#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HTR6	3362	broad.mit.edu	37	1	20005583	20005583	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:20005583G>T	ENST00000289753.1	+	3	1512	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	349					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)			endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	GGCCAGCCTGGCCTCGCCATC	0.687																																					p.A349S	Esophageal Squamous(168;1879 2619 6848 21062)												.	HTR6-91	0			c.G1045T						.						30.0	34.0	33.0					1																	20005583		2201	4298	6499	SO:0001583	missense	3362	exon3			AGCCTGGCCTCGC	L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.1045G>T	1.37:g.20005583G>T	ENSP00000289753:p.Ala349Ser	43	2		80	11	NM_000871	0	0	0	0	0	Q13640|Q5TGZ1	Missense_Mutation	SNP	ENST00000289753.1	37	CCDS197.1	.	.	.	.	.	.	.	.	.	.	G	9.626	1.135033	0.21123	.	.	ENSG00000158748	ENST00000289753	T	0.32988	1.43	5.39	4.25	0.50352	.	0.303975	0.23513	N	0.047376	T	0.16514	0.0397	N	0.14661	0.345	0.23113	N	0.998271	P	0.45044	0.849	B	0.42738	0.396	T	0.07849	-1.0751	9	.	.	.	.	4.8529	0.13545	0.2699:0.0:0.7301:0.0	.	349	P50406	5HT6R_HUMAN	S	349	ENSP00000289753:A349S	.	A	+	1	0	HTR6	19878170	0.724000	0.28038	0.959000	0.39883	0.135000	0.20990	1.057000	0.30492	2.698000	0.92095	0.561000	0.74099	GCC	.		0.687	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007704.1	NM_000871	
PITHD1	57095	hgsc.bcm.edu	37	1	24105128	24105128	+	Silent	SNP	A	A	G	rs562148184		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:24105128A>G	ENST00000246151.4	+	1	234	c.123A>G	c.(121-123)caA>caG	p.Q41Q	RP5-886K2.3_ENST00000427796.1_RNA	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	41	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						AGCGGCTGCAATGCCTTAACG	0.751													G|||	1	0.000199681	0.0	0.0014	5008	,	,		6646	0.0		0.0	False		,,,				2504	0.0				p.Q41Q		.											.	PITHD1-90	0			c.A123G						.																																			SO:0001819	synonymous_variant	57095	exon1			GCTGCAATGCCTT		CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.123A>G	1.37:g.24105128A>G		4	0		17	7	NM_020362	0	0	10	14	4	B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Silent	SNP	ENST00000246151.4	37	CCDS240.1																																																																																			.		0.751	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362	
CATSPER4	378807	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	26524220	26524220	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:26524220T>A	ENST00000456354.2	+	4	570	c.503T>A	c.(502-504)cTc>cAc	p.L168H		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	168					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TTTATCTTGCTCTTGCGGTTC	0.542																																					p.L168H													.	CATSPER4-91	0			c.T503A						.						105.0	88.0	94.0					1																	26524220		2203	4300	6503	SO:0001583	missense	378807	exon4			TCTTGCTCTTGCG	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.503T>A	1.37:g.26524220T>A	ENSP00000390423:p.Leu168His	82	1		84	29	NM_198137	0	0	0	0	0	A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	CCDS30645.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855937	0.51376	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.98807	-5.15;-5.15	5.32	4.16	0.48862	Ion transport (1);	0.974000	0.08402	N	0.951329	D	0.98658	0.9550	M	0.71920	2.185	0.09310	N	1	D	0.69078	0.997	P	0.60173	0.87	D	0.93664	0.6984	10	0.48119	T	0.1	-7.1998	9.1267	0.36818	0.0:0.0:0.1847:0.8153	.	168	Q7RTX7	CTSR4_HUMAN	H	168	ENSP00000341006:L168H;ENSP00000390423:L168H	ENSP00000341006:L168H	L	+	2	0	CATSPER4	26396807	0.256000	0.24012	0.166000	0.22797	0.043000	0.13939	2.574000	0.46016	0.820000	0.34516	0.460000	0.39030	CTC	.		0.542	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137	
RLF	6018	broad.mit.edu;bcgsc.ca	37	1	40702398	40702398	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:40702398G>A	ENST00000372771.4	+	8	2051	c.2024G>A	c.(2023-2025)gGt>gAt	p.G675D		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	675					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CCATGTCCCGGTACAGACTGT	0.388																																					p.G675D													.	RLF-93	0			c.G2024A						.						111.0	111.0	111.0					1																	40702398		2203	4300	6503	SO:0001583	missense	6018	exon8			GTCCCGGTACAGA		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.2024G>A	1.37:g.40702398G>A	ENSP00000361857:p.Gly675Asp	51	1		46	20	NM_012421	0	0	2	7	5	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658618	0.47467	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.39056	1.1	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.045241	0.85682	D	0.000000	T	0.60457	0.2270	L	0.44542	1.39	0.58432	D	0.999997	D;D	0.89917	0.998;1.0	D;D	0.91635	0.976;0.999	T	0.56631	-0.7947	10	0.52906	T	0.07	-12.1306	20.4387	0.99107	0.0:0.0:1.0:0.0	.	368;675	F5H2M5;Q13129	.;RLF_HUMAN	D	675;368	ENSP00000361857:G675D	ENSP00000361857:G675D	G	+	2	0	RLF	40474985	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.167000	0.58209	2.836000	0.97738	0.655000	0.94253	GGT	.		0.388	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
HFM1	164045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	91742587	91742587	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:91742587C>G	ENST00000370425.3	-	31	3522	c.3424G>C	c.(3424-3426)Gaa>Caa	p.E1142Q	HFM1_ENST00000370424.3_Missense_Mutation_p.E821Q|HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Missense_Mutation_p.E374Q	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1142					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TGATTGCATTCTCGGTTCCCA	0.289																																					p.E1142Q		.											.	HFM1-112	0			c.G3424C						.						129.0	128.0	129.0					1																	91742587		2203	4299	6502	SO:0001583	missense	164045	exon31			TGCATTCTCGGTT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3424G>C	1.37:g.91742587C>G	ENSP00000359454:p.Glu1142Gln	109	0		88	30	NM_001017975	0	0	0	1	1	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	12.44|12.44|12.44	1.937796|1.937796|1.937796	0.34189|0.34189|0.34189	.|.|.	.|.|.	ENSG00000162669|ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424|ENST00000370421	.|T;T;T|.	.|0.64618|.	.|0.25;0.63;-0.11|.	5.71|5.71|5.71	5.71|5.71|5.71	0.89125|0.89125|0.89125	.|.|.	0.237508|0.237508|.	0.33005|0.33005|.	N|N|.	0.005389|0.005389|.	T|T|T	0.55481|0.55481|0.55481	0.1923|0.1923|0.1923	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.36745|0.36745|0.36745	D|D|D	0.882419|0.882419|0.882419	.|B;B;B|.	.|0.28378|.	.|0.082;0.209;0.105|.	.|B;B;B|.	.|0.25614|.	.|0.045;0.062;0.034|.	T|T|T	0.59461|0.59461|0.59461	-0.7450|-0.7450|-0.7450	6|10|6	.|0.40728|0.42905	.|T|T	.|0.16|0.14	.|.|.	10.7947|10.7947|10.7947	0.46453|0.46453|0.46453	0.0:0.9137:0.0:0.0863|0.0:0.9137:0.0:0.0863|0.0:0.9137:0.0:0.0863	.|.|.	.|821;353;1142|.	.|A6NGI5;B1B0B5;A2PYH4|.	.|.;.;HFM1_HUMAN|.	D|Q|T	353|1142;374;821|825	.|ENSP00000359454:E1142Q;ENSP00000294696:E374Q;ENSP00000359453:E821Q|.	.|ENSP00000294696:E374Q|ENSP00000359450:R825T	E|E|R	-|-|-	3|1|2	2|0|0	HFM1|HFM1|HFM1	91515175|91515175|91515175	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.815000|0.815000|0.815000	0.46073|0.46073|0.46073	3.562000|3.562000|3.562000	0.53777|0.53777|0.53777	2.698000|2.698000|2.698000	0.92095|0.92095|0.92095	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GAG|GAA|AGA	.		0.289	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
SLC44A3	126969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	95330398	95330398	+	Silent	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:95330398T>A	ENST00000271227.6	+	11	1440	c.1338T>A	c.(1336-1338)tcT>tcA	p.S446S	SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000529450.1_Silent_p.S414S|SLC44A3_ENST00000446120.2_Silent_p.S410S|SLC44A3_ENST00000527077.1_Silent_p.S378S|SLC44A3_ENST00000467909.1_Silent_p.S398S|SLC44A3_ENST00000532427.1_Silent_p.S366S	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	446					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TTTTAATCTCTGTGGTGAGGA	0.433																																					p.S446S		.											.	SLC44A3-91	0			c.T1338A						.						217.0	202.0	207.0					1																	95330398		2203	4300	6503	SO:0001819	synonymous_variant	126969	exon11			AATCTCTGTGGTG	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1338T>A	1.37:g.95330398T>A		87	0		68	22	NM_001114106	0	0	127	210	83	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	ENST00000271227.6	37	CCDS44176.1																																																																																			.		0.433	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
CHD1L	9557	ucsc.edu;bcgsc.ca	37	1	146765335	146765335	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:146765335T>C	ENST00000369258.4	+	21	2455	c.2435T>C	c.(2434-2436)cTg>cCg	p.L812P	CHD1L_ENST00000431239.1_Missense_Mutation_p.L718P|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Missense_Mutation_p.L531P|CHD1L_ENST00000369259.3_Missense_Mutation_p.L608P	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	812	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TCCAATGTCCTGTCTGGCATT	0.458																																					p.L812P													.	CHD1L-231	0			c.T2435C						.						187.0	182.0	184.0					1																	146765335		2203	4300	6503	SO:0001583	missense	9557	exon21			ATGTCCTGTCTGG	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2435T>C	1.37:g.146765335T>C	ENSP00000358262:p.Leu812Pro	59	0		43	4	NM_004284	0	0	21	21	0	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	CCDS927.1	.	.	.	.	.	.	.	.	.	.	T	19.21	3.784525	0.70222	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.27	5.27	0.74061	Appr-1-p processing (1);	0.072961	0.56097	D	0.000022	T	0.52008	0.1708	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.987;0.999;0.991	T	0.55604	-0.8115	10	0.51188	T	0.08	.	11.8759	0.52548	0.0:0.0:0.0:1.0	.	718;608;812	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	P	718;608;812;531	ENSP00000389031:L718P;ENSP00000358263:L608P;ENSP00000358262:L812P;ENSP00000355100:L531P	ENSP00000355100:L531P	L	+	2	0	CHD1L	145231959	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.989000	0.63870	2.118000	0.64928	0.455000	0.32223	CTG	.		0.458	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
GON4L	54856	broad.mit.edu	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000437809.1_Silent_p.E1528E|GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																					p.E1528E													.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.G4584A						.						35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856	exon22			TTCTTCCTCCTCT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T		32	0		55	5	NM_001037533	0	0	7	7	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
RGL1	23179	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183885769	183885769	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:183885769T>G	ENST00000360851.3	+	16	2116	c.1938T>G	c.(1936-1938)aaT>aaG	p.N646K	RGL1_ENST00000536277.1_Missense_Mutation_p.N644K|RGL1_ENST00000304685.4_Missense_Mutation_p.N681K|RGL1_ENST00000539189.1_Missense_Mutation_p.N617K			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	646					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						ACCAACAGAATGAAGACACCT	0.527																																					p.N681K													.	RGL1-725	0			c.T2043G						.						144.0	135.0	138.0					1																	183885769		2203	4300	6503	SO:0001583	missense	23179	exon17			ACAGAATGAAGAC	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1938T>G	1.37:g.183885769T>G	ENSP00000354097:p.Asn646Lys	97	1		93	41	NM_015149	0	0	3	8	5	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	T	12.79	2.044074	0.36085	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.43	-2.84	0.05751	.	0.338661	0.34959	N	0.003544	T	0.19208	0.0461	L	0.36672	1.1	0.23872	N	0.996605	P;B;B;B	0.34587	0.458;0.118;0.118;0.118	B;B;B;B	0.32465	0.146;0.018;0.018;0.018	T	0.35325	-0.9793	10	0.06757	T	0.87	.	3.1668	0.06539	0.1095:0.3105:0.1084:0.4716	.	617;644;646;681	F5H6U6;B7Z2W5;Q9NZL6;Q5SXQ6	.;.;RGL1_HUMAN;.	K	681;681;644;646;617	ENSP00000303192:N681K;ENSP00000356501:N681K;ENSP00000438662:N644K;ENSP00000354097:N646K;ENSP00000437355:N617K	ENSP00000303192:N681K	N	+	3	2	RGL1	182152392	0.000000	0.05858	0.939000	0.37840	0.995000	0.86356	-1.705000	0.01896	-0.313000	0.08728	-0.137000	0.14449	AAT	.		0.527	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
KLHDC8A	55220	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205308913	205308913	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:205308913C>T	ENST00000367156.3	-	6	1216	c.400G>A	c.(400-402)Ggg>Agg	p.G134R	KLHDC8A_ENST00000367155.3_Missense_Mutation_p.G134R|KLHDC8A_ENST00000460687.1_5'UTR|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.G134R|KLHDC8A_ENST00000537168.1_Missense_Mutation_p.G21R	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	134										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AGGCCCATCCCGCCTGCCGCA	0.557																																					p.G134R													.	KLHDC8A-91	0			c.G400A						.						107.0	87.0	94.0					1																	205308913		2203	4300	6503	SO:0001583	missense	55220	exon3			CCATCCCGCCTGC		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.400G>A	1.37:g.205308913C>T	ENSP00000356124:p.Gly134Arg	146	0		93	51	NM_018203	0	0	0	0	0	B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	37	CCDS30985.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486904	0.84854	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253;ENST00000537168	D;D;D;D	0.94537	-3.45;-3.45;-3.45;-1.85	5.87	5.87	0.94306	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.97639	0.9226	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.97864	1.0282	10	0.87932	D	0	-20.5621	19.803	0.96516	0.0:1.0:0.0:0.0	.	21;134	F5H5F1;Q8IYD2	.;KLD8A_HUMAN	R	134;134;134;21	ENSP00000356123:G134R;ENSP00000356124:G134R;ENSP00000442229:G134R;ENSP00000443447:G21R	ENSP00000356123:G134R	G	-	1	0	KLHDC8A	203575536	1.000000	0.71417	0.999000	0.59377	0.493000	0.33554	7.774000	0.85478	2.781000	0.95711	0.655000	0.94253	GGG	.		0.557	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203	
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	225546329	225546329	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:225546329T>C	ENST00000445597.2	+	53	9180	c.9180T>C	c.(9178-9180)acT>acC	p.T3060T	DNAH14_ENST00000430092.1_Silent_p.T3824T|DNAH14_ENST00000439375.2_Silent_p.T3824T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3060					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATGCCAGAACTCCGCTGATAC	0.348																																					p.T3824T		.											.	DNAH14-23	0			c.T11472C						.						115.0	103.0	106.0					1																	225546329		692	1591	2283	SO:0001819	synonymous_variant	127602	exon72			CAGAACTCCGCTG	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9180T>C	1.37:g.225546329T>C		95	0		70	32	NM_001373	0	0	0	0	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37																																																																																				.		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
HK1	3098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	71128300	71128300	+	Silent	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:71128300G>A	ENST00000359426.6	+	5	608	c.504G>A	c.(502-504)ctG>ctA	p.L168L	HK1_ENST00000298649.3_Silent_p.L167L|HK1_ENST00000448642.2_Silent_p.L203L|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000404387.2_Silent_p.L172L|HK1_ENST00000360289.2_Silent_p.L156L	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	168	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						AGGCCATCCTGATCACCTGGA	0.547																																					p.L172L		.											.	HK1-252	0			c.G516A						.						97.0	85.0	89.0					10																	71128300		2203	4300	6503	SO:0001819	synonymous_variant	3098	exon8			CATCCTGATCACC	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.504G>A	10.37:g.71128300G>A		180	0		171	68	NM_033498	0	0	0	0	0	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	37	CCDS7292.1																																																																																			.		0.547	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
HOGA1	112817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	99358955	99358955	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:99358955C>T	ENST00000370646.4	+	3	811	c.450C>T	c.(448-450)ctC>ctT	p.L150L	PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron|HOGA1_ENST00000370647.4_Intron	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	150					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						GTGCGGCCCTCATTCACCACT	0.612																																					p.L150L		.											.	HOGA1-90	0			c.C450T						.						52.0	47.0	49.0					10																	99358955		2203	4300	6503	SO:0001819	synonymous_variant	112817	exon3			GGCCCTCATTCAC	BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.450C>T	10.37:g.99358955C>T		124	0		88	35	NM_138413	0	0	70	102	32	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Silent	SNP	ENST00000370646.4	37	CCDS7467.1																																																																																			.		0.612	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049726.1	NM_138413	
SLC18A2	6571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	119003520	119003520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:119003520G>T	ENST00000298472.5	+	3	303	c.160G>T	c.(160-162)Gag>Tag	p.E54*	SLC18A2_ENST00000497497.1_3'UTR|RP11-501J20.5_ENST00000425264.1_RNA	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	54					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CATTAAGCATGAGAAGAATGC	0.478																																					p.E54X		.											.	SLC18A2-90	0			c.G160T						.						70.0	61.0	64.0					10																	119003520		2203	4300	6503	SO:0001587	stop_gained	6571	exon3			AAGCATGAGAAGA	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.160G>T	10.37:g.119003520G>T	ENSP00000298472:p.Glu54*	88	0		64	29	NM_003054	0	0	0	0	0	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Nonsense_Mutation	SNP	ENST00000298472.5	37	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307301	0.81247	.	.	ENSG00000165646	ENST00000298472	.	.	.	5.82	5.82	0.92795	.	0.167513	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-19.4478	14.7287	0.69365	0.0:0.144:0.856:0.0	.	.	.	.	X	54	.	ENSP00000298472:E54X	E	+	1	0	SLC18A2	118993510	0.976000	0.34144	0.990000	0.47175	0.418000	0.31294	1.665000	0.37449	2.756000	0.94617	0.563000	0.77884	GAG	.		0.478	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
ARL14EP	120534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	30352522	30352522	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:30352522C>T	ENST00000282032.3	+	2	242	c.27C>T	c.(25-27)gtC>gtT	p.V9V		NM_152316.1	NP_689529.1	Q8N8R7	AL14E_HUMAN	ADP-ribosylation factor-like 14 effector protein	9						cytoplasm (GO:0005737)											CAGTTGGAGTCCAGCTTCGTA	0.378																																					p.V9V		.											.	.	0			c.C27T						.						76.0	70.0	72.0					11																	30352522		2202	4299	6501	SO:0001819	synonymous_variant	120534	exon2			TGGAGTCCAGCTT	AK096287	CCDS7869.1	11p14.1	2014-09-17	2012-07-09	2012-07-09	ENSG00000152219	ENSG00000152219			26798	protein-coding gene	gene with protein product		612295	"""chromosome 11 open reading frame 46"""	C11orf46		21458045	Standard	XM_005252792		Approved	FLJ38968, ARF7EP	uc001mso.1	Q8N8R7	OTTHUMG00000166154	ENST00000282032.3:c.27C>T	11.37:g.30352522C>T		360	0		328	142	NM_152316	0	0	7	20	13	Q5HYH9	Silent	SNP	ENST00000282032.3	37	CCDS7869.1																																																																																			.		0.378	ARL14EP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388129.1	NM_152316	
CCDC85B	11007	hgsc.bcm.edu	37	11	65658488	65658488	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:65658488C>T	ENST00000312579.2	+	1	614	c.234C>T	c.(232-234)cgC>cgT	p.R78R	FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000533045.1_5'Flank|FIBP_ENST00000357519.4_5'Flank|FIBP_ENST00000338369.2_5'Flank	NM_006848.2	NP_006839.2	Q15834	CC85B_HUMAN	coiled-coil domain containing 85B	78					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)									READ - Rectum adenocarcinoma(159;0.166)		GTGAGCTGCGCGACCTCTGCT	0.701																																					p.R78R		.											.	CCDC85B-90	0			c.C234T						.						5.0	6.0	5.0					11																	65658488		2076	4086	6162	SO:0001819	synonymous_variant	11007	exon1			GCTGCGCGACCTC	BC008796	CCDS8120.1	11q13.1	2010-12-24				ENSG00000175602			24926	protein-coding gene	gene with protein product	"""hepatitis delta antigen interacting protein A"""	605360				8810253, 15644333, 17873903	Standard	NM_006848		Approved	DIPA	uc001ogf.3	Q15834		ENST00000312579.2:c.234C>T	11.37:g.65658488C>T		0	0		19	9	NM_006848	0	0	9	22	13	B2R598|Q96HA0	Silent	SNP	ENST00000312579.2	37	CCDS8120.1																																																																																			.		0.701	CCDC85B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391196.1	NM_006848	
SDHD	6392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111958619	111958619	+	Missense_Mutation	SNP	A	A	G	rs397514034		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:111958619A>G	ENST00000375549.3	+	2	226	c.91A>G	c.(91-93)Atc>Gtc	p.I31V	TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000528048.1_Missense_Mutation_p.I31V|TIMM8B_ENST00000507614.1_5'Flank|SDHD_ENST00000525291.1_Intron|SDHD_ENST00000528182.1_Missense_Mutation_p.I31V|SDHD_ENST00000526592.1_Missense_Mutation_p.I31V|TIMM8B_ENST00000504148.2_5'Flank|SDHD_ENST00000532699.1_Missense_Mutation_p.I31V|SDHD_ENST00000528021.1_Missense_Mutation_p.I31V	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	31					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	ACCTGCTCATATCTCAGCATT	0.473			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																												p.T31A		.	yes	Rec		Familial paraganglioma	11	11q23	6392	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""		O	.	SDHD-226	0			c.A91G						.						178.0	155.0	163.0					11																	111958619		2201	4297	6498	SO:0001583	missense	6392	exon2	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	GCTCATATCTCAG	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.91A>G	11.37:g.111958619A>G	ENSP00000364699:p.Ile31Val	67	0		60	26	NM_003002	0	0	77	150	73	A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	ENST00000375549.3	37	CCDS31678.1	.	.	.	.	.	.	.	.	.	.	A	0.223	-1.026824	0.02045	.	.	ENSG00000204370	ENST00000375549;ENST00000528182;ENST00000528048;ENST00000528021;ENST00000526592	D;D;T;D;D	0.94497	-3.44;-2.77;-1.48;-2.76;-2.9	4.81	2.78	0.32641	.	0.321128	0.32244	N	0.006373	T	0.77624	0.4158	N	0.01168	-0.975	0.19300	N	0.999977	B	0.02656	0.0	B	0.01281	0.0	T	0.68224	-0.5465	10	0.02654	T	1	-1.6835	6.2353	0.20760	0.2591:0.0:0.7409:0.0	.	31	O14521	DHSD_HUMAN	V	31	ENSP00000364699:I31V;ENSP00000435475:I31V;ENSP00000436217:I31V;ENSP00000432465:I31V;ENSP00000432005:I31V	ENSP00000436395:I31V	I	+	1	0	SDHD	111463829	0.331000	0.24713	0.060000	0.19600	0.783000	0.44284	0.435000	0.21510	0.511000	0.28236	-0.248000	0.11899	ATC	.		0.473	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392351.1	NM_003002	
KANSL2	54934	bcgsc.ca	37	12	49073469	49073469	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49073469T>A	ENST00000420613.2	-	3	446	c.399A>T	c.(397-399)gaA>gaT	p.E133D	KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Missense_Mutation_p.E316D|KANSL2_ENST00000553086.1_Missense_Mutation_p.E133D	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	133					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											TGCGACTACTTTCTGGAGTCT	0.493																																					p.E133D													.	.	0			c.A399T						.						50.0	47.0	48.0					12																	49073469		1917	4135	6052	SO:0001583	missense	54934	exon3			ACTACTTTCTGGA	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.399A>T	12.37:g.49073469T>A	ENSP00000415436:p.Glu133Asp	82	0		122	64	NM_017822	0	0	14	14	0	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	ENST00000420613.2	37	CCDS44869.1	.	.	.	.	.	.	.	.	.	.	T	15.29	2.790834	0.50102	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000553086;ENST00000550931	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.95	2.33	0.28932	.	0.051599	0.85682	D	0.000000	T	0.52484	0.1737	N	0.11560	0.145	0.80722	D	1	B;B	0.31931	0.347;0.06	B;B	0.26416	0.069;0.03	T	0.37526	-0.9702	10	0.25106	T	0.35	-23.2646	7.0563	0.25102	0.0:0.3922:0.0:0.6078	.	316;133	F8VX10;Q9H9L4	.;CL041_HUMAN	D	316;133;133;70	ENSP00000449747:E316D;ENSP00000415436:E133D;ENSP00000448833:E133D;ENSP00000448129:E70D	ENSP00000415436:E133D	E	-	3	2	C12orf41	47359736	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.459000	0.21908	0.507000	0.28148	0.533000	0.62120	GAA	.		0.493	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49432161	49432161	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49432161A>C	ENST00000301067.7	-	34	8977	c.8978T>G	c.(8977-8979)cTg>cGg	p.L2993R	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2993					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ATCGTCATCCAGCTCGGGATC	0.597																																					p.L2993R		.											.	MLL2-612	0			c.T8978G						.						85.0	85.0	85.0					12																	49432161		2025	4193	6218	SO:0001583	missense	8085	exon34			TCATCCAGCTCGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8978T>G	12.37:g.49432161A>C	ENSP00000301067:p.Leu2993Arg	153	0		173	49	NM_003482	0	0	5	7	2	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.408624	0.25378	.	.	ENSG00000167548	ENST00000301067	D	0.83335	-1.71	5.46	5.46	0.80206	.	0.000000	0.30428	N	0.009645	D	0.86053	0.5841	L	0.29908	0.895	0.38041	D	0.935458	D	0.89917	1.0	D	0.75484	0.986	D	0.88960	0.3393	10	0.87932	D	0	.	14.8421	0.70233	1.0:0.0:0.0:0.0	.	2993	O14686	MLL2_HUMAN	R	2993	ENSP00000301067:L2993R	ENSP00000301067:L2993R	L	-	2	0	MLL2	47718428	0.520000	0.26250	0.999000	0.59377	0.717000	0.41224	4.553000	0.60753	2.207000	0.71202	0.533000	0.62120	CTG	.		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
RHEBL1	121268	broad.mit.edu;bcgsc.ca	37	12	49460045	49460045	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49460045C>A	ENST00000301068.6	-	6	588	c.349G>T	c.(349-351)Gtg>Ttg	p.V117L		NM_144593.1	NP_653194.1	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1	117					GTP catabolic process (GO:0006184)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|small GTPase mediated signal transduction (GO:0007264)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|large_intestine(2)|lung(5)	9						TTGTTCCCCACTAGAACCACT	0.498																																					p.V117L													.	RHEBL1-659	0			c.G349T						.						114.0	106.0	108.0					12																	49460045		2203	4300	6503	SO:0001583	missense	121268	exon6			TCCCCACTAGAAC	AK098663	CCDS8778.1	12q13.12	2014-05-09				ENSG00000167550			21166	protein-coding gene	gene with protein product						12477932	Standard	NM_144593		Approved	MGC34869, FLJ25797	uc001rtc.1	Q8TAI7	OTTHUMG00000170407	ENST00000301068.6:c.349G>T	12.37:g.49460045C>A	ENSP00000301068:p.Val117Leu	99	2		112	68	NM_144593	0	0	0	0	0	Q56VH8	Missense_Mutation	SNP	ENST00000301068.6	37	CCDS8778.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035378	0.75617	.	.	ENSG00000167550	ENST00000301068	T	0.81330	-1.48	5.25	4.36	0.52297	Small GTP-binding protein domain (1);	0.059229	0.64402	D	0.000003	D	0.89153	0.6634	M	0.85197	2.74	0.48571	D	0.999678	D	0.89917	1.0	D	0.77557	0.99	D	0.89836	0.3999	10	0.87932	D	0	.	10.0518	0.42221	0.0:0.9062:0.0:0.0938	.	117	Q8TAI7	REBL1_HUMAN	L	117	ENSP00000301068:V117L	ENSP00000301068:V117L	V	-	1	0	RHEBL1	47746312	0.915000	0.31059	0.998000	0.56505	0.940000	0.58332	1.598000	0.36740	1.347000	0.45714	0.591000	0.81541	GTG	.		0.498	RHEBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408969.1	NM_144593	
RAB5B	5869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56384574	56384574	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:56384574A>G	ENST00000360299.5	+	4	645	c.424A>G	c.(424-426)Atg>Gtg	p.M142V	RAB5B_ENST00000448789.2_Intron|RAB5B_ENST00000553116.1_Missense_Mutation_p.M142V	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	142					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			CAACAAACGTATGGTGGAGTA	0.522																																					p.M142V		.											.	RAB5B-227	0			c.A424G						.						126.0	120.0	122.0					12																	56384574		2203	4300	6503	SO:0001583	missense	5869	exon4			AAACGTATGGTGG		CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.424A>G	12.37:g.56384574A>G	ENSP00000353444:p.Met142Val	102	0		151	87	NM_002868	0	0	58	159	101	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	37	CCDS8900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.481|9.481	1.098275|1.098275	0.20552|0.20552	.|.	.|.	ENSG00000111540|ENSG00000111540	ENST00000553116;ENST00000360299|ENST00000549218	T;T|.	0.78364|.	-1.17;-1.17|.	4.81|4.81	3.66|3.66	0.41972|0.41972	Small GTP-binding protein domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.15782|0.15782	0.0380|0.0380	N|N	0.00633|0.00633	-1.31|-1.31	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.06991|0.06991	-1.0796|-1.0796	10|5	0.09843|.	T|.	0.71|.	-6.2164|-6.2164	9.8491|9.8491	0.41046|0.41046	0.9168:0.0:0.0832:0.0|0.9168:0.0:0.0832:0.0	.|.	142;142|.	Q6FI54;P61020|.	.;RAB5B_HUMAN|.	V|C	142|61	ENSP00000450168:M142V;ENSP00000353444:M142V|.	ENSP00000353444:M142V|.	M|Y	+|+	1|2	0|0	RAB5B|RAB5B	54670841|54670841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.607000|1.607000	0.36836|0.36836	0.974000|0.974000	0.38366|0.38366	0.477000|0.477000	0.44152|0.44152	ATG|TAT	.		0.522	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405396.1		
LRP1	4035	broad.mit.edu	37	12	57566959	57566959	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:57566959C>A	ENST00000243077.3	+	21	3638	c.3172C>A	c.(3172-3174)Ccc>Acc	p.P1058T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1058					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.P1058T(3)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCACGAGGCCCCCTGGTGG	0.672											OREG0021936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1058T													.	LRP1-596	3	Substitution - Missense(3)	prostate(2)|endometrium(1)	c.C3172A						.						45.0	42.0	43.0					12																	57566959		2203	4300	6503	SO:0001583	missense	4035	exon21			ACGAGGCCCCCTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3172C>A	12.37:g.57566959C>A	ENSP00000243077:p.Pro1058Thr	41	1	1024	44	4	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589375	0.66105	.	.	ENSG00000123384	ENST00000243077	D	0.91237	-2.81	5.08	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.89255	0.6663	N	0.13140	0.3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85355	0.1104	10	0.10902	T	0.67	.	14.634	0.68676	0.0:0.8532:0.1468:0.0	.	1058	Q07954	LRP1_HUMAN	T	1058	ENSP00000243077:P1058T	ENSP00000243077:P1058T	P	+	1	0	LRP1	55853226	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	7.488000	0.81441	1.355000	0.45865	0.561000	0.74099	CCC	.		0.672	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
SLC17A8	246213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	100811853	100811853	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:100811853T>G	ENST00000323346.5	+	11	1657	c.1344T>G	c.(1342-1344)atT>atG	p.I448M	SLC17A8_ENST00000392989.3_Missense_Mutation_p.I398M|SLC17A8_ENST00000552697.1_3'UTR	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	448					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						ATGCCAGCATTCTCATGGGGA	0.478																																					p.I448M		.											.	SLC17A8-93	0			c.T1344G						.						177.0	163.0	167.0					12																	100811853		2203	4300	6503	SO:0001583	missense	246213	exon11			CAGCATTCTCATG	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1344T>G	12.37:g.100811853T>G	ENSP00000316909:p.Ile448Met	86	0		103	73	NM_139319	0	0	0	1	1	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261452	0.59431	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.55588	0.51;0.51	5.55	1.98	0.26296	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.90542	3.125	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.87578	0.987;0.998	T	0.74121	-0.3767	10	0.66056	D	0.02	.	9.7886	0.40692	0.0:0.349:0.0:0.651	.	448;398	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	M	448;398	ENSP00000316909:I448M;ENSP00000376715:I398M	ENSP00000316909:I448M	I	+	3	3	SLC17A8	99335984	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.508000	0.22692	0.164000	0.19529	-0.250000	0.11733	ATT	.		0.478	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
ACACB	32	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	109702126	109702126	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:109702126G>A	ENST00000338432.7	+	50	6996	c.6877G>A	c.(6877-6879)Gtg>Atg	p.V2293M	ACACB_ENST00000543201.1_3'UTR|ACACB_ENST00000377854.5_Missense_Mutation_p.V2223M|ACACB_ENST00000377848.3_Missense_Mutation_p.V2293M			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2293	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CTACCACCAGGTGGCGGTGCA	0.622											OREG0022102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V2293M													.	ACACB-98	0			c.G6877A						.						68.0	70.0	69.0					12																	109702126		2203	4300	6503	SO:0001583	missense	32	exon49			CACCAGGTGGCGG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6877G>A	12.37:g.109702126G>A	ENSP00000341044:p.Val2293Met	125	1	1421	104	55	NM_001093	0	0	7	25	18	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	32	5.106643	0.94292	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	D;D;D	0.97772	-4.53;-4.53;-4.53	4.79	4.79	0.61399	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.98789	0.9592	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99764	1.1022	10	0.66056	D	0.02	.	18.2354	0.89948	0.0:0.0:1.0:0.0	.	2293	O00763	ACACB_HUMAN	M	2293;2293;2223;1524	ENSP00000341044:V2293M;ENSP00000367079:V2293M;ENSP00000367085:V2223M	ENSP00000341044:V2293M	V	+	1	0	ACACB	108186509	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.389000	0.81357	0.655000	0.94253	GTG	.		0.622	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
PEBP1	5037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	118575948	118575948	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:118575948A>C	ENST00000261313.2	+	2	592	c.240A>C	c.(238-240)aaA>aaC	p.K80N		NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	80						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGATCCCAAATACAGGTGAG	0.517																																					p.K80N	NSCLC(44;94 1357 12187 49467)	.											.	PEBP1-779	0			c.A240C						.						41.0	36.0	38.0					12																	118575948		2203	4300	6503	SO:0001583	missense	5037	exon2			TCCCAAATACAGG	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.240A>C	12.37:g.118575948A>C	ENSP00000261313:p.Lys80Asn	35	0		73	24	NM_002567	0	0	0	0	0	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	37	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425675	0.43020	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.48522	0.81	4.42	0.684	0.18003	Phosphatidylethanolamine-binding, conserved site (1);	0.048518	0.85682	D	0.000000	T	0.37433	0.1003	L	0.60904	1.88	0.54753	D	0.999985	B;B	0.12013	0.005;0.001	B;B	0.23716	0.048;0.046	T	0.08554	-1.0716	10	0.30078	T	0.28	-8.474	4.709	0.12863	0.5104:0.0:0.3477:0.142	.	80;80	B4DRT4;P30086	.;PEBP1_HUMAN	N	80	ENSP00000261313:K80N	ENSP00000261313:K80N	K	+	3	2	PEBP1	117060331	0.829000	0.29322	0.997000	0.53966	0.937000	0.57800	0.050000	0.14120	-0.044000	0.13491	-0.274000	0.10170	AAA	.		0.517	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
RXFP2	122042	bcgsc.ca	37	13	32360573	32360573	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr13:32360573T>C	ENST00000298386.2	+	12	1054	c.983T>C	c.(982-984)tTg>tCg	p.L328S	RXFP2_ENST00000380314.1_Missense_Mutation_p.L304S	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	328					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TTTAAAGACTTGAAGCTTCTA	0.338																																					p.L328S													.	RXFP2-90	0			c.T983C						.						99.0	92.0	95.0					13																	32360573		2203	4300	6503	SO:0001583	missense	122042	exon12			AAGACTTGAAGCT	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.983T>C	13.37:g.32360573T>C	ENSP00000298386:p.Leu328Ser	58	0		67	5	NM_130806	0	0	0	0	0	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083863	0.55861	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.72282	-0.64;-0.64	5.72	4.51	0.55191	.	0.000000	0.64402	D	0.000001	D	0.83422	0.5251	M	0.83223	2.63	0.25477	N	0.987777	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.75875	-0.3163	10	0.48119	T	0.1	.	11.3401	0.49527	0.1361:0.0:0.0:0.8639	.	304;328	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	S	304;328	ENSP00000369670:L304S;ENSP00000298386:L328S	ENSP00000298386:L328S	L	+	2	0	RXFP2	31258573	0.974000	0.33945	0.992000	0.48379	0.974000	0.67602	4.820000	0.62671	0.963000	0.38082	0.533000	0.62120	TTG	.		0.338	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
MYCBP2	23077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	77714983	77714983	+	De_novo_Start_OutOfFrame	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr13:77714983T>C	ENST00000360084.5	-	0	7377				MYCBP2_ENST00000544440.2_Missense_Mutation_p.K2429E|MYCBP2_ENST00000357337.6_Missense_Mutation_p.K2429E|MYCBP2_ENST00000407578.2_Missense_Mutation_p.K2467E					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCCCTAACCTTATTAGGCTGA	0.403																																					p.K2467E		.											.	MYCBP2-236	0			c.A7399G						.						220.0	222.0	222.0					13																	77714983		2203	4300	6503			23077	exon50			TAACCTTATTAGG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000360084.5:c.-327A>G	13.37:g.77714983T>C		124	0		107	6	NM_015057	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360084.5	37		.	.	.	.	.	.	.	.	.	.	T	20.4	3.985587	0.74589	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.36520	1.26;1.25;1.26	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	M	0.61703	1.905	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.59658	-0.7413	10	0.72032	D	0.01	.	15.2435	0.73488	0.0:0.0:0.0:1.0	.	2429	O75592	MYCB2_HUMAN	E	2429;2467;2429	ENSP00000349892:K2429E;ENSP00000384288:K2467E;ENSP00000444596:K2429E	ENSP00000349892:K2429E	K	-	1	0	MYCBP2	76612984	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.642000	0.83385	2.012000	0.59069	0.482000	0.46254	AAG	.		0.403	MYCBP2-202	KNOWN	basic	protein_coding	protein_coding		NM_015057	
SPTB	6710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	65253201	65253201	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr14:65253201C>T	ENST00000389721.5	-	15	3514	c.3482G>A	c.(3481-3483)aGc>aAc	p.S1161N	SPTB_ENST00000556626.1_Missense_Mutation_p.S1161N|SPTB_ENST00000389720.3_Missense_Mutation_p.S1161N|SPTB_ENST00000389722.3_Missense_Mutation_p.S1161N|SPTB_ENST00000542895.1_Missense_Mutation_p.S1161N	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1161					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GAGGGTGTGGCTGCGGCTCTC	0.612																																					p.S1161N		.											.	SPTB-100	0			c.G3482A						.						58.0	59.0	59.0					14																	65253201		2203	4300	6503	SO:0001583	missense	6710	exon15			GTGTGGCTGCGGC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3482G>A	14.37:g.65253201C>T	ENSP00000374371:p.Ser1161Asn	98	0		80	30	NM_001024858	0	0	0	0	0	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851576	0.32699	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	4.78	3.86	0.44501	.	0.412688	0.27549	N	0.018876	T	0.18551	0.0445	N	0.01352	-0.895	0.22096	N	0.999368	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.13176	-1.0519	10	0.59425	D	0.04	.	6.711	0.23276	0.0:0.7003:0.0:0.2997	.	1161;1165	P11277;Q59FP5	SPTB1_HUMAN;.	N	1165;1161;1161;1161;1161;1161	ENSP00000374372:S1161N;ENSP00000451752:S1161N;ENSP00000374371:S1161N;ENSP00000443882:S1161N;ENSP00000374370:S1161N	ENSP00000374370:S1161N	S	-	2	0	SPTB	64322954	0.429000	0.25530	0.066000	0.19879	0.879000	0.50718	3.324000	0.52022	1.079000	0.41038	0.549000	0.68633	AGC	.		0.612	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42166194	42166194	+	Missense_Mutation	SNP	A	A	C	rs199969875		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:42166194A>C	ENST00000320955.6	-	25	4966	c.4739T>G	c.(4738-4740)cTg>cGg	p.L1580R		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1580					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCCAGAACTCAGCACCCGTTG	0.652																																					p.L1545R		.											.	SPTBN5-91	0			c.T4634G						.						26.0	31.0	29.0					15																	42166194		2009	4188	6197	SO:0001583	missense	51332	exon25			GAACTCAGCACCC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4739T>G	15.37:g.42166194A>C	ENSP00000317790:p.Leu1580Arg	29	0		26	10	NM_016642	0	0	0	0	0		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	16.38	3.107363	0.56291	.	.	ENSG00000137877	ENST00000320955	T	0.51071	0.72	5.26	5.26	0.73747	.	0.111511	0.39909	N	0.001223	T	0.71484	0.3345	M	0.84683	2.71	0.34983	D	0.754273	D	0.89917	1.0	D	0.87578	0.998	T	0.83027	-0.0164	10	0.87932	D	0	.	14.1772	0.65549	1.0:0.0:0.0:0.0	.	1580	Q9NRC6	SPTN5_HUMAN	R	1580	ENSP00000317790:L1580R	ENSP00000317790:L1580R	L	-	2	0	SPTBN5	39953486	1.000000	0.71417	0.240000	0.24138	0.217000	0.24651	6.813000	0.75231	1.979000	0.57680	0.529000	0.55759	CTG	.		0.652	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
TGM7	116179	broad.mit.edu	37	15	43571977	43571977	+	Silent	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:43571977C>A	ENST00000452443.2	-	10	1528	c.1524G>T	c.(1522-1524)ctG>ctT	p.L508L		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	508					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TACGCAGCAGCAGCTGCAGGT	0.657																																					p.L508L													.	TGM7-92	0			c.G1524T						.						38.0	44.0	42.0					15																	43571977		2201	4297	6498	SO:0001819	synonymous_variant	116179	exon10			CAGCAGCAGCTGC	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1524G>T	15.37:g.43571977C>A		36	1		35	5	NM_052955	0	0	0	0	0		Silent	SNP	ENST00000452443.2	37	CCDS32213.1																																																																																			.		0.657	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
VPS13C	54832	broad.mit.edu	37	15	62207846	62207846	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:62207846A>T	ENST00000261517.5	-	61	8504	c.8431T>A	c.(8431-8433)Ttt>Att	p.F2811I	VPS13C_ENST00000249837.3_Missense_Mutation_p.F2768I|VPS13C_ENST00000395896.4_Missense_Mutation_p.F2811I|VPS13C_ENST00000395898.3_Missense_Mutation_p.F2768I|RN7SL613P_ENST00000584412.1_RNA	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTTTTAGTAAAAATGTTCTTC	0.338																																					p.F2811I													.	VPS13C-92	0			c.T8431A						.						23.0	25.0	24.0					15																	62207846		2195	4296	6491	SO:0001583	missense	54832	exon61			TAGTAAAAATGTT	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8431T>A	15.37:g.62207846A>T	ENSP00000261517:p.Phe2811Ile	34	1		31	4	NM_020821	0	0	7	7	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813000	0.90707	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.31510	1.49;1.49;1.49	5.52	5.52	0.82312	Vacuolar protein sorting-associated protein (1);	0.000000	0.85682	D	0.000000	T	0.60856	0.2301	M	0.86502	2.82	0.80722	D	1	D;D;D;D;D	0.69078	0.995;0.957;0.963;0.997;0.97	D;D;P;D;D	0.73708	0.981;0.936;0.886;0.981;0.93	T	0.66991	-0.5783	10	0.52906	T	0.07	.	15.6453	0.77042	1.0:0.0:0.0:0.0	.	2811;2768;2811;2768;2811	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	I	2768;2811;2811;2811	ENSP00000249837:F2768I;ENSP00000261517:F2811I;ENSP00000379233:F2811I	ENSP00000249837:F2768I	F	-	1	0	VPS13C	59995138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.896000	0.92521	2.088000	0.63022	0.528000	0.53228	TTT	.		0.338	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
SMAD6	4091	hgsc.bcm.edu	37	15	66995735	66995735	+	Missense_Mutation	SNP	C	C	T	rs368960350	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:66995735C>T	ENST00000288840.5	+	1	1170	c.139C>T	c.(139-141)Ccg>Tcg	p.P47S	SMAD6_ENST00000457357.2_Missense_Mutation_p.P47S	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	47					BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						TGAGCCGGCCCCGCGGGCAAG	0.781													C|||	28	0.00559105	0.0212	0.0	5008	,	,		7406	0.0		0.0	False		,,,				2504	0.0				p.P47S	Esophageal Squamous(179;72 2004 22333 39628 47290)	.											.	SMAD6-415	0			c.C139T						.	C	SER/PRO	19,2291		0,19,1136	1.0	2.0	2.0		139	1.6	1.0	15		2	0,5124		0,0,2562	no	missense	SMAD6	NM_005585.4	74	0,19,3698	TT,TC,CC		0.0,0.8225,0.2556	possibly-damaging	47/497	66995735	19,7415	1155	2562	3717	SO:0001583	missense	4091	exon1			CCGGCCCCGCGGG	BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.139C>T	15.37:g.66995735C>T	ENSP00000288840:p.Pro47Ser	4	0		43	26	NM_005585	0	0	1	1	0	A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	Missense_Mutation	SNP	ENST00000288840.5	37	CCDS10221.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578776	0.46006	0.008225	0.0	ENSG00000137834	ENST00000288840;ENST00000457357	T;T	0.73789	-0.78;-0.78	3.56	1.62	0.23740	.	0.217966	0.39475	N	0.001355	T	0.47948	0.1473	L	0.27053	0.805	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.43032	-0.9416	10	0.62326	D	0.03	.	4.743	0.13024	0.0:0.6512:0.2231:0.1257	.	47	O43541	SMAD6_HUMAN	S	47	ENSP00000288840:P47S;ENSP00000396961:P47S	ENSP00000288840:P47S	P	+	1	0	SMAD6	64782789	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	2.369000	0.44231	0.205000	0.20568	0.462000	0.41574	CCG	.		0.781	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256953.2	NM_005585	
ISLR	3671	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	74468065	74468065	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:74468065G>T	ENST00000249842.3	+	2	1223	c.866G>T	c.(865-867)gGg>gTg	p.G289V	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.G289V	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	289	Ig-like.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GGCACTGATGGGCGTGCCCTG	0.637																																					p.G289V													.	ISLR-155	0			c.G866T						.						78.0	79.0	78.0					15																	74468065		2198	4297	6495	SO:0001583	missense	3671	exon2			CTGATGGGCGTGC	AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.866G>T	15.37:g.74468065G>T	ENSP00000249842:p.Gly289Val	125	1		121	69	NM_201526	0	0	1	1	0		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142217	0.37825	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.64085	-0.08;-0.08	4.37	4.37	0.52481	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42548	U	0.000696	D	0.83672	0.5305	H	0.95328	3.655	0.48395	D	0.999649	D	0.64830	0.994	P	0.61477	0.889	D	0.89755	0.3943	10	0.87932	D	0	.	16.9283	0.86182	0.0:0.0:1.0:0.0	.	289	O14498	ISLR_HUMAN	V	289	ENSP00000249842:G289V;ENSP00000378550:G289V	ENSP00000249842:G289V	G	+	2	0	ISLR	72255118	0.995000	0.38212	0.217000	0.23759	0.095000	0.18619	2.221000	0.42917	1.987000	0.57996	0.313000	0.20887	GGG	.		0.637	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
ADAMTS7	11173	broad.mit.edu	37	15	79083052	79083052	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:79083052C>T	ENST00000388820.4	-	6	1198	c.988G>A	c.(988-990)Gcc>Acc	p.A330T	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	330	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						AGGGGATGGGCATCCCCCTTC	0.597																																					p.A330T													.	ADAMTS7-226	0			c.G988A						.						183.0	136.0	152.0					15																	79083052		2196	4293	6489	SO:0001583	missense	11173	exon6			GATGGGCATCCCC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.988G>A	15.37:g.79083052C>T	ENSP00000373472:p.Ala330Thr	84	0		78	4	NM_014272	0	0	2	2	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	0.048	-1.260469	0.01445	.	.	ENSG00000136378	ENST00000388820;ENST00000456326	D	0.86865	-2.18	4.86	-9.71	0.00518	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.854880	0.02471	N	0.087547	T	0.73916	0.3648	N	0.13371	0.34	0.09310	N	1	B;B;B	0.14012	0.009;0.001;0.005	B;B;B	0.24006	0.05;0.008;0.01	T	0.64300	-0.6440	10	0.14252	T	0.57	.	11.2082	0.48782	0.165:0.6694:0.0:0.1656	.	330;330;330	E7EP58;A8MQ00;Q9UKP4	.;.;ATS7_HUMAN	T	330	ENSP00000373472:A330T	ENSP00000373472:A330T	A	-	1	0	ADAMTS7	76870107	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.472000	0.02341	-3.126000	0.00237	-1.786000	0.00637	GCC	.		0.597	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
VASN	114990	broad.mit.edu	37	16	4432543	4432543	+	Silent	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:4432543A>C	ENST00000304735.3	+	2	1820	c.1665A>C	c.(1663-1665)acA>acC	p.T555T	CORO7_ENST00000423908.2_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000537233.2_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	555	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						AGGCCCATACACCCCCAGCCG	0.731																																					p.T555T													.	VASN-68	0			c.A1665C						.						11.0	17.0	15.0					16																	4432543		2155	4252	6407	SO:0001819	synonymous_variant	114990	exon2			CCATACACCCCCA	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1665A>C	16.37:g.4432543A>C		20	2		135	32	NM_138440	0	0	17	17	0	Q6UXL4|Q6UXL5|Q96CX1	Silent	SNP	ENST00000304735.3	37	CCDS10514.1																																																																																			.		0.731	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
GPR97	222487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57713092	57713092	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:57713092C>T	ENST00000333493.4	+	5	657	c.496C>T	c.(496-498)Ccc>Tcc	p.P166S	GPR97_ENST00000450388.3_Missense_Mutation_p.P46S|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000327655.6_5'UTR	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	166					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTCACAGGGCCCCCGGCTCGG	0.632																																					p.P166S		.											.	GPR97-91	0			c.C496T						.						60.0	61.0	61.0					16																	57713092		2198	4300	6498	SO:0001583	missense	222487	exon5			CAGGGCCCCCGGC	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.496C>T	16.37:g.57713092C>T	ENSP00000332900:p.Pro166Ser	68	0		90	25	NM_170776	0	0	0	0	0	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	37	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	C	6.016	0.371299	0.11409	.	.	ENSG00000182885	ENST00000333493;ENST00000450388	T;T	0.28454	1.61;1.7	4.3	-0.0636	0.13776	.	0.491076	0.17461	N	0.173450	T	0.19248	0.0462	L	0.38838	1.175	0.34925	D	0.748776	B	0.21071	0.051	B	0.18561	0.022	T	0.09015	-1.0694	10	0.52906	T	0.07	.	4.2438	0.10662	0.0:0.5249:0.1709:0.3042	.	166	Q86Y34	GPR97_HUMAN	S	166;46	ENSP00000332900:P166S;ENSP00000404803:P46S	ENSP00000332900:P166S	P	+	1	0	GPR97	56270593	0.001000	0.12720	0.670000	0.29842	0.078000	0.17371	-0.024000	0.12435	0.104000	0.17725	0.313000	0.20887	CCC	.		0.632	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72821093	72821093	+	Silent	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:72821093G>T	ENST00000268489.5	-	10	11754	c.11082C>A	c.(11080-11082)acC>acA	p.T3694T	AC004943.1_ENST00000584072.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA|ZFHX3_ENST00000397992.5_Silent_p.T2780T|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3694					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TTCCTACACTGGTCAGACCAC	0.463																																					p.T3694T		.											.	ZFHX3-72	0			c.C11082A						.						161.0	173.0	169.0					16																	72821093		2198	4300	6498	SO:0001819	synonymous_variant	463	exon10			TACACTGGTCAGA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.11082C>A	16.37:g.72821093G>T		112	0		127	37	NM_006885	0	0	2	4	2	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.463	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
CLEC18B	497190	broad.mit.edu;bcgsc.ca	37	16	74444869	74444869	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:74444869G>T	ENST00000339953.5	-	9	1169	c.1048C>A	c.(1048-1050)Ctg>Atg	p.L350M		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	350	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGGCGGCCCAGATAGAAGGCG	0.587																																					p.L350M													.	CLEC18B-90	0			c.C1048A						.						2.0	2.0	2.0					16																	74444869		706	1402	2108	SO:0001583	missense	497190	exon9			GGCCCAGATAGAA	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.1048C>A	16.37:g.74444869G>T	ENSP00000341051:p.Leu350Met	592	0		588	122	NM_001011880	0	0	0	0	0	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	N	15.98	2.992397	0.54041	.	.	ENSG00000140839	ENST00000429489;ENST00000339953	T	0.22336	1.96	3.14	1.05	0.20165	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000007	T	0.36524	0.0970	M	0.67569	2.06	0.32862	D	0.508097	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.44711	-0.9310	10	0.72032	D	0.01	.	5.3462	0.16010	0.2931:0.0:0.7069:0.0	.	350;350	C9JSV1;Q6UXF7	.;CL18B_HUMAN	M	350	ENSP00000341051:L350M	ENSP00000341051:L350M	L	-	1	2	CLEC18B	73002370	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.317000	0.51968	0.532000	0.28657	0.425000	0.28330	CTG	.		0.587	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
GALNS	2588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88889080	88889080	+	Silent	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:88889080G>A	ENST00000268695.5	-	12	1369	c.1281C>T	c.(1279-1281)gtC>gtT	p.V427V	GALNS_ENST00000542788.1_Silent_p.V352V	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	427					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		TGTGAGTTGTGACCCCTGAAA	0.622																																					p.V427V	GBM(129;1929 2344 25209 33204)	.											.	GALNS-153	0			c.C1281T						.						105.0	88.0	94.0					16																	88889080		2196	4299	6495	SO:0001819	synonymous_variant	2588	exon12			AGTTGTGACCCCT	D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.1281C>T	16.37:g.88889080G>A		205	0		251	75	NM_000512	0	0	20	31	11	Q86VK3	Silent	SNP	ENST00000268695.5	37	CCDS10970.1																																																																																			.		0.622	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	325	23		498	29	NM_145301	0	0	8	40	32	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18058522	18058522	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:18058522C>T	ENST00000205890.5	+	46	8661	c.8323C>T	c.(8323-8325)Cgc>Tgc	p.R2775C	MYO15A_ENST00000585180.1_Missense_Mutation_p.R39C|MYO15A_ENST00000418233.3_Missense_Mutation_p.R39C	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2775	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CTACTTCTCCCGCATCTTCCC	0.607																																					p.R2775C		.											.	MYO15A-97	0			c.C8323T						.						39.0	48.0	45.0					17																	18058522		2100	4218	6318	SO:0001583	missense	51168	exon45			TTCTCCCGCATCT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8323C>T	17.37:g.18058522C>T	ENSP00000205890:p.Arg2775Cys	65	0		108	12	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898121	0.52227	.	.	ENSG00000091536	ENST00000205890	D	0.93488	-3.23	5.1	5.1	0.69264	.	.	.	.	.	D	0.97164	0.9073	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	D	0.97931	1.0320	9	0.87932	D	0	.	18.5096	0.90911	0.0:1.0:0.0:0.0	.	39;2775	B4DFC7;Q9UKN7	.;MYO15_HUMAN	C	2775	ENSP00000205890:R2775C	ENSP00000205890:R2775C	R	+	1	0	MYO15A	17999247	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.086000	0.76885	2.363000	0.80096	0.561000	0.74099	CGC	.		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
AATF	26574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	35345926	35345926	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:35345926G>A	ENST00000225402.5	+	6	1307	c.1056G>A	c.(1054-1056)atG>atA	p.M352I		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	352	RB1 binding.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				CCAGCTTCATGGCAAAGCGCT	0.493																																					p.M352I	NSCLC(49;901 1159 19183 41572 46244)	.											.	AATF-90	0			c.G1056A						.						97.0	90.0	93.0					17																	35345926		2203	4300	6503	SO:0001583	missense	26574	exon6			CTTCATGGCAAAG	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.1056G>A	17.37:g.35345926G>A	ENSP00000225402:p.Met352Ile	82	0		157	84	NM_012138	0	0	22	69	47	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	ENST00000225402.5	37	CCDS32632.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740923	0.30865	.	.	ENSG00000108270	ENST00000225402	.	.	.	5.58	4.62	0.57501	.	0.033193	0.85682	D	0.000000	T	0.43722	0.1260	L	0.33339	1.005	0.52501	D	0.999955	B	0.12013	0.005	B	0.17098	0.017	T	0.26224	-1.0109	9	0.15066	T	0.55	-8.411	11.471	0.50268	0.1564:0.0:0.8436:0.0	.	352	Q9NY61	AATF_HUMAN	I	352	.	ENSP00000225402:M352I	M	+	3	0	AATF	32420039	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.264000	0.72527	1.370000	0.46153	0.561000	0.74099	ATG	.		0.493	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346591	39346591	+	Silent	SNP	C	C	T	rs76923645|rs148036927		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:39346591C>T	ENST00000398470.1	+	1	453	c.453C>T	c.(451-453)ccC>ccT	p.P151P	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Silent_p.P68P	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	151	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTTGCCAGCCCACCTGCTGTG	0.582																																					p.P151P		.											.	.	0			c.C453T						.																																			SO:0001819	synonymous_variant	728318	exon1			CCAGCCCACCTGC	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.453C>T	17.37:g.39346591C>T		108	0		178	55	NM_001190460	0	0	0	0	0		Silent	SNP	ENST00000398470.1	37	CCDS56029.1																																																																																			C|0.500;T|0.500		0.582	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
SCPEP1	59342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	55058480	55058480	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:55058480A>C	ENST00000262288.3	+	2	169	c.114A>C	c.(112-114)gaA>gaC	p.E38D	SCPEP1_ENST00000571898.1_3'UTR|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	38					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					AGGGCAAGGAAGTATGGGATT	0.493																																					p.E38D		.											.	SCPEP1-91	0			c.A114C						.						128.0	105.0	113.0					17																	55058480		2203	4300	6503	SO:0001583	missense	59342	exon2			CAAGGAAGTATGG	AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.114A>C	17.37:g.55058480A>C	ENSP00000262288:p.Glu38Asp	235	1		338	161	NM_021626	0	0	4	9	5	Q96A94|Q9H3F0	Missense_Mutation	SNP	ENST00000262288.3	37	CCDS11593.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093414	0.56075	.	.	ENSG00000121064	ENST00000262288	D	0.85955	-2.05	5.84	3.64	0.41730	.	0.000000	0.85682	D	0.000000	D	0.91331	0.7266	M	0.89414	3.03	0.46954	D	0.99926	D	0.65815	0.995	D	0.70716	0.97	D	0.90110	0.4191	10	0.66056	D	0.02	-12.7064	5.5755	0.17220	0.71:0.0:0.29:0.0	.	38	Q9HB40	RISC_HUMAN	D	38	ENSP00000262288:E38D	ENSP00000262288:E38D	E	+	3	2	SCPEP1	52413479	0.816000	0.29132	0.975000	0.42487	0.312000	0.27988	0.445000	0.21677	1.036000	0.39998	0.533000	0.62120	GAA	.		0.493	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440622.1	NM_021626	
NACA2	342538	ucsc.edu	37	17	59668318	59668318	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:59668318C>T	ENST00000521764.1	-	1	245	c.224G>A	c.(223-225)aGg>aAg	p.R75K		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	75	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					CTTCCGTGCCCTCTTTTCACT	0.458																																					p.R75K													.	NACA2-91	0			c.G224A						.						246.0	229.0	234.0					17																	59668318		2203	4300	6503	SO:0001583	missense	342538	exon1			CGTGCCCTCTTTT	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.224G>A	17.37:g.59668318C>T	ENSP00000427802:p.Arg75Lys	137	1		277	4	NM_199290	0	0	0	1895	1895	Q2VIR9	Missense_Mutation	SNP	ENST00000521764.1	37	CCDS11630.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976583	0.34848	.	.	ENSG00000253506	ENST00000521764	T	0.17528	2.27	0.753	-0.748	0.11087	Nascent polypeptide-associated complex NAC (2);	0.072360	0.50627	N	0.000118	T	0.01489	0.0048	N	0.00010	-3.04	0.23577	N	0.997375	B	0.02656	0.0	B	0.01281	0.0	T	0.46076	-0.9217	9	.	.	.	.	4.0866	0.09950	0.0:0.257:0.0:0.743	.	75	Q9H009	NACA2_HUMAN	K	75	ENSP00000427802:R75K	.	R	-	2	0	NACA2	57023100	1.000000	0.71417	0.973000	0.42090	0.773000	0.43773	3.300000	0.51834	-0.188000	0.10499	-0.624000	0.04008	AGG	.		0.458	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
SPHK1	8877	hgsc.bcm.edu	37	17	74381682	74381682	+	5'UTR	SNP	C	C	T	rs56342542	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:74381682C>T	ENST00000545180.1	+	0	766				SPHK1_ENST00000590959.1_5'UTR|SPHK1_ENST00000323374.4_Missense_Mutation_p.T72I|SPHK1_ENST00000592299.1_5'UTR|SPHK1_ENST00000392496.3_5'UTR			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1						'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	AGCGCCCCCACAGCGCCAGGG	0.716													C|||	43	0.00858626	0.0	0.0173	5008	,	,		12154	0.0		0.0278	False		,,,				2504	0.0031				p.T72I	GBM(90;966 1307 27369 33775 44498)	.											.	SPHK1-1107	0			c.C215T						.	C	,,,ILE/THR	16,3798		0,16,1891	6.0	10.0	9.0		,,,215	3.8	0.0	17	dbSNP_129	9	114,7334		0,114,3610	no	utr-5,utr-5,utr-5,missense	SPHK1	NM_001142601.1,NM_001142602.1,NM_021972.3,NM_182965.2	,,,89	0,130,5501	TT,TC,CC		1.5306,0.4195,1.1543	,,,possibly-damaging	,,,72/471	74381682	130,11132	1907	3724	5631	SO:0001623	5_prime_UTR_variant	8877	exon2			CCCCCACAGCGCC	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.-44C>T	17.37:g.74381682C>T		3	0		43	15	NM_182965	0	0	1	3	2	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	37	CCDS45785.1	26	0.011904761904761904	2	0.0040650406504065045	6	0.016574585635359115	0	0.0	18	0.023746701846965697	C	12.88	2.071524	0.36566	0.004195	0.015306	ENSG00000176170	ENST00000323374	T	0.23950	1.88	5.03	3.83	0.44106	.	1.434080	0.04181	N	0.326590	T	0.10766	0.0263	.	.	.	0.22489	N	0.999055	B	0.29646	0.253	B	0.27500	0.08	T	0.08066	-1.0740	9	0.35671	T	0.21	-13.0527	11.1919	0.48690	0.0:0.8948:0.0:0.1052	rs56342542;rs61751847	72	Q9NYA1-2	.	I	72	ENSP00000313681:T72I	ENSP00000313681:T72I	T	+	2	0	SPHK1	71893277	0.000000	0.05858	0.031000	0.17742	0.031000	0.12232	0.145000	0.16157	2.337000	0.79520	0.462000	0.41574	ACA	C|0.988;T|0.012		0.716	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
P4HB	5034	broad.mit.edu	37	17	79813349	79813349	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:79813349C>A	ENST00000331483.4	-	3	688	c.466G>T	c.(466-468)Gct>Tct	p.A156S	P4HB_ENST00000472244.1_5'UTR|P4HB_ENST00000439918.2_Intron|P4HB_ENST00000576390.1_Intron	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	156					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			CCGATGACAGCCACCTCGCTG	0.602																																					p.A156S	Colon(49;444 983 1296 7887 42561)												.	P4HB-46	0			c.G466T						.						58.0	63.0	61.0					17																	79813349		2203	4300	6503	SO:0001583	missense	5034	exon3			TGACAGCCACCTC	J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.466G>T	17.37:g.79813349C>A	ENSP00000327801:p.Ala156Ser	70	0		104	5	NM_000918	1	0	598	600	1	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	ENST00000331483.4	37	CCDS11787.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206607	0.58343	.	.	ENSG00000185624	ENST00000331483;ENST00000436463	T	0.22336	1.96	4.75	0.549	0.17213	Thioredoxin-like fold (2);	0.324426	0.35677	N	0.003055	T	0.16642	0.0400	L	0.35414	1.06	0.80722	D	1	B	0.18610	0.029	B	0.30316	0.114	T	0.07309	-1.0779	10	0.59425	D	0.04	.	9.5234	0.39149	0.0:0.7428:0.0:0.2572	.	156	P07237	PDIA1_HUMAN	S	156;140	ENSP00000327801:A156S	ENSP00000327801:A156S	A	-	1	0	P4HB	77406638	0.996000	0.38824	0.235000	0.24058	0.848000	0.48234	2.629000	0.46485	-0.171000	0.10797	0.462000	0.41574	GCT	.		0.602	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918	
GREB1L	80000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	19020247	19020247	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr18:19020247G>C	ENST00000580732.2	+	9	1348	c.967G>C	c.(967-969)Ggg>Cgg	p.G323R	GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000424526.1_Missense_Mutation_p.G323R|GREB1L_ENST00000431264.1_Missense_Mutation_p.G323R|GREB1L_ENST00000269218.6_Missense_Mutation_p.G323R|GREB1L_ENST00000400483.4_Missense_Mutation_p.G323R			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	323						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GTTCATTTCTGGGCCACCAAA	0.458																																					p.G323R		.											.	.	0			c.G967C						.						75.0	71.0	72.0					18																	19020247		692	1591	2283	SO:0001583	missense	80000	exon9			ATTTCTGGGCCAC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.967G>C	18.37:g.19020247G>C	ENSP00000464162:p.Gly323Arg	66	0		67	26	NM_001142966	0	0	0	0	0	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809799	0.70797	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.22945	2.72;2.59;1.94;1.93	5.48	5.48	0.80851	.	.	.	.	.	T	0.53981	0.1830	M	0.74881	2.28	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.53408	-0.8443	9	0.51188	T	0.08	-2.0122	19.3376	0.94324	0.0:0.0:1.0:0.0	.	323;323	Q9C091;Q9C091-2	GRB1L_HUMAN;.	R	323	ENSP00000412060:G323R;ENSP00000269218:G323R;ENSP00000383331:G323R;ENSP00000393125:G323R	ENSP00000269218:G323R	G	+	1	0	GREB1L	17274245	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.189000	0.89712	2.580000	0.87095	0.650000	0.86243	GGG	.		0.458	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
DCC	1630	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	50985743	50985743	+	Silent	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr18:50985743T>A	ENST00000442544.2	+	24	4150	c.3534T>A	c.(3532-3534)tcT>tcA	p.S1178S	DCC_ENST00000581580.1_Silent_p.S813S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1178					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GAAGGGACTCTCCCATCCAAA	0.478																																					p.S1178S													.	DCC-225	0			c.T3534A						.						140.0	138.0	139.0					18																	50985743		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon24			GGACTCTCCCATC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3534T>A	18.37:g.50985743T>A		55	1		45	24	NM_005215	0	0	0	0	0		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																			.		0.478	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
SERPINB8	5271	broad.mit.edu	37	18	61654493	61654493	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr18:61654493G>T	ENST00000397985.2	+	7	1362	c.1106G>T	c.(1105-1107)gGc>gTc	p.G369V	SERPINB8_ENST00000542677.1_Missense_Mutation_p.G187V|SERPINB8_ENST00000353706.2_Missense_Mutation_p.G369V|SERPINB8_ENST00000493661.1_Intron	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	369					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				TTGTTCTGTGGCAGGTTCTCT	0.468																																					p.G369V													.	SERPINB8-226	0			c.G1106T						.						96.0	97.0	97.0					18																	61654493		2203	4300	6503	SO:0001583	missense	5271	exon7			TCTGTGGCAGGTT	L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.1106G>T	18.37:g.61654493G>T	ENSP00000381072:p.Gly369Val	78	2		71	7	NM_198833	0	0	2	2	0	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	ENST00000397985.2	37	CCDS11991.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496901	0.64186	.	.	ENSG00000166401	ENST00000397985;ENST00000353706;ENST00000542677	D;D;T	0.98044	-4.68;-4.68;-0.1	5.38	5.38	0.77491	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.99296	0.9754	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98676	1.0690	10	0.87932	D	0	.	18.3101	0.90195	0.0:0.0:1.0:0.0	.	369	P50452	SPB8_HUMAN	V	369;369;187	ENSP00000381072:G369V;ENSP00000331368:G369V;ENSP00000438328:G187V	ENSP00000331368:G369V	G	+	2	0	SERPINB8	59805473	1.000000	0.71417	0.997000	0.53966	0.099000	0.18886	9.555000	0.98123	2.793000	0.96121	0.655000	0.94253	GGC	.		0.468	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1	NM_001031848	
DOHH	83475	broad.mit.edu	37	19	3496745	3496745	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:3496745G>T	ENST00000427575.1	-	2	519	c.68C>A	c.(67-69)gCc>gAc	p.A23D	DOHH_ENST00000250937.3_Missense_Mutation_p.A23D	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGAAGCGGGCCTGCAGGGG	0.672																																					p.A23D													.	DOHH-90	0			c.C68A						.						30.0	34.0	33.0					19																	3496745		2203	4299	6502	SO:0001583	missense	83475	exon2			AAGCGGGCCTGCA	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.68C>A	19.37:g.3496745G>T	ENSP00000398882:p.Ala23Asp	23	0		82	6	NM_001145165	0	0	20	20	0		Missense_Mutation	SNP	ENST00000427575.1	37	CCDS12108.1	.	.	.	.	.	.	.	.	.	.	G	6.366	0.435651	0.12104	.	.	ENSG00000129932	ENST00000427575;ENST00000250937	.	.	.	4.28	4.28	0.50868	Armadillo-like helical (1);	0.572614	0.17864	N	0.159432	T	0.30324	0.0761	L	0.45352	1.415	0.26414	N	0.97622	B	0.06786	0.001	B	0.08055	0.003	T	0.16364	-1.0405	9	0.12766	T	0.61	-7.5811	8.1479	0.31124	0.1119:0.0:0.8881:0.0	.	23	Q9BU89	DOHH_HUMAN	D	23	.	ENSP00000250937:A23D	A	-	2	0	DOHH	3447745	0.999000	0.42202	1.000000	0.80357	0.689000	0.40095	4.666000	0.61554	1.947000	0.56498	0.561000	0.74099	GCC	.		0.672	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452932.1	NM_031304	
ZNF443	10224	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12541862	12541862	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:12541862T>C	ENST00000301547.5	-	4	1321	c.1124A>G	c.(1123-1125)gAt>gGt	p.D375G	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	375					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						ACTAGGACAATCAAAGCCTTT	0.423																																					p.D375G													.	ZNF443-91	0			c.A1124G						.						191.0	179.0	183.0					19																	12541862		2203	4298	6501	SO:0001583	missense	10224	exon4			GGACAATCAAAGC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1124A>G	19.37:g.12541862T>C	ENSP00000301547:p.Asp375Gly	132	1		127	39	NM_005815	0	0	3	5	2		Missense_Mutation	SNP	ENST00000301547.5	37	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	T	9.235	1.036915	0.19669	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.07800	3.16	1.37	-2.7	0.06004	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06826	0.0174	N	0.04043	-0.29	0.09310	N	1	D	0.56035	0.974	P	0.62885	0.908	T	0.26573	-1.0099	9	0.30854	T	0.27	.	3.7751	0.08657	0.0:0.3:0.4706:0.2293	.	375	Q9Y2A4	ZN443_HUMAN	G	375	ENSP00000301547:D375G	ENSP00000301547:D375G	D	-	2	0	ZNF443	12402862	0.000000	0.05858	0.002000	0.10522	0.169000	0.22640	-4.305000	0.00256	-0.500000	0.06614	0.378000	0.23410	GAT	.		0.423	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
ZSWIM4	65249	broad.mit.edu	37	19	13928686	13928686	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:13928686A>T	ENST00000254323.2	+	8	1658	c.1469A>T	c.(1468-1470)aAg>aTg	p.K490M	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.K324M|RN7SL619P_ENST00000581753.1_RNA	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	490							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GCCCAGGACAAGGTGGTGCGC	0.701																																					p.K490M													.	ZSWIM4-90	0			c.A1469T						.						48.0	25.0	33.0					19																	13928686		2137	4198	6335	SO:0001583	missense	65249	exon8			AGGACAAGGTGGT	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1469A>T	19.37:g.13928686A>T	ENSP00000254323:p.Lys490Met	84	0		130	5	NM_023072	0	0	21	21	0		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.789084	0.90367	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.54279	0.59;0.58	4.51	4.51	0.55191	.	0.192153	0.33772	N	0.004568	T	0.68632	0.3022	M	0.67397	2.05	0.43824	D	0.996399	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	T	0.71889	-0.4456	10	0.72032	D	0.01	-31.4044	11.7679	0.51941	1.0:0.0:0.0:0.0	.	324;490	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	M	490;324	ENSP00000254323:K490M;ENSP00000405278:K324M	ENSP00000254323:K490M	K	+	2	0	ZSWIM4	13789686	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.944000	0.75940	1.669000	0.50854	0.379000	0.24179	AAG	.		0.701	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
PODNL1	79883	hgsc.bcm.edu	37	19	14044012	14044012	+	Silent	SNP	G	G	A	rs79400921	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:14044012G>A	ENST00000339560.5	-	8	1318	c.1045C>T	c.(1045-1047)Ctg>Ttg	p.L349L	PODNL1_ENST00000254320.3_Silent_p.L267L|PODNL1_ENST00000538517.2_Silent_p.L258L|PODNL1_ENST00000538371.2_Silent_p.L347L	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	349	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			ACGCGGTCCAGCCCATTGCCA	0.726													G|||	17	0.00339457	0.0129	0.0	5008	,	,		12628	0.0		0.0	False		,,,				2504	0.0				p.L349L		.											.	PODNL1-90	0			c.C1045T						.	G	,,	25,3857		0,25,1916	4.0	6.0	6.0		1039,772,1045	2.1	0.7	19	dbSNP_131	6	1,7563		0,1,3781	no	coding-synonymous,coding-synonymous,coding-synonymous	PODNL1	NM_001146254.1,NM_001146255.1,NM_024825.3	,,	0,26,5697	AA,AG,GG		0.0132,0.644,0.2272	,,	347/511,258/422,349/513	14044012	26,11420	1941	3782	5723	SO:0001819	synonymous_variant	79883	exon8			GGTCCAGCCCATT	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.1045C>T	19.37:g.14044012G>A		0	0		24	9	NM_024825	0	0	0	0	0	B7Z564|Q9H5G9	Silent	SNP	ENST00000339560.5	37	CCDS12300.1																																																																																			.		0.726	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
CYP4F3	4051	ucsc.edu;bcgsc.ca	37	19	15760902	15760902	+	Missense_Mutation	SNP	G	G	A	rs113330239		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:15760902G>A	ENST00000221307.8	+	7	874	c.827G>A	c.(826-828)cGc>cAc	p.R276H	CYP4F3_ENST00000586182.2_Missense_Mutation_p.R276H|CYP4F3_ENST00000585846.1_Missense_Mutation_p.R276H|CYP4F3_ENST00000591058.1_Missense_Mutation_p.R276H	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	276					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.R276H(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GAGCGGCGCCGCACCCTCCCT	0.577													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18604	0.0		0.0	False		,,,				2504	0.0				p.R276H													.	CYP4F3-93	1	Substitution - Missense(1)	large_intestine(1)	c.G827A						.						106.0	96.0	99.0					19																	15760902		2203	4300	6503	SO:0001583	missense	4051	exon7			GGCGCCGCACCCT	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.827G>A	19.37:g.15760902G>A	ENSP00000221307:p.Arg276His	254	2		202	91	NM_001199209	0	0	0	0	0	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	37	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	14.12	2.441442	0.43326	.	.	ENSG00000186529	ENST00000538865;ENST00000221307	T	0.69561	-0.41	3.99	-0.166	0.13351	.	0.712480	0.12645	U	0.450940	T	0.63117	0.2484	M	0.77406	2.37	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.19148	0.015;0.024	T	0.58188	-0.7680	10	0.52906	T	0.07	.	7.3165	0.26503	0.4513:0.0:0.5487:0.0	.	276;276	B7Z8Z3;Q08477	.;CP4F3_HUMAN	H	203;276	ENSP00000221307:R276H	ENSP00000221307:R276H	R	+	2	0	CYP4F3	15621902	0.000000	0.05858	0.009000	0.14445	0.817000	0.46193	-1.012000	0.03649	0.173000	0.19788	0.313000	0.20887	CGC	G|0.500;A|0.500		0.577	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
CPAMD8	27151	broad.mit.edu	37	19	17086849	17086849	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:17086849T>C	ENST00000443236.1	-	16	2043	c.2012A>G	c.(2011-2013)tAc>tGc	p.Y671C	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	624	Poly-Arg.	Cleavage; by furin-like protease. {ECO:0000305}.				extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCTGAGCAGGTAGACACTCTT	0.597																																					p.Y671C													.	CPAMD8-141	0			c.A2012G						.						40.0	47.0	45.0					19																	17086849		2155	4268	6423	SO:0001583	missense	27151	exon16			AGCAGGTAGACAC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2012A>G	19.37:g.17086849T>C	ENSP00000402505:p.Tyr671Cys	174	2		154	3	NM_015692	0	0	0	0	0	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.08|16.08	3.020616|3.020616	0.54576|0.54576	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	2.74|2.74	2.74|2.74	0.32292|0.32292	.|Alpha-2-macroglobulin, N-terminal 2 (1);	.|0.000000	.|0.64402	.|D	.|0.000011	T|T	0.77505|0.77505	0.4140|0.4140	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79108	.|0.992	T|T	0.78645|0.78645	-0.2123|-0.2123	5|9	.|0.51188	.|T	.|0.08	.|.	11.0186|11.0186	0.47705|0.47705	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|624	.|Q8IZJ3	.|CPMD8_HUMAN	A|C	682|671	.|.	.|ENSP00000291440:Y671C	T|Y	-|-	1|2	0|0	CPAMD8|CPAMD8	16947849|16947849	1.000000|1.000000	0.71417|0.71417	0.834000|0.834000	0.33040|0.33040	0.815000|0.815000	0.46073|0.46073	3.865000|3.865000	0.56033|0.56033	1.047000|1.047000	0.40274|0.40274	0.454000|0.454000	0.30748|0.30748	ACC|TAC	.		0.597	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
LRRC25	126364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18507658	18507658	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:18507658C>G	ENST00000339007.3	-	1	769	c.116G>C	c.(115-117)aGt>aCt	p.S39T	LRRC25_ENST00000595840.1_Missense_Mutation_p.S39T	NM_145256.2	NP_660299.2	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25	39						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|skin(1)	8						GCACGTGGCACTGAACTCCGC	0.622																																					p.S39T		.											.	LRRC25-90	0			c.G116C						.						76.0	57.0	64.0					19																	18507658		2203	4300	6503	SO:0001583	missense	126364	exon1			GTGGCACTGAACT	AK095435	CCDS12377.1	19p13.11	2013-09-20			ENSG00000175489	ENSG00000175489			29806	protein-coding gene	gene with protein product		607518				12384430	Standard	NM_145256		Approved	MAPA, FLJ38116	uc002niw.3	Q8N386	OTTHUMG00000183361	ENST00000339007.3:c.116G>C	19.37:g.18507658C>G	ENSP00000340983:p.Ser39Thr	256	1		195	85	NM_145256	0	0	4	4	0	Q6IQ00|Q8N9A5	Missense_Mutation	SNP	ENST00000339007.3	37	CCDS12377.1	.	.	.	.	.	.	.	.	.	.	C	0.518	-0.863567	0.02590	.	.	ENSG00000175489	ENST00000339007	T	0.31510	1.49	4.4	-4.55	0.03441	.	2.202890	0.02302	N	0.071289	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20739	-1.0266	10	0.02654	T	1	2.5899	1.3392	0.02151	0.2155:0.2315:0.3888:0.1642	.	39	Q8N386	LRC25_HUMAN	T	39	ENSP00000340983:S39T	ENSP00000340983:S39T	S	-	2	0	LRRC25	18368658	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.684000	0.05173	-0.454000	0.07066	-0.367000	0.07326	AGT	.		0.622	LRRC25-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466342.1	NM_145256	
ZNF14	7561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19822257	19822257	+	Silent	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:19822257T>G	ENST00000344099.3	-	4	1971	c.1833A>C	c.(1831-1833)ggA>ggC	p.G611G		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	611					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAGGTTTCTCTCCAGTGTGAG	0.408																																					p.G611G		.											.	ZNF14-517	0			c.A1833C						.						83.0	81.0	82.0					19																	19822257		2203	4300	6503	SO:0001819	synonymous_variant	7561	exon4			TTTCTCTCCAGTG	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1833A>C	19.37:g.19822257T>G		64	0		84	38	NM_021030	0	0	7	13	6	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	37	CCDS12409.1																																																																																			.		0.408	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
ZNF180	7733	bcgsc.ca	37	19	44981544	44981544	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:44981544T>C	ENST00000221327.4	-	5	1435	c.1154A>G	c.(1153-1155)gAa>gGa	p.E385G	ZNF180_ENST00000592529.1_Missense_Mutation_p.E358G|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000391956.4_Missense_Mutation_p.E360G	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TTTTCCACATTCACTACATTC	0.448																																					p.E385G	Esophageal Squamous(180;1353 2003 32862 46574 49854)												.	ZNF180-92	0			c.A1154G						.						71.0	72.0	71.0					19																	44981544		2203	4299	6502	SO:0001583	missense	7733	exon5			CCACATTCACTAC	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1154A>G	19.37:g.44981544T>C	ENSP00000221327:p.Glu385Gly	62	0		51	4	NM_013256	0	0	6	6	0	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	T	3.784	-0.045104	0.07452	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07444	3.19;3.19	5.28	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.363008	0.19929	N	0.102906	T	0.09774	0.0240	L	0.46819	1.47	0.09310	N	0.999997	P;P;P	0.43412	0.768;0.806;0.806	B;B;B	0.41440	0.243;0.357;0.357	T	0.12016	-1.0564	10	0.87932	D	0	-5.0445	9.1013	0.36669	0.3914:0.0:0.0:0.6086	.	360;384;385	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	G	385;360	ENSP00000221327:E385G;ENSP00000375818:E360G	ENSP00000221327:E385G	E	-	2	0	ZNF180	49673384	0.000000	0.05858	0.231000	0.23993	0.114000	0.19823	0.269000	0.18589	0.526000	0.28541	0.533000	0.62120	GAA	.		0.448	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
ZNF835	90485	hgsc.bcm.edu	37	19	57175950	57175950	+	Missense_Mutation	SNP	A	A	G	rs369897881		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:57175950A>G	ENST00000537055.2	-	2	848	c.617T>C	c.(616-618)gTc>gCc	p.V206A		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CAGGTGCGTGACGCGCGTGAA	0.716																																					p.V206A		.											.	ZNF835-72	0			c.T617C						.	A	ALA/VAL	3,4319		0,3,2158	15.0	16.0	16.0		617	-3.4	0.0	19		16	0,8402		0,0,4201	no	missense	ZNF835	NM_001005850.2	64	0,3,6359	GG,GA,AA		0.0,0.0694,0.0236	benign	206/538	57175950	3,12721	2161	4201	6362	SO:0001583	missense	90485	exon2			TGCGTGACGCGCG	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.617T>C	19.37:g.57175950A>G	ENSP00000444747:p.Val206Ala	0	0		46	19	NM_001005850	0	0	0	0	0	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	7.598	0.672178	0.14776	6.94E-4	0.0	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.07114	3.22	2.12	-3.43	0.04810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02807	0.0084	N	0.04245	-0.25	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.45920	-0.9228	9	0.16896	T	0.51	.	4.1371	0.10176	0.246:0.0:0.5433:0.2107	.	228	Q9Y2P0	ZN835_HUMAN	A	228;206	ENSP00000444747:V206A	ENSP00000341756:V228A	V	-	2	0	ZNF835	61867762	0.000000	0.05858	0.000000	0.03702	0.296000	0.27459	-1.731000	0.01853	-0.977000	0.03537	-0.411000	0.06167	GTC	.		0.716	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
DHX57	90957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	39088916	39088916	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:39088916T>C	ENST00000295373.6	-	5	762	c.636A>G	c.(634-636)gcA>gcG	p.A212A	AC018693.6_ENST00000442829.1_RNA|DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	212	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GCTCTAGTGATGCTCCCACAT	0.448																																					p.A212A	Melanoma(191;1090 2095 4375 23729 47341)	.											.	DHX57-228	0			c.A636G						.						84.0	79.0	81.0					2																	39088916		2203	4300	6503	SO:0001819	synonymous_variant	90957	exon5			TAGTGATGCTCCC	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.636A>G	2.37:g.39088916T>C		107	0		120	66	NM_198963	0	0	4	10	6	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	37	CCDS1800.1																																																																																			.		0.448	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
PDE11A	50940	broad.mit.edu	37	2	178936708	178936708	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:178936708G>A	ENST00000286063.6	-	1	774	c.457C>T	c.(457-459)Cga>Tga	p.R153*	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	153					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.R153*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	GCCCTCCGTCGTACACTACTC	0.587									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.R153X													.	PDE11A-93	1	Substitution - Nonsense(1)	large_intestine(1)	c.C457T						.						78.0	75.0	76.0					2																	178936708		2203	4300	6503	SO:0001587	stop_gained	50940	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TCCGTCGTACACT	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.457C>T	2.37:g.178936708G>A	ENSP00000286063:p.Arg153*	145	1		120	4	NM_016953	0	0	0	0	0	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Nonsense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	G	40	8.081797	0.98643	.	.	ENSG00000128655	ENST00000286063	.	.	.	5.04	4.06	0.47325	.	0.504890	0.20822	N	0.085054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6094	0.62068	0.0:0.0:0.7542:0.2457	.	.	.	.	X	153	.	ENSP00000286063:R153X	R	-	1	2	PDE11A	178644954	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.726000	0.38085	2.341000	0.79615	0.655000	0.94253	CGA	.		0.587	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
STK11IP	114790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220473931	220473931	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:220473931T>C	ENST00000456909.1	+	16	2012	c.1922T>C	c.(1921-1923)gTc>gCc	p.V641A	STK11IP_ENST00000295641.10_Missense_Mutation_p.V652A			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	652					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACGCAGCTGTCCAGGTGATG	0.662																																					p.V652A		.											.	STK11IP-91	0			c.T1955C						.						23.0	22.0	23.0					2																	220473931		2018	4164	6182	SO:0001583	missense	114790	exon16			CAGCTGTCCAGGT	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1922T>C	2.37:g.220473931T>C	ENSP00000389383:p.Val641Ala	82	0		89	35	NM_052902	0	0	0	0	0	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		.	.	.	.	.	.	.	.	.	.	T	12.88	2.071525	0.36566	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05025	3.51;3.51	5.0	-0.564	0.11774	.	1.280970	0.05320	N	0.526447	T	0.07683	0.0193	L	0.43152	1.355	0.20821	N	0.999844	B;B;B	0.14012	0.009;0.004;0.002	B;B;B	0.15484	0.013;0.003;0.006	T	0.43956	-0.9359	10	0.72032	D	0.01	-0.0971	8.4014	0.32588	0.0:0.3626:0.0:0.6374	.	620;652;652	B4DUE4;Q8N1F8-2;Q8N1F8	.;.;S11IP_HUMAN	A	641;620;652	ENSP00000389383:V641A;ENSP00000295641:V652A	ENSP00000295641:V652A	V	+	2	0	STK11IP	220182175	0.431000	0.25546	0.117000	0.21633	0.652000	0.38707	0.654000	0.24918	-0.222000	0.09958	-0.250000	0.11733	GTC	.		0.662	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
INPP5D	3635	broad.mit.edu	37	2	234102516	234102516	+	Silent	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:234102516G>T	ENST00000359570.5	+	25	2469	c.2469G>T	c.(2467-2469)acG>acT	p.T823T	INPP5D_ENST00000455936.2_Silent_p.T587T|INPP5D_ENST00000450745.1_Silent_p.T587T			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	835					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		CCATCTACACGCCTCTCACCC	0.597																																					.	NSCLC(82;1215 1426 16163 20348 41018)												.	INPP5D-652	0			.						.						80.0	83.0	82.0					2																	234102516		2057	4190	6247	SO:0001819	synonymous_variant	3635	.			CTACACGCCTCTC	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.2469G>T	2.37:g.234102516G>T		91	0		81	5	.	0	0	5	5	0	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	ENST00000359570.5	37																																																																																				.		0.597	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	827	14		961	30	.	0	0	155	155	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B-22	0			c.529-2A>G						.																																			SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G		939	16		1107	42	NR_003579	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
FRG1B	284802	bcgsc.ca	37	20	29628283	29628283	+	Silent	SNP	G	G	C	rs200164543		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:29628283G>C	ENST00000278882.3	+	6	665	c.285G>C	c.(283-285)ggG>ggC	p.G95G	FRG1B_ENST00000439954.2_Silent_p.G100G|FRG1B_ENST00000358464.4_Silent_p.G95G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95								p.G95G(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGAAGCAGGGGACATAGAAG	0.378																																					.													.	FRG1B-22	4	Substitution - coding silent(4)	urinary_tract(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			AGCAGGGGACATA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.285G>C	20.37:g.29628283G>C		808	11		928	34	.	0	0	186	186	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.378	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29632680	29632680	+	Silent	SNP	G	G	A	rs4892355		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:29632680G>A	ENST00000278882.3	+	8	875	c.495G>A	c.(493-495)aaG>aaA	p.K165K	FRG1B_ENST00000358464.4_Silent_p.K165K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	165										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTCTTAAAAAGGCTCAGAAAG	0.313																																					.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TAAAAAGGCTCAG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.495G>A	20.37:g.29632680G>A		592	28		758	72	.	0	0	116	116	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
BPIFB4	149954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31685559	31685559	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:31685559A>T	ENST00000375483.3	+	11	1535	c.1535A>T	c.(1534-1536)aAa>aTa	p.K512I		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	512						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCCCAGCCCAAAGACCTGGAG	0.577																																					p.K512I		.											.	.	0			c.A1535T						.						100.0	72.0	81.0					20																	31685559		2203	4300	6503	SO:0001583	missense	149954	exon11			AGCCCAAAGACCT	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1535A>T	20.37:g.31685559A>T	ENSP00000364632:p.Lys512Ile	137	0		169	79	NM_182519	0	0	0	0	0	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582504	0.46006	.	.	ENSG00000186191	ENST00000375483	T	0.07327	3.2	5.26	5.26	0.73747	.	0.240028	0.35067	N	0.003468	T	0.07279	0.0184	N	0.24115	0.695	0.24134	N	0.995755	B	0.30937	0.301	B	0.31812	0.136	T	0.27773	-1.0064	10	0.62326	D	0.03	-11.2987	11.8323	0.52303	1.0:0.0:0.0:0.0	.	512	P59827	BPIB4_HUMAN	I	512	ENSP00000364632:K512I	ENSP00000364632:K512I	K	+	2	0	BPIFB4	31149220	0.981000	0.34729	0.940000	0.37924	0.577000	0.36160	2.261000	0.43276	2.108000	0.64289	0.379000	0.24179	AAA	.		0.577	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
XIRP1	165904	broad.mit.edu	37	3	39229085	39229085	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:39229085T>A	ENST00000340369.3	-	2	2080	c.1852A>T	c.(1852-1854)Aca>Tca	p.T618S	XIRP1_ENST00000396251.1_Missense_Mutation_p.T618S|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	618	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GCCTTGGCTGTGGGATCTGTG	0.607																																					p.T618S													.	XIRP1-158	0			c.A1852T						.						81.0	71.0	74.0					3																	39229085		2203	4300	6503	SO:0001583	missense	165904	exon2			TGGCTGTGGGATC	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1852A>T	3.37:g.39229085T>A	ENSP00000343140:p.Thr618Ser	53	0		53	3	NM_001198621	0	0	0	0	0	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	T	3.269	-0.149600	0.06585	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05025	3.51;3.9	4.59	0.404	0.16355	.	1.428260	0.04215	U	0.332466	T	0.06280	0.0162	L	0.46157	1.445	0.09310	N	1	B;B	0.22909	0.028;0.077	B;B	0.17979	0.02;0.019	T	0.42155	-0.9468	10	0.36615	T	0.2	.	0.7335	0.00961	0.3376:0.1046:0.1732:0.3846	.	618;618	Q702N8;Q702N8-2	XIRP1_HUMAN;.	S	618	ENSP00000379550:T618S;ENSP00000343140:T618S	ENSP00000343140:T618S	T	-	1	0	XIRP1	39204089	0.000000	0.05858	0.002000	0.10522	0.935000	0.57460	-0.544000	0.06077	0.217000	0.20800	0.379000	0.24179	ACA	.		0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
ATXN7	6314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	63983337	63983337	+	Intron	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:63983337C>T	ENST00000295900.6	+	12	3211				ATXN7_ENST00000398590.3_Missense_Mutation_p.T901I|ATXN7_ENST00000484332.1_Intron|ATXN7_ENST00000487717.1_Intron|ATXN7_ENST00000538065.1_Missense_Mutation_p.T901I	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7						cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ATTTCAGCAACATCACCCCAG	0.428																																					p.T901I		.											.	ATXN7-90	0			c.C2702T						.						296.0	237.0	255.0					3																	63983337		692	1591	2283	SO:0001627	intron_variant	6314	exon12			CAGCAACATCACC	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.2661+1178C>T	3.37:g.63983337C>T		64	0		66	27	NM_001177387	0	0	1	3	2	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	37	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045840	0.36085	.	.	ENSG00000163635	ENST00000398590;ENST00000538065;ENST00000522345	T;T;T	0.51071	2.49;2.49;0.72	4.03	3.14	0.36123	.	0.628911	0.14004	N	0.347922	T	0.26159	0.0638	N	0.08118	0	0.22521	N	0.99903	B	0.12013	0.005	B	0.11329	0.006	T	0.15321	-1.0441	10	0.56958	D	0.05	0.0408	7.1588	0.25652	0.0:0.8751:0.0:0.1249	.	901	O15265-2	.	I	901;901;72	ENSP00000381590:T901I;ENSP00000439585:T901I;ENSP00000428067:T72I	ENSP00000381590:T901I	T	+	2	0	ATXN7	63958377	0.005000	0.15991	0.963000	0.40424	0.987000	0.75469	0.983000	0.29552	1.254000	0.44035	0.644000	0.83932	ACA	.		0.428	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
ITGB5	3693	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124515325	124515325	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:124515325A>T	ENST00000296181.4	-	10	1899	c.1603T>A	c.(1603-1605)Tgc>Agc	p.C535S		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	535	Cysteine-rich tandem repeats.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		CTCTCGAAGCAGGAGCACTGG	0.597																																					p.C535S													.	ITGB5-227	0			c.T1603A						.						103.0	92.0	96.0					3																	124515325		2203	4300	6503	SO:0001583	missense	3693	exon10			CGAAGCAGGAGCA	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1603T>A	3.37:g.124515325A>T	ENSP00000296181:p.Cys535Ser	100	1		77	29	NM_002213	0	0	42	65	23	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.715465	0.89112	.	.	ENSG00000082781	ENST00000296181	D	0.98207	-4.79	5.26	5.26	0.73747	.	0.136977	0.64402	D	0.000003	D	0.99290	0.9752	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98816	1.0745	10	0.87932	D	0	.	15.3487	0.74363	1.0:0.0:0.0:0.0	.	535	P18084	ITB5_HUMAN	S	535	ENSP00000296181:C535S	ENSP00000296181:C535S	C	-	1	0	ITGB5	125998015	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	9.049000	0.93837	2.208000	0.71279	0.460000	0.39030	TGC	.		0.597	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
TOPBP1	11073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	133331389	133331389	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:133331389C>T	ENST00000260810.5	-	24	4010	c.3879G>A	c.(3877-3879)ttG>ttA	p.L1293L		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1293	BRCT 7. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TTTCTATCACCAATCCACCTT	0.383								Other conserved DNA damage response genes																													p.L1293L	Ovarian(21;193 658 4424 15423 17362)	.											.	TOPBP1-540	0			c.G3879A						.						50.0	48.0	49.0					3																	133331389		1904	4132	6036	SO:0001819	synonymous_variant	11073	exon24			TATCACCAATCCA	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3879G>A	3.37:g.133331389C>T		69	0		52	20	NM_007027	0	0	0	0	0	B7Z7W8|Q7LGC1|Q9UEB9	Silent	SNP	ENST00000260810.5	37	CCDS46919.1																																																																																			.		0.383	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	
KLHL6	89857	broad.mit.edu	37	3	183217515	183217515	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:183217515A>C	ENST00000341319.3	-	4	1045	c.1010T>G	c.(1009-1011)gTg>gGg	p.V337G		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	337					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CAGGCAGGTCACCTCTGCCAC	0.567																																					p.V337G													.	KLHL6-93	0			c.T1010G						.						82.0	71.0	75.0					3																	183217515		2203	4300	6503	SO:0001583	missense	89857	exon4			CAGGTCACCTCTG	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1010T>G	3.37:g.183217515A>C	ENSP00000341342:p.Val337Gly	91	4		73	7	NM_130446	0	0	2	2	0	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.224479	0.79576	.	.	ENSG00000172578	ENST00000341319	T	0.69175	-0.38	5.12	5.12	0.69794	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.79155	0.4398	M	0.78049	2.395	0.80722	D	1	D	0.56035	0.974	P	0.57911	0.829	T	0.82682	-0.0336	10	0.87932	D	0	.	15.234	0.73413	1.0:0.0:0.0:0.0	.	337	Q8WZ60	KLHL6_HUMAN	G	337	ENSP00000341342:V337G	ENSP00000341342:V337G	V	-	2	0	KLHL6	184700209	1.000000	0.71417	0.999000	0.59377	0.815000	0.46073	8.910000	0.92685	2.068000	0.61886	0.454000	0.30748	GTG	.		0.567	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
CLDN16	10686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	190126252	190126252	+	Missense_Mutation	SNP	T	T	G	rs143316426	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:190126252T>G	ENST00000264734.2	+	4	990	c.742T>G	c.(742-744)Ttg>Gtg	p.L248V	CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	248					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		GGGTTGCTTTTTGGCTGGAGC	0.393																																					p.L248V		.											.	CLDN16-227	0			c.T742G						.						142.0	138.0	140.0					3																	190126252		2203	4300	6503	SO:0001583	missense	10686	exon4			TGCTTTTTGGCTG	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.742T>G	3.37:g.190126252T>G	ENSP00000264734:p.Leu248Val	69	0		78	40	NM_006580	0	0	5	5	0		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084809	0.36758	.	.	ENSG00000113946	ENST00000264734	D	0.89875	-2.58	5.6	3.12	0.35913	.	0.099830	0.43919	D	0.000514	D	0.82282	0.5003	L	0.39326	1.205	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.78966	-0.1995	10	0.44086	T	0.13	-2.4464	8.0251	0.30431	0.0:0.0724:0.135:0.7926	.	248	Q9Y5I7	CLD16_HUMAN	V	248	ENSP00000264734:L248V	ENSP00000264734:L248V	L	+	1	2	CLDN16	191608946	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	1.133000	0.31430	0.909000	0.36697	0.455000	0.32223	TTG	T|0.999;C|0.001		0.393	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
PLK4	10733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	128813596	128813596	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr4:128813596T>C	ENST00000270861.5	+	10	2389	c.2115T>C	c.(2113-2115)taT>taC	p.Y705Y	PLK4_ENST00000507249.1_Silent_p.Y644Y|PLK4_ENST00000514379.1_Silent_p.Y664Y|PLK4_ENST00000513090.1_Silent_p.Y673Y|PLK4_ENST00000515069.1_Silent_p.Y627Y|RNU6-583P_ENST00000516012.1_RNA	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	705					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						AAATCACTTATTTTACAAGAT	0.313																																					p.Y705Y	Colon(135;508 1718 19061 31832 42879)	.											.	PLK4-333	0			c.T2115C						.						121.0	116.0	118.0					4																	128813596		2202	4299	6501	SO:0001819	synonymous_variant	10733	exon10			CACTTATTTTACA	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2115T>C	4.37:g.128813596T>C		72	0		115	31	NM_014264	0	0	2	5	3	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	ENST00000270861.5	37	CCDS3735.1																																																																																			.		0.313	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
CPE	1363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	166300624	166300624	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr4:166300624A>C	ENST00000402744.4	+	1	531	c.251A>C	c.(250-252)gAg>gCg	p.E84A		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	84					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGCAGCTTCGAGGGCCGGGAG	0.682																																					p.E84A		.											.	CPE-155	0			c.A251C						.						13.0	14.0	14.0					4																	166300624		2161	4236	6397	SO:0001583	missense	1363	exon1			GCTTCGAGGGCCG	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.251A>C	4.37:g.166300624A>C	ENSP00000386104:p.Glu84Ala	111	0		156	91	NM_001873	0	0	15	67	52	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	37	CCDS3810.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301811	0.81136	.	.	ENSG00000109472	ENST00000402744;ENST00000261510	T	0.15372	2.43	4.1	4.1	0.47936	Peptidase M14, carboxypeptidase A (2);	0.098707	0.64402	D	0.000002	T	0.27697	0.0681	M	0.84082	2.675	0.58432	D	0.999999	B	0.24576	0.106	B	0.31245	0.126	T	0.14615	-1.0466	10	0.59425	D	0.04	-28.9098	12.8978	0.58109	1.0:0.0:0.0:0.0	.	84	P16870	CBPE_HUMAN	A	84;48	ENSP00000386104:E84A	ENSP00000261510:E48A	E	+	2	0	CPE	166520074	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.494000	0.73661	1.707000	0.51288	0.254000	0.18369	GAG	.		0.682	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873	
SHROOM1	134549	broad.mit.edu	37	5	132160935	132160935	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:132160935G>T	ENST00000378679.3	-	4	1702	c.898C>A	c.(898-900)Ccc>Acc	p.P300T	SHROOM1_ENST00000319854.3_Missense_Mutation_p.P300T|SHROOM1_ENST00000378676.1_Missense_Mutation_p.P300T|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	300					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGACTGGCGGGCCTGAAGGCA	0.592																																					p.P300T													.	SHROOM1-91	0			c.C898A						.						30.0	33.0	32.0					5																	132160935		2203	4300	6503	SO:0001583	missense	134549	exon1			TGGCGGGCCTGAA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.898C>A	5.37:g.132160935G>T	ENSP00000367950:p.Pro300Thr	69	0		87	8	NM_133456	0	0	3	3	0	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	37	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578119	0.65878	.	.	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676;ENST00000440118	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	4.7	4.7	0.59300	.	0.362631	0.24720	N	0.036146	T	0.38878	0.1057	L	0.32530	0.975	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.76575	0.988;0.973	T	0.11665	-1.0578	10	0.52906	T	0.07	-15.8128	13.8589	0.63548	0.0:0.0:1.0:0.0	.	300;300	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	T	300	ENSP00000367950:P300T;ENSP00000324245:P300T;ENSP00000367947:P300T;ENSP00000388049:P300T	ENSP00000324245:P300T	P	-	1	0	SHROOM1	132188834	0.006000	0.16342	0.662000	0.29724	0.016000	0.09150	0.732000	0.26072	2.542000	0.85734	0.561000	0.74099	CCC	.		0.592	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
FAM13B	51306	broad.mit.edu	37	5	137289150	137289150	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:137289150G>A	ENST00000033079.3	-	15	2108	c.1657C>T	c.(1657-1659)Cga>Tga	p.R553*	FAM13B_ENST00000420893.2_Nonsense_Mutation_p.R553*|FAM13B_ENST00000425075.2_Nonsense_Mutation_p.R457*	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	553					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GATGATCTTCGAATTCTGAAT	0.353																																					p.R553X													.	.	0			c.C1657T						.						115.0	111.0	112.0					5																	137289150		2203	4299	6502	SO:0001587	stop_gained	51306	exon15			ATCTTCGAATTCT	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1657C>T	5.37:g.137289150G>A	ENSP00000033079:p.Arg553*	42	0		80	5	NM_001101800	0	0	0	0	0	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Nonsense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	G	41	9.156967	0.99084	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9213	13.6288	0.62183	0.0:0.0:0.8451:0.1549	.	.	.	.	X	553;457;553	.	ENSP00000033079:R553X	R	-	1	2	FAM13B	137317049	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.454000	0.52986	2.403000	0.81681	0.585000	0.79938	CGA	.		0.353	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
HIGD2A	192286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	175816407	175816407	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:175816407T>A	ENST00000274787.2	+	2	303	c.230T>A	c.(229-231)cTc>cAc	p.L77H	NOP16_ENST00000507413.1_5'Flank|NOP16_ENST00000389158.5_5'Flank|NOP16_ENST00000509257.1_5'Flank|NOP16_ENST00000510123.1_5'Flank	NM_138820.2	NP_620175.1	Q9BW72	HIG2A_HUMAN	HIG1 hypoxia inducible domain family, member 2A	77	HIG1. {ECO:0000255|PROSITE- ProRule:PRU00836}.				negative regulation of apoptotic process (GO:0043066)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)				large_intestine(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		CGCTCTCAGCTCATGATGCGC	0.647																																					p.L77H		.											.	HIGD2A-90	0			c.T230A						.						67.0	74.0	71.0					5																	175816407		2203	4300	6503	SO:0001583	missense	192286	exon2			CTCAGCTCATGAT	BC007502	CCDS4401.1	5q35.2	2009-03-17	2009-03-17		ENSG00000146066	ENSG00000146066			28311	protein-coding gene	gene with protein product			"""HIG1 domain family, member 2A"""			12477932	Standard	NM_138820		Approved	MGC2198	uc003meg.3	Q9BW72	OTTHUMG00000130657	ENST00000274787.2:c.230T>A	5.37:g.175816407T>A	ENSP00000274787:p.Leu77His	135	0		141	35	NM_138820	0	0	517	788	271		Missense_Mutation	SNP	ENST00000274787.2	37	CCDS4401.1	.	.	.	.	.	.	.	.	.	.	T	32	5.165072	0.94727	.	.	ENSG00000146066	ENST00000274787	.	.	.	5.89	5.89	0.94794	Hypoxia induced protein, domain (2);	0.244211	0.42548	D	0.000699	T	0.63965	0.2556	L	0.33710	1.025	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.57911	-0.7729	9	0.13853	T	0.58	-17.0539	16.3158	0.82923	0.0:0.0:0.0:1.0	.	77	Q9BW72	HIG2A_HUMAN	H	77	.	ENSP00000274787:L77H	L	+	2	0	HIGD2A	175749013	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.646000	0.83445	2.254000	0.74563	0.533000	0.62120	CTC	.		0.647	HIGD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253147.1	NM_138820	
UNC5A	90249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176300996	176300996	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:176300996T>G	ENST00000329542.4	+	7	1188	c.914T>G	c.(913-915)cTc>cGc	p.L305R	UNC5A_ENST00000261961.3_Missense_Mutation_p.L265R	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	305					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACGTGGCCCTCTATGTGGGC	0.627																																					p.L305R		.											.	UNC5A-91	0			c.T914G						.						96.0	81.0	86.0					5																	176300996		2203	4300	6503	SO:0001583	missense	90249	exon7			TGGCCCTCTATGT	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.914T>G	5.37:g.176300996T>G	ENSP00000332737:p.Leu305Arg	102	0		113	68	NM_133369	0	0	0	0	0	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466120	0.84425	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.58506	0.33;0.68	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	T	0.74261	0.3693	M	0.69248	2.105	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.77603	-0.2526	10	0.87932	D	0	-27.0982	15.222	0.73320	0.0:0.0:0.0:1.0	.	265;305	Q6ZN44-3;Q6ZN44	.;UNC5A_HUMAN	R	305;265	ENSP00000332737:L305R;ENSP00000261961:L265R	ENSP00000261961:L265R	L	+	2	0	UNC5A	176233602	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.627000	0.83176	2.010000	0.58986	0.402000	0.26972	CTC	.		0.627	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
ECI2	10455	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4130664	4130664	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:4130664T>G	ENST00000380118.3	-	4	479	c.443A>C	c.(442-444)gAt>gCt	p.D148A	C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000380125.2_Missense_Mutation_p.D118A|ECI2_ENST00000465828.1_Missense_Mutation_p.D118A|ECI2_ENST00000361538.2_Missense_Mutation_p.D118A|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000413766.2_5'UTR			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	148					fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						TGTGATGCCATCTTCGGAGGT	0.458																																					p.D148A													.	ECI2-90	0			c.A443C						.						199.0	172.0	181.0					6																	4130664		2203	4300	6503	SO:0001583	missense	10455	exon4			ATGCCATCTTCGG	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.443A>C	6.37:g.4130664T>G	ENSP00000369461:p.Asp148Ala	106	1		88	24	NM_206836	0	0	72	131	59	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	14.64	2.594282	0.46214	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	T;T;T;T;T	0.49720	0.79;0.79;0.79;0.79;0.77	5.95	0.473	0.16763	.	0.524869	0.21650	N	0.071183	T	0.28764	0.0713	M	0.82433	2.59	0.80722	D	1	B	0.28667	0.219	B	0.31751	0.135	T	0.07947	-1.0746	10	0.33940	T	0.23	.	4.8584	0.13571	0.1281:0.2415:0.0:0.6304	.	148	O75521	ECI2_HUMAN	A	148;118;118;118;195	ENSP00000369461:D148A;ENSP00000369468:D118A;ENSP00000354737:D118A;ENSP00000420309:D118A;ENSP00000417459:D195A	ENSP00000354737:D118A	D	-	2	0	ECI2	4075663	0.969000	0.33509	0.093000	0.20910	0.844000	0.47949	2.042000	0.41222	0.098000	0.17522	0.533000	0.62120	GAT	.		0.458	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
TNFRSF21	27242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	47254097	47254097	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:47254097G>A	ENST00000296861.2	-	2	724	c.331C>T	c.(331-333)Cag>Tag	p.Q111*		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	111					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			GGGCATGGCTGACTACAGTCA	0.522																																					p.Q111X		.											.	TNFRSF21-227	0			c.C331T						.						162.0	141.0	149.0					6																	47254097		2203	4300	6503	SO:0001587	stop_gained	27242	exon2			ATGGCTGACTACA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.331C>T	6.37:g.47254097G>A	ENSP00000296861:p.Gln111*	137	0		136	61	NM_014452	0	0	33	47	14	B2RDI9|Q0D2P5|Q96D86	Nonsense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	G	39	7.562418	0.98361	.	.	ENSG00000146072	ENST00000296861	.	.	.	5.65	4.72	0.59763	.	0.399599	0.28612	N	0.014733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	8.9938	0.36039	0.0:0.1192:0.6376:0.2432	.	.	.	.	X	111	.	ENSP00000296861:Q111X	Q	-	1	0	TNFRSF21	47362056	0.996000	0.38824	0.998000	0.56505	0.998000	0.95712	2.242000	0.43106	2.826000	0.97356	0.563000	0.77884	CAG	.		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
CEP85L	387119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	118790282	118790282	+	Missense_Mutation	SNP	C	C	T	rs371610026		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:118790282C>T	ENST00000368491.3	-	12	2828	c.2207G>A	c.(2206-2208)cGt>cAt	p.R736H	CEP85L_ENST00000368488.5_Missense_Mutation_p.R739H	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	736						centrosome (GO:0005813)|cytoplasm (GO:0005737)											GCCCTGAGCACGCTGATTAAG	0.378																																					p.R739H		.											.	.	0			c.G2216A						.						93.0	91.0	92.0					6																	118790282		1996	4188	6184	SO:0001583	missense	387119	exon13			TGAGCACGCTGAT	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.2207G>A	6.37:g.118790282C>T	ENSP00000357477:p.Arg736His	121	0		105	22	NM_001178035	0	0	0	1	1	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	C	33	5.236142	0.95240	.	.	ENSG00000111860	ENST00000368491;ENST00000368488	T;T	0.12465	2.68;2.68	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.72118	2.19	0.52501	D	0.999954	D	0.89917	1.0	D	0.91635	0.999	T	0.01621	-1.1310	10	0.62326	D	0.03	-8.4553	20.6208	0.99490	0.0:1.0:0.0:0.0	.	736	Q5SZL2	CF204_HUMAN	H	736;739	ENSP00000357477:R736H;ENSP00000357474:R739H	ENSP00000357474:R739H	R	-	2	0	C6orf204	118896975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.059000	0.64306	2.882000	0.98803	0.655000	0.94253	CGT	.		0.378	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
KIAA1244	57221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	138656258	138656258	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:138656258G>A	ENST00000251691.4	+	33	6441	c.6275G>A	c.(6274-6276)aGg>aAg	p.R2092K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CAGGACAAGAGGCCCCGCTCA	0.647																																					p.R2092K		.											.	KIAA1244-228	0			c.G6275A						.						19.0	19.0	19.0					6																	138656258		2203	4297	6500	SO:0001583	missense	57221	exon33			ACAAGAGGCCCCG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.6275G>A	6.37:g.138656258G>A	ENSP00000251691:p.Arg2092Lys	28	0		19	8	NM_020340	0	0	0	0	0		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.215145|5.215145	0.95104|0.95104	.|.	.|.	ENSG00000112379|ENSG00000112379	ENST00000367706|ENST00000251691	.|T	.|0.20598	.|2.06	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.156972	.|0.56097	.|D	.|0.000026	.|T	.|0.24812	.|0.0602	L|L	0.32530|0.32530	0.975|0.975	0.51012|0.51012	D|D	0.999903|0.999903	.|D	.|0.58268	.|0.982	.|D	.|0.67548	.|0.952	.|T	.|0.01301	.|-1.1391	.|10	.|0.18276	.|T	.|0.48	.|-24.3666	19.9626|19.9626	0.97256|0.97256	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2092	.|Q5TH69	.|BIG3_HUMAN	.|K	-1|2092	.|ENSP00000251691:R2092K	.|ENSP00000251691:R2092K	.|R	+|+	.|2	.|0	KIAA1244|KIAA1244	138697951|138697951	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.198000|9.198000	0.94994|0.94994	2.723000|2.723000	0.93209|0.93209	0.511000|0.511000	0.50034|0.50034	.|AGG	.		0.647	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
ANLN	54443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	36446013	36446013	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr7:36446013A>C	ENST00000265748.2	+	4	932	c.711A>C	c.(709-711)aaA>aaC	p.K237N	ANLN_ENST00000396068.2_Missense_Mutation_p.K237N	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	237	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GTTTATCCAAATTTTCCTCTG	0.428																																					p.K237N		.											.	ANLN-517	0			c.A711C						.						125.0	118.0	120.0					7																	36446013		2203	4300	6503	SO:0001583	missense	54443	exon4			ATCCAAATTTTCC	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.711A>C	7.37:g.36446013A>C	ENSP00000265748:p.Lys237Asn	104	0		89	49	NM_018685	0	0	0	0	0	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	A	16.86	3.239520	0.58995	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	T;T	0.03004	4.08;4.08	5.51	4.35	0.52113	.	0.142348	0.64402	D	0.000007	T	0.16214	0.0390	M	0.71581	2.175	0.44067	D	0.99681	D;D;D;D	0.89917	1.0;0.998;0.999;0.998	D;D;D;D	0.87578	0.998;0.913;0.973;0.913	T	0.00176	-1.1953	10	0.72032	D	0.01	-27.164	12.9765	0.58540	0.8648:0.1352:0.0:0.0	.	114;237;237;237	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	N	237	ENSP00000265748:K237N;ENSP00000379380:K237N	ENSP00000265748:K237N	K	+	3	2	ANLN	36412538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.978000	0.63799	1.024000	0.39682	0.528000	0.53228	AAA	.		0.428	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
ASH2L	9070	broad.mit.edu	37	8	37978552	37978552	+	Silent	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr8:37978552G>A	ENST00000343823.6	+	10	1359	c.1050G>A	c.(1048-1050)ccG>ccA	p.P350P	ASH2L_ENST00000428278.2_Silent_p.P256P|RP11-90P5.4_ENST00000519081.1_RNA|ASH2L_ENST00000250635.7_Silent_p.P256P|RP11-90P5.5_ENST00000476186.2_RNA|ASH2L_ENST00000545394.1_Silent_p.P211P|ASH2L_ENST00000521652.1_Silent_p.P256P	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	350					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				AGCCTGATCCGCACGCCCCTG	0.522											OREG0018719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P350P													.	ASH2L-131	0			c.G1050A						.						134.0	126.0	128.0					8																	37978552		2203	4300	6503	SO:0001819	synonymous_variant	9070	exon10			TGATCCGCACGCC	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.1050G>A	8.37:g.37978552G>A		120	1	874	204	6	NM_004674	0	1	86	87	0	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Silent	SNP	ENST00000343823.6	37	CCDS6101.1																																																																																			.		0.522	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674	
C8orf82	414919	hgsc.bcm.edu	37	8	145753110	145753110	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr8:145753110C>A	ENST00000524821.1	-	3	482	c.267G>T	c.(265-267)gaG>gaT	p.E89D	LRRC24_ENST00000533758.1_5'Flank|LRRC24_ENST00000529415.2_5'Flank|C8orf82_ENST00000313465.5_3'UTR			Q6P1X6	CH082_HUMAN	chromosome 8 open reading frame 82	89										endometrium(1)|urinary_tract(1)	2						GGAAAGCGGCCTCGTAGCGCC	0.682																																					p.E89D		.											.	C8orf82-44	0			c.G267T						.						38.0	48.0	45.0					8																	145753110		2179	4287	6466	SO:0001583	missense	414919	exon3			AGCGGCCTCGTAG		CCDS34970.1	8q24	2012-04-18			ENSG00000213563	ENSG00000213563			33826	protein-coding gene	gene with protein product						12477932	Standard	NM_001001795		Approved	MGC70857	uc003zdp.1	Q6P1X6	OTTHUMG00000165181	ENST00000524821.1:c.267G>T	8.37:g.145753110C>A	ENSP00000436621:p.Glu89Asp	8	0		30	16	NM_001001795	0	0	46	87	41	Q6GMR2|Q6P2Q7	Missense_Mutation	SNP	ENST00000524821.1	37	CCDS34970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.998184|3.998184	0.74818|0.74818	.|.	.|.	ENSG00000213563|ENSG00000213563	ENST00000524821|ENST00000532827	.|.	.|.	.|.	3.97|3.97	2.88|2.88	0.33553|0.33553	.|.	0.238001|.	0.26891|.	U|.	0.021962|.	T|T	0.55752|0.55752	0.1940|0.1940	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D;P|.	0.58268|.	0.982;0.939|.	P;P|.	0.58013|.	0.831;0.554|.	T|T	0.51872|0.51872	-0.8650|-0.8650	9|5	0.44086|.	T|.	0.13|.	-10.1373|-10.1373	3.8003|3.8003	0.08756|0.08756	0.0:0.6552:0.0:0.3448|0.0:0.6552:0.0:0.3448	.|.	81;89|.	Q6P1X6-2;Q6P1X6|.	.;CH082_HUMAN|.	D|C	89|134	.|.	ENSP00000436621:E89D|.	E|G	-|-	3|1	2|0	C8orf82|C8orf82	145723918|145723918	0.969000|0.969000	0.33509|0.33509	1.000000|1.000000	0.80357|0.80357	0.932000|0.932000	0.56968|0.56968	1.066000|1.066000	0.30604|0.30604	0.810000|0.810000	0.34279|0.34279	0.563000|0.563000	0.77884|0.77884	GAG|GGC	.		0.682	C8orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382503.1	NM_001001795	
CERCAM	51148	broad.mit.edu	37	9	131186698	131186698	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr9:131186698C>T	ENST00000372838.4	+	5	969	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	CERCAM_ENST00000372842.1_Missense_Mutation_p.R113C	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	191					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						GGGCTACTACCGCCGCACAGC	0.662																																					p.R191C													.	CERCAM-69	0			c.C571T						.						47.0	51.0	50.0					9																	131186698		2203	4300	6503	SO:0001583	missense	51148	exon5			TACTACCGCCGCA	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.571C>T	9.37:g.131186698C>T	ENSP00000361929:p.Arg191Cys	79	0		51	3	NM_016174	0	0	9	9	0	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	37	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231933	0.79688	.	.	ENSG00000167123	ENST00000372842;ENST00000420512;ENST00000372838;ENST00000413863	T;T;T	0.21932	1.98;1.98;1.98	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.45478	0.1344	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.63703	0.917	T	0.48927	-0.8991	10	0.87932	D	0	0.3165	16.4921	0.84205	0.0:1.0:0.0:0.0	.	191	Q5T4B2	GT253_HUMAN	C	113;113;191;144	ENSP00000361933:R113C;ENSP00000416676:R113C;ENSP00000361929:R191C	ENSP00000361929:R191C	R	+	1	0	CERCAM	130226519	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	1.964000	0.40462	2.473000	0.83533	0.467000	0.42956	CGC	.		0.662	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	NM_016174	
KIAA1210	57481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	118219440	118219440	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chrX:118219440T>G	ENST00000402510.2	-	12	4753	c.4754A>C	c.(4753-4755)aAg>aCg	p.K1585T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1585										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ACTCTTCTGCTTCTGCTTTGC	0.448																																					p.K1585T		.											.	KIAA1210-67	0			c.A4754C						.						108.0	96.0	99.0					X																	118219440		1887	4103	5990	SO:0001583	missense	57481	exon12			TTCTGCTTCTGCT	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4754A>C	X.37:g.118219440T>G	ENSP00000384670:p.Lys1585Thr	29	0		46	6	NM_020721	0	0	0	0	0	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.05|11.05	1.525709|1.525709	0.27299|0.27299	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.22743	.|1.94	5.16|5.16	-4.73|-4.73	0.03259|0.03259	.|.	.|.	.|.	.|.	.|.	T|T	0.32912|0.32912	0.0845|0.0845	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	1|1	.|D	.|0.62365	.|0.991	.|P	.|0.61070	.|0.883	T|T	0.21930|0.21930	-1.0231|-1.0231	5|9	.|0.35671	.|T	.|0.21	.|.	12.3761|12.3761	0.55281|0.55281	0.0:0.2909:0.0:0.7091|0.0:0.2909:0.0:0.7091	.|.	.|1585	.|Q9ULL0	.|K1210_HUMAN	D|T	991|1585	.|ENSP00000384670:K1585T	.|ENSP00000384670:K1585T	E|K	-|-	3|2	2|0	KIAA1210|RP13-347D8.6	118103468|118103468	0.049000|0.049000	0.20398|0.20398	0.001000|0.001000	0.08648|0.08648	0.044000|0.044000	0.14063|0.14063	-0.389000|-0.389000	0.07342|0.07342	-1.098000|-1.098000	0.03038|0.03038	0.486000|0.486000	0.48141|0.48141	GAA|AAG	.		0.448	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
KANSL2	54934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49073468	49073468	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49073468delT	ENST00000420613.2	-	3	447	c.400delA	c.(400-402)agtfs	p.S135fs	KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Frame_Shift_Del_p.S318fs|KANSL2_ENST00000553086.1_Frame_Shift_Del_p.S135fs	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	135					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											CTGCGACTACTTTCTGGAGTC	0.493																																					p.S134fs		.											.	.	0			c.400delA						.						50.0	47.0	48.0					12																	49073468		1915	4135	6050	SO:0001589	frameshift_variant	54934	exon3			.	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.400delA	12.37:g.49073468delT	ENSP00000415436:p.Ser135fs	81	0		122	64	NM_017822	0	0	0	0	0	Q8N3B5|Q96CV0|Q9NX51	Frame_Shift_Del	DEL	ENST00000420613.2	37	CCDS44869.1																																																																																			.		0.493	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
KANSL2	54934	hgsc.bcm.edu	37	12	49073468	49073469	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49073468_49073469delTT	ENST00000420613.2	-	3	446_447	c.399_400delAA	c.(397-402)gaaagtfs	p.S135fs	KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Frame_Shift_Del_p.S318fs|KANSL2_ENST00000553086.1_Frame_Shift_Del_p.S135fs	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	135					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											CTGCGACTACTTTCTGGAGTCT	0.49																																					p.133_134del		.											.	.	0			c.399_400del						.																																			SO:0001589	frameshift_variant	54934	exon3			.	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.399_400delAA	12.37:g.49073468_49073469delTT	ENSP00000415436:p.Ser135fs	82	0		122	41	NM_017822	0	0	0	0	0	Q8N3B5|Q96CV0|Q9NX51	Frame_Shift_Del	DEL	ENST00000420613.2	37	CCDS44869.1																																																																																			.		0.490	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
TM9SF1	10548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24661497	24661519	+	Frame_Shift_Del	DEL	CTGCTGAGTTAATGGCCCCATGA	CTGCTGAGTTAATGGCCCCATGA	-	rs150862560		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	CTGCTGAGTTAATGGCCCCATGA	CTGCTGAGTTAATGGCCCCATGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr14:24661497_24661519delCTGCTGAGTTAATGGCCCCATGA	ENST00000261789.4	-	4	1369_1391	c.1011_1033delTCATGGGGCCATTAACTCAGCAG	c.(1009-1035)cgtcatggggccattaactcagcagccfs	p.HGAINSAA338fs	TM9SF1_ENST00000396854.4_Frame_Shift_Del_p.HGAINSAA338fs|TM9SF1_ENST00000524835.1_Frame_Shift_Del_p.HGAINSAA251fs|TM9SF1_ENST00000556387.1_Frame_Shift_Del_p.HGAINSAA547fs|TM9SF1_ENST00000530611.1_Frame_Shift_Del_p.HGAINSAA547fs|TM9SF1_ENST00000528669.1_Frame_Shift_Del_p.HGAINSAA338fs|RP11-468E2.2_ENST00000561419.1_5'Flank	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	338					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.S343P(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		AACAAGATGGCTGCTGAGTTAATGGCCCCATGACGGTGCACAT	0.538																																					p.337_345del		.											.	TM9SF1-91	1	Substitution - Missense(1)	large_intestine(1)	c.1011_1033del						.																																			SO:0001589	frameshift_variant	10548	exon4			.	U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1011_1033delTCATGGGGCCATTAACTCAGCAG	14.37:g.24661497_24661519delCTGCTGAGTTAATGGCCCCATGA	ENSP00000261789:p.His338fs	253	0		209	48	NM_001014842	0	0	0	0	0	D3DS65|Q86SZ6|Q96FI8	Frame_Shift_Del	DEL	ENST00000261789.4	37	CCDS9617.1																																																																																			.		0.538	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
HERC2	8924	bcgsc.ca	37	15	28456185	28456185	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:28456185delA	ENST00000261609.7	-	44	7140	c.7032delT	c.(7030-7032)tctfs	p.S2344fs		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGCTGGCTGAGACAGGATCT	0.488																																					p.S2344fs													.	HERC2-234	0			c.7032delT						.						36.0	37.0	36.0					15																	28456185		2202	4297	6499	SO:0001589	frameshift_variant	8924	exon44			TGGCTGAGACAGG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.7032delT	15.37:g.28456185delA	ENSP00000261609:p.Ser2344fs	409	1		406	140	NM_004667	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000261609.7	37	CCDS10021.1																																																																																			.		0.488	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HSPB6	126393	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36243734	36243734	+	IGR	DEL	G	G	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:36243734delG	ENST00000592984.1	-	0	1634				AC002398.9_ENST00000591613.2_3'UTR|AC002398.12_ENST00000587767.1_RNA|AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_Splice_Site_p.R64fs			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACTGGCAAAAGGTAAGGTGGC	0.627																																					p.R64fs		.											.	.	0			c.191delG						.						27.0	33.0	31.0					19																	36243734		2060	4204	6264	SO:0001628	intergenic_variant	55957	exon4			.	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36243734delG		83	0		73	28	NM_019104	0	0	0	0	0	O14551|Q6NVI3|Q96MG9	Frame_Shift_Del	DEL	ENST00000592984.1	37	CCDS12475.1																																																																																			.		0.627	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617	
COL18A1	80781	broad.mit.edu	37	21	46911183	46911183	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr21:46911183delC	ENST00000359759.4	+	21	3378	c.3357delC	c.(3355-3357)ggcfs	p.G1119fs	COL18A1_ENST00000400337.2_Frame_Shift_Del_p.G704fs|COL18A1_ENST00000355480.5_Frame_Shift_Del_p.G884fs			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1119	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCCTCCCTGGCCCCCCCGGAC	0.692																																					p.G884fs													.	COL18A1-90	0			c.2652delC						.						19.0	26.0	24.0					21																	46911183		1917	4091	6008	SO:0001589	frameshift_variant	80781	exon21			CCCTGGCCCCCCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3357delC	21.37:g.46911183delC	ENSP00000352798:p.Gly1119fs	260	0		451	7	NM_030582	0	0	0	0	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Frame_Shift_Del	DEL	ENST00000359759.4	37																																																																																				.		0.692	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
DOCK3	1795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	51393580	51393580	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:51393580delG	ENST00000266037.9	+	42	4333	c.4310delG	c.(4309-4311)aggfs	p.R1437fs		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1437	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAGATGGATAGGGTACCAGAT	0.493																																					p.R1437fs		.											.	DOCK3-22	0			c.4310delG						.						147.0	140.0	142.0					3																	51393580		1982	4180	6162	SO:0001589	frameshift_variant	1795	exon42			.	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4310delG	3.37:g.51393580delG	ENSP00000266037:p.Arg1437fs	232	0		199	65	NM_004947	0	0	0	0	0	O15017	Frame_Shift_Del	DEL	ENST00000266037.9	37	CCDS46835.1																																																																																			.		0.493	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
MFSD3	113655	broad.mit.edu	37	8	145738764	145738764	+	IGR	DEL	A	A	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr8:145738764delA	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Frame_Shift_Del_p.V769fs|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGCCACCACCACCCGGCAACT	0.687																																					p.V767fs													.	RECQL4-1083	0			c.2300delT						.						15.0	20.0	19.0					8																	145738764		2073	4204	6277	SO:0001628	intergenic_variant	9401	exon15			ACCACCACCCGGC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738764delA		92	0		181	7	NM_004260	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000301327.4	37	CCDS6431.1																																																																																			.		0.687	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
NCOR2	9612	hgsc.bcm.edu	37	12	124824739	124824740	+	Frame_Shift_Ins	INS	-	-	GCCG			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:124824739_124824740insGCCG	ENST00000405201.1	-	37	5499_5500	c.5499_5500insCGGC	c.(5497-5502)cagagcfs	p.S1834fs	NCOR2_ENST00000429285.2_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000356219.3_Frame_Shift_Ins_p.S1841fs|NCOR2_ENST00000404121.2_Frame_Shift_Ins_p.S1395fs|NCOR2_ENST00000404621.1_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000397355.1_Frame_Shift_Ins_p.S1825fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1845					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ctgccgctgctctgctCTGTAC	0.713																																					p.S1834fs		.											.	NCOR2-229	0			c.5500_5501insCGGC						.																																			SO:0001589	frameshift_variant	9612	exon39			.	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5499_5500insCGGC	12.37:g.124824739_124824740insGCCG	ENSP00000384018:p.Ser1834fs	10	0		61	11	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			GCCGCTGCT|1.000;|0.000		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
NBEAL1	65065	hgsc.bcm.edu;bcgsc.ca	37	2	204009565	204009566	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:204009565_204009566insT	ENST00000449802.1	+	31	5337_5338	c.5004_5005insT	c.(5005-5007)tttfs	p.F1669fs		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1669										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GTAGCTCCTCATTTTTTGAAGA	0.317																																					p.S1668fs		.											.	NBEAL1-92	0			c.5004_5005insT						.																																			SO:0001589	frameshift_variant	65065	exon31			.	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5010dupT	2.37:g.204009571_204009571dupT	ENSP00000399903:p.Phe1669fs	52	0		45	16	NM_001114132	0	0	0	0	0	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Frame_Shift_Ins	INS	ENST00000449802.1	37	CCDS46495.1																																																																																			.		0.317	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
DNAH1	25981	hgsc.bcm.edu;bcgsc.ca	37	3	52402933	52402934	+	Splice_Site	INS	-	-	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:52402933_52402934insG	ENST00000420323.2	+	37	6203_6204	c.5942_5943insG	c.(5941-5946)gaggca>gaGggca	p.A1982fs		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1982	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AAGCTCACAGAGGTGCACCTAC	0.584																																					p.E1981fs		.											.	DNAH1-67	0			c.5942_5943insG						.																																			SO:0001630	splice_region_variant	25981	exon37			.	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5943+1->G	3.37:g.52402935_52402935dupG		178	0		131	33	NM_015512	0	0	0	0	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Frame_Shift_Ins	INS	ENST00000420323.2	37	CCDS46842.1																																																																																			.		0.584	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	Frame_Shift_Ins
KDM2B	84678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121881832	121881833	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:121881832_121881833GC>AA	ENST00000377071.4	-	16	2505_2506	c.2433_2434GC>TT	c.(2431-2436)gaGCtg>gaTTtg	p.E811D	KDM2B_ENST00000542973.1_Missense_Mutation_p.E179D|KDM2B_ENST00000377069.4_Missense_Mutation_p.E780D|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	811					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CGTCCACTCAGCTCCTGGGGCT	0.649											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E811D		.											.	KDM2B-638	0			c.G2340T						.																																			SO:0001583	missense	84678	exon16			ACTCAGCTCCTGG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2433_2434delinsAA	12.37:g.121881832_121881833delinsAA	ENSP00000366271:p.Glu811Asp	55.0	0.0	1514	53.0	12.0	NM_001005366	0	0	0	0	0	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	DNP	ENST00000377071.4	37	CCDS41850.1																																																																																			.		0.649	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
