4.67	3.73	0.42828	.	.	.	.	.	T	0.61999	0.2392	M	0.62723	1.935	0.09310	N	1	B;B	0.25609	0.13;0.079	B;B	0.24701	0.055;0.025	T	0.54860	-0.8230	9	0.48119	T	0.1	.	8.9619	0.35851	0.0:0.8957:0.0:0.1043	.	625;633	O95382-3;O95382	.;M3K6_HUMAN	K	625;633;356;633	ENSP00000363152:E625K;ENSP00000419591:E633K;ENSP00000350195:E633K	ENSP00000350195:E633K	E	-	1	0	MAP3K6	27560022	0.005000	0.15991	0.073000	0.20177	0.013000	0.08279	1.483000	0.35497	2.433000	0.82419	0.655000	0.94253	GAG	.		0.736	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
ZSWIM5	57643	broad.mit.edu	37	1	45671664	45671664	+	Missense_Mutation	SNP	C	C	A	rs565101218		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:45671664C>A	ENST00000359600.5	-	1	564	c.359G>T	c.(358-360)gGc>gTc	p.G120V	ZSWIM5_ENST00000464588.1_Intron	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	120						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					ggcgccggggccgccccggTA	0.781																																					p.G120V													.	ZSWIM5-22	0			c.G359T						.						6.0	7.0	7.0					1																	45671664		1628	3773	5401	SO:0001583	missense	57643	exon1			CCGGGGCCGCCCC	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.359G>T	1.37:g.45671664C>A	ENSP00000352614:p.Gly120Val	18	0		25	4	NM_020883	0	0	0	0	0	Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	C	7.574	0.667370	0.14710	.	.	ENSG00000162415	ENST00000359600	T	0.68765	-0.35	2.14	-0.388	0.12459	.	0.311011	0.20497	U	0.091165	T	0.46092	0.1375	L	0.34521	1.04	0.34312	D	0.685593	B	0.20780	0.048	B	0.15484	0.013	T	0.33214	-0.9877	10	0.30078	T	0.28	-0.8426	4.5086	0.11899	0.0:0.6055:0.2312:0.1633	.	120	Q9P217	ZSWM5_HUMAN	V	120	ENSP00000352614:G120V	ENSP00000352614:G120V	G	-	2	0	ZSWIM5	45444251	0.015000	0.18098	0.365000	0.25901	0.495000	0.33615	0.095000	0.15127	0.219000	0.20840	0.121000	0.15741	GGC	.		0.781	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	
PRKACB	5567	ucsc.edu	37	1	84663465	84663465	+	Silent	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:84663465T>C	ENST00000370689.2	+	7	864	c.600T>C	c.(598-600)tgT>tgC	p.C200C	PRKACB_ENST00000370680.1_Silent_p.C206C|PRKACB_ENST00000394839.2_Silent_p.C170C|PRKACB_ENST00000370685.3_Silent_p.C247C|PRKACB_ENST00000370682.3_Silent_p.C204C|PRKACB_ENST00000370688.3_Silent_p.C200C|PRKACB_ENST00000394838.2_Silent_p.C207C	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	200	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		GGACATTATGTGGAACTCCAG	0.343																																					p.C247C													.	PRKACB-1083	0			c.T741C						.						102.0	113.0	109.0					1																	84663465		2203	4299	6502	SO:0001819	synonymous_variant	5567	exon7			ATTATGTGGAACT	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.600T>C	1.37:g.84663465T>C		44	0		37	1	NM_182948	0	0	7	7	0	B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Silent	SNP	ENST00000370689.2	37	CCDS691.1																																																																																			.		0.343	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948	
TUFT1	7286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151552139	151552139	+	Silent	SNP	A	A	G	rs201062061		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:151552139A>G	ENST00000368849.3	+	11	1001	c.939A>G	c.(937-939)aaA>aaG	p.K313K	TUFT1_ENST00000353024.3_Silent_p.K254K|TUFT1_ENST00000368848.2_Silent_p.K288K|TUFT1_ENST00000392712.3_Silent_p.K258K|TUFT1_ENST00000538902.1_Silent_p.K332K	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	313					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGAATTCAAAAGCTGTGATCC	0.547																																					p.K313K		.											.	TUFT1-90	0			c.A939G						.						58.0	53.0	55.0					1																	151552139		2203	4300	6503	SO:0001819	synonymous_variant	7286	exon11			TTCAAAAGCTGTG	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.939A>G	1.37:g.151552139A>G		170	0		138	17	NM_020127	0	0	0	0	0	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Silent	SNP	ENST00000368849.3	37	CCDS1000.1																																																																																			.		0.547	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
GATAD2B	57459	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	153792180	153792180	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:153792180G>C	ENST00000368655.4	-	3	610	c.367C>G	c.(367-369)Cca>Gca	p.P123A		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	123					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATGATGTCTGGTGAGGGAGTT	0.408																																					p.P123A		.											.	GATAD2B-90	0			c.C367G						.						111.0	112.0	112.0					1																	153792180		2203	4300	6503	SO:0001583	missense	57459	exon3			TGTCTGGTGAGGG	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.367C>G	1.37:g.153792180G>C	ENSP00000357644:p.Pro123Ala	241	0		193	17	NM_020699	0	0	0	0	0	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821458	0.90873	.	.	ENSG00000143614	ENST00000368655	T	0.41400	1.0	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.53029	0.1771	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.42982	-0.9419	10	0.35671	T	0.21	-15.871	17.5737	0.87942	0.0:0.0:1.0:0.0	.	123	Q8WXI9	P66B_HUMAN	A	123	ENSP00000357644:P123A	ENSP00000357644:P123A	P	-	1	0	GATAD2B	152058804	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.086000	0.94088	2.682000	0.91365	0.557000	0.71058	CCA	.		0.408	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
EFNA1	1942	ucsc.edu	37	1	155104060	155104060	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:155104060C>T	ENST00000368407.3	+	2	856	c.338C>T	c.(337-339)cCt>cTt	p.P113L	EFNA1_ENST00000469878.1_3'UTR|EFNA1_ENST00000368406.2_Missense_Mutation_p.P113L	NM_004428.2	NP_004419.2	P20827	EFNA1_HUMAN	ephrin-A1	113	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|ephrin receptor signaling pathway (GO:0048013)|mitral valve morphogenesis (GO:0003183)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|notochord formation (GO:0014028)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of angiogenesis (GO:0045765)|regulation of axonogenesis (GO:0050770)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|substrate adhesion-dependent cell spreading (GO:0034446)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ephrin receptor binding (GO:0046875)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(1)|lung(1)|skin(1)	5	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGCTTCACACCTTTCACCCTG	0.547																																					p.P113L													.	EFNA1-90	0			c.C338T						.						54.0	48.0	50.0					1																	155104060		2203	4300	6503	SO:0001583	missense	1942	exon2			TCACACCTTTCAC		CCDS1091.1, CCDS1092.1	1q21-q22	2011-03-09			ENSG00000169242	ENSG00000169242		"""Ephrins"""	3221	protein-coding gene	gene with protein product		191164		TNFAIP4, EPLG1		2233719, 8660976	Standard	NM_182685		Approved	LERK1, ECKLG	uc001fhh.3	P20827	OTTHUMG00000035312	ENST00000368407.3:c.338C>T	1.37:g.155104060C>T	ENSP00000357392:p.Pro113Leu	338	0		249	1	NM_182685	0	0	4	4	0	D3DV86|Q5SR60|Q5SR61|Q6I9T9|Q8N578	Missense_Mutation	SNP	ENST00000368407.3	37	CCDS1091.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556530	0.86231	.	.	ENSG00000169242	ENST00000368407;ENST00000368406	T;T	0.73363	-0.74;-0.74	5.22	4.3	0.51218	Ephrin, conserved site (1);Cupredoxin (2);	0.154283	0.64402	D	0.000015	D	0.84969	0.5590	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.88382	0.3002	10	0.87932	D	0	-7.7709	13.8904	0.63736	0.0:0.8459:0.1541:0.0	.	113;113	P20827-2;P20827	.;EFNA1_HUMAN	L	113	ENSP00000357392:P113L;ENSP00000357391:P113L	ENSP00000357391:P113L	P	+	2	0	EFNA1	153370684	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.710000	0.68392	1.314000	0.45095	0.655000	0.94253	CCT	.		0.547	EFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085428.1	NM_004428	
CAMK1D	57118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12856228	12856228	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:12856228G>A	ENST00000378847.3	+	7	1013	c.676G>A	c.(676-678)Gac>Aac	p.D226N	CAMK1D_ENST00000378845.1_Missense_Mutation_p.D226N	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		TGATGAAAATGACTCCAAGCT	0.483																																					p.D226N		.											.	CAMK1D-334	0			c.G676A						.						101.0	90.0	94.0					10																	12856228		2203	4300	6503	SO:0001583	missense	57118	exon7			GAAAATGACTCCA	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.676G>A	10.37:g.12856228G>A	ENSP00000368124:p.Asp226Asn	73	0		99	10	NM_153498	0	0	0	0	0	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	37	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	G	31	5.064215	0.93898	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.65364	-0.15;-0.15	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	L	0.35723	1.085	0.80722	D	1	D;B	0.54047	0.964;0.267	D;B	0.63703	0.917;0.344	T	0.68907	-0.5285	10	0.42905	T	0.14	-37.1453	16.7965	0.85603	0.0:0.0:1.0:0.0	.	226;226	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	N	226	ENSP00000368124:D226N;ENSP00000368122:D226N	ENSP00000368122:D226N	D	+	1	0	CAMK1D	12896234	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.517000	0.98020	2.556000	0.86216	0.555000	0.69702	GAC	.		0.483	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
ZNF33B	7582	ucsc.edu	37	10	43088083	43088083	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:43088083A>G	ENST00000359467.3	-	5	2429	c.2315T>C	c.(2314-2316)aTa>aCa	p.I772T	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	772					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						TTTTTCTCCTATGTGTGTTCT	0.413																																					p.I772T	Melanoma(137;1247 1767 16772 25727 43810)												.	ZNF33B-90	0			c.T2315C						.						122.0	117.0	119.0					10																	43088083		2203	4300	6503	SO:0001583	missense	7582	exon5			TCTCCTATGTGTG	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.2315T>C	10.37:g.43088083A>G	ENSP00000352444:p.Ile772Thr	149	0		120	1	NM_006955	0	0	4	4	0	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.955903	0.00470	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.11712	2.75	2.5	-0.594	0.11664	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.829025	0.09911	N	0.739814	T	0.02156	0.0067	N	0.00496	-1.435	0.24656	N	0.993495	B	0.02656	0.0	B	0.01281	0.0	T	0.44711	-0.9310	10	0.02654	T	1	.	6.666	0.23041	0.3882:0.0:0.6118:0.0	.	772	Q06732	ZN33B_HUMAN	T	772;738	ENSP00000352444:I772T	ENSP00000352444:I772T	I	-	2	0	ZNF33B	42408089	0.175000	0.23083	0.845000	0.33349	0.880000	0.50808	0.511000	0.22739	-0.125000	0.11703	-0.537000	0.04273	ATA	.		0.413	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
IKZF5	64376	broad.mit.edu;bcgsc.ca	37	10	124754057	124754057	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:124754057T>C	ENST00000368886.5	-	5	819	c.499A>G	c.(499-501)Aaa>Gaa	p.K167E	PSTK_ENST00000497219.1_Intron	NM_001271840.1	NP_001258769.1	Q9H5V7	IKZF5_HUMAN	IKAROS family zinc finger 5 (Pegasus)	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|lung(3)|prostate(1)	6		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)		CTAGTACCTTTAATTGGTACC	0.408																																					p.K167E													.	IKZF5-90	0			c.A499G						.						144.0	132.0	136.0					10																	124754057		1925	4126	6051	SO:0001583	missense	64376	exon5			TACCTTTAATTGG	AF230808	CCDS41574.1	10q26	2011-05-31	2006-08-25	2006-08-25	ENSG00000095574	ENSG00000095574		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	14283	protein-coding gene	gene with protein product		606238	"""zinc finger protein, subfamily 1A, 5"", ""zinc finger protein, subfamily 1A, 5 (Pegasus)"""	ZNFN1A5		10978333	Standard	NM_001271840		Approved	Pegasus, FLJ22973	uc021qaj.2	Q9H5V7	OTTHUMG00000019192	ENST00000368886.5:c.499A>G	10.37:g.124754057T>C	ENSP00000357881:p.Lys167Glu	163	1		122	7	NM_001271840	0	0	0	0	0	B3KVH7|D3DRE7|Q9H2T0	Missense_Mutation	SNP	ENST00000368886.5	37	CCDS41574.1	.	.	.	.	.	.	.	.	.	.	T	15.40	2.823756	0.50739	.	.	ENSG00000095574	ENST00000368886	T	0.05319	3.46	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.06234	0.0161	N	0.24115	0.695	0.80722	D	1	B	0.25719	0.132	B	0.17098	0.017	T	0.37430	-0.9706	10	0.45353	T	0.12	-14.6901	16.4237	0.83790	0.0:0.0:0.0:1.0	.	167	Q9H5V7	IKZF5_HUMAN	E	167	ENSP00000357881:K167E	ENSP00000357881:K167E	K	-	1	0	IKZF5	124744047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.857000	0.69525	2.279000	0.76181	0.533000	0.62120	AAA	.		0.408	IKZF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050820.2	NM_022466	
MUC2	4583	bcgsc.ca	37	11	1092926	1092926	+	Missense_Mutation	SNP	C	C	G	rs377100070		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:1092926C>G	ENST00000441003.2	+	30	4772	c.4745C>G	c.(4744-4746)aCa>aGa	p.T1582R	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1583R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1582R(1)|p.T1583R(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.632																																					p.T1582R													.	MUC2-90	2	Substitution - Missense(2)	prostate(2)	c.C4745G						.	C	ARG/THR	24,3818		0,24,1897	77.0	115.0	102.0		4742	0.5	0.0	11		102	140,6992		0,140,3426	no	missense	MUC2	NM_002457.2	71	0,164,5323	GG,GC,CC		1.963,0.6247,1.4944	benign	1581/2813	1092926	164,10810	1921	3566	5487	SO:0001583	missense	4583	exon30			CCCCAACATCGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4745C>G	11.37:g.1092926C>G	ENSP00000415183:p.Thr1582Arg	180	0		144	6	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.792	-0.251014	0.05867	0.006247	0.01963	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14144	2.53;2.91	1.75	0.53	0.17102	.	18.926900	0.00496	U	0.000153	T	0.05227	0.0139	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.28364	-1.0046	9	0.45353	T	0.12	.	7.5493	0.27786	0.0:0.7315:0.2684:0.0	.	1582	E7EUV1	.	R	1582;1583	ENSP00000415183:T1582R;ENSP00000351956:T1583R	ENSP00000351956:T1583R	T	+	2	0	MUC2	1082926	0.001000	0.12720	0.001000	0.08648	0.035000	0.12851	0.551000	0.23361	1.016000	0.39470	0.121000	0.15741	ACA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093312	1093312	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:1093312C>G	ENST00000441003.2	+	30	5158	c.5131C>G	c.(5131-5133)Cca>Gca	p.P1711A	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.P1678A	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccaacacccac	0.637																																					p.P1711A													.	MUC2-90	0			c.C5131G						.						145.0	191.0	175.0					11																	1093312		1907	3560	5467	SO:0001583	missense	4583	exon30			CCAACCCCAACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5131C>G	11.37:g.1093312C>G	ENSP00000415183:p.Pro1711Ala	124	4		97	8	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.304	-0.972196	0.02215	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08458	3.09;3.11	1.4	-2.79	0.05841	.	0.190326	0.20108	U	0.099085	T	0.02533	0.0077	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.41106	-0.9527	9	0.08179	T	0.78	.	2.4144	0.04432	0.4935:0.3028:0.0:0.2036	.	1711	E7EUV1	.	A	1711;1678	ENSP00000415183:P1711A;ENSP00000351956:P1678A	ENSP00000351956:P1678A	P	+	1	0	MUC2	1083312	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-5.838000	0.00095	-0.673000	0.05259	-1.098000	0.02139	CCA	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KCNQ1	3784	hgsc.bcm.edu	37	11	2466535	2466535	+	Silent	SNP	G	G	T	rs587781009		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:2466535G>T	ENST00000155840.5	+	1	315	c.207G>T	c.(205-207)gcG>gcT	p.A69A		NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	69					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ccccggccgcgcccgccgcgc	0.811																																					p.A69A		.											.	KCNQ1-515	0			c.G207T						.						3.0	4.0	3.0					11																	2466535		1287	2827	4114	SO:0001819	synonymous_variant	3784	exon1			GGCCGCGCCCGCC	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.207G>T	11.37:g.2466535G>T		0	0		4	4	NM_000218	0	0	0	0	0	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Silent	SNP	ENST00000155840.5	37	CCDS7736.1																																																																																			.		0.811	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
TRIM68	55128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4621750	4621750	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:4621750C>T	ENST00000300747.5	-	7	1503	c.1214G>A	c.(1213-1215)cGa>cAa	p.R405Q		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	405	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGTGCCTGCTCGGTACTCATT	0.517																																					p.R405Q		.											.	TRIM68-91	0			c.G1214A						.						100.0	84.0	89.0					11																	4621750		2201	4298	6499	SO:0001583	missense	55128	exon7			CCTGCTCGGTACT	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1214G>A	11.37:g.4621750C>T	ENSP00000300747:p.Arg405Gln	196	0		164	35	NM_018073	0	0	0	0	0	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473848	0.63737	.	.	ENSG00000167333	ENST00000300747;ENST00000544055	T	0.68181	-0.31	4.99	0.918	0.19386	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.160187	0.29932	N	0.010838	T	0.44582	0.1300	L	0.33753	1.03	0.28223	N	0.926426	P	0.34837	0.472	B	0.34824	0.19	T	0.23762	-1.0179	10	0.12766	T	0.61	.	3.2819	0.06918	0.1772:0.4704:0.0:0.3524	.	405	Q6AZZ1	TRI68_HUMAN	Q	405;126	ENSP00000300747:R405Q	ENSP00000300747:R405Q	R	-	2	0	TRIM68	4578326	0.000000	0.05858	0.996000	0.52242	0.995000	0.86356	-0.456000	0.06754	0.351000	0.24027	0.561000	0.74099	CGA	.		0.517	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
CD59	966	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	33731752	33731752	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:33731752C>T	ENST00000395850.3	-	4	382	c.307G>A	c.(307-309)Ggt>Agt	p.G103S	CD59_ENST00000445143.2_Missense_Mutation_p.G103S|CD59_ENST00000528700.1_Missense_Mutation_p.G103S|CD59_ENST00000527577.1_Missense_Mutation_p.G103S|CD59_ENST00000534312.1_Splice_Site_p.D103N|CD59_ENST00000351554.3_Missense_Mutation_p.G103S|CD59_ENST00000426650.2_Missense_Mutation_p.G103S|CD59_ENST00000415002.2_Missense_Mutation_p.G103S|CD59_ENST00000533403.1_3'UTR|CD59_ENST00000437761.2_Missense_Mutation_p.G103S	NM_000611.5|NM_001127225.1|NM_001127226.1|NM_001127227.1|NM_203329.2|NM_203330.2|NM_203331.2	NP_000602.1|NP_001120697.1|NP_001120698.1|NP_001120699.1|NP_976074.1|NP_976075.1|NP_976076.1	P13987	CD59_HUMAN	CD59 molecule, complement regulatory protein	103	UPAR/Ly6.				blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|negative regulation of activation of membrane attack complex (GO:0001971)|negative regulation of apoptotic process (GO:0043066)|positive regulation of T cell proliferation (GO:0042102)|regulation of complement activation (GO:0030449)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|compact myelin (GO:0043218)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	complement binding (GO:0001848)			endometrium(1)|lung(2)	3						GATGTCCCACCATTTTCAAGC	0.473																																					p.G103S													.	CD59-90	0			c.G307A						.						160.0	124.0	136.0					11																	33731752		2202	4298	6500	SO:0001583	missense	966	exon5			TCCCACCATTTTC		CCDS7886.1	11p13	2014-09-17	2006-03-28			ENSG00000085063		"""CD molecules"", ""Complement system"""	1689	protein-coding gene	gene with protein product		107271	"""CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344)"", ""CD59 antigen, complement regulatory protein"""	MIC11, MIN1, MSK21, MIN2, MIN3		7691713	Standard	NM_001127223		Approved	16.3A5, EJ16, EJ30, EL32, G344, p18-20	uc001mus.4	P13987		ENST00000395850.3:c.307G>A	11.37:g.33731752C>T	ENSP00000379191:p.Gly103Ser	215	2		215	25	NM_203331	0	0	144	195	51		Missense_Mutation	SNP	ENST00000395850.3	37	CCDS7886.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.01|11.01	1.513538|1.513538	0.27123|0.27123	.|.	.|.	ENSG00000085063|ENSG00000085063	ENST00000534312|ENST00000527926;ENST00000395850;ENST00000351554;ENST00000415002;ENST00000445143;ENST00000426650;ENST00000437761;ENST00000527577;ENST00000528700	D|D;T;T;T;T;T;T;T;T	0.92249|0.94184	-3.0|-3.37;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89	1.71|1.71	-1.94|-1.94	0.07571|0.07571	.|Ly-6 antigen / uPA receptor -like (1);	.|1.089460	.|0.06889	.|N	.|0.803918	D|D	0.92609|0.92609	0.7652|0.7652	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	.|D	.|0.55385	.|0.971	.|P	.|0.54238	.|0.746	D|D	0.83396|0.83396	0.0020|0.0020	7|10	0.05620|0.38643	T|T	0.96|0.18	-12.9057|-12.9057	4.096|4.096	0.09991|0.09991	0.0:0.3422:0.4816:0.1762|0.0:0.3422:0.4816:0.1762	.|.	.|103	.|P13987	.|CD59_HUMAN	N|S	103|103	ENSP00000432362:D103N|ENSP00000437122:G103S;ENSP00000379191:G103S;ENSP00000340210:G103S;ENSP00000404822:G103S;ENSP00000403511:G103S;ENSP00000402425:G103S;ENSP00000410182:G103S;ENSP00000432942:G103S;ENSP00000434617:G103S	ENSP00000432362:D103N|ENSP00000340210:G103S	D|G	-|-	1|1	0|0	CD59|CD59	33688328|33688328	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.162000|0.162000	0.16501|0.16501	-0.554000|-0.554000	0.06150|0.06150	-0.304000|-0.304000	0.09214|0.09214	GAC|GGT	.		0.473	CD59-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000388809.1	NM_203329	
ZNHIT2	741	hgsc.bcm.edu	37	11	64884755	64884755	+	Missense_Mutation	SNP	G	G	A	rs200126440		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:64884755G>A	ENST00000310597.4	-	1	415	c.371C>T	c.(370-372)cCt>cTt	p.P124L	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	124							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						CCGCCATGGAGGCAGCAGCCG	0.731													G|||	1	0.000199681	0.0	0.0	5008	,	,		11861	0.0		0.001	False		,,,				2504	0.0				p.P124L		.											.	ZNHIT2-153	0			c.C371T						.	G	LEU/PRO	0,3516		0,0,1758	6.0	8.0	7.0		371	4.6	1.0	11		7	3,7301		0,3,3649	no	missense	ZNHIT2	NM_014205.2	98	0,3,5407	AA,AG,GG		0.0411,0.0,0.0277	probably-damaging	124/404	64884755	3,10817	1758	3652	5410	SO:0001583	missense	741	exon1			CATGGAGGCAGCA		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.371C>T	11.37:g.64884755G>A	ENSP00000308548:p.Pro124Leu	1	0		13	8	NM_014205	0	0	1	3	2	Q3SY14|Q8IUV0	Missense_Mutation	SNP	ENST00000310597.4	37	CCDS8094.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129799	0.77549	0.0	4.11E-4	ENSG00000174276	ENST00000310597	T	0.34472	1.36	4.55	4.55	0.56014	.	0.142165	0.47455	U	0.000232	T	0.59959	0.2232	M	0.74881	2.28	0.53005	D	0.999966	D	0.89917	1.0	D	0.83275	0.996	T	0.64757	-0.6332	10	0.72032	D	0.01	-12.5655	14.8345	0.70172	0.0:0.0:1.0:0.0	.	124	Q9UHR6	ZNHI2_HUMAN	L	124	ENSP00000308548:P124L	ENSP00000308548:P124L	P	-	2	0	ZNHIT2	64641331	0.995000	0.38212	0.958000	0.39756	0.786000	0.44442	2.667000	0.46808	2.366000	0.80165	0.561000	0.74099	CCT	.		0.731	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385260.1	NM_014205	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117352683	117352683	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:117352683G>C	ENST00000321322.6	-	12	2735	c.2734C>G	c.(2734-2736)Ctg>Gtg	p.L912V	DSCAML1_ENST00000527706.1_Missense_Mutation_p.L642V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	852	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTCACCTTCAGTGTGGAGACG	0.622																																					p.L912V		.											.	DSCAML1-159	0			c.C2734G						.						104.0	73.0	84.0					11																	117352683		2201	4296	6497	SO:0001583	missense	57453	exon12			CCTTCAGTGTGGA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2734C>G	11.37:g.117352683G>C	ENSP00000315465:p.Leu912Val	110	0		97	33	NM_020693	0	0	0	0	0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397882	0.42512	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.73681	-0.77;-0.77	3.89	2.97	0.34412	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85111	0.5622	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.85651	0.1282	9	0.62326	D	0.03	.	11.2591	0.49071	0.09:0.0:0.91:0.0	.	852	Q8TD84	DSCL1_HUMAN	V	642;912;619	ENSP00000434335:L642V;ENSP00000315465:L912V	ENSP00000315465:L912V	L	-	1	2	DSCAML1	116857893	1.000000	0.71417	0.934000	0.37439	0.083000	0.17756	4.754000	0.62191	0.844000	0.35094	0.485000	0.47835	CTG	.		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117869470	117869470	+	Missense_Mutation	SNP	G	G	T	rs576666901	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:117869470G>T	ENST00000227752.3	+	7	971	c.851G>T	c.(850-852)cGt>cTt	p.R284L	IL10RA_ENST00000541785.1_Missense_Mutation_p.R264L|IL10RA_ENST00000545409.1_Missense_Mutation_p.R135L|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	284					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		ATCAGCCAGCGTCCCTCCCCA	0.582																																					p.R284L		.											.	IL10RA-91	0			c.G851T						.						90.0	73.0	79.0					11																	117869470		2200	4296	6496	SO:0001583	missense	3587	exon7			GCCAGCGTCCCTC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.851G>T	11.37:g.117869470G>T	ENSP00000227752:p.Arg284Leu	122	0		115	18	NM_001558	0	0	16	16	0	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	G	8.140	0.784909	0.16189	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.23950	1.88;1.88;1.88	5.26	-3.16	0.05217	.	4.015810	0.00166	N	0.000015	T	0.07052	0.0179	N	0.01267	-0.92	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20505	-1.0273	10	0.10377	T	0.69	-0.0195	1.5109	0.02496	0.1162:0.2378:0.2516:0.3945	.	264;284	F5GYV8;Q13651	.;I10R1_HUMAN	L	284;264;135;264	ENSP00000227752:R284L;ENSP00000441397:R264L;ENSP00000443019:R135L	ENSP00000227752:R284L	R	+	2	0	IL10RA	117374680	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	-1.174000	0.03105	-0.149000	0.11215	-0.457000	0.05445	CGT	.		0.582	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101720912	101720912	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:101720912C>A	ENST00000261637.4	+	26	3269	c.3095C>A	c.(3094-3096)tCt>tAt	p.S1032Y		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1032					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CAGGGGAAATCTGCTTCAGGC	0.453																																					p.S1032Y		.											.	UTP20-155	0			c.C3095A						.						103.0	103.0	103.0					12																	101720912		2203	4300	6503	SO:0001583	missense	27340	exon26			GGAAATCTGCTTC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3095C>A	12.37:g.101720912C>A	ENSP00000261637:p.Ser1032Tyr	90	0		82	13	NM_014503	0	0	0	0	0	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501228	0.85176	.	.	ENSG00000120800	ENST00000261637	T	0.20881	2.04	5.02	5.02	0.67125	Down-regulated-in-metastasis protein (1);Armadillo-type fold (1);	0.112147	0.64402	D	0.000007	T	0.45637	0.1352	M	0.63843	1.955	0.58432	D	0.999997	D	0.89917	1.0	D	0.77557	0.99	T	0.33624	-0.9861	10	0.49607	T	0.09	-16.674	18.7119	0.91661	0.0:1.0:0.0:0.0	.	1032	O75691	UTP20_HUMAN	Y	1032	ENSP00000261637:S1032Y	ENSP00000261637:S1032Y	S	+	2	0	UTP20	100245043	0.999000	0.42202	0.997000	0.53966	0.758000	0.43043	7.357000	0.79456	2.491000	0.84063	0.305000	0.20034	TCT	.		0.453	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
PAH	5053	broad.mit.edu	37	12	103271308	103271308	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:103271308T>A	ENST00000553106.1	-	4	845	c.373A>T	c.(373-375)Att>Ttt	p.I125F	PAH_ENST00000307000.2_Missense_Mutation_p.I120F|PAH_ENST00000551988.1_5'UTR	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	125					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AGCTCTTGAATGGTTCTTGGG	0.507																																					p.I125F													.	PAH-72	0			c.A373T						.						150.0	138.0	142.0					12																	103271308		2203	4300	6503	SO:0001583	missense	5053	exon4			CTTGAATGGTTCT	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.373A>T	12.37:g.103271308T>A	ENSP00000448059:p.Ile125Phe	74	1		81	4	NM_000277	0	0	0	0	0	Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	37	CCDS9092.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844247	0.91197	.	.	ENSG00000171759	ENST00000553106;ENST00000307000;ENST00000551337	D;D;D	0.99695	-6.43;-6.43;-5.58	5.86	5.86	0.93980	Aromatic amino acid hydroxylase, C-terminal (3);	0.095070	0.64402	D	0.000001	D	0.99834	0.9925	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	D	0.96686	0.9507	10	0.87932	D	0	-9.0062	16.2436	0.82429	0.0:0.0:0.0:1.0	.	125;125	B4DPN2;P00439	.;PH4H_HUMAN	F	125;120;125	ENSP00000448059:I125F;ENSP00000303500:I120F;ENSP00000447620:I125F	ENSP00000303500:I120F	I	-	1	0	PAH	101795438	1.000000	0.71417	0.997000	0.53966	0.863000	0.49368	5.866000	0.69590	2.232000	0.73038	0.533000	0.62120	ATT	.		0.507	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
GCN1L1	10985	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120572149	120572149	+	Silent	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:120572149G>C	ENST00000300648.6	-	53	7275	c.7263C>G	c.(7261-7263)gcC>gcG	p.A2421A		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2421					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCGGATGACGGCATCCACTT	0.592																																					p.A2421A													.	GCN1L1-94	0			c.C7263G						.						116.0	118.0	117.0					12																	120572149		2115	4229	6344	SO:0001819	synonymous_variant	10985	exon53			GATGACGGCATCC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7263C>G	12.37:g.120572149G>C		69	1		76	9	NM_006836	0	0	1	8	7	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1																																																																																			.		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
FBRSL1	57666	hgsc.bcm.edu	37	12	133159733	133159733	+	Missense_Mutation	SNP	C	C	T	rs11550079	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:133159733C>T	ENST00000434748.2	+	17	3527	c.2507C>T	c.(2506-2508)gCc>gTc	p.A836V	FBRSL1_ENST00000261673.6_Missense_Mutation_p.A763V	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	836				A -> V (in Ref. 3; BAB13371). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						AAGGAGGAGGCCGCCAAGATG	0.761													C|||	2725	0.544129	0.4939	0.6225	5008	,	,		5355	0.7113		0.4026	False		,,,				2504	0.5297				p.A836V		.											.	FBRSL1-70	0			c.C2507T						.						2.0	6.0	5.0					12																	133159733		475	1282	1757	SO:0001583	missense	57666	exon17			AGGAGGCCGCCAA		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.2507C>T	12.37:g.133159733C>T	ENSP00000396160:p.Ala836Val	0	0		14	11	NM_001142641	0	0	0	0	0	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	1159	0.5306776556776557	248	0.5040650406504065	211	0.5828729281767956	393	0.6870629370629371	307	0.4050131926121372	c	9.709	1.156573	0.21454	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.31769	1.48;1.49	3.17	-0.242	0.13039	.	0.664906	0.15256	U	0.272063	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.44627	0.839	B	0.40134	0.32	T	0.26677	-1.0096	9	0.45353	T	0.12	-3.3224	5.7681	0.18237	0.1838:0.5714:0.2447:0.0	rs11550079	836	Q9HCM7	FBSL_HUMAN	V	836;763	ENSP00000396160:A836V;ENSP00000261673:A763V	ENSP00000261673:A763V	A	+	2	0	FBRSL1	131669806	0.317000	0.24589	0.004000	0.12327	0.011000	0.07611	0.750000	0.26334	0.431000	0.26258	-0.720000	0.03607	GCC	C|0.470;T|0.530		0.761	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
TNFRSF19	55504	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	24167593	24167593	+	Splice_Site	SNP	A	A	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:24167593A>C	ENST00000382258.4	+	3	383	c.179A>C	c.(178-180)aAg>aCg	p.K60T	TNFRSF19_ENST00000464735.1_3'UTR|TNFRSF19_ENST00000403372.2_Intron|TNFRSF19_ENST00000248484.4_Splice_Site_p.K60T|TNFRSF19_ENST00000382263.3_Splice_Site_p.K60T	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	60					apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		GAGTTGTCTAAGGTATATTGG	0.408																																					p.K60T													.	TNFRSF19-228	0			c.A179C						.						125.0	122.0	123.0					13																	24167593		2203	4300	6503	SO:0001630	splice_region_variant	55504	exon3			TGTCTAAGGTATA	AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.180+1A>C	13.37:g.24167593A>C		147	1		122	17	NM_018647	0	0	0	0	0	A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Missense_Mutation	SNP	ENST00000382258.4	37	CCDS9302.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.533748	0.64972	.	.	ENSG00000127863	ENST00000248484;ENST00000382258;ENST00000382263	T;T;T	0.21361	2.01;2.01;2.01	5.3	5.3	0.74995	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.21861	-1.0233	10	0.46703	T	0.11	-31.0155	13.0516	0.58958	1.0:0.0:0.0:0.0	.	60;60;60	Q9NS68;A8KA09;Q9NS68-2	TNR19_HUMAN;.;.	T	60	ENSP00000248484:K60T;ENSP00000371693:K60T;ENSP00000371698:K60T	ENSP00000248484:K60T	K	+	2	0	TNFRSF19	23065593	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	6.400000	0.73252	2.135000	0.66039	0.482000	0.46254	AAG	.		0.408	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044156.2	NM_018647	Missense_Mutation
HMGB1	3146	broad.mit.edu	37	13	31036768	31036768	+	Silent	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:31036768C>T	ENST00000405805.1	-	4	1318	c.378G>A	c.(376-378)gcG>gcA	p.A126A	HMGB1_ENST00000341423.5_Silent_p.A126A|HMGB1_ENST00000326004.4_Silent_p.A126A|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399494.1_Silent_p.A126A|HMGB1_ENST00000399489.1_Silent_p.A126A|HMGB1_ENST00000339872.4_Silent_p.A126A			P09429	HMGB1_HUMAN	high mobility group box 1	126					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)	p.A126A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CCAGTTTCTTCGCAACATCAC	0.413																																					p.A126A													.	HMGB1-227	1	Substitution - coding silent(1)	large_intestine(1)	c.G378A						.						96.0	88.0	91.0					13																	31036768		2202	4280	6482	SO:0001819	synonymous_variant	3146	exon4			TTTCTTCGCAACA	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.378G>A	13.37:g.31036768C>T		110	0		89	4	NM_002128	0	0	406	418	12	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Silent	SNP	ENST00000405805.1	37	CCDS9335.1																																																																																			.		0.413	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
KIAA0226L	80183	broad.mit.edu;bcgsc.ca	37	13	46946278	46946278	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:46946278G>A	ENST00000429979.1	-	3	937	c.333C>T	c.(331-333)tcC>tcT	p.S111S	KIAA0226L_ENST00000409879.2_Intron|KIAA0226L_ENST00000378784.4_Silent_p.S44S|KIAA0226L_ENST00000389908.3_Silent_p.S111S|KIAA0226L_ENST00000378787.3_Silent_p.S111S|RNU2-6P_ENST00000411404.1_RNA|KIAA0226L_ENST00000534925.1_5'UTR|KIAA0226L_ENST00000480935.1_5'UTR|KIAA0226L_ENST00000378797.2_Silent_p.S111S|KIAA0226L_ENST00000322896.6_Intron|KIAA0226L_ENST00000378781.3_Silent_p.S111S	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	111	Ser-rich.									NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						CGCTGCCAACGGAGTCTGTGG	0.572																																					p.S111S													.	.	0			c.C333T						.						92.0	88.0	89.0					13																	46946278		2203	4300	6503	SO:0001819	synonymous_variant	80183	exon3			GCCAACGGAGTCT	AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.333C>T	13.37:g.46946278G>A		123	0		122	6	NM_025113	0	0	0	0	0	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Silent	SNP	ENST00000429979.1	37	CCDS31970.2																																																																																			.		0.572	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044809.2	NM_025113	
TPP2	7174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103328750	103328750	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:103328750G>T	ENST00000376065.4	+	28	3681	c.3645G>T	c.(3643-3645)tgG>tgT	p.W1215C	TPP2_ENST00000466153.1_3'UTR|TPP2_ENST00000376052.3_Missense_Mutation_p.W1228C	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1215					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AAGAAAACTGGAAAAATTGTA	0.303																																					p.W1215C		.											.	TPP2-92	0			c.G3645T						.						56.0	60.0	58.0					13																	103328750		2201	4290	6491	SO:0001583	missense	7174	exon28			AAACTGGAAAAAT	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3645G>T	13.37:g.103328750G>T	ENSP00000365233:p.Trp1215Cys	137	0		117	11	NM_003291	0	0	40	40	0	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891078	0.33348	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.8	5.8	0.92144	.	0.162876	0.56097	D	0.000022	T	0.39733	0.1089	N	0.22421	0.69	0.80722	D	1	P	0.41748	0.761	B	0.37780	0.258	T	0.28073	-1.0055	9	0.38643	T	0.18	.	15.1747	0.72901	0.0692:0.0:0.9308:0.0	.	1215	P29144	TPP2_HUMAN	C	1215;1228	.	ENSP00000365220:W1228C	W	+	3	0	TPP2	102126751	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.923000	0.70045	2.746000	0.94184	0.563000	0.77884	TGG	.		0.303	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
IRS2	8660	hgsc.bcm.edu	37	13	110435073	110435073	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:110435073G>A	ENST00000375856.3	-	1	3842	c.3328C>T	c.(3328-3330)Ctc>Ttc	p.L1110F		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1110					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGCTCCATGAGGCTCAGCCTC	0.731																																					p.L1110F	Melanoma(100;613 2409 40847)	.											.	IRS2-1334	0			c.C3328T						.						5.0	6.0	6.0					13																	110435073		2027	4070	6097	SO:0001583	missense	8660	exon1			CCATGAGGCTCAG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3328C>T	13.37:g.110435073G>A	ENSP00000365016:p.Leu1110Phe	8	0		54	21	NM_003749	0	0	0	0	0	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	37	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514438	0.27123	.	.	ENSG00000185950	ENST00000375856	T	0.46063	0.88	3.92	2.96	0.34315	.	0.608901	0.14485	U	0.316713	T	0.58323	0.2114	M	0.64404	1.975	0.36281	D	0.855788	D	0.76494	0.999	D	0.75484	0.986	T	0.62324	-0.6878	10	0.35671	T	0.21	-24.5425	12.0667	0.53592	0.1011:0.0:0.8989:0.0	.	1110	Q9Y4H2	IRS2_HUMAN	F	1110	ENSP00000365016:L1110F	ENSP00000365016:L1110F	L	-	1	0	IRS2	109233074	1.000000	0.71417	0.997000	0.53966	0.010000	0.07245	3.062000	0.49971	2.039000	0.60335	0.644000	0.83932	CTC	.		0.731	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94052953	94052953	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr14:94052953G>C	ENST00000393151.2	+	21	2815	c.2815G>C	c.(2815-2817)Gat>Cat	p.D939H	UNC79_ENST00000555664.1_Missense_Mutation_p.D939H|UNC79_ENST00000256339.4_Missense_Mutation_p.D762H|UNC79_ENST00000553484.1_Missense_Mutation_p.D939H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	939					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGTAAAGAATGATACCGAAAG	0.333																																					p.D762H		.											.	.	0			c.G2284C						.						51.0	51.0	51.0					14																	94052953		2202	4299	6501	SO:0001583	missense	57578	exon21			AAGAATGATACCG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2815G>C	14.37:g.94052953G>C	ENSP00000376858:p.Asp939His	24	0		30	7	NM_020818	0	0	0	0	0	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	19.14	3.769262	0.69992	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18810	2.2;2.2;2.19;2.2	5.94	5.94	0.96194	.	0.110277	0.64402	D	0.000009	T	0.33235	0.0856	L	0.34521	1.04	0.42647	D	0.99343	D	0.57571	0.98	P	0.55965	0.788	T	0.00860	-1.1537	10	0.51188	T	0.08	-21.7402	20.3736	0.98901	0.0:0.0:1.0:0.0	.	939	C9JQL1	.	H	762;939;939;939;939	ENSP00000256339:D762H;ENSP00000450868:D939H;ENSP00000451360:D939H;ENSP00000376858:D939H	ENSP00000256339:D762H	D	+	1	0	KIAA1409	93122706	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.130000	0.77235	2.820000	0.97059	0.650000	0.86243	GAT	.		0.333	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000556337.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.H515P	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P													.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	41	9		94	28	NM_001202429	0	0	0	0	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
C15orf39	56905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	75500838	75500838	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr15:75500838A>G	ENST00000360639.2	+	2	2769	c.2449A>G	c.(2449-2451)Aag>Gag	p.K817E	C15orf39_ENST00000567617.1_Missense_Mutation_p.K817E|RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000394987.4_Missense_Mutation_p.K817E			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	817						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						GCTGCTGGCCAAGCTGCTGTC	0.667																																					p.K817E		.											.	C15orf39-90	0			c.A2449G						.						22.0	18.0	19.0					15																	75500838		2188	4288	6476	SO:0001583	missense	56905	exon2			CTGGCCAAGCTGC	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2449A>G	15.37:g.75500838A>G	ENSP00000353854:p.Lys817Glu	22	0		42	7	NM_015492	0	0	3	3	0	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	37	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	A	7.085	0.571051	0.13623	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	T;T	0.16324	2.35;2.35	5.07	1.05	0.20165	.	0.591269	0.18433	N	0.141368	T	0.12178	0.0296	L	0.45581	1.43	0.09310	N	0.999999	B;P	0.37370	0.234;0.592	B;B	0.34652	0.14;0.187	T	0.14062	-1.0486	10	0.46703	T	0.11	-8.4875	4.778	0.13189	0.5116:0.3589:0.1295:0.0	.	379;817	Q2VPA3;Q6ZRI6	.;CO039_HUMAN	E	817;817;215	ENSP00000353854:K817E;ENSP00000378438:K817E	ENSP00000353854:K817E	K	+	1	0	C15orf39	73287891	0.993000	0.37304	0.863000	0.33907	0.025000	0.11179	2.862000	0.48388	0.735000	0.32537	0.459000	0.35465	AAG	.		0.667	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
UBE2I	7329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1370453	1370453	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:1370453A>G	ENST00000355803.4	+	6	899	c.348A>G	c.(346-348)atA>atG	p.I116M	LA16c-358B7.3_ENST00000567829.1_RNA|UBE2I_ENST00000403747.2_Missense_Mutation_p.I116M|UBE2I_ENST00000406620.1_Missense_Mutation_p.I116M|LA16c-358B7.3_ENST00000568106.1_RNA|UBE2I_ENST00000566587.1_Missense_Mutation_p.I116M|UBE2I_ENST00000397515.2_Missense_Mutation_p.I116M|UBE2I_ENST00000402301.1_Missense_Mutation_p.I116M|UBE2I_ENST00000325437.5_Missense_Mutation_p.I116M|UBE2I_ENST00000397514.3_Missense_Mutation_p.I116M	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I	116					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				TATTAGGAATACAGGAACTTC	0.512																																					p.I116M		.											.	UBE2I-290	0			c.A348G						.						96.0	95.0	95.0					16																	1370453		2199	4300	6499	SO:0001583	missense	7329	exon6			AGGAATACAGGAA	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845	ENST00000355803.4:c.348A>G	16.37:g.1370453A>G	ENSP00000348056:p.Ile116Met	25	0		36	5	NM_003345	0	0	92	111	19	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	Missense_Mutation	SNP	ENST00000355803.4	37	CCDS10433.1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.254235	0.59212	.	.	ENSG00000103275	ENST00000325437;ENST00000355803;ENST00000397514;ENST00000397515;ENST00000406620;ENST00000403747;ENST00000402301	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.13	2.85	0.33270	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64427	0.2597	H	0.96805	3.885	0.80722	D	1	P;B	0.49961	0.93;0.326	P;B	0.47827	0.558;0.342	T	0.67856	-0.5562	10	0.87932	D	0	.	6.5449	0.22400	0.686:0.1604:0.0:0.1536	.	116;116	B0QYN7;P63279	.;UBC9_HUMAN	M	116	ENSP00000324897:I116M;ENSP00000348056:I116M;ENSP00000380649:I116M;ENSP00000380650:I116M;ENSP00000384568:I116M;ENSP00000385009:I116M;ENSP00000384361:I116M	ENSP00000324897:I116M	I	+	3	3	UBE2I	1310454	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.052000	0.30429	0.406000	0.25560	0.459000	0.35465	ATA	.		0.512	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250317.2	NM_003345	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3817823	3817823	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:3817823C>A	ENST00000262367.5	-	16	3957	c.3148G>T	c.(3148-3150)Gaa>Taa	p.E1050*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.E1012*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1050					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGTTTCTTTTCATCCACTTCC	0.433			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.E1050X		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.G3148T						.						250.0	223.0	232.0					16																	3817823		2197	4300	6497	SO:0001587	stop_gained	1387	exon16			TCTTTTCATCCAC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3148G>T	16.37:g.3817823C>A	ENSP00000262367:p.Glu1050*	102	0		110	30	NM_004380	0	0	1	2	1	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	49	15.549454	0.99837	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.61	5.61	0.85477	.	0.069937	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-12.7639	20.0086	0.97443	0.0:1.0:0.0:0.0	.	.	.	.	X	1050;1080;1012	.	ENSP00000262367:E1050X	E	-	1	0	CREBBP	3757824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.451000	0.66632	2.808000	0.96608	0.655000	0.94253	GAA	.		0.433	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30744761	30744761	+	Silent	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:30744761A>G	ENST00000262518.4	+	28	6673	c.6288A>G	c.(6286-6288)gaA>gaG	p.E2096E	SRCAP_ENST00000344771.4_Silent_p.E1938E|SRCAP_ENST00000395059.2_Silent_p.E2034E	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2096	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTAGAGTTGAACAGAGACAGG	0.527																																					p.E2096E		.											.	SRCAP-94	0			c.A6288G						.						82.0	72.0	75.0					16																	30744761		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon28			AGTTGAACAGAGA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6288A>G	16.37:g.30744761A>G		105	0		100	25	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.527	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	61823266	61823266	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:61823266G>C	ENST00000577390.1	-	8	2352	c.1398C>G	c.(1396-1398)atC>atG	p.I466M	CDH8_ENST00000584337.1_Missense_Mutation_p.I466M|CDH8_ENST00000299345.6_Missense_Mutation_p.I466M|CDH8_ENST00000577730.1_Missense_Mutation_p.I466M	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	466	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CAGTAGCAATGATTGTTATGT	0.403																																					p.I466M		.											.	CDH8-161	0			c.C1398G						.						234.0	196.0	209.0					16																	61823266		2203	4300	6503	SO:0001583	missense	1006	exon8			AGCAATGATTGTT	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1398C>G	16.37:g.61823266G>C	ENSP00000462701:p.Ile466Met	154	0		157	11	NM_001796	0	0	0	0	0	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012887	0.35511	.	.	ENSG00000150394	ENST00000299345	T	0.68025	-0.3	5.44	5.44	0.79542	Cadherin (4);Cadherin-like (1);	0.056358	0.64402	D	0.000001	T	0.70404	0.3220	M	0.77486	2.375	0.36180	D	0.849374	B;B	0.26845	0.001;0.161	B;B	0.39152	0.01;0.292	T	0.76454	-0.2953	10	0.87932	D	0	.	7.413	0.27027	0.2018:0.0:0.7982:0.0	.	282;466	Q3LID3;P55286	.;CADH8_HUMAN	M	466	ENSP00000299345:I466M	ENSP00000299345:I466M	I	-	3	3	CDH8	60380767	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.084000	0.41625	2.716000	0.92895	0.491000	0.48974	ATC	.		0.403	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
PKD1L2	114780	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81197248	81197248	+	RNA	SNP	C	C	T	rs200120814		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:81197248C>T	ENST00000525539.1	-	0	3433				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GAGTTGACCACTAGGGCTGGT	0.532																																					.													.	PKD1L2-92	0			.						.	C	ASN/SER	0,3888		0,0,1944	52.0	49.0	50.0		3434	2.1	0.5	16		50	2,8290		0,2,4144	yes	missense	PKD1L2	NM_052892.3	46	0,2,6088	TT,TC,CC		0.0241,0.0,0.0164	benign	1145/2460	81197248	2,12178	1944	4146	6090			114780	.			TGACCACTAGGGC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81197248C>T		98	0		105	26	.	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37																																																																																				.		0.532	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
RPH3AL	9501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	131631	131631	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:131631T>A	ENST00000331302.7	-	6	673	c.366A>T	c.(364-366)aaA>aaT	p.K122N	RPH3AL_ENST00000576001.1_5'UTR|RPH3AL_ENST00000536489.2_Intron|RPH3AL_ENST00000323434.8_Intron	NM_001190411.1|NM_006987.3	NP_001177340.1|NP_008918.1	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)	122	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of protein secretion (GO:0050714)|regulation of calcium ion-dependent exocytosis (GO:0017158)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|secretory granule membrane (GO:0030667)	cytoskeletal protein binding (GO:0008092)|metal ion binding (GO:0046872)			NS(2)|breast(1)|kidney(1)|large_intestine(1)|skin(1)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		CGATCCCACATTTGGTGCAGA	0.587																																					p.K122N		.											.	RPH3AL-91	0			c.A366T						.						81.0	81.0	81.0					17																	131631		2203	4300	6503	SO:0001583	missense	9501	exon6			CCCACATTTGGTG		CCDS10994.1, CCDS54059.1	17p13.3	2014-07-02			ENSG00000181031	ENSG00000181031		"""Synaptotagmins"""	10296	protein-coding gene	gene with protein product		604881				10395805	Standard	NM_006987		Approved	Noc2	uc021tmx.1	Q9UNE2	OTTHUMG00000090273	ENST00000331302.7:c.366A>T	17.37:g.131631T>A	ENSP00000328977:p.Lys122Asn	211	0		231	46	NM_006987	0	0	0	0	0	D3DTG7|Q9BSB3	Missense_Mutation	SNP	ENST00000331302.7	37	CCDS10994.1	.	.	.	.	.	.	.	.	.	.	T	15.21	2.767130	0.49574	.	.	ENSG00000181031	ENST00000323434	.	.	.	5.02	-8.63	0.00878	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000008	T	0.71426	0.3338	M	0.70903	2.155	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.82818	-0.0269	9	0.87932	D	0	-14.7906	16.2241	0.82283	0.0:0.5791:0.0:0.4208	.	122	Q9UNE2	RPH3L_HUMAN	N	122	.	ENSP00000319210:K122N	K	-	3	2	RPH3AL	131631	0.328000	0.24687	0.618000	0.29105	0.943000	0.58893	-0.811000	0.04500	-2.189000	0.00758	-1.660000	0.00751	AAA	.		0.587	RPH3AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206597.2	NM_006987	
TRPV3	162514	broad.mit.edu	37	17	3438998	3438998	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:3438998G>T	ENST00000576742.1	-	7	974	c.653C>A	c.(652-654)gCg>gAg	p.A218E	TRPV3_ENST00000301365.4_Missense_Mutation_p.A218E|TRPV3_ENST00000572519.1_Missense_Mutation_p.A218E	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	218					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GATGTTCAGCGCCGTCTGCCC	0.736																																					p.A218E													.	TRPV3-94	0			c.C653A						.						8.0	9.0	9.0					17																	3438998		2163	4231	6394	SO:0001583	missense	162514	exon7			TTCAGCGCCGTCT	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.653C>A	17.37:g.3438998G>T	ENSP00000461518:p.Ala218Glu	16	0		80	7	NM_001258205	0	0	0	0	0	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	G	36	5.688246	0.96784	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.71341	-0.56	5.03	5.03	0.67393	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	D	0.89491	0.6730	H	0.96111	3.77	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.997;0.999;1.0;1.0;0.997	D;D;D;D;D;D;P	0.91635	0.979;0.993;0.933;0.993;0.999;0.999;0.89	D	0.92506	0.6012	10	0.87932	D	0	-11.7793	18.2979	0.90153	0.0:0.0:1.0:0.0	.	202;202;218;202;218;218;218	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	E	218;218;202	ENSP00000301365:A218E	ENSP00000301365:A218E	A	-	2	0	TRPV3	3385748	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.422000	0.97458	2.741000	0.93983	0.555000	0.69702	GCG	.		0.736	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
RPL26	6154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8283223	8283223	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:8283223A>C	ENST00000584164.1	-	3	591	c.200T>G	c.(199-201)aTt>aGt	p.I67S	RPL26_ENST00000578812.1_Missense_Mutation_p.I67S|RPL26_ENST00000293842.5_Missense_Mutation_p.I67S|RP11-849F2.7_ENST00000582471.1_Missense_Mutation_p.I67S|RPL26_ENST00000582556.1_Missense_Mutation_p.I67S|RPL26_ENST00000583011.1_Missense_Mutation_p.I67S|RPL26_ENST00000585176.1_5'UTR|RP11-849F2.5_ENST00000585181.1_RNA|RP11-849F2.5_ENST00000579904.1_RNA			P61254	RL26_HUMAN	ribosomal protein L26	67					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			skin(1)|urinary_tract(1)	2						TACTTTGCCAATTTGCTGACC	0.373																																					p.I67S		.											.	RPL26-227	0			c.T200G						.						51.0	51.0	51.0					17																	8283223		2203	4300	6503	SO:0001583	missense	6154	exon3			TTGCCAATTTGCT		CCDS11142.1	17p13	2011-04-06			ENSG00000161970	ENSG00000161970		"""L ribosomal proteins"""	10327	protein-coding gene	gene with protein product		603704				8479925	Standard	XM_005256749		Approved	L26	uc002glh.1	P61254	OTTHUMG00000108191	ENST00000584164.1:c.200T>G	17.37:g.8283223A>C	ENSP00000463784:p.Ile67Ser	101	0		117	14	NM_000987	1	0	3518	3788	269	B2R4F0|D3DTR8|Q02877|Q6IPY2	Missense_Mutation	SNP	ENST00000584164.1	37	CCDS11142.1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.367500	0.42003	.	.	ENSG00000161970	ENST00000293842	.	.	.	4.7	4.7	0.59300	KOW (2);Translation protein SH3-like (1);Ribosomal protein L24/L26, conserved site (1);Ribosomal protein L24, SH3-like (1);	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	N	0.22421	0.69	0.58432	D	0.999995	B	0.13145	0.007	B	0.25506	0.061	T	0.36016	-0.9765	9	0.37606	T	0.19	-1.2756	12.4268	0.55551	1.0:0.0:0.0:0.0	.	67	P61254	RL26_HUMAN	S	67	.	ENSP00000293842:I67S	I	-	2	0	RPL26	8223948	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.239000	0.95389	1.871000	0.54225	0.523000	0.50628	ATT	.		0.373	RPL26-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442322.1	NM_000987	
CEP95	90799	bcgsc.ca	37	17	62528114	62528114	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:62528114T>C	ENST00000556440.2	+	14	2156	c.1646T>C	c.(1645-1647)cTc>cCc	p.L549P	CEP95_ENST00000553412.1_Missense_Mutation_p.L385P|AC009994.2_ENST00000579926.1_RNA	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	549						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AGAGGTGGCCTCCCAAAGCCA	0.428																																					p.L549P													.	CEP95-23	0			c.T1646C						.						79.0	75.0	76.0					17																	62528114		1871	4096	5967	SO:0001583	missense	90799	exon14			GTGGCCTCCCAAA	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1646T>C	17.37:g.62528114T>C	ENSP00000450461:p.Leu549Pro	77	0		63	4	NM_138363	0	0	16	16	0	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	37	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363258	0.41902	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.34472	1.36;1.36	5.97	4.89	0.63831	.	0.942091	0.09055	N	0.855130	T	0.43809	0.1264	L	0.54323	1.7	0.28087	N	0.93197	D	0.56035	0.974	P	0.51135	0.66	T	0.20638	-1.0269	10	0.35671	T	0.21	0.0229	8.2179	0.31524	0.0:0.0693:0.1338:0.7969	.	549	Q96GE4	CEP95_HUMAN	P	484;549;385	ENSP00000450461:L549P;ENSP00000450906:L385P	ENSP00000438458:L484P	L	+	2	0	CEP95	59958576	0.101000	0.21875	0.994000	0.49952	0.384000	0.30261	0.957000	0.29215	1.048000	0.40298	0.533000	0.62120	CTC	.		0.428	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
GGA3	23163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73239164	73239164	+	Missense_Mutation	SNP	C	C	G	rs35542883		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:73239164C>G	ENST00000245541.6	-	6	724	c.508G>C	c.(508-510)Gat>Cat	p.D170H	GGA3_ENST00000582717.1_Missense_Mutation_p.D98H|GGA3_ENST00000582486.1_Missense_Mutation_p.D98H|GGA3_ENST00000538886.1_Missense_Mutation_p.D48H|GGA3_ENST00000578348.1_Missense_Mutation_p.D48H|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000351904.7_Missense_Mutation_p.D137H|GGA3_ENST00000537686.1_Intron	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	170	Binds to ARF1 (in long isoform).				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			TCCTCATCATCAAAAACAGGG	0.547																																					p.D170H		.											.	GGA3-154	0			c.G508C						.						161.0	149.0	153.0					17																	73239164		2203	4300	6503	SO:0001583	missense	23163	exon6			CATCATCAAAAAC	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.508G>C	17.37:g.73239164C>G	ENSP00000245541:p.Asp170His	240	0		284	77	NM_138619	0	0	0	0	0	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	ENST00000245541.6	37	CCDS11717.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879725	0.51801	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T	0.52983	2.01;0.64	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.67397	2.05	0.80722	D	1	D;P;D	0.89917	1.0;0.522;1.0	D;P;D	0.72982	0.972;0.729;0.979	T	0.69465	-0.5138	10	0.54805	T	0.06	-21.0362	18.153	0.89682	0.0:1.0:0.0:0.0	.	48;137;170	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	H	170;137;98;48	ENSP00000245541:D170H;ENSP00000326575:D137H	ENSP00000245541:D170H	D	-	1	0	GGA3	70750759	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.646000	0.83445	2.505000	0.84491	0.563000	0.77884	GAT	.		0.547	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619	
UTS2R	2837	broad.mit.edu	37	17	80333066	80333066	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:80333066C>A	ENST00000313135.2	+	1	914	c.866C>A	c.(865-867)gCg>gAg	p.A289E		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	289					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			GCCCCGCTGGCGCCGCGGACG	0.672																																					p.A289E													.	UTS2R-153	0			c.C866A						.																																			SO:0001583	missense	2837	exon1			CGCTGGCGCCGCG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.866C>A	17.37:g.80333066C>A	ENSP00000323516:p.Ala289Glu	50	2		102	13	NM_018949	0	0	0	0	0	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313287	0.40996	.	.	ENSG00000181408	ENST00000313135	T	0.72051	-0.62	4.95	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.338048	0.28257	U	0.016009	T	0.61375	0.2342	N	0.17723	0.515	0.09310	N	1	P	0.42973	0.796	P	0.50791	0.65	T	0.55711	-0.8098	10	0.07644	T	0.81	.	14.9821	0.71319	0.0:0.5448:0.4552:0.0	.	289	Q9UKP6	UR2R_HUMAN	E	289	ENSP00000323516:A289E	ENSP00000323516:A289E	A	+	2	0	UTS2R	77926355	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.380000	0.20602	0.518000	0.28383	0.637000	0.83480	GCG	.		0.672	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
RNMT	8731	ucsc.edu	37	18	13746266	13746266	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr18:13746266T>C	ENST00000383314.2	+	9	1427	c.1187T>C	c.(1186-1188)cTg>cCg	p.L396P	RNMT_ENST00000589866.1_Missense_Mutation_p.L396P|RNMT_ENST00000543302.2_Missense_Mutation_p.L396P|RNMT_ENST00000535051.1_Missense_Mutation_p.L154P|RNMT_ENST00000592764.1_Missense_Mutation_p.L396P|RNMT_ENST00000262173.3_Missense_Mutation_p.L396P			O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	396	mRNA cap 0 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00895}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA (guanine-N7)-methylation (GO:0036265)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|receptor complex (GO:0043235)	mRNA (guanine-N7-)-methyltransferase activity (GO:0004482)|RNA binding (GO:0003723)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|skin(2)	18						AAAACATTTCTGGAATTCTAC	0.308																																					p.L396P	GBM(29;474 594 19092 36647 41529)												.	RNMT-90	0			c.T1187C						.						65.0	70.0	69.0					18																	13746266		2203	4300	6503	SO:0001583	missense	8731	exon9			CATTTCTGGAATT	AF067791	CCDS11867.1	18p11.21	2008-05-14			ENSG00000101654	ENSG00000101654	2.1.1.56		10075	protein-coding gene	gene with protein product		603514				9828141, 9705270	Standard	NM_003799		Approved	RG7MT1	uc002ksl.1	O43148	OTTHUMG00000131718	ENST00000383314.2:c.1187T>C	18.37:g.13746266T>C	ENSP00000372804:p.Leu396Pro	321	0		274	1	NM_003799	0	0	0	0	0	B0YJ90|D3DUJ5|O94996|Q9UIJ9	Missense_Mutation	SNP	ENST00000383314.2	37	CCDS11867.1	.	.	.	.	.	.	.	.	.	.	T	8.940	0.965691	0.18583	.	.	ENSG00000101654	ENST00000383314;ENST00000535051;ENST00000543302;ENST00000262173	.	.	.	5.55	3.11	0.35812	.	0.418121	0.25935	N	0.027358	T	0.39682	0.1087	N	0.16307	0.4	0.48830	D	0.999714	B;B	0.26876	0.134;0.162	B;B	0.31495	0.108;0.131	T	0.09422	-1.0675	9	0.27082	T	0.32	-28.1696	9.4478	0.38708	0.1136:0.0:0.4992:0.3872	.	396;396	O43148-2;O43148	.;MCES_HUMAN	P	396;154;396;396	.	ENSP00000262173:L396P	L	+	2	0	RNMT	13736266	0.510000	0.26171	1.000000	0.80357	0.841000	0.47740	0.549000	0.23329	0.376000	0.24707	-0.680000	0.03767	CTG	.		0.308	RNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254636.1	NM_003799	
CTAGE1	64693	broad.mit.edu	37	18	19995948	19995948	+	5'Flank	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr18:19995948G>C	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Silent_p.L609L			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TAAAACTTCTGAGTTCTGCTG	0.388																																					p.L609L													.	CTAGE1-1	0			c.C1827G						.						89.0	97.0	94.0					18																	19995948		2190	4291	6481	SO:0001631	upstream_gene_variant	64693	exon1			ACTTCTGAGTTCT	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995948G>C	Exception_encountered	156	1		120	11	NM_172241	0	0	13	13	0	B0YIZ3	Silent	SNP	ENST00000525417.1	37																																																																																				.		0.388	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241	
GRIN3B	116444	hgsc.bcm.edu	37	19	1003374	1003374	+	Silent	SNP	G	G	A	rs34585248	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:1003374G>A	ENST00000234389.3	+	2	691	c.672G>A	c.(670-672)gcG>gcA	p.A224A	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	224					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGATGGCGGCGCCAGTGGGGG	0.746													g|||	158	0.0315495	0.0015	0.0173	5008	,	,		11320	0.0754		0.0338	False		,,,				2504	0.0348				p.A224A		.											.	GRIN3B-90	0			c.G672A						.	G		37,3905		0,37,1934	4.0	6.0	5.0		672	-8.1	0.0	19	dbSNP_126	5	211,7611		3,205,3703	no	coding-synonymous	GRIN3B	NM_138690.1		3,242,5637	AA,AG,GG		2.6975,0.9386,2.1081		224/1044	1003374	248,11516	1971	3911	5882	SO:0001819	synonymous_variant	116444	exon2			GGCGGCGCCAGTG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.672G>A	19.37:g.1003374G>A		5	0		60	36	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Silent	SNP	ENST00000234389.3	37	CCDS32861.1																																																																																			G|0.966;A|0.034		0.746	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9058716	9058716	+	Nonsense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:9058716G>C	ENST00000397910.4	-	3	28933	c.28730C>G	c.(28729-28731)tCa>tGa	p.S9577*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9579	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATGACATTGACTCTATCTC	0.488																																					p.S9577X		.											.	MUC16-566	0			c.C28730G						.						90.0	84.0	86.0					19																	9058716		2003	4163	6166	SO:0001587	stop_gained	94025	exon3			GACATTGACTCTA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28730C>G	19.37:g.9058716G>C	ENSP00000381008:p.Ser9577*	154	0		155	31	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	60	44.522612	0.99986	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.5	1.41	0.22369	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.6673	0.23047	0.0:0.0:0.7208:0.2792	.	.	.	.	X	9577	.	ENSP00000381008:S9577X	S	-	2	0	MUC16	8919716	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.009000	0.12765	0.597000	0.29811	0.305000	0.20034	TCA	.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF257	113835	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	22271296	22271296	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:22271296G>A	ENST00000594947.1	+	4	888	c.744G>A	c.(742-744)aaG>aaA	p.K248K		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTCAACATAAGGTAATTCATA	0.388																																					p.K248K													.	ZNF257-90	0			c.G744A						.						37.0	40.0	39.0					19																	22271296		2124	4259	6383	SO:0001819	synonymous_variant	113835	exon4			ACATAAGGTAATT	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.744G>A	19.37:g.22271296G>A		81	1		71	7	NM_033468	0	0	0	0	0	B3KPS4|E9PG34|Q8NE34	Silent	SNP	ENST00000594947.1	37	CCDS46030.1																																																																																			.		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
PRKCG	5582	broad.mit.edu	37	19	54401866	54401866	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:54401866C>G	ENST00000263431.3	+	11	1547	c.1265C>G	c.(1264-1266)tCc>tGc	p.S422C	PRKCG_ENST00000540413.1_Missense_Mutation_p.S422C|PRKCG_ENST00000542049.1_Missense_Mutation_p.S309C	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	422	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CAGCTCCACTCCACCTTCCAG	0.657																																					p.S422C													.	PRKCG-1367	0			c.C1265G						.						10.0	11.0	10.0					19																	54401866		2188	4281	6469	SO:0001583	missense	5582	exon11			TCCACTCCACCTT	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1265C>G	19.37:g.54401866C>G	ENSP00000263431:p.Ser422Cys	89	0		89	9	NM_002739	0	0	4	4	0	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861903	0.51482	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	T;T;T	0.25749	1.78;1.78;1.78	5.02	2.85	0.33270	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.20088	0.0483	N	0.21448	0.665	0.48040	D	0.999578	B;P;P	0.45531	0.0;0.86;0.732	B;P;P	0.46479	0.003;0.501;0.518	T	0.01863	-1.1258	9	0.34782	T	0.22	.	8.9808	0.35964	0.0:0.7671:0.1491:0.0838	.	309;422;422	B7Z8Q0;F5H5C4;P05129	.;.;KPCG_HUMAN	C	422;422;309	ENSP00000443493:S422C;ENSP00000263431:S422C;ENSP00000438090:S309C	ENSP00000263431:S422C	S	+	2	0	PRKCG	59093678	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	2.711000	0.47177	0.629000	0.30376	-0.291000	0.09656	TCC	.		0.657	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
MBOAT7	79143	broad.mit.edu	37	19	54684811	54684811	+	Missense_Mutation	SNP	T	T	C	rs200188828		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:54684811T>C	ENST00000245615.1	-	6	1013	c.533A>G	c.(532-534)gAg>gGg	p.E178G	MBOAT7_ENST00000474910.1_5'Flank|MBOAT7_ENST00000431666.2_Missense_Mutation_p.E105G|MBOAT7_ENST00000338624.6_Missense_Mutation_p.E105G|MBOAT7_ENST00000391754.1_Missense_Mutation_p.E178G	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	178					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAAGGGCTGCTCCAGCCAGTC	0.721											OREG0003644	type=REGULATORY REGION|Gene=AK123290|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.E178G	NSCLC(97;826 2151 10470 22540)												.	MBOAT7-68	0			c.A533G						.						2.0	4.0	3.0					19																	54684811		1737	3558	5295	SO:0001583	missense	79143	exon6			GGCTGCTCCAGCC	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.533A>G	19.37:g.54684811T>C	ENSP00000245615:p.Glu178Gly	12	0	1002	38	9	NM_001146082	0	0	5	5	0	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	ENST00000245615.1	37	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	t	15.07	2.724382	0.48728	.	.	ENSG00000125505	ENST00000431666;ENST00000338624;ENST00000245615;ENST00000391754;ENST00000414665	T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89	4.06	4.06	0.47325	.	0.184664	0.23762	U	0.044815	T	0.65123	0.2661	L	0.46157	1.445	0.31189	N	0.701203	B;B;P	0.39576	0.351;0.302;0.679	B;B;B	0.35039	0.129;0.057;0.194	T	0.70410	-0.4879	10	0.42905	T	0.14	-18.9591	12.37	0.55250	0.0:0.0:0.0:1.0	.	160;105;178	B4DDH8;Q96N66-2;Q96N66	.;.;MBOA7_HUMAN	G	105;105;178;178;178	ENSP00000410503:E105G;ENSP00000344377:E105G;ENSP00000245615:E178G;ENSP00000375634:E178G;ENSP00000388250:E178G	ENSP00000245615:E178G	E	-	2	0	MBOAT7	59376623	0.351000	0.24887	1.000000	0.80357	0.817000	0.46193	0.664000	0.25068	1.646000	0.50622	0.446000	0.29264	GAG	.		0.721	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298	
PPP6R1	22870	broad.mit.edu	37	19	55743012	55743012	+	Silent	SNP	T	T	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:55743012T>G	ENST00000412770.2	-	20	2897	c.2331A>C	c.(2329-2331)tcA>tcC	p.S777S	AC010327.1_ENST00000581390.1_RNA|PPP6R1_ENST00000587283.1_Silent_p.S777S|TMEM86B_ENST00000327042.4_5'Flank	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	777	Pro-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CCTGAGGTGCTGAGGGGGGTG	0.667																																					p.S777S													.	PPP6R1-67	0			c.A2331C						.						24.0	29.0	27.0					19																	55743012		1983	4161	6144	SO:0001819	synonymous_variant	22870	exon20			AGGTGCTGAGGGG	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.2331A>C	19.37:g.55743012T>G		60	0		68	5	NM_014931	0	0	51	59	8	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Silent	SNP	ENST00000412770.2	37	CCDS46186.1																																																																																			.		0.667	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
ZNF814	730051	ucsc.edu	37	19	58384712	58384712	+	Silent	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:58384712A>G	ENST00000435989.2	-	3	2280	c.2046T>C	c.(2044-2046)caT>caC	p.H682H	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	682					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCTCCAGTATGGCCATGCT	0.408																																					p.H682H													.	.	0			c.T2046C						.						68.0	57.0	60.0					19																	58384712		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			TCCAGTATGGCCA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2046T>C	19.37:g.58384712A>G		160	0		142	1	NM_001144989	0	0	2	2	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
RMDN2	151393	bcgsc.ca	37	2	38156861	38156861	+	Silent	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:38156861A>G	ENST00000406384.1	+	2	635	c.441A>G	c.(439-441)gaA>gaG	p.E147E	RMDN2_ENST00000354545.2_Silent_p.E147E	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	147						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											AGGAAGCAGAAAGTGAAGGAG	0.338																																					p.E147E													.	.	0			c.A441G						.						29.0	27.0	28.0					2																	38156861		692	1591	2283	SO:0001819	synonymous_variant	151393	exon2			AGCAGAAAGTGAA	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.441A>G	2.37:g.38156861A>G		80	1		65	4	NM_001170792	0	0	0	0	0	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Silent	SNP	ENST00000406384.1	37	CCDS54351.1																																																																																			.		0.338	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
ALMS1	7840	broad.mit.edu	37	2	73675809	73675809	+	Nonsense_Mutation	SNP	A	A	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:73675809A>T	ENST00000264448.6	+	8	2263	c.2152A>T	c.(2152-2154)Aga>Tga	p.R718*	ALMS1_ENST00000377715.1_Nonsense_Mutation_p.R718*|ALMS1_ENST00000409009.1_Nonsense_Mutation_p.R676*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	718	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CCACTCACATAGAGAGAAGCC	0.478																																					p.R718X													.	ALMS1-142	0			c.A2152T						.						126.0	123.0	124.0					2																	73675809		1876	4104	5980	SO:0001587	stop_gained	7840	exon8			TCACATAGAGAGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2152A>T	2.37:g.73675809A>T	ENSP00000264448:p.Arg718*	71	0		91	3	NM_015120	0	0	0	0	0	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	32	5.117870	0.94385	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	.	.	.	4.11	-2.77	0.05877	.	0.983825	0.08315	N	0.964810	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	5.0571	0.14539	0.4523:0.1607:0.387:0.0	.	.	.	.	X	676;718;718	.	ENSP00000264448:R718X	R	+	1	2	ALMS1	73529317	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.167000	0.09940	-0.488000	0.06726	0.533000	0.62120	AGA	.		0.478	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
PHOSPHO2	493911	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170557975	170557975	+	Nonsense_Mutation	SNP	T	T	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:170557975T>A	ENST00000359744.3	+	4	882	c.494T>A	c.(493-495)tTa>tAa	p.L165*	KLHL23_ENST00000272797.4_Intron|KLHL23_ENST00000602521.1_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	165							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						GATAAACAGTTACAACAGGGA	0.343																																					p.L165X													.	PHOSPHO2-91	0			c.T494A						.						67.0	68.0	67.0					2																	170557975		2202	4299	6501	SO:0001587	stop_gained	493911	exon4			AACAGTTACAACA	BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.494T>A	2.37:g.170557975T>A	ENSP00000352782:p.Leu165*	87	0		53	6	NM_001199286	0	0	2	2	0	B2RC30|D3DPC7	Nonsense_Mutation	SNP	ENST00000359744.3	37	CCDS33319.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368506	0.42003	.	.	ENSG00000144362	ENST00000359744	.	.	.	6.06	0.949	0.19566	.	0.731679	0.12670	U	0.448875	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	9.8927	0.41300	0.0:0.3207:0.0:0.6793	.	.	.	.	X	165	.	ENSP00000352782:L165X	L	+	2	0	PHOSPHO2	170266221	0.716000	0.27956	0.041000	0.18516	0.050000	0.14768	1.014000	0.29950	0.172000	0.19760	-0.250000	0.11733	TTA	.		0.343	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333304.1	NM_001008489	
TASP1	55617	broad.mit.edu	37	20	13561621	13561621	+	Silent	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr20:13561621C>T	ENST00000337743.4	-	6	531	c.411G>A	c.(409-411)aaG>aaA	p.K137K	TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	137					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						AGACTGGGTTCTTGATTCCta	0.408																																					p.K137K													.	TASP1-90	0			c.G411A						.						78.0	77.0	77.0					20																	13561621		2203	4300	6503	SO:0001819	synonymous_variant	55617	exon6			TGGGTTCTTGATT	AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.411G>A	20.37:g.13561621C>T		41	2		26	6	NM_017714	0	0	0	0	0	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Silent	SNP	ENST00000337743.4	37	CCDS13116.1																																																																																			.		0.408	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
LAMA5	3911	broad.mit.edu	37	20	60895706	60895706	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr20:60895706A>C	ENST00000252999.3	-	50	6734	c.6668T>G	c.(6667-6669)cTg>cGg	p.L2223R		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2223	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.L2223R(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCGGGGGCCCAGGGGGCTCCG	0.706																																					p.L2223R													.	LAMA5-93	1	Substitution - Missense(1)	kidney(1)	c.T6668G						.																																			SO:0001583	missense	3911	exon50			GGGCCCAGGGGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6668T>G	20.37:g.60895706A>C	ENSP00000252999:p.Leu2223Arg	55	5		90	25	NM_005560	0	0	3	3	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	1.825	-0.471240	0.04445	.	.	ENSG00000130702	ENST00000252999	T	0.10860	2.83	4.01	-3.35	0.04928	Laminin I (1);	1.233460	0.05846	U	0.620293	T	0.06781	0.0173	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.43278	-0.9401	10	0.13470	T	0.59	.	6.2822	0.21013	0.5127:0.1317:0.3557:0.0	.	2223	O15230	LAMA5_HUMAN	R	2223	ENSP00000252999:L2223R	ENSP00000252999:L2223R	L	-	2	0	LAMA5	60329101	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-2.320000	0.01119	-0.781000	0.04548	-0.402000	0.06365	CTG	.		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30057329	30057329	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:30057329G>A	ENST00000338641.4	+	8	1251		c.e8+1		NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000413209.2_Intron|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000361676.4_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000334961.7_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(5)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TGACAAGGAGGTAGGACATGT	0.532			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	5	Unknown(5)	meninges(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.810+1G>A						.						117.0	108.0	111.0					22																	30057329		2203	4300	6503	SO:0001630	splice_region_variant	4771	exon8	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	AAGGAGGTAGGAC	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.810+1G>A	22.37:g.30057329G>A		68	0		42	14	NM_016418	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	33	5.287845	0.95517	.	.	ENSG00000186575	ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0795	0.97766	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28387329	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.864000	0.99589	2.747000	0.94245	0.650000	0.86243	.	.		0.532	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
MIRLET7BHG	400931	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46501510	46501510	+	Silent	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:46501510C>T	ENST00000381051.2	+	5	482	c.429C>T	c.(427-429)tcC>tcT	p.S143S	FLJ27365_ENST00000360737.3_Intron																							CAGAACATTCCGTCACCACGA	0.642																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	400931	.			ACATTCCGTCACC																												ENST00000381051.2:c.429C>T	22.37:g.46501510C>T		124	1		101	32	.	0	0	0	0	0		RNA	SNP	ENST00000381051.2	37																																																																																				.		0.642	FLJ27365-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316783.1		
IL17RC	84818	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9959173	9959173	+	Silent	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:9959173C>T	ENST00000295981.3	+	1	392	c.174C>T	c.(172-174)agC>agT	p.S58S	IL17RC_ENST00000498214.1_Intron|IL17RC_ENST00000403601.3_Intron|IL17RC_ENST00000416074.2_Intron|IL17RC_ENST00000383812.4_Intron|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000455057.1_Intron|IL17RC_ENST00000413608.1_Intron	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	58					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAAGCCTTAGCCTGGCTCCTG	0.592																																					p.S58S													.	IL17RC-92	0			c.C174T						.						81.0	85.0	84.0					3																	9959173		2203	4300	6503	SO:0001819	synonymous_variant	84818	exon1			CCTTAGCCTGGCT	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.174C>T	3.37:g.9959173C>T		160	1		193	20	NM_153461	0	0	0	3	3	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	ENST00000295981.3	37	CCDS2590.1																																																																																			.		0.592	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
ROBO1	6091	ucsc.edu	37	3	78685208	78685208	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:78685208G>A	ENST00000464233.1	-	23	3201	c.3088C>T	c.(3088-3090)Ctg>Ttg	p.L1030L	ROBO1_ENST00000436010.2_Silent_p.L991L|ROBO1_ENST00000495273.1_Silent_p.L985L|ROBO1_ENST00000467549.1_Intron	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1030					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GGGAGCATCAGATTTGTTTGT	0.378																																					p.L1030L													.	ROBO1-67	0			c.C3088T						.						66.0	65.0	66.0					3																	78685208		1907	4115	6022	SO:0001819	synonymous_variant	6091	exon23			GCATCAGATTTGT	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3088C>T	3.37:g.78685208G>A		163	0		199	1	NM_002941	0	0	0	0	0	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																			.		0.378	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
CD96	10225	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	111297955	111297955	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:111297955C>T	ENST00000283285.5	+	5	804	c.673C>T	c.(673-675)Ctt>Ttt	p.L225F	CD96_ENST00000438817.2_Missense_Mutation_p.L209F|CD96_ENST00000352690.4_Missense_Mutation_p.L209F	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	225	Ig-like V-type 2.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TAGAGTCAAGCTTGGTACAGA	0.423									Opitz Trigonocephaly syndrome																												p.L225F		.											.	CD96-93	0			c.C673T						.						120.0	108.0	112.0					3																	111297955		2203	4300	6503	SO:0001583	missense	10225	exon5	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	GTCAAGCTTGGTA	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.673C>T	3.37:g.111297955C>T	ENSP00000283285:p.Leu225Phe	178	0		178	14	NM_198196	0	0	12	12	0	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	CCDS2959.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.734|5.734	0.319968|0.319968	0.10845|0.10845	.|.	.|.	ENSG00000153283|ENSG00000153283	ENST00000465428|ENST00000352690;ENST00000283285;ENST00000438817	.|T;T;T	.|0.73258	.|1.54;-0.73;1.54	5.18|5.18	1.28|1.28	0.21552|0.21552	.|Immunoglobulin subtype (1);	.|0.567715	.|0.14720	.|N	.|0.302408	T|T	0.59702|0.59702	0.2213|0.2213	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|P;P;P;P	.|0.44946	.|0.761;0.846;0.761;0.761	.|B;P;B;B	.|0.46585	.|0.322;0.521;0.443;0.322	T|T	0.50800|0.50800	-0.8785|-0.8785	5|10	.|0.51188	.|T	.|0.08	-0.8167|-0.8167	5.5178|5.5178	0.16916|0.16916	0.2453:0.5587:0.1213:0.0747|0.2453:0.5587:0.1213:0.0747	.|.	.|209;209;225;209	.|E9PEJ1;P40200-2;P40200;Q8WUE2	.|.;.;TACT_HUMAN;.	V|F	50|209;225;209	.|ENSP00000342040:L209F;ENSP00000283285:L225F;ENSP00000389801:L209F	.|ENSP00000283285:L225F	A|L	+|+	2|1	0|0	CD96|CD96	112780645|112780645	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	0.121000|0.121000	0.15667|0.15667	-0.203000|-0.203000	0.10251|0.10251	-1.886000|-1.886000	0.00541|0.00541	GCT|CTT	.		0.423	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
GSK3B	2932	bcgsc.ca	37	3	119642255	119642255	+	Silent	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:119642255G>T	ENST00000264235.8	-	4	1424	c.442C>A	c.(442-444)Cga>Aga	p.R148R	GSK3B_ENST00000316626.5_Silent_p.R148R	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	TGTTTGGCTCGACTATAGTGT	0.358																																					p.R148R													.	GSK3B-978	0			c.C442A						.						62.0	59.0	60.0					3																	119642255		2203	4300	6503	SO:0001819	synonymous_variant	2932	exon4			TGGCTCGACTATA	BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.442C>A	3.37:g.119642255G>T		53	0		51	4	NM_002093	0	0	3	3	0	D3DN89|Q9BWH3|Q9UL47	Silent	SNP	ENST00000264235.8	37	CCDS54628.1																																																																																			.		0.358	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2		
ZIC1	7545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	147128794	147128794	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:147128794G>T	ENST00000282928.4	+	1	1624	c.895G>T	c.(895-897)Gag>Tag	p.E299*		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	299					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCACACGGGCGAGAAGCCCTT	0.562																																					p.E299X		.											.	ZIC1-91	0			c.G895T						.						91.0	94.0	93.0					3																	147128794		2203	4300	6503	SO:0001587	stop_gained	7545	exon1			ACGGGCGAGAAGC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.895G>T	3.37:g.147128794G>T	ENSP00000282928:p.Glu299*	169	0		160	36	NM_003412	0	0	0	0	0	Q2M3N1	Nonsense_Mutation	SNP	ENST00000282928.4	37	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	G	43	9.911065	0.99294	.	.	ENSG00000152977	ENST00000282928	.	.	.	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.2006	0.82071	0.0:0.0:1.0:0.0	.	.	.	.	X	299	.	ENSP00000282928:E299X	E	+	1	0	ZIC1	148611484	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.528000	0.81941	1.862000	0.54008	0.561000	0.74099	GAG	.		0.562	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
MAEA	10296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1332242	1332242	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:1332242G>A	ENST00000303400.4	+	8	995	c.932G>A	c.(931-933)aGc>aAc	p.S311N	MAEA_ENST00000514708.1_Missense_Mutation_p.S243N|MAEA_ENST00000505177.2_Missense_Mutation_p.S349N|MAEA_ENST00000264750.6_Missense_Mutation_p.S270N|MAEA_ENST00000452175.2_Missense_Mutation_p.S232N|MAEA_ENST00000505839.1_Missense_Mutation_p.S263N|MAEA_ENST00000512289.1_3'UTR|MAEA_ENST00000510794.1_Missense_Mutation_p.S310N	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	311					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	AGCTCCAAGAGCCCTGACTGC	0.662																																					p.S311N		.											.	MAEA-91	0			c.G932A						.						61.0	61.0	61.0					4																	1332242		2203	4300	6503	SO:0001583	missense	10296	exon8			CCAAGAGCCCTGA	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.932G>A	4.37:g.1332242G>A	ENSP00000302830:p.Ser311Asn	76	0		68	18	NM_001017405	0	0	6	11	5	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	7.811	0.715683	0.15306	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000452175;ENST00000514708;ENST00000510794;ENST00000505839	T;T;T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84;2.84;2.84	5.41	4.44	0.53790	.	0.178095	0.64402	D	0.000005	T	0.04770	0.0129	N	0.20328	0.56	0.46260	D	0.998958	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0;0.0	T	0.34254	-0.9836	10	0.05959	T	0.93	-33.7543	3.5266	0.07761	0.3654:0.0:0.6346:0.0	.	310;349;97;243;270;311	B4DVN3;E7ESC7;B3KRN7;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;.;MAEA_HUMAN	N	311;349;270;243;290;232;243;310;263	ENSP00000302830:S311N;ENSP00000422215:S349N;ENSP00000264750:S270N;ENSP00000411415:S232N;ENSP00000427512:S243N;ENSP00000426807:S310N;ENSP00000424436:S263N	ENSP00000264750:S270N	S	+	2	0	MAEA	1322242	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.331000	0.79192	2.531000	0.85337	0.655000	0.94253	AGC	.		0.662	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
SLC30A9	10463	ucsc.edu	37	4	42077746	42077746	+	Silent	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:42077746T>C	ENST00000264451.7	+	16	1671	c.1491T>C	c.(1489-1491)gaT>gaC	p.D497D		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	497					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAGATTTTGATGGGCGAGTTG	0.323																																					p.D497D													.	SLC30A9-91	0			c.T1491C						.						108.0	107.0	108.0					4																	42077746		2203	4300	6503	SO:0001819	synonymous_variant	10463	exon16			TTTTGATGGGCGA	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1491T>C	4.37:g.42077746T>C		280	0		236	1	NM_006345	0	0	7	7	0	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Silent	SNP	ENST00000264451.7	37	CCDS3465.1																																																																																			.		0.323	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
TLL1	7092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	166996130	166996130	+	Silent	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:166996130T>C	ENST00000061240.2	+	17	2936	c.2289T>C	c.(2287-2289)caT>caC	p.H763H	TLL1_ENST00000507499.1_Silent_p.H786H	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	763	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTGTGCTACATGACAATAAAC	0.403																																					p.H763H		.											.	TLL1-158	0			c.T2289C						.						296.0	244.0	262.0					4																	166996130		2203	4300	6503	SO:0001819	synonymous_variant	7092	exon17			GCTACATGACAAT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2289T>C	4.37:g.166996130T>C		223	0		161	18	NM_012464	0	0	0	0	0	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	CCDS3811.1																																																																																			.		0.403	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
FCHO2	115548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	72359736	72359736	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:72359736C>A	ENST00000430046.2	+	18	1530	c.1414C>A	c.(1414-1416)Ctt>Att	p.L472I	FCHO2_ENST00000512348.1_Missense_Mutation_p.L439I|FCHO2_ENST00000341845.6_Missense_Mutation_p.L472I	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	472	Ser-rich.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		CAGACCAAAGCTTACTTCAGG	0.403																																					p.L472I		.											.	FCHO2-23	0			c.C1414A						.						65.0	61.0	62.0					5																	72359736		1850	4087	5937	SO:0001583	missense	115548	exon18			CCAAAGCTTACTT	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.1414C>A	5.37:g.72359736C>A	ENSP00000393776:p.Leu472Ile	193	0		139	43	NM_138782	0	0	0	0	0	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967806	0.74131	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.39056	1.1;1.11;3.55	5.62	5.62	0.85841	.	0.164332	0.40728	N	0.001021	T	0.52933	0.1765	L	0.56769	1.78	0.41260	D	0.986778	D;D	0.67145	0.99;0.996	P;P	0.60415	0.76;0.874	T	0.43956	-0.9359	10	0.18710	T	0.47	-12.133	12.5234	0.56073	0.0:0.8806:0.0:0.1194	.	439;472	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	I	472;472;439	ENSP00000393776:L472I;ENSP00000344034:L472I;ENSP00000427296:L439I	ENSP00000344034:L472I	L	+	1	0	FCHO2	72395492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.706000	0.47135	2.637000	0.89404	0.650000	0.86243	CTT	.		0.403	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
IQGAP2	10788	broad.mit.edu	37	5	75960882	75960882	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:75960882A>T	ENST00000274364.6	+	22	2858	c.2561A>T	c.(2560-2562)aAg>aTg	p.K854M	IQGAP2_ENST00000379730.3_Missense_Mutation_p.K356M|IQGAP2_ENST00000396234.3_Missense_Mutation_p.K350M|IQGAP2_ENST00000502745.1_Missense_Mutation_p.K350M	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	854					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGCTGAACAAGAAAAAAGGA	0.328																																					p.K854M													.	IQGAP2-96	0			c.A2561T						.						87.0	84.0	85.0					5																	75960882		2203	4300	6503	SO:0001583	missense	10788	exon22			TGAACAAGAAAAA	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2561A>T	5.37:g.75960882A>T	ENSP00000274364:p.Lys854Met	143	0		134	4	NM_006633	0	0	0	0	0	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.530557	0.85706	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000502745	T;T;T;T;T;T	0.05717	4.11;4.02;4.09;3.4;4.02;4.02	5.3	5.3	0.74995	.	0.197976	0.52532	D	0.000072	T	0.25494	0.0620	M	0.78344	2.41	0.58432	D	0.999997	D;D;D;D	0.76494	0.999;0.999;0.998;0.997	D;D;D;P	0.70935	0.967;0.971;0.952;0.88	T	0.01165	-1.1431	10	0.72032	D	0.01	-31.5248	14.9093	0.70743	1.0:0.0:0.0:0.0	.	356;804;350;854	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	M	854;356;804;407;350;350	ENSP00000274364:K854M;ENSP00000442313:K356M;ENSP00000421097:K804M;ENSP00000422661:K407M;ENSP00000379535:K350M;ENSP00000426027:K350M	ENSP00000274364:K854M	K	+	2	0	IQGAP2	75996638	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.105000	0.94246	1.993000	0.58246	0.482000	0.46254	AAG	.		0.328	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
NR3C1	2908	ucsc.edu	37	5	142680190	142680190	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:142680190A>G	ENST00000343796.2	-	5	2600	c.1607T>C	c.(1606-1608)tTg>tCg	p.L536S	NR3C1_ENST00000394464.2_Missense_Mutation_p.L536S|NR3C1_ENST00000415690.2_Missense_Mutation_p.L536S|NR3C1_ENST00000394466.2_Missense_Mutation_p.L537S|NR3C1_ENST00000504336.1_5'UTR|NR3C1_ENST00000231509.3_Missense_Mutation_p.L537S|NR3C1_ENST00000424646.2_Missense_Mutation_p.L510S|NR3C1_ENST00000504572.1_Missense_Mutation_p.L537S|NR3C1_ENST00000503201.1_Missense_Mutation_p.L536S|NR3C1_ENST00000416954.2_Missense_Mutation_p.L139S	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	536	Interaction with CLOCK.|Interaction with CRY1.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	AATAACCTCCAACAGTGACAC	0.463																																					p.L537S													.	NR3C1-92	0			c.T1610C						.						233.0	213.0	220.0					5																	142680190		2203	4300	6503	SO:0001583	missense	2908	exon5			ACCTCCAACAGTG	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1607T>C	5.37:g.142680190A>G	ENSP00000343205:p.Leu536Ser	217	0		183	2	NM_001024094	0	0	7	7	0	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697339	0.88830	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;T;D;D;D;D;D;D	0.96619	-4.07;-4.07;1.06;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.69	5.69	0.88448	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.98595	0.9530	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.99686	1.1000	10	0.72032	D	0.01	.	15.94	0.79747	1.0:0.0:0.0:0.0	.	536;536;537	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	S	536;536;536;510;537;537;537;139;536	ENSP00000377977:L536S;ENSP00000343205:L536S;ENSP00000387672:L536S;ENSP00000405282:L510S;ENSP00000422518:L537S;ENSP00000377979:L537S;ENSP00000231509:L537S;ENSP00000404218:L139S;ENSP00000427672:L536S	ENSP00000231509:L537S	L	-	2	0	NR3C1	142660383	1.000000	0.71417	0.963000	0.40424	0.919000	0.55068	6.979000	0.76154	2.156000	0.67533	0.533000	0.62120	TTG	.		0.463	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
PXDC1	221749	broad.mit.edu	37	6	3751742	3751742	+	Silent	SNP	G	G	T	rs199672547		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr6:3751742G>T	ENST00000380283.4	-	1	518	c.24C>A	c.(22-24)ggC>ggA	p.G8G	PXDC1_ENST00000477592.2_5'UTR|RP11-420L9.5_ENST00000603791.1_RNA	NM_183373.3	NP_899229.2	Q5TGL8	PXDC1_HUMAN	PX domain containing 1	8	PX.						phosphatidylinositol binding (GO:0035091)										CGAGCGACGTGCCCTCAAACA	0.726																																					p.G8G													.	.	0			c.C24A						.						14.0	13.0	13.0					6																	3751742		2177	4274	6451	SO:0001819	synonymous_variant	221749	exon1			CGACGTGCCCTCA	AJ420534	CCDS4486.1	6p25.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000168994	ENSG00000168994			21361	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 145"""	C6orf145			Standard	NM_183373		Approved		uc003mvt.2	Q5TGL8	OTTHUMG00000014146	ENST00000380283.4:c.24C>A	6.37:g.3751742G>T		53	1		69	5	NM_183373	0	0	5	5	0	A8K0N3|Q6PGP0|Q86XB7	Silent	SNP	ENST00000380283.4	37	CCDS4486.1																																																																																			G|0.996;A|0.004		0.726	PXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039688.1	NM_183373	
APOM	55937	broad.mit.edu	37	6	31625014	31625014	+	Silent	SNP	C	C	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr6:31625014C>G	ENST00000375916.3	+	3	778	c.282C>G	c.(280-282)ctC>ctG	p.L94L	C6orf47-AS1_ENST00000422049.1_RNA|APOM_ENST00000375920.4_Silent_p.L22L|APOM_ENST00000375918.2_Silent_p.L22L	NM_019101.2	NP_061974.2	O95445	APOM_HUMAN	apolipoprotein M	94					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|response to glucose (GO:0009749)|reverse cholesterol transport (GO:0043691)	discoidal high-density lipoprotein particle (GO:0034365)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|lipid transporter activity (GO:0005319)|phospholipid binding (GO:0005543)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(1)	7						AAGATGGGCTCTGTGTGCCCC	0.507																																					p.L94L	Colon(39;129 858 13764 41453 42617)												.	APOM-90	0			c.C282G						.						117.0	106.0	110.0					6																	31625014		1510	2709	4219	SO:0001819	synonymous_variant	55937	exon3			TGGGCTCTGTGTG	AJ245434	CCDS4710.1, CCDS59004.1	6p21	2014-01-22			ENSG00000204444	ENSG00000204444		"""Apolipoproteins"", ""Lipocalins"""	13916	protein-coding gene	gene with protein product		606907				10531326, 11418126	Standard	NM_019101		Approved	ApoM, G3a, NG20	uc003nvl.3	O95445	OTTHUMG00000031250	ENST00000375916.3:c.282C>G	6.37:g.31625014C>G		111	0		102	4	NM_019101	0	0	0	0	0	B0UX98|Q5SRP4|Q9P046|Q9UMP6	Silent	SNP	ENST00000375916.3	37	CCDS4710.1																																																																																			.		0.507	APOM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076527.3	NM_019101	
RARS2	57038	ucsc.edu;bcgsc.ca	37	6	88299660	88299660	+	Missense_Mutation	SNP	G	G	A	rs201899366	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr6:88299660G>A	ENST00000369536.5	-	1	61	c.16C>T	c.(16-18)Cgc>Tgc	p.R6C	ORC3_ENST00000417380.2_5'Flank|ORC3_ENST00000257789.4_5'Flank|ORC3_ENST00000392844.3_5'Flank|ORC3_ENST00000546266.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	6					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.R6C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		ATAGCGCGGCGAAAGCCGCAC	0.672											OREG0031911	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	G|||	2	0.000399361	0.0	0.0014	5008	,	,		12638	0.001		0.0	False		,,,				2504	0.0				p.R6C													.	RARS2-92	1	Substitution - Missense(1)	breast(1)	c.C16T						.						26.0	32.0	30.0					6																	88299660		2202	4300	6502	SO:0001583	missense	57038	exon1			CGCGGCGAAAGCC	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.16C>T	6.37:g.88299660G>A	ENSP00000358549:p.Arg6Cys	83	11	1258	81	34	NM_020320	0	0	3	3	0	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	CCDS5011.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.34	3.364729	0.61513	.	.	ENSG00000146282	ENST00000369536	T	0.73897	-0.79	5.11	5.11	0.69529	Arginyl tRNA synthetase, class Ia, N-terminal (2);	0.101495	0.64402	D	0.000003	T	0.70753	0.3260	L	0.55481	1.735	0.80722	D	1	D	0.69078	0.997	P	0.50231	0.635	T	0.75277	-0.3374	10	0.87932	D	0	.	14.2251	0.65853	0.0:0.0:1.0:0.0	.	6	Q5T160	SYRM_HUMAN	C	6	ENSP00000358549:R6C	ENSP00000358549:R6C	R	-	1	0	RARS2	88356379	1.000000	0.71417	0.978000	0.43139	0.031000	0.12232	2.529000	0.45632	2.826000	0.97356	0.655000	0.94253	CGC	G|0.999;A|0.000		0.672	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
MTRF1L	54516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	153315714	153315714	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr6:153315714C>G	ENST00000367233.5	-	4	620	c.621G>C	c.(619-621)aaG>aaC	p.K207N	MTRF1L_ENST00000367230.1_Missense_Mutation_p.K171N|MTRF1L_ENST00000367231.5_Missense_Mutation_p.K207N|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	207						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		GCTTTTCTGTCTTTGGCACTC	0.502																																					p.K207N		.											.	MTRF1L-90	0			c.G621C						.						164.0	143.0	150.0					6																	153315714		2203	4300	6503	SO:0001583	missense	54516	exon4			TTCTGTCTTTGGC	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.621G>C	6.37:g.153315714C>G	ENSP00000356202:p.Lys207Asn	113	0		112	14	NM_019041	0	0	1	1	0	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	37	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560810	0.65538	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771;ENST00000448966	T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76	4.97	3.11	0.35812	.	0.096199	0.64402	D	0.000001	T	0.18718	0.0449	M	0.78801	2.425	0.40959	D	0.984603	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.76071	0.964;0.973;0.987;0.974	T	0.01102	-1.1451	10	0.56958	D	0.05	-12.0679	8.928	0.35652	0.0:0.7454:0.0:0.2546	.	171;207;171;207	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	N	207;207;171;58;71	ENSP00000356202:K207N;ENSP00000356200:K207N;ENSP00000356199:K171N;ENSP00000414383:K58N;ENSP00000415113:K71N	ENSP00000356199:K171N	K	-	3	2	MTRF1L	153357407	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.344000	0.33941	0.558000	0.29135	0.585000	0.79938	AAG	.		0.502	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
CARD11	84433	broad.mit.edu	37	7	2956956	2956956	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:2956956G>A	ENST00000396946.4	-	20	3074	c.2671C>T	c.(2671-2673)Cga>Tga	p.R891*		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	891					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AAGCTTGCTCGCGAGAGACGG	0.557			Mis		DLBCL																																p.R891X				Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11-870	0			c.C2671T						.						39.0	52.0	47.0					7																	2956956		2203	4300	6503	SO:0001587	stop_gained	84433	exon20			TTGCTCGCGAGAG	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2671C>T	7.37:g.2956956G>A	ENSP00000380150:p.Arg891*	30	1		35	5	NM_032415	0	0	8	8	0	A4D1Z7|Q2NKN7|Q548H3	Nonsense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	37	6.455396	0.97581	.	.	ENSG00000198286	ENST00000396946	.	.	.	4.99	-2.13	0.07144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2197	16.1139	0.81289	0.0:0.0:0.3409:0.6591	.	.	.	.	X	891	.	ENSP00000380150:R891X	R	-	1	2	CARD11	2923482	0.094000	0.21725	0.016000	0.15963	0.402000	0.30811	0.308000	0.19314	-0.204000	0.10235	-0.314000	0.08810	CGA	.		0.557	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
BZW2	28969	broad.mit.edu	37	7	16721024	16721024	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:16721024G>T	ENST00000433922.2	+	4	512	c.334G>T	c.(334-336)Gct>Tct	p.A112S	BZW2_ENST00000258761.3_Missense_Mutation_p.A112S|BZW2_ENST00000405202.1_Missense_Mutation_p.A36S|BZW2_ENST00000452975.2_Missense_Mutation_p.A112S|BZW2_ENST00000432311.1_3'UTR	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	112					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		CCGAAACTATGCTCAGGTAGA	0.438																																					p.A112S													.	BZW2-92	0			c.G334T						.						109.0	96.0	100.0					7																	16721024		2203	4300	6503	SO:0001583	missense	28969	exon4			AACTATGCTCAGG	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.334G>T	7.37:g.16721024G>T	ENSP00000397249:p.Ala112Ser	59	0		54	5	NM_014038	0	0	0	0	0	A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565035	0.86439	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000452975;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	L	0.54908	1.71	0.80722	D	1	D;D;D	0.89917	0.993;1.0;0.993	D;D;D	0.83275	0.968;0.996;0.968	T	0.47114	-0.9142	10	0.10111	T	0.7	-6.5489	20.2527	0.98410	0.0:0.0:1.0:0.0	.	112;112;112	E7ETZ4;Q96JW5;Q9Y6E2	.;.;BZW2_HUMAN	S	112;112;112;112;36;112;112;112	ENSP00000403481:A112S;ENSP00000258761:A112S;ENSP00000397249:A112S;ENSP00000411715:A112S;ENSP00000385577:A36S;ENSP00000412750:A112S;ENSP00000415924:A112S;ENSP00000416531:A112S	ENSP00000258761:A112S	A	+	1	0	BZW2	16687549	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.810000	0.99221	2.788000	0.95919	0.557000	0.71058	GCT	.		0.438	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
AUTS2	26053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	70231266	70231266	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:70231266G>A	ENST00000342771.4	+	9	1956	c.1635G>A	c.(1633-1635)ccG>ccA	p.P545P	AUTS2_ENST00000406775.2_Silent_p.P545P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	545	His-rich.									breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		cCTTCACGCCGTTCCCCCACG	0.642																																					p.P545P		.											.	AUTS2-92	0			c.G1635A						.						278.0	255.0	263.0					7																	70231266		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon9			CACGCCGTTCCCC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1635G>A	7.37:g.70231266G>A		63	0		90	31	NM_001127231	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455200	0.26161	.	.	ENSG00000158321	ENST00000443672	.	.	.	5.56	-2.87	0.05700	.	.	.	.	.	T	0.50343	0.1610	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45131	-0.9282	4	.	.	.	-11.6373	6.7468	0.23466	0.1273:0.5083:0.2255:0.1389	.	.	.	.	H	87	.	.	R	+	2	0	AUTS2	69869202	0.862000	0.29867	0.976000	0.42696	0.997000	0.91878	-0.056000	0.11787	-0.475000	0.06852	0.561000	0.74099	CGT	.		0.642	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
KMT2C	58508	broad.mit.edu	37	7	151945198	151945198	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:151945198G>C	ENST00000262189.6	-	14	2539	c.2321C>G	c.(2320-2322)gCa>gGa	p.A774G	KMT2C_ENST00000355193.2_Missense_Mutation_p.A774G	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	774					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCTTATGTCTGCTGATGATGA	0.423																																					p.A774G													.	MLL3-1398	0			c.C2321G						.						184.0	163.0	170.0					7																	151945198		2203	4300	6503	SO:0001583	missense	58508	exon14			ATGTCTGCTGATG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2321C>G	7.37:g.151945198G>C	ENSP00000262189:p.Ala774Gly	771	0		627	13	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	1.692	-0.503696	0.04261	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83591	-1.74;-1.74	5.25	-0.131	0.13494	.	0.953037	0.08585	N	0.923914	T	0.66287	0.2774	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48375	-0.9041	10	0.22109	T	0.4	.	5.4057	0.16320	0.3328:0.4327:0.2345:0.0	.	774	Q8NEZ4	MLL3_HUMAN	G	774	ENSP00000262189:A774G;ENSP00000347325:A774G	ENSP00000262189:A774G	A	-	2	0	MLL3	151576131	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.369000	0.20416	-0.035000	0.13691	-0.145000	0.13849	GCA	.		0.423	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TBC1D31	93594	broad.mit.edu;ucsc.edu	37	8	124094982	124094982	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr8:124094982C>A	ENST00000287380.1	+	3	355	c.265C>A	c.(265-267)Ctg>Atg	p.L89M	TBC1D31_ENST00000521676.1_Intron|TBC1D31_ENST00000378080.2_Intron|TBC1D31_ENST00000327098.5_Missense_Mutation_p.L89M|TBC1D31_ENST00000309336.3_Missense_Mutation_p.L89M|TBC1D31_ENST00000522420.1_Intron	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	89						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TTGCACAGCTCTGGCCTTTAA	0.343																																					p.L89M													.	WDR67-226	0			c.C265A						.						111.0	103.0	106.0					8																	124094982		2203	4300	6503	SO:0001583	missense	93594	exon3			ACAGCTCTGGCCT	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.265C>A	8.37:g.124094982C>A	ENSP00000287380:p.Leu89Met	28	0		32	4	NM_001145088	0	0	0	0	0	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	37	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669778	0.67814	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522276	T;T;T;T	0.74421	-0.51;1.29;1.29;-0.84	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.081913	0.51477	D	0.000088	T	0.80793	0.4691	M	0.70595	2.14	0.80722	D	1	D;D;D	0.67145	0.992;0.996;0.986	D;D;P	0.64410	0.919;0.925;0.796	T	0.79650	-0.1715	10	0.35671	T	0.21	-11.8875	5.9847	0.19428	0.1856:0.7013:0.0:0.1131	.	89;89;89	B7ZL19;Q96DN5;Q3KRB0	.;WDR67_HUMAN;.	M	89;89;89;79	ENSP00000287380:L89M;ENSP00000308358:L89M;ENSP00000312701:L89M;ENSP00000428891:L79M	ENSP00000287380:L89M	L	+	1	2	WDR67	124164163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.479000	0.45197	2.689000	0.91719	0.591000	0.81541	CTG	.		0.343	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	
OPLAH	26873	broad.mit.edu	37	8	145111554	145111554	+	Missense_Mutation	SNP	C	C	T	rs200399200		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr8:145111554C>T	ENST00000426825.1	-	13	1892	c.1811G>A	c.(1810-1812)cGt>cAt	p.R604H	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	604					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTCCCCCGCACGGGGCGAGCG	0.667																																					p.R604H													.	OPLAH-68	0			c.G1811A						.	C	HIS/ARG	0,4232		0,0,2116	20.0	27.0	24.0		1811	0.8	0.0	8		24	1,8449		0,1,4224	no	missense	OPLAH	NM_017570.3	29	0,1,6340	TT,TC,CC		0.0118,0.0,0.0079	possibly-damaging	604/1289	145111554	1,12681	2116	4225	6341	SO:0001583	missense	26873	exon13			CCCGCACGGGGCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1811G>A	8.37:g.145111554C>T	ENSP00000475943:p.Arg604His	85	0		108	3	NM_017570	0	0	0	0	0	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	C	5.999	0.368217	0.11352	0.0	1.18E-4	ENSG00000178814	ENST00000426825	.	.	.	4.69	0.788	0.18601	.	0.196928	0.44097	D	0.000484	T	0.22589	0.0545	.	.	.	0.40220	D	0.977721	P	0.43701	0.815	B	0.38712	0.28	T	0.19289	-1.0310	7	0.45353	T	0.12	.	4.0517	0.09798	0.1541:0.4819:0.0:0.364	.	604	O14841	OPLA_HUMAN	H	604	.	ENSP00000412071:R604H	R	-	2	0	OPLAH	145183542	0.007000	0.16637	0.012000	0.15200	0.255000	0.26057	0.188000	0.17018	0.093000	0.17368	0.514000	0.50259	CGT	.		0.667	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
COL27A1	85301	broad.mit.edu	37	9	117052570	117052570	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr9:117052570C>A	ENST00000356083.3	+	47	4718	c.4327C>A	c.(4327-4329)Cca>Aca	p.P1443T		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1443	Collagen-like 14.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CATCGCTGGACCAGATGGGCT	0.637																																					p.P1443T													.	COL27A1-94	0			c.C4327A						.						30.0	24.0	26.0					9																	117052570		2193	4288	6481	SO:0001583	missense	85301	exon47			GCTGGACCAGATG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4327C>A	9.37:g.117052570C>A	ENSP00000348385:p.Pro1443Thr	138	0		155	5	NM_032888	0	0	10	10	0	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	9.195	1.027065	0.19512	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.93133	-3.17	5.47	2.6	0.31112	.	.	.	.	.	D	0.86932	0.6052	L	0.31157	0.91	0.23425	N	0.99771	B	0.24186	0.099	B	0.22601	0.04	T	0.70070	-0.4973	9	0.15499	T	0.54	.	9.8448	0.41021	0.0:0.7351:0.1199:0.145	.	1443	Q8IZC6	CORA1_HUMAN	T	1443	ENSP00000348385:P1443T	ENSP00000348385:P1443T	P	+	1	0	COL27A1	116092391	0.676000	0.27567	0.993000	0.49108	0.959000	0.62525	0.352000	0.20113	0.020000	0.15106	-1.961000	0.00478	CCA	.		0.637	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
TRIM32	22954	broad.mit.edu;bcgsc.ca	37	9	119461631	119461631	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr9:119461631T>A	ENST00000450136.1	+	2	1771	c.1610T>A	c.(1609-1611)cTg>cAg	p.L537Q	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.L537Q|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	537					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						GGCCTCAATCTGGAGAATCGG	0.557																																					p.L537Q	Esophageal Squamous(92;212 1916 19711 26951)												.	TRIM32-650	0			c.T1610A						.						71.0	66.0	67.0					9																	119461631		2203	4300	6503	SO:0001583	missense	22954	exon2			TCAATCTGGAGAA	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.1610T>A	9.37:g.119461631T>A	ENSP00000408292:p.Leu537Gln	168	1		150	12	NM_012210	0	0	0	1	1	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	T	15.49	2.849798	0.51270	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.83419	-1.72;-1.72	5.56	5.56	0.83823	Six-bladed beta-propeller, TolB-like (1);	0.184376	0.35936	N	0.002883	T	0.71762	0.3378	N	0.08118	0	0.46823	D	0.999217	D	0.56968	0.978	P	0.45881	0.496	T	0.73341	-0.4013	9	.	.	.	-4.4367	15.6974	0.77512	0.0:0.0:0.0:1.0	.	537	Q13049	TRI32_HUMAN	Q	537	ENSP00000408292:L537Q;ENSP00000363095:L537Q	.	L	+	2	0	TRIM32	118501452	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.665000	0.83852	2.098000	0.63641	0.528000	0.53228	CTG	.		0.557	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
LMX1B	4010	broad.mit.edu	37	9	129376780	129376780	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr9:129376780C>A	ENST00000373474.4	+	1	59	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	RP11-123K19.1_ENST00000451449.2_RNA|RP11-123K19.1_ENST00000432418.1_RNA|LMX1B_ENST00000425646.2_5'UTR|RP11-123K19.1_ENST00000425370.1_RNA|LMX1B_ENST00000561065.1_5'UTR|LMX1B_ENST00000526117.1_Missense_Mutation_p.Q18K|LMX1B_ENST00000355497.5_Missense_Mutation_p.Q18K			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	18					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CCCTCGCGGGCAGACGGACTG	0.721									Nail-Patella Syndrome																												p.Q18K	Pancreas(110;1796 2278 18357 20466)												.	LMX1B-90	0			c.C52A						.						19.0	17.0	18.0					9																	129376780		2195	4295	6490	SO:0001583	missense	4010	exon1	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	CGCGGGCAGACGG	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.52C>A	9.37:g.129376780C>A	ENSP00000362573:p.Gln18Lys	62	1		125	6	NM_001174146	0	0	0	0	0	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	c	12.88	2.070080	0.36566	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497	D;D;D	0.85258	-1.8;-1.79;-1.96	3.04	3.04	0.35103	.	0.120313	0.35262	U	0.003325	T	0.69771	0.3148	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.64859	-0.6308	8	0.07030	T	0.85	.	12.8315	0.57748	0.0:1.0:0.0:0.0	.	.	.	.	K	18	ENSP00000436930:Q18K;ENSP00000362573:Q18K;ENSP00000347684:Q18K	ENSP00000347684:Q18K	Q	+	1	0	LMX1B	128416601	0.998000	0.40836	1.000000	0.80357	0.948000	0.59901	1.351000	0.34022	1.569000	0.49696	0.388000	0.25769	CAG	.		0.721	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
LAMC3	10319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	133914285	133914285	+	Silent	SNP	G	G	A	rs201170354	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr9:133914285G>A	ENST00000361069.4	+	5	1144	c.1011G>A	c.(1009-1011)acG>acA	p.T337T	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	337	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGGAATGCACGTTTGATCGGG	0.617													g|||	3	0.000599042	0.0015	0.0014	5008	,	,		19786	0.0		0.0	False		,,,				2504	0.0				p.T337T		.											.	LAMC3-93	0			c.G1011A						.						77.0	80.0	79.0					9																	133914285		2203	4300	6503	SO:0001819	synonymous_variant	10319	exon5			ATGCACGTTTGAT	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1011G>A	9.37:g.133914285G>A		46	0		58	8	NM_006059	0	0	0	0	0	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1																																																																																			G|0.999;A|0.000		0.617	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
USP9X	8239	broad.mit.edu	37	X	41022128	41022128	+	Silent	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:41022128T>C	ENST00000324545.8	+	15	2616	c.1983T>C	c.(1981-1983)ctT>ctC	p.L661L	USP9X_ENST00000378308.2_Silent_p.L661L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	661					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TTAACTTCCTTAGGTTTGTTT	0.368																																					p.L661L	Ovarian(172;1807 2695 35459 49286)												.	USP9X-563	0			c.T1983C						.						129.0	121.0	124.0					X																	41022128		2189	4297	6486	SO:0001819	synonymous_variant	8239	exon15			CTTCCTTAGGTTT	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1983T>C	X.37:g.41022128T>C		250	0		217	6	NM_001039591	0	0	0	0	0	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																			.		0.368	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
TFE3	7030	broad.mit.edu	37	X	48888986	48888986	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:48888986G>A	ENST00000315869.7	-	9	1469	c.1210C>T	c.(1210-1212)Cag>Tag	p.Q404*	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	404					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						TTGGAGCGCTGCTGCTCCTTC	0.602			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																p.Q404X				Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	.	TFE3-658	0			c.C1210T						.						33.0	30.0	31.0					X																	48888986		2202	4297	6499	SO:0001587	stop_gained	7030	exon9			AGCGCTGCTGCTC	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1210C>T	X.37:g.48888986G>A	ENSP00000314129:p.Gln404*	104	0		76	4	NM_006521	0	0	26	26	0	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Nonsense_Mutation	SNP	ENST00000315869.7	37	CCDS14315.3	.	.	.	.	.	.	.	.	.	.	g	39	7.717535	0.98450	.	.	ENSG00000068323	ENST00000315869	.	.	.	5.64	3.88	0.44766	.	0.056288	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6987	10.5431	0.45045	0.1621:0.0:0.8379:0.0	.	.	.	.	X	404	.	ENSP00000314129:Q404X	Q	-	1	0	TFE3	48775930	1.000000	0.71417	0.249000	0.24280	0.956000	0.61745	7.905000	0.87416	0.549000	0.28973	0.462000	0.41574	CAG	.		0.602	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	NM_006521	
DGKK	139189	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50144042	50144042	+	RNA	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:50144042T>C	ENST00000376025.2	-	0	1463							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CACCATCGCCTTTGGGGTCGC	0.473																																					.													.	DGKK-227	0			.						.						71.0	60.0	64.0					X																	50144042		1948	4121	6069			139189	.			ATCGCCTTTGGGG	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50144042T>C		363	0		363	93	.	0	0	0	0	0	B2RP91	Silent	SNP	ENST00000376025.2	37																																																																																				.		0.473	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742	
ZXDB	158586	hgsc.bcm.edu	37	X	57618715	57618715	+	Silent	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:57618715C>T	ENST00000374888.1	+	1	447	c.234C>T	c.(232-234)acC>acT	p.T78T		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CGCCGAGGACCGATCAACCTA	0.756													C|||	1	0.000264901	0.0	0.0	3775	,	,		6694	0.0		0.001	False		,,,				2504	0.0				p.T78T		.											.	ZXDB-130	0			c.C234T						.						3.0	5.0	4.0					X																	57618715		1444	3093	4537	SO:0001819	synonymous_variant	158586	exon1			GAGGACCGATCAA	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.234C>T	X.37:g.57618715C>T		4	0		12	8	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Silent	SNP	ENST00000374888.1	37	CCDS35313.1																																																																																			.		0.756	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
GLUD2	2747	ucsc.edu	37	X	120182480	120182480	+	Silent	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:120182480A>G	ENST00000328078.1	+	1	1019	c.942A>G	c.(940-942)ctA>ctG	p.L314L		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	314					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						ATGTGGGCCTACACTCTATGA	0.383																																					p.L314L													.	GLUD2-131	0			c.A942G						.						230.0	212.0	218.0					X																	120182480		2203	4300	6503	SO:0001819	synonymous_variant	2747	exon1			GGGCCTACACTCT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.942A>G	X.37:g.120182480A>G		461	4		317	4	NM_012084	0	0	0	6	6	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																			.		0.383	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
THOC2	57187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	122757675	122757675	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:122757675T>C	ENST00000245838.8	-	28	3497	c.3466A>G	c.(3466-3468)Aaa>Gaa	p.K1156E	THOC2_ENST00000355725.4_Missense_Mutation_p.K1156E|THOC2_ENST00000491737.1_Missense_Mutation_p.K1041E	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1156					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CTCTTCTCTTTTTCTTCTTGG	0.348																																					p.K1156E		.											.	THOC2-133	0			c.A3466G						.						150.0	119.0	128.0					X																	122757675		1809	4080	5889	SO:0001583	missense	57187	exon28			TCTCTTTTTCTTC	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3466A>G	X.37:g.122757675T>C	ENSP00000245838:p.Lys1156Glu	67	0		42	7	NM_001081550	0	0	10	10	0	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.88|19.88	3.909495|3.909495	0.72868|0.72868	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	THO complex, subunitTHOC2, C-terminal (1);|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.72661|0.72661	0.3488|0.3488	M|M	0.67625|0.67625	2.065|2.065	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.72293|0.72293	-0.4336|-0.4336	9|6	0.13470|.	T|.	0.59|.	-17.2559|-17.2559	15.2657|15.2657	0.73660|0.73660	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1156|.	Q8NI27|.	THOC2_HUMAN|.	E|R	1156;1156;1041|228	.|.	ENSP00000245838:K1156E|.	K|K	-|-	1|2	0|0	THOC2|THOC2	122585356|122585356	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.040000|8.040000	0.89188|0.89188	1.988000|1.988000	0.58038|0.58038	0.481000|0.481000	0.45027|0.45027	AAA|AAA	.		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
NASP	4678	broad.mit.edu;bcgsc.ca	37	1	46073053	46073073	+	In_Frame_Del	DEL	CCAAAAAAACAGAAGACAAGT	CCAAAAAAACAGAAGACAAGT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CCAAAAAAACAGAAGACAAGT	CCAAAAAAACAGAAGACAAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:46073053_46073073delCCAAAAAAACAGAAGACAAGT	ENST00000350030.3	+	6	557_577	c.470_490delCCAAAAAAACAGAAGACAAGT	c.(469-492)gccaaaaaaacagaagacaagtct>gct	p.KKTEDKS158del	NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_In_Frame_Del_p.KKTEDKS160del|NASP_ENST00000372052.4_Intron|NASP_ENST00000537798.1_In_Frame_Del_p.KKTEDKS94del	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	158	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AAAGAAGAAGCCAAAAAAACAGAAGACAAGTCTTTGGCAAA	0.412																																					p.157_164del													.	NASP-91	0			c.470_490del						.																																			SO:0001651	inframe_deletion	4678	exon6			AAGAAGCCAAAAA	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.470_490delCCAAAAAAACAGAAGACAAGT	1.37:g.46073053_46073073delCCAAAAAAACAGAAGACAAGT	ENSP00000255120:p.Lys158_Ser164del	229	0		178	13	NM_002482	0	0	0	0	0	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	In_Frame_Del	DEL	ENST00000350030.3	37	CCDS524.1																																																																																			.		0.412	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
PHTF1	10745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	114255942	114255943	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:114255942_114255943delTT	ENST00000369604.1	-	8	1224_1225	c.741_742delAA	c.(739-744)acaagafs	p.R248fs	PHTF1_ENST00000393357.2_Frame_Shift_Del_p.R248fs|PHTF1_ENST00000447664.2_Intron|PHTF1_ENST00000369598.1_Frame_Shift_Del_p.R203fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369600.1_Frame_Shift_Del_p.R195fs|PHTF1_ENST00000369596.2_Frame_Shift_Del_p.R195fs|PHTF1_ENST00000357783.2_Frame_Shift_Del_p.R248fs			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	248					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTTCTCTCTTGTTTGCCACA	0.371																																					p.247_248del		.											.	PHTF1-91	0			c.741_742del						.																																			SO:0001589	frameshift_variant	10745	exon7			.	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.741_742delAA	1.37:g.114255942_114255943delTT	ENSP00000358617:p.Arg248fs	93	0		81	20	NM_006608	0	0	0	0	0	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Del	DEL	ENST00000369604.1	37	CCDS861.1																																																																																			.		0.371	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
PFKP	5214	hgsc.bcm.edu	37	10	3150955	3150955	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:3150955delA	ENST00000381125.4	+	9	1009	c.933delA	c.(931-933)ggafs	p.G312fs	PFKP_ENST00000381075.2_Frame_Shift_Del_p.G304fs	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	312	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		TGCAGAGAGGAGGGACCCCTT	0.562																																					p.G311fs		.											.	PFKP-253	0			c.933delA						.						148.0	132.0	138.0					10																	3150955		2203	4300	6503	SO:0001589	frameshift_variant	5214	exon9			.	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.933delA	10.37:g.3150955delA	ENSP00000370517:p.Gly312fs	168	0		156	35	NM_002627	0	0	0	0	0	B3KS15|Q5VSR7|Q5VSR8	Frame_Shift_Del	DEL	ENST00000381125.4	37	CCDS7059.1																																																																																			.		0.562	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
PITRM1	10531	broad.mit.edu;bcgsc.ca	37	10	3207428	3207429	+	Splice_Site	DEL	AC	AC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:3207428_3207429delAC	ENST00000224949.4	-	6	665		c.e6+1		PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Splice_Site|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000451104.2_Splice_Site			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						AAGAAAACTTACAAACGCTCCC	0.411																																					.													.	PITRM1-91	0			.						.																																			SO:0001630	splice_region_variant	10531	.			AAACTTACAAACG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.630+1GT>-	10.37:g.3207428_3207429delAC		92	0		94	9	.	0	0	0	0	0	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Splice_Site	DEL	ENST00000224949.4	37	CCDS59208.1																																																																																			.		0.411	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		Intron
AHNAK	79026	broad.mit.edu;bcgsc.ca	37	11	62285795	62285796	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:62285795_62285796delAG	ENST00000378024.4	-	5	16367_16368	c.16093_16094delCT	c.(16093-16095)ctgfs	p.L5365fs	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5365					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGTCCCCTCAGTGTCACATCT	0.545																																					p.5365_5365del													.	AHNAK-109	0			c.16093_16094del						.																																			SO:0001589	frameshift_variant	79026	exon5			CCCCTCAGTGTCA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.16093_16094delCT	11.37:g.62285795_62285796delAG	ENSP00000367263:p.Leu5365fs	180	0		153	16	NM_001620	0	0	0	0	0	A1A586	Frame_Shift_Del	DEL	ENST00000378024.4	37	CCDS31584.1																																																																																			.		0.545	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
MTA2	9219	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62364175	62364176	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:62364175_62364176delCT	ENST00000278823.2	-	9	1204_1205	c.815_816delAG	c.(814-816)gagfs	p.E272fs	MTA2_ENST00000524902.1_Frame_Shift_Del_p.E99fs|MTA2_ENST00000527204.1_Frame_Shift_Del_p.E99fs	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	272	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						ATAGCATGGCCTCTGAGGCTGA	0.55																																					p.272_272del		.											.	MTA2-92	0			c.815_816del						.																																			SO:0001589	frameshift_variant	9219	exon9			.	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.815_816delAG	11.37:g.62364177_62364178delCT	ENSP00000278823:p.Glu272fs	128	0		134	24	NM_004739	0	0	0	0	0	Q68DB1|Q9UQB5	Frame_Shift_Del	DEL	ENST00000278823.2	37	CCDS8022.1																																																																																			.		0.550	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
OR8D1	283159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	124180084	124180085	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:124180084_124180085delGT	ENST00000357821.2	-	1	648_649	c.578_579delAC	c.(577-579)cacfs	p.H193fs		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H193Q(1)		kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GCTCATTGAGGTGTGTGTTGGA	0.46																																					p.193_193del		.											.	OR8D1-71	1	Substitution - Missense(1)	ovary(1)	c.578_579del						.																																			SO:0001589	frameshift_variant	283159	exon1			.	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.578_579delAC	11.37:g.124180090_124180091delGT	ENSP00000350474:p.His193fs	198	0		214	45	NM_001002917	0	0	0	0	0	B2RNL4|Q6IEW1|Q8NGH0	Frame_Shift_Del	DEL	ENST00000357821.2	37	CCDS31706.1																																																																																			.		0.460	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
LRRK2	120892	broad.mit.edu	37	12	40742254	40742254	+	Frame_Shift_Del	DEL	G	G	-	rs10878405	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:40742254delG	ENST00000298910.7	+	43	6382	c.6324delG	c.(6322-6324)gagfs	p.E2108fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2108	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTATGGTTGAGAAATTAATTA	0.308																																					p.E2108fs													.	LRRK2-533	0			c.6324delG						.						87.0	86.0	86.0					12																	40742254		2203	4299	6502	SO:0001589	frameshift_variant	120892	exon43			GGTTGAGAAATTA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6324delG	12.37:g.40742254delG	ENSP00000298910:p.Glu2108fs	211	0		148	9	NM_198578	0	0	0	0	0	A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Del	DEL	ENST00000298910.7	37	CCDS31774.1																																																																																			.		0.308	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
LRRK2	120892	broad.mit.edu	37	12	40742257	40742259	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	ATT	ATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:40742257_40742259delATT	ENST00000298910.7	+	43	6385_6387	c.6327_6329delATT	c.(6325-6330)aaatta>aaa	p.L2110del		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGGTTGAGAAATTAATTAAACAG	0.315																																					p.2109_2110del													.	LRRK2-533	0			c.6327_6329del						.																																			SO:0001651	inframe_deletion	120892	exon43			TGAGAAATTAATT	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6327_6329delATT	12.37:g.40742257_40742259delATT	ENSP00000298910:p.Leu2110del	207	0		146	9	NM_198578	0	0	0	0	0	A6NJU2|Q6ZS50|Q8NCX9	In_Frame_Del	DEL	ENST00000298910.7	37	CCDS31774.1																																																																																			.		0.315	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
SOAT2	8435	broad.mit.edu;bcgsc.ca	37	12	53499371	53499372	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:53499371_53499372delAG	ENST00000301466.3	+	4	362_363	c.302_303delAG	c.(301-303)cagfs	p.Q101fs		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	101					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	CTGGGGAAACAGAAAGTTTTCA	0.5																																					p.101_101del													.	SOAT2-91	0			c.302_303del						.																																			SO:0001589	frameshift_variant	8435	exon4			GGAAACAGAAAGT	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.302_303delAG	12.37:g.53499371_53499372delAG	ENSP00000301466:p.Gln101fs	84	0		88	9	NM_003578	0	0	0	0	0	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Frame_Shift_Del	DEL	ENST00000301466.3	37	CCDS8847.1																																																																																			.		0.500	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	81251281	81251284	+	Frame_Shift_Del	DEL	CTTA	CTTA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CTTA	CTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr14:81251281_81251284delCTTA	ENST00000555265.1	-	15	2541_2544	c.2166_2169delTAAG	c.(2164-2169)tttaagfs	p.FK722fs	CEP128_ENST00000281129.3_Frame_Shift_Del_p.FK722fs			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	722						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TCTTTTCTTTCTTAAAGTGCTTCA	0.412																																					p.722_723del		.											.	CEP128-91	0			c.2166_2169del						.																																			SO:0001589	frameshift_variant	145508	exon14			.	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2166_2169delTAAG	14.37:g.81251281_81251284delCTTA	ENSP00000451162:p.Phe722fs	92	0		75	25	NM_152446	0	0	0	0	0	B9EK52|Q86X97|Q96ML4	Frame_Shift_Del	DEL	ENST00000555265.1	37	CCDS32130.1																																																																																			.		0.412	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
GLCE	26035	hgsc.bcm.edu;bcgsc.ca	37	15	69553563	69553564	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr15:69553563_69553564delAG	ENST00000261858.2	+	4	952_953	c.724_725delAG	c.(724-726)agafs	p.R242fs	GLCE_ENST00000559420.2_Frame_Shift_Del_p.R178fs|GLCE_ENST00000559500.1_3'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	242					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)	p.R242K(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AGCAGAAGACAGAGACAAAAAC	0.401																																					p.242_242del		.											.	GLCE-92	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.724_725del						.																																			SO:0001589	frameshift_variant	26035	exon4			.	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.724_725delAG	15.37:g.69553565_69553566delAG	ENSP00000261858:p.Arg242fs	157	0		105	22	NM_015554	0	0	0	0	0	Q6GUQ2	Frame_Shift_Del	DEL	ENST00000261858.2	37	CCDS32277.1																																																																																			.		0.401	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
SPIRE2	84501	broad.mit.edu;bcgsc.ca	37	16	89924825	89924826	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:89924825_89924826delAG	ENST00000378247.3	+	8	1225_1226	c.1182_1183delAG	c.(1180-1185)acagatfs	p.D395fs	SPIRE2_ENST00000393062.2_Frame_Shift_Del_p.D395fs	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	395					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TGTCAGTCACAGATGCTGGGGG	0.629																																					p.394_395del													.	SPIRE2-90	0			c.1182_1183del						.																																			SO:0001589	frameshift_variant	84501	exon8			AGTCACAGATGCT	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1182_1183delAG	16.37:g.89924825_89924826delAG	ENSP00000367494:p.Asp395fs	89	0		102	12	NM_032451	0	0	0	0	0	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Frame_Shift_Del	DEL	ENST00000378247.3	37	CCDS32516.1																																																																																			.		0.629	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
C17orf80	55028	broad.mit.edu	37	17	71232036	71232037	+	Frame_Shift_Del	DEL	CA	CA	-	rs373362252|rs555089459		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:71232036_71232037delCA	ENST00000535032.2	+	2	528_529	c.415_416delCA	c.(415-417)cagfs	p.Q139fs	FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000359042.2_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000577615.1_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000426147.2_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000255557.4_Frame_Shift_Del_p.Q139fs			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	139						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			AACCAAGGCTCAGTTTTACGCA	0.381																																					p.139_139del													.	C17orf80-91	0			c.415_416del						.																																			SO:0001589	frameshift_variant	55028	exon3			AAGGCTCAGTTTT	AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.415_416delCA	17.37:g.71232036_71232037delCA	ENSP00000440551:p.Gln139fs	142	0		197	12	NM_001100621	0	0	0	0	0	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Frame_Shift_Del	DEL	ENST00000535032.2	37	CCDS11694.1																																																																																			.		0.381	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1	NM_017941	
MAU2	23383	hgsc.bcm.edu	37	19	19431690	19431704	+	In_Frame_Del	DEL	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	-	rs553682593|rs375425486|rs550594758	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:19431690_19431704delGCGGCCCAGGCGGCG	ENST00000392313.6	+	1	201_215	c.22_36delGCGGCCCAGGCGGCG	c.(22-36)gcggcccaggcggcgdel	p.AAQAA13del	MAU2_ENST00000262815.8_In_Frame_Del_p.AAQAA13del|SUGP1_ENST00000334782.5_5'Flank|SUGP1_ENST00000247001.5_5'Flank|SUGP1_ENST00000585763.1_5'Flank	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	13	Ala-rich.|Sufficient for interaction with NIPBL.				maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						ggcggcggcagcggcccaggcggcggcggcccagg	0.735																																					p.8_12del		.											.	MAU2-91	0			c.22_36del						.			89,1901		39,11,945						-8.2	0.6			3	148,4936		53,42,2447	no	coding	MAU2	NM_015329.3		92,53,3392	A1A1,A1R,RR		2.9111,4.4724,3.3503				237,6837				SO:0001651	inframe_deletion	23383	exon1			.	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.22_36delGCGGCCCAGGCGGCG	19.37:g.19431690_19431704delGCGGCCCAGGCGGCG	ENSP00000376127:p.Ala13_Ala17del	2	0		40	28	NM_015329	0	0	0	0	0	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	In_Frame_Del	DEL	ENST00000392313.6	37	CCDS32969.2																																																																																			.		0.735	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
SOCS5	9655	broad.mit.edu	37	2	46987222	46987224	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	ATT	ATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:46987222_46987224delATT	ENST00000306503.5	+	2	1725_1727	c.1553_1555delATT	c.(1552-1557)cattat>cat	p.Y519del	SOCS5_ENST00000394861.2_In_Frame_Del_p.Y519del	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	519	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			AAAGAGTATCATTATAAACAAAA	0.433																																					p.518_519del													.	SOCS5-659	0			c.1553_1555del						.																																			SO:0001651	inframe_deletion	9655	exon2			AGTATCATTATAA	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1553_1555delATT	2.37:g.46987222_46987224delATT	ENSP00000305133:p.Tyr519del	233	0		212	10	NM_144949	0	0	0	0	0	Q53SD4|Q8IYZ4	In_Frame_Del	DEL	ENST00000306503.5	37	CCDS1830.1																																																																																			.		0.433	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2		
ASPRV1	151516	broad.mit.edu	37	2	70188625	70188626	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:70188625_70188626delAG	ENST00000320256.4	-	1	771_772	c.195_196delCT	c.(193-198)ctctgtfs	p.C66fs	PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						AGAAACCCACAGAGCAGTGTCG	0.653																																					p.65_66del													.	ASPRV1-69	0			c.195_196del						.																																			SO:0001589	frameshift_variant	151516	exon1			ACCCACAGAGCAG	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.195_196delCT	2.37:g.70188627_70188628delAG	ENSP00000315383:p.Cys66fs	173	0		163	14	NM_152792	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000320256.4	37	CCDS1897.1																																																																																			.		0.653	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
TTL	150465	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	113260608	113260609	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:113260608_113260609delAT	ENST00000233336.6	+	5	916_917	c.725_726delAT	c.(724-726)aatfs	p.N242fs		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	242	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		CATTTGACCAATCACTGCATTC	0.376			T	ETV6	ALL																																p.242_242del		.		Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	.	TTL-658	0			c.725_726del						.																																			SO:0001589	frameshift_variant	150465	exon5			.		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.725_726delAT	2.37:g.113260608_113260609delAT	ENSP00000233336:p.Asn242fs	130	0		123	33	NM_153712	0	0	0	0	0	Q585T3|Q7Z302|Q8N426	Frame_Shift_Del	DEL	ENST00000233336.6	37	CCDS2096.1																																																																																			.		0.376	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712	
C22orf39	128977	broad.mit.edu	37	22	19435297	19435299	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:19435297_19435299delAGA	ENST00000399562.4	-	1	456_458	c.24_26delTCT	c.(22-27)cttctg>ctg	p.8_9LL>L	HIRA_ENST00000541063.1_5'Flank|C22orf39_ENST00000333059.5_5'Flank|C22orf39_ENST00000542103.1_In_Frame_Del_p.8_9LL>L|HIRA_ENST00000546308.1_5'Flank|AC000068.5_ENST00000431090.1_RNA|C22orf39_ENST00000399568.1_5'Flank	NM_173793.4	NP_776154.3	Q6P5X5	CV039_HUMAN	chromosome 22 open reading frame 39	8												Colorectal(54;0.0993)					ATCGACTGACAGAAGAACTAATG	0.591																																					p.8_9del													.	C22orf39-22	0			c.24_26del						.																																			SO:0001651	inframe_deletion	128977	exon1			ACTGACAGAAGAA		CCDS33599.1, CCDS33599.2, CCDS54498.1	22q11.21	2008-10-31			ENSG00000242259	ENSG00000242259			27012	protein-coding gene	gene with protein product							Standard	NM_173793		Approved	MGC74441	uc002zpk.2	Q6P5X5	OTTHUMG00000150137	ENST00000399562.4:c.24_26delTCT	22.37:g.19435300_19435302delAGA	ENSP00000382474:p.Leu9del	259	0		305	14	NM_173793	0	0	0	0	0	A8MTW6|D3DX18|F5H3A8|J3KNP9	In_Frame_Del	DEL	ENST00000399562.4	37	CCDS33599.2																																																																																			.		0.591	C22orf39-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316494.3	NM_173793	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	226	0		189	96	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TEX33	339669	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	37396006	37396008	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:37396006_37396008delTCA	ENST00000405091.2	-	5	758_760	c.507_509delTGA	c.(505-510)gatgaa>gaa	p.D169del	TEX33_ENST00000381821.1_In_Frame_Del_p.D169del|TEX33_ENST00000402860.3_In_Frame_Del_p.D84del			O43247	TEX33_HUMAN	testis expressed 33	169																	CTCGAAGACTTCATCAATAGCCT	0.542																																					p.169_170del		.											.	.	0			c.507_509del						.																																			SO:0001651	inframe_deletion	339669	exon4			.	BC042635	CCDS13937.1, CCDS54524.1	22q12.3	2013-10-11	2012-02-16	2012-02-16	ENSG00000185264	ENSG00000185264			28568	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 33"""	C22orf33		22332119	Standard	NM_178552		Approved	MGC35206, EAN57	uc003aqf.3	O43247	OTTHUMG00000150531	ENST00000405091.2:c.507_509delTGA	22.37:g.37396009_37396011delTCA	ENSP00000386118:p.Asp169del	92	0		88	25	NM_001163857	0	0	0	0	0	B1AH46|Q6ICF2|Q8IVQ2|Q9Y4V8	In_Frame_Del	DEL	ENST00000405091.2	37	CCDS54524.1																																																																																			.		0.542	TEX33-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318778.2	NM_178552	
SYN2	6854	broad.mit.edu	37	3	12046124	12046126	+	RNA	DEL	AGC	AGC	-	rs76272937|rs74800608|rs375843790|rs74185804|rs202010288	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:12046124_12046126delAGC	ENST00000432424.2	+	0	245_247							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						AGCCCCAGCAAGCGCCGAcgccg	0.764														5004	0.999201	0.9992	1.0	5008	,	,		2724	1.0		0.999	False		,,,				2504	0.998				.													.	SYN2-24	0			.						.																																					6854	.			CCAGCAAGCGCCG		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12046124_12046126delAGC		5	0		10	3	.	0	0	0	0	0	A8MY98	In_Frame_Del	DEL	ENST00000432424.2	37																																																																																				.		0.764	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625	
GOLGA4	2803	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	37365077	37365078	+	Splice_Site	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:37365077_37365078delAG	ENST00000361924.2	+	14	2075		c.e14-1		GOLGA4_ENST00000356847.4_Splice_Site|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTTAATTAACAGAGAATTCTTG	0.307																																					.		.											.	GOLGA4-93	0			.						.																																			SO:0001630	splice_region_variant	2803	.			.	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1702-1AG>-	3.37:g.37365079_37365080delAG		141	0		128	33	.	0	0	0	0	0	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Splice_Site	DEL	ENST00000361924.2	37	CCDS2666.1																																																																																			.		0.307	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Intron
NFKBIZ	64332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	101572345	101572345	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:101572345delC	ENST00000326172.5	+	5	1090	c.975delC	c.(973-975)aacfs	p.N325fs	NFKBIZ_ENST00000326151.5_Intron|NFKBIZ_ENST00000394054.2_Frame_Shift_Del_p.N225fs	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	325	Required for transcriptional activity. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ATGAACCAAACCTCTTTGATG	0.468																																					p.N325fs		.											.	NFKBIZ-92	0			c.975delC						.						128.0	124.0	125.0					3																	101572345		2203	4300	6503	SO:0001589	frameshift_variant	64332	exon5			.	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.975delC	3.37:g.101572345delC	ENSP00000325663:p.Asn325fs	93	0		91	17	NM_031419	0	0	0	0	0	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Frame_Shift_Del	DEL	ENST00000326172.5	37	CCDS2946.1																																																																																			.		0.468	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419	
HTT	3064	broad.mit.edu	37	4	3076604	3076606	+	In_Frame_Del	DEL	CAG	CAG	-	rs71180116|rs374076986	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:3076604_3076606delCAG	ENST00000355072.5	+	1	197_199	c.52_54delCAG	c.(52-54)cagdel	p.Q38del	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	38	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CAAGTCCTTCcagcagcagcagc	0.704																																					p.18_18del													.	HTT-281	0			c.52_54del						.																																			SO:0001651	inframe_deletion	3064	exon1			TCCTTCCAGCAGC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.52_54delCAG	4.37:g.3076613_3076615delCAG	ENSP00000347184:p.Gln38del	4	0		9	3	NM_002111	0	0	0	0	0	Q9UQB7	In_Frame_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.704	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
RASA1	5921	hgsc.bcm.edu;bcgsc.ca	37	5	86564698	86564699	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:86564698_86564699delCC	ENST00000274376.6	+	1	994_995	c.430_431delCC	c.(430-432)cccfs	p.P145fs	RASA1_ENST00000512763.1_5'Flank|RASA1_ENST00000506290.1_5'Flank|RASA1_ENST00000456692.2_5'Flank	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	145					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCCTTACCTGCCCCCTTTGGGG	0.624																																					p.144_144del		.											.	RASA1-661	0			c.430_431del						.																																			SO:0001589	frameshift_variant	5921	exon1			.		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.430_431delCC	5.37:g.86564700_86564701delCC	ENSP00000274376:p.Pro145fs	38	0		35	12	NM_002890	0	0	0	0	0	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	37	CCDS34200.1																																																																																			.		0.624	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
EIF4EBP3	8637	broad.mit.edu;bcgsc.ca	37	5	139928645	139928646	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:139928645_139928646delAG	ENST00000310331.2	+	2	330_331	c.258_259delAG	c.(256-261)acagagfs	p.E89fs	SRA1_ENST00000520427.1_5'Flank|ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Del_p.R2612fs|ANKHD1_ENST00000297183.6_Frame_Shift_Del_p.R2612fs	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3	89					negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGGAGACAGAGGAAGAGAT	0.564																																					p.2612_2612del													.	ANKHD1-EIF4EBP3-28	0			c.7834_7835del						.																																			SO:0001589	frameshift_variant	404734	exon35			GGAGACAGAGGAA	AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498	ENST00000310331.2:c.258_259delAG	5.37:g.139928647_139928648delAG	ENSP00000308472:p.Glu89fs	125	0		89	12	NM_020690	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000310331.2	37	CCDS4226.1																																																																																			.		0.564	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732	
PCDHB5	26167	broad.mit.edu;bcgsc.ca	37	5	140515133	140515134	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:140515133_140515134delAG	ENST00000231134.5	+	1	334_335	c.117_118delAG	c.(115-120)acagaafs	p.E40fs		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	40	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGAAGAAACAGAAAGTGGCTA	0.49																																					p.39_40del													.	PCDHB5-95	0			c.117_118del						.																																			SO:0001589	frameshift_variant	26167	exon1			AGAAACAGAAAGT	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.117_118delAG	5.37:g.140515133_140515134delAG	ENSP00000231134:p.Glu40fs	141	0		102	11	NM_015669	0	0	0	0	0	Q549F4|Q9UFU9	Frame_Shift_Del	DEL	ENST00000231134.5	37	CCDS4247.1																																																																																			.		0.490	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
FASTK	10922	bcgsc.ca	37	7	150775936	150775938	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	GCT	GCT	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:150775936_150775938delGCT	ENST00000297532.6	-	3	753_755	c.676_678delAGC	c.(676-678)agcdel	p.S226del	RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000482571.1_Intron|FASTK_ENST00000353841.2_In_Frame_Del_p.S85del|FASTK_ENST00000540185.1_Intron|FASTK_ENST00000489884.1_Intron	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	226					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		CACCTGCCAGGCTGCTGATCAGA	0.616																																					p.226_226del													.	FASTK-359	0			c.676_678del						.																																			SO:0001651	inframe_deletion	10922	exon3			TGCCAGGCTGCTG		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.676_678delAGC	7.37:g.150775939_150775941delGCT	ENSP00000297532:p.Ser226del	70	0		59	6	NM_006712	0	0	0	0	0	A8K867|F8VTW9|Q59EM8|Q8IVA0	In_Frame_Del	DEL	ENST00000297532.6	37	CCDS5918.1																																																																																			.		0.616	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2	NM_006712	
ZNF7	7553	broad.mit.edu	37	8	146066868	146066869	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr8:146066868_146066869delTC	ENST00000528372.1	+	5	616_617	c.376_377delTC	c.(376-378)tctfs	p.S126fs	ZNF7_ENST00000325241.6_Frame_Shift_Del_p.S126fs|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000529819.1_Intron|ZNF7_ENST00000446747.2_Frame_Shift_Del_p.S137fs|ZNF7_ENST00000544249.1_Frame_Shift_Del_p.S30fs|ZNF7_ENST00000532393.1_3'UTR			P17097	ZNF7_HUMAN	zinc finger protein 7	126					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		TGGAGACGTTTCTGATTCTGAG	0.485																																					p.126_126del													.	ZNF7-94	0			c.376_377del						.																																			SO:0001589	frameshift_variant	7553	exon5			GACGTTTCTGATT	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.376_377delTC	8.37:g.146066868_146066869delTC	ENSP00000432724:p.Ser126fs	90	0		87	10	NM_003416	0	0	0	0	0	B4DT08|D3DWN6|P17015|Q8N8Y4	Frame_Shift_Del	DEL	ENST00000528372.1	37	CCDS6435.1																																																																																			.		0.485	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841231	15841236	+	In_Frame_Del	DEL	AGCCGG	AGCCGG	-	rs199648317		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AGCCGG	AGCCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:15841231_15841236delAGCCGG	ENST00000307771.7	+	11	1339_1344	c.1315_1320delAGCCGG	c.(1315-1320)agccggdel	p.SR447del		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	447	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					GGGCCGGGGCagccggagccggagcc	0.636			"""F, S, Mis"""		"""MDS, CLL"""																																p.439_440del	NSCLC(197;1631 3042 5741 31152)	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2-133	0			c.1315_1320del						.			17,138,2720		4,1,5,3,32,53,20,1147,368						3.0	0.1			9	24,75,5168		3,0,9,9,11,35,18,1934,1256	no	codingComplex	ZRSR2	NM_005089.3		7,1,14,12,43,88,38,3081,1624	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		1.8796,5.3913,3.1196				41,213,7888				SO:0001651	inframe_deletion	8233	exon11			.	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1315_1320delAGCCGG	X.37:g.15841237_15841242delAGCCGG	ENSP00000303015:p.Ser447_Arg448del	23	0		62	19	NM_005089	0	0	0	0	0	Q14D69	In_Frame_Del	DEL	ENST00000307771.7	37	CCDS14172.1																																																																																			.		0.636	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
BCOR	54880	broad.mit.edu	37	X	39913206	39913207	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:39913206_39913207delAC	ENST00000378444.4	-	14	5136_5137	c.4908_4909delGT	c.(4906-4911)gtgtttfs	p.F1637fs	BCOR_ENST00000378463.1_Frame_Shift_Del_p.F480fs|BCOR_ENST00000397354.3_Frame_Shift_Del_p.F1603fs|BCOR_ENST00000342274.4_Frame_Shift_Del_p.F1603fs|BCOR_ENST00000378455.4_Frame_Shift_Del_p.F1585fs	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1637	Necessary and sufficient for interaction with PCGF1.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCAAATTCAAACACATCGCTAT	0.465			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.1636_1637del				Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.4908_4909del						.																																			SO:0001589	frameshift_variant	54880	exon14			ATTCAAACACATC	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4908_4909delGT	X.37:g.39913208_39913209delAC	ENSP00000367705:p.Phe1637fs	261	0		235	19	NM_001123385	0	0	0	0	0	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Frame_Shift_Del	DEL	ENST00000378444.4	37	CCDS48093.1																																																																																			.		0.465	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
EPHA2	1969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	16459720	16459721	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:16459720_16459721insTG	ENST00000358432.5	-	11	2161_2162	c.2007_2008insCA	c.(2005-2010)cagttcfs	p.F670fs		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	670	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	TGGTGGCTGAACTGGCCCATGA	0.629																																					p.F670fs		.											.	EPHA2-1419	0			c.2008_2009insCA						.																																			SO:0001589	frameshift_variant	1969	exon11			.	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2007_2008insCA	1.37:g.16459720_16459721insTG	ENSP00000351209:p.Phe670fs	84	0		56	13	NM_004431	0	0	0	0	0	B5A968|Q8N3Z2	Frame_Shift_Ins	INS	ENST00000358432.5	37	CCDS169.1																																																																																			.		0.629	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
FARP2	9855	broad.mit.edu	37	2	242433486	242433487	+	Frame_Shift_Ins	INS	-	-	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:242433486_242433487insG	ENST00000264042.3	+	27	3281_3282	c.3111_3112insG	c.(3112-3114)ggcfs	p.G1038fs	STK25_ENST00000478403.1_5'Flank|STK25_ENST00000316586.4_3'UTR	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	1038					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TCGTGCAGGATGGCCCCCAACC	0.634																																					p.D1037fs													.	FARP2-93	0			c.3111_3112insG						.																																			SO:0001589	frameshift_variant	9855	exon27			GCAGGATGGCCCC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.3113dupG	2.37:g.242433488_242433488dupG	ENSP00000264042:p.Gly1038fs	415	0		398	8	NM_014808	0	0	0	0	0	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Frame_Shift_Ins	INS	ENST00000264042.3	37	CCDS33424.1																																																																																			.		0.634	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
MAP3K1	4214	bcgsc.ca	37	5	56183244	56183245	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:56183244_56183245insTA	ENST00000399503.3	+	18	4154_4155	c.4154_4155insTA	c.(4153-4158)agaattfs	p.RI1385fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGAGACTAAGAATTGCAGATT	0.421																																					p.R1385fs													.	MAP3K1-956	0			c.4154_4155insTA						.																																			SO:0001589	frameshift_variant	4214	exon18			GACTAAGAATTGC	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	Exception_encountered	5.37:g.56183244_56183245insTA	ENSP00000382423:p.Arg1385fs	130	0		116	15	NM_005921	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000399503.3	37	CCDS43318.1																																																																																			.		0.421	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
TOM1	10043	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	35723290	35723291	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:35723290_35723291GA>TC	ENST00000449058.2	+	7	800_801	c.675_676GA>TC	c.(673-678)gaGAtg>gaTCtg	p.225_226EM>DL	TOM1_ENST00000382034.5_Missense_Mutation_p.158_159EM>DL|TOM1_ENST00000411850.1_Missense_Mutation_p.225_226EM>DL|TOM1_ENST00000436462.2_Missense_Mutation_p.187_188EM>DL|TOM1_ENST00000447733.1_Missense_Mutation_p.192_193EM>DL|TOM1_ENST00000425375.1_Missense_Mutation_p.180_181EM>DL	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	225	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GTGAGCTGGAGATGGTGAGTGG	0.604																																					p.EM234DL													.	TOM1-91	0			c.A676C						.																																			SO:0001583	missense	10043	exon7			CTGGAGATGGTGA	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	Exception_encountered	22.37:g.35723290_35723291delinsTC	ENSP00000394466:p.E225_M226delinsDL	101	1		72	10	NM_001135732	0	0	0	0	0	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	DNP	ENST00000449058.2	37	CCDS13913.1																																																																																			.		0.604	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
