#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA1522	57648	ucsc.edu;bcgsc.ca	37	1	33236309	33236309	+	Missense_Mutation	SNP	G	G	A	rs370409288		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:33236309G>A	ENST00000373480.1	+	6	1455	c.1352G>A	c.(1351-1353)cGg>cAg	p.R451Q	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.R510Q|KIAA1522_ENST00000373481.3_Missense_Mutation_p.R462Q	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	451	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CTCCATCAGCGGGGCTTAGCA	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15500	0.001		0.0	False		,,,				2504	0.0				p.R510Q													.	KIAA1522-90	0			c.G1529A						.	G	GLN/ARG,GLN/ARG,	0,4066		0,0,2033	16.0	19.0	18.0		1352,1529,	3.6	1.0	1		18	1,8363		0,1,4181	no	missense,missense,intron	KIAA1522	NM_001198972.1,NM_020888.2,NM_001198973.1	43,43,	0,1,6214	AA,AG,GG		0.012,0.0,0.0080	possibly-damaging,possibly-damaging,	451/1036,510/1095,	33236309	1,12429	2033	4182	6215	SO:0001583	missense	57648	exon6			ATCAGCGGGGCTT	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.1352G>A	1.37:g.33236309G>A	ENSP00000362579:p.Arg451Gln	33	0		37	4	NM_020888	0	0	44	44	0	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302446	0.40694	0.0	1.2E-4	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.12879	2.64;2.65;2.66	4.55	3.56	0.40772	.	0.231822	0.29529	N	0.011887	T	0.07324	0.0185	L	0.41236	1.265	0.25554	N	0.987056	P;P;P	0.37997	0.614;0.614;0.614	B;B;B	0.26770	0.073;0.073;0.073	T	0.24190	-1.0167	10	0.33141	T	0.24	-12.1615	2.7924	0.05392	0.2252:0.0:0.5308:0.244	.	462;451;510	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	Q	510;462;451	ENSP00000383851:R510Q;ENSP00000362580:R462Q;ENSP00000362579:R451Q	ENSP00000362579:R451Q	R	+	2	0	KIAA1522	33008896	0.998000	0.40836	1.000000	0.80357	0.923000	0.55619	1.042000	0.30303	2.225000	0.72522	0.462000	0.41574	CGG	.		0.657	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
FOXE3	2301	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	47882415	47882415	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:47882415A>C	ENST00000335071.2	+	1	672	c.428A>C	c.(427-429)aAc>aCc	p.N143T		NM_012186.2	NP_036318.1	Q13461	FOXE3_HUMAN	forkhead box E3	143					camera-type eye development (GO:0043010)|cell development (GO:0048468)|positive regulation of epithelial cell proliferation (GO:0050679)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|upper_aerodigestive_tract(1)	5				READ - Rectum adenocarcinoma(2;0.0908)		GGCAAGGGCAACTACTGGACG	0.687																																					p.N143T		.											.	FOXE3-130	0			c.A428C						.						41.0	43.0	43.0					1																	47882415		2203	4299	6502	SO:0001583	missense	2301	exon1			AGGGCAACTACTG	AF275722	CCDS550.1	1p32	2008-02-05			ENSG00000186790	ENSG00000186790		"""Forkhead boxes"""	3808	protein-coding gene	gene with protein product		601094		FKHL12		8825632	Standard	NM_012186		Approved	FREAC8	uc001crk.3	Q13461	OTTHUMG00000007954	ENST00000335071.2:c.428A>C	1.37:g.47882415A>C	ENSP00000334472:p.Asn143Thr	101	0		103	30	NM_012186	1	0	1	2	0	Q5SVY9|Q9NQV9	Missense_Mutation	SNP	ENST00000335071.2	37	CCDS550.1	.	.	.	.	.	.	.	.	.	.	a	20.1	3.934136	0.73442	.	.	ENSG00000186790	ENST00000335071	D	0.95518	-3.73	3.45	3.45	0.39498	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.41097	U	0.000952	D	0.97467	0.9171	M	0.87328	2.875	0.54753	D	0.999982	D	0.71674	0.998	D	0.70487	0.969	D	0.97641	1.0148	10	0.62326	D	0.03	.	12.082	0.53675	1.0:0.0:0.0:0.0	.	143	Q13461	FOXE3_HUMAN	T	143	ENSP00000334472:N143T	ENSP00000334472:N143T	N	+	2	0	FOXE3	47655002	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.748000	0.55142	1.427000	0.47276	0.373000	0.22412	AAC	.		0.687	FOXE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021836.1	NM_012186	
BCAR3	8412	hgsc.bcm.edu	37	1	94054978	94054978	+	Splice_Site	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:94054978T>C	ENST00000370244.1	-	7	775		c.e7-2		RP5-1033H22.2_ENST00000427243.1_RNA|RP5-1033H22.2_ENST00000417401.1_RNA|BCAR3_ENST00000370243.1_Splice_Site|RP5-1033H22.2_ENST00000431770.1_RNA|BCAR3_ENST00000260502.6_Splice_Site|BCAR3_ENST00000370247.3_Splice_Site	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3						lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TTCAGACACCTTTGGGACAAA	0.483																																					.		.											.	BCAR3-228	0			c.487-2A>G						.						41.0	41.0	41.0					1																	94054978		2203	4300	6503	SO:0001630	splice_region_variant	8412	exon6			GACACCTTTGGGA	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.487-2A>G	1.37:g.94054978T>C		41	0		31	2	NM_003567	0	0	2	2	0	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Splice_Site	SNP	ENST00000370244.1	37	CCDS745.1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458136	0.26161	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7375	0.62827	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	BCAR3	93827566	1.000000	0.71417	0.996000	0.52242	0.119000	0.20118	7.280000	0.78610	2.052000	0.61016	0.533000	0.62120	.	.		0.483	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		Intron
SYPL2	284612	ucsc.edu	37	1	110022091	110022091	+	Missense_Mutation	SNP	A	A	G	rs201865079	byFrequency	TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:110022091A>G	ENST00000369872.3	+	6	956	c.740A>G	c.(739-741)gAc>gGc	p.D247G	SYPL2_ENST00000401021.3_Missense_Mutation_p.D183G	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	247					cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		cagggccaggaccaggaccag	0.602													A|||	11	0.00219649	0.0	0.0014	5008	,	,		16187	0.0		0.0	False		,,,				2504	0.0102				p.D247G													.	SYPL2-91	0			c.A740G						.	A	GLY/ASP	3,4047		0,3,2022	77.0	90.0	86.0		740	0.7	0.8	1		86	49,8357		0,49,4154	yes	missense	SYPL2	NM_001040709.1	94	0,52,6176	GG,GA,AA		0.5829,0.0741,0.4175	benign	247/273	110022091	52,12404	2025	4203	6228	SO:0001583	missense	284612	exon6			GCCAGGACCAGGA	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.740A>G	1.37:g.110022091A>G	ENSP00000358888:p.Asp247Gly	90	1		83	1	NM_001040709	0	0	18	24	6	A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Missense_Mutation	SNP	ENST00000369872.3	37	CCDS41365.1	14	0.00641025641025641	0	0.0	4	0.011049723756906077	0	0.0	10	0.013192612137203167	A	6.239	0.412302	0.11812	7.41E-4	0.005829	ENSG00000143028	ENST00000401021;ENST00000369872	T	0.30714	1.52	0.736	0.736	0.18307	.	1.039220	0.07570	N	0.918460	T	0.06371	0.0164	N	0.08118	0	0.22552	N	0.998991	P;P	0.43392	0.805;0.805	P;P	0.47134	0.539;0.539	T	0.14811	-1.0459	10	0.17832	T	0.49	.	3.6722	0.08279	1.0:0.0:0.0:0.0	.	183;247	B4DYR7;Q5VXT5	.;SYPL2_HUMAN	G	183;247	ENSP00000358888:D247G	ENSP00000358888:D247G	D	+	2	0	SYPL2	109823614	0.999000	0.42202	0.830000	0.32933	0.496000	0.33645	0.643000	0.24750	0.115000	0.18071	0.113000	0.15668	GAC	A|0.994;G|0.006		0.602	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1	NM_001006603	
PEA15	8682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	160181403	160181403	+	Silent	SNP	C	C	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:160181403C>A	ENST00000360472.4	+	2	257	c.69C>A	c.(67-69)ctC>ctA	p.L23L	PEA15_ENST00000368076.1_Silent_p.L44L|RP11-536C5.7_ENST00000418602.1_RNA|PEA15_ENST00000488858.1_3'UTR|PEA15_ENST00000368077.1_Silent_p.L23L	NM_003768.3	NP_003759.1	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15	23	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|DNA damage checkpoint (GO:0000077)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of glucose import (GO:0046325)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|response to morphine (GO:0043278)|transport (GO:0006810)	cytoplasm (GO:0005737)|microtubule associated complex (GO:0005875)				large_intestine(1)|lung(4)	5	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TAGAACAGCTCAAGTCGGCCT	0.542																																					p.L23L		.											.	PEA15-658	0			c.C69A						.						135.0	112.0	120.0					1																	160181403		2203	4300	6503	SO:0001819	synonymous_variant	8682	exon2			ACAGCTCAAGTCG	Y13736	CCDS1199.1, CCDS72954.1	1q21.1	2008-07-18			ENSG00000162734	ENSG00000162734			8822	protein-coding gene	gene with protein product	"""Phosphoprotein enriched in astrocytes, 15kD"", ""homolog of mouse MAT-1 oncogene"""	603434				9205133	Standard	XM_005245564		Approved	HMAT1, MAT1, PED, PEA-15, MAT1H, HUMMAT1H	uc001fvk.3	Q15121	OTTHUMG00000031605	ENST00000360472.4:c.69C>A	1.37:g.160181403C>A		131	0		100	16	NM_003768	0	0	87	106	19	B1AKZ3|O00511	Silent	SNP	ENST00000360472.4	37	CCDS1199.1																																																																																			.		0.542	PEA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077407.1	NM_003768	
DENND1B	163486	hgsc.bcm.edu	37	1	197684159	197684159	+	Splice_Site	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:197684159A>G	ENST00000367396.3	-	3	296		c.e3+1		DENND1B_ENST00000400967.2_Splice_Site|DENND1B_ENST00000235453.4_Splice_Site	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						tGTGGTACCAACCTGGTCTCC	0.328																																					.		.											.	DENND1B-44	0			c.126+2T>C						.						56.0	54.0	55.0					1																	197684159		1808	4072	5880	SO:0001630	splice_region_variant	163486	exon4			GTACCAACCTGGT	BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.126+1T>C	1.37:g.197684159A>G		32	0		30	2	NM_001195215	0	0	0	0	0	B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Splice_Site	SNP	ENST00000367396.3	37	CCDS41452.2	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785719	0.70337	.	.	ENSG00000213047	ENST00000542760;ENST00000450419;ENST00000235453;ENST00000367396;ENST00000400967	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3422	0.66636	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND1B	195950782	1.000000	0.71417	0.999000	0.59377	0.838000	0.47535	7.530000	0.81962	2.185000	0.69588	0.455000	0.32223	.	.		0.328	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086539.1	NM_144977	Intron
VIM	7431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17276732	17276732	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr10:17276732C>G	ENST00000224237.5	+	5	1068	c.923C>G	c.(922-924)gCc>gGc	p.A308G	VIM_ENST00000544301.1_Missense_Mutation_p.A308G|RP11-124N14.3_ENST00000456355.1_RNA			P08670	VIME_HUMAN	vimentin	308	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AACAATGACGCCCTGCGCCAG	0.512																																					p.A308G		.											.	VIM-291	0			c.C923G						.						94.0	89.0	91.0					10																	17276732		2203	4300	6503	SO:0001583	missense	7431	exon6			ATGACGCCCTGCG	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.923C>G	10.37:g.17276732C>G	ENSP00000224237:p.Ala308Gly	134	0		116	17	NM_003380	3	3	2221	2592	365	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627666	0.87560	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	D;D;D	0.89681	-2.55;-2.55;-2.55	6.05	6.05	0.98169	Filament (1);	0.000000	0.46442	D	0.000298	D	0.95439	0.8519	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.69078	0.989;0.985;0.995;0.997	P;P;D;D	0.69479	0.897;0.902;0.941;0.964	D	0.92981	0.6406	10	0.18710	T	0.47	.	20.6031	0.99464	0.0:1.0:0.0:0.0	.	295;295;308;308	F5H288;B3KRK8;B0YJC4;P08670	.;.;.;VIME_HUMAN	G	308;308;295;134	ENSP00000446007:A308G;ENSP00000224237:A308G;ENSP00000391842:A134G	ENSP00000224237:A308G	A	+	2	0	VIM	17316738	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	7.811000	0.86092	2.881000	0.98747	0.637000	0.83480	GCC	.		0.512	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
C11orf49	79096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47074069	47074069	+	Splice_Site	SNP	G	G	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:47074069G>T	ENST00000278460.7	+	3	339	c.280G>T	c.(280-282)Gat>Tat	p.D94Y	C11orf49_ENST00000378618.2_Splice_Site_p.D94Y|C11orf49_ENST00000378615.3_Splice_Site_p.D94Y|C11orf49_ENST00000543718.1_Intron|C11orf49_ENST00000395460.2_Splice_Site_p.D94Y|C11orf49_ENST00000536126.1_5'UTR|C11orf49_ENST00000527268.1_3'UTR	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	94						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						CAAAAATGGCGGTAAGTCTTC	0.463																																					p.D94Y		.											.	C11orf49-90	0			c.G280T						.						101.0	102.0	102.0					11																	47074069		2201	4299	6500	SO:0001630	splice_region_variant	79096	exon3			AATGGCGGTAAGT	AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.280+1G>T	11.37:g.47074069G>T		82	0		102	47	NM_001003677	0	0	0	0	0	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	ENST00000278460.7	37	CCDS7925.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879678	0.91740	.	.	ENSG00000149179	ENST00000278460;ENST00000378618;ENST00000395460;ENST00000378615;ENST00000526827	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	6.03	6.03	0.97812	.	0.097269	0.64402	D	0.000002	T	0.55289	0.1911	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.977;0.977	T	0.54351	-0.8307	10	0.87932	D	0	-17.2898	20.5568	0.99304	0.0:0.0:1.0:0.0	.	94;94;94	E9PAX7;Q9H6J7-2;Q9H6J7	.;.;CK049_HUMAN	Y	94;94;94;94;20	ENSP00000278460:D94Y;ENSP00000367881:D94Y;ENSP00000378844:D94Y;ENSP00000367878:D94Y;ENSP00000433707:D20Y	ENSP00000278460:D94Y	D	+	1	0	C11orf49	47030645	1.000000	0.71417	0.986000	0.45419	0.971000	0.66376	8.948000	0.93006	2.861000	0.98227	0.655000	0.94253	GAT	.		0.463	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391218.1	NM_024113	Missense_Mutation
ANKRD13D	338692	hgsc.bcm.edu;bcgsc.ca	37	11	67059495	67059495	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:67059495A>G	ENST00000447274.2	+	6	1489	c.314A>G	c.(313-315)gAc>gGc	p.D105G	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.D192G|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.D105G|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.D105G			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	105						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GTGGACCATGACCGGCAGGTG	0.672																																					p.D192G		.											.	ANKRD13D-91	0			c.A575G						.						36.0	38.0	37.0					11																	67059495		2200	4294	6494	SO:0001583	missense	338692	exon6			ACCATGACCGGCA	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.314A>G	11.37:g.67059495A>G	ENSP00000402616:p.Asp105Gly	101	0		57	4	NM_207354	1	0	28	30	1	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37		.	.	.	.	.	.	.	.	.	.	A	24.6	4.554741	0.86231	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	3.9	3.9	0.45041	.	0.074445	0.52532	D	0.000070	T	0.63462	0.2513	M	0.80183	2.485	0.58432	D	0.999999	D;P	0.89917	1.0;0.624	D;P	0.75484	0.986;0.525	T	0.66736	-0.5848	10	0.48119	T	0.1	-35.5096	12.1809	0.54211	1.0:0.0:0.0:0.0	.	192;105	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	G	105;192;105;105	ENSP00000402616:D105G;ENSP00000427130:D192G;ENSP00000310874:D105G;ENSP00000444404:D105G	ENSP00000310874:D105G	D	+	2	0	ANKRD13D	66816071	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.912000	0.92726	1.785000	0.52413	0.459000	0.35465	GAC	.		0.672	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	73020470	73020470	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:73020470G>A	ENST00000263674.3	+	1	1137	c.787G>A	c.(787-789)Gga>Aga	p.G263R	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	263					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCAGCTGCCTGGAGCCCAGAG	0.721																																					p.G263R		.											.	ARHGEF17-227	0			c.G787A						.						10.0	14.0	13.0					11																	73020470		2079	4096	6175	SO:0001583	missense	9828	exon1			CTGCCTGGAGCCC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.787G>A	11.37:g.73020470G>A	ENSP00000263674:p.Gly263Arg	47	0		44	23	NM_014786	0	0	9	19	10	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654144	0.29425	.	.	ENSG00000110237	ENST00000263674	T	0.64260	-0.09	4.85	0.091	0.14466	.	0.445825	0.16707	N	0.202865	T	0.43656	0.1257	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39251	-0.9623	10	0.87932	D	0	-19.5376	8.2312	0.31599	0.1586:0.385:0.4564:0.0	.	263	Q96PE2	ARHGH_HUMAN	R	263	ENSP00000263674:G263R	ENSP00000263674:G263R	G	+	1	0	ARHGEF17	72698118	0.001000	0.12720	0.001000	0.08648	0.237000	0.25408	0.062000	0.14389	0.096000	0.17463	-0.502000	0.04539	GGA	.		0.721	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	76890090	76890090	+	Splice_Site	SNP	G	G	T	rs397516295		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:76890090G>T	ENST00000409709.3	+	20	2554		c.e20-1		MYO7A_ENST00000409619.2_Splice_Site|MYO7A_ENST00000458637.2_Splice_Site|MYO7A_ENST00000409893.1_Splice_Site	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGCTGTTTCAGGTCTAACTTT	0.587																																					.		.											.	MYO7A-138	0			c.2283-1G>T	GRCh37	CS064428	MYO7A	S		.						34.0	38.0	37.0					11																	76890090		2134	4237	6371	SO:0001630	splice_region_variant	4647	exon20			GTTTCAGGTCTAA	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2283-1G>T	11.37:g.76890090G>T		21	0		18	9	NM_001127179	0	0	0	0	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Splice_Site	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569249	0.28003	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	.	.	.	4.24	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5355	0.84372	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO7A	76567738	1.000000	0.71417	0.998000	0.56505	0.147000	0.21601	7.778000	0.85637	2.319000	0.78375	0.289000	0.19496	.	.		0.587	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	Intron
MED17	9440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	93542943	93542943	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:93542943C>A	ENST00000251871.3	+	11	1932	c.1645C>A	c.(1645-1647)Ctg>Atg	p.L549M	MED17_ENST00000533367.1_3'UTR	NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	549					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTGGCAAGTACTGAGCTTCAG	0.493																																					p.L549M		.											.	MED17-187	0			c.C1645A						.						233.0	193.0	206.0					11																	93542943		2201	4298	6499	SO:0001583	missense	9440	exon11			CAAGTACTGAGCT	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.1645C>A	11.37:g.93542943C>A	ENSP00000251871:p.Leu549Met	189	0		163	71	NM_004268	0	0	24	47	23	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	37	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	C	31	5.067027	0.93898	.	.	ENSG00000042429	ENST00000251871;ENST00000427225	T	0.64991	-0.13	5.65	5.65	0.86999	.	0.063209	0.64402	D	0.000003	T	0.79040	0.4379	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.79424	-0.1809	10	0.72032	D	0.01	-15.3186	20.0822	0.97779	0.0:1.0:0.0:0.0	.	549	Q9NVC6	MED17_HUMAN	M	549;519	ENSP00000251871:L549M	ENSP00000251871:L549M	L	+	1	2	MED17	93182591	1.000000	0.71417	0.719000	0.30619	0.979000	0.70002	4.846000	0.62860	2.826000	0.97356	0.563000	0.77884	CTG	.		0.493	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
VPS26B	112936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	134115448	134115448	+	Silent	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:134115448C>T	ENST00000281187.5	+	6	1453	c.975C>T	c.(973-975)acC>acT	p.T325T	VPS26B_ENST00000525095.2_Silent_p.T325T	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	325					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		AGGTGCGGACCCCCAGCCAGC	0.652																																					p.T325T	Colon(171;1263 1952 15904 45703 47982)	.											.	VPS26B-90	0			c.C975T						.						44.0	37.0	39.0					11																	134115448		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon6			GCGGACCCCCAGC		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.975C>T	11.37:g.134115448C>T		37	0		32	18	NM_052875	0	0	11	21	10	Q96A55	Silent	SNP	ENST00000281187.5	37	CCDS8495.1																																																																																			.		0.652	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1	NM_052875	
RPAP3	79657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48080648	48080648	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr12:48080648C>T	ENST00000005386.3	-	9	1022	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K	RPAP3_ENST00000432584.3_Missense_Mutation_p.E144K|RPAP3_ENST00000380650.4_Missense_Mutation_p.E303K	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	303										endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					GTATAGCATTCAATTGCTCTT	0.353																																					p.E303K		.											.	RPAP3-69	0			c.G907A						.						154.0	140.0	145.0					12																	48080648		2203	4300	6503	SO:0001583	missense	79657	exon9			AGCATTCAATTGC	AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.907G>A	12.37:g.48080648C>T	ENSP00000005386:p.Glu303Lys	86	1		79	45	NM_024604	0	0	9	19	10	B4DRW9|Q6PHR5	Missense_Mutation	SNP	ENST00000005386.3	37	CCDS8753.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998449	0.93227	.	.	ENSG00000005175	ENST00000005386;ENST00000432584;ENST00000380650	T;T;T	0.61274	0.12;0.12;0.12	4.71	4.71	0.59529	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.254766	0.44688	D	0.000421	T	0.60663	0.2286	L	0.35341	1.055	0.58432	D	0.999998	D;D	0.61697	0.99;0.98	P;P	0.60173	0.794;0.87	T	0.52320	-0.8591	10	0.10636	T	0.68	.	17.52	0.87784	0.0:1.0:0.0:0.0	.	303;303	Q9H6T3-2;Q9H6T3	.;RPAP3_HUMAN	K	303;144;303	ENSP00000005386:E303K;ENSP00000401823:E144K;ENSP00000370024:E303K	ENSP00000005386:E303K	E	-	1	0	RPAP3	46366915	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.309000	0.78937	2.554000	0.86153	0.555000	0.69702	GAA	.		0.353	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405340.1	NM_024604	
PLA2G4F	255189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42442584	42442584	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr15:42442584A>G	ENST00000382396.4	-	9	958	c.872T>C	c.(871-873)gTg>gCg	p.V291A	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.V291A			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	291					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCCCAGGGCCACAGAACACTG	0.652																																					p.V291A		.											.	PLA2G4F-94	0			c.T872C						.						22.0	23.0	22.0					15																	42442584		2203	4299	6502	SO:0001583	missense	255189	exon9			AGGGCCACAGAAC		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.872T>C	15.37:g.42442584A>G	ENSP00000371833:p.Val291Ala	31	0		29	15	NM_213600	0	0	0	0	0	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.632244	0.29068	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.01560	4.77;4.82	4.88	4.88	0.63580	Lysophospholipase, catalytic domain (1);	0.320592	0.21644	N	0.071298	T	0.02848	0.0085	M	0.64404	1.975	0.31744	N	0.635362	P;P	0.46395	0.877;0.877	B;B	0.38106	0.265;0.197	T	0.12142	-1.0559	10	0.72032	D	0.01	-9.9511	11.1909	0.48685	1.0:0.0:0.0:0.0	.	78;291	A2RRC4;Q68DD2	.;PA24F_HUMAN	A	287;291;291;291;291	ENSP00000380442:V291A;ENSP00000371833:V291A	ENSP00000290497:V287A	V	-	2	0	PLA2G4F	40229876	0.055000	0.20627	0.840000	0.33206	0.044000	0.14063	4.335000	0.59298	1.982000	0.57802	0.533000	0.62120	GTG	.		0.652	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
TICRR	90381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	90129030	90129030	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr15:90129030G>A	ENST00000268138.7	+	4	1373	c.1268G>A	c.(1267-1269)cGc>cAc	p.R423H	RP11-429B14.1_ENST00000559041.1_RNA|TICRR_ENST00000560985.1_Missense_Mutation_p.R422H			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	423					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										ACTGTGTGCCGCACCAAGGAG	0.542																																					p.R423H		.											.	.	0			c.G1268A						.						86.0	88.0	87.0					15																	90129030		1978	4151	6129	SO:0001583	missense	90381	exon4			TGTGCCGCACCAA	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1268G>A	15.37:g.90129030G>A	ENSP00000268138:p.Arg423His	90	0		68	6	NM_152259	0	0	0	0	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	g	3.132	-0.178303	0.06380	.	.	ENSG00000140534	ENST00000268138	T	0.13901	2.55	5.24	-2.38	0.06622	.	0.846013	0.11198	N	0.589141	T	0.08447	0.0210	L	0.27053	0.805	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.28964	-1.0027	10	0.46703	T	0.11	0.7395	7.3452	0.26660	0.4494:0.1087:0.4419:0.0	.	423	Q7Z2Z1	TICRR_HUMAN	H	423	ENSP00000268138:R423H	ENSP00000268138:R423H	R	+	2	0	C15orf42	87930034	0.000000	0.05858	0.005000	0.12908	0.010000	0.07245	-0.060000	0.11712	-0.695000	0.05105	-0.150000	0.13652	CGC	.		0.542	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
PKD1	5310	ucsc.edu	37	16	2168072	2168072	+	Silent	SNP	G	G	A	rs554071267		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr16:2168072G>A	ENST00000262304.4	-	5	1129	c.921C>T	c.(919-921)ttC>ttT	p.F307F	RP11-304L19.2_ENST00000562027.1_RNA|PKD1_ENST00000423118.1_Silent_p.F307F	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	307	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGCCGTCTCCGAAGTCCCAGC	0.716													g|||	1	0.000199681	0.0	0.0	5008	,	,		14557	0.0		0.0	False		,,,				2504	0.001				p.F307F													.	PKD1-91	0			c.C921T						.						5.0	7.0	7.0					16																	2168072		2005	4072	6077	SO:0001819	synonymous_variant	5310	exon5			GTCTCCGAAGTCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.921C>T	16.37:g.2168072G>A		37	0		26	2	NM_000296	0	0	4	4	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
KPNB1	3837	broad.mit.edu	37	17	45727756	45727756	+	Silent	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr17:45727756G>A	ENST00000290158.4	+	2	452	c.45G>A	c.(43-45)cgG>cgA	p.R15R	RP11-580I16.2_ENST00000580045.1_RNA|RP11-580I16.2_ENST00000582389.1_RNA|KPNB1_ENST00000540627.1_5'Flank|RP11-580I16.2_ENST00000584391.1_RNA|KPNB1_ENST00000577918.1_3'UTR|KPNB1_ENST00000535458.2_Intron	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	15					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						CCCTAGATCGGCTGGAGCTGG	0.716																																					p.G15G													.	KPNB1-229	0			c.A45A						.						16.0	18.0	17.0					17																	45727756		2203	4299	6502	SO:0001819	synonymous_variant	3837	exon2			AGATCGGCTGGAG	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.45G>A	17.37:g.45727756G>A		33	0		43	3	NM_002265	0	0	1	1	0	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Silent	SNP	ENST00000290158.4	37	CCDS11513.1																																																																																			.		0.716	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265	
APCDD1	147495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	10487950	10487950	+	Missense_Mutation	SNP	G	G	A	rs112875590		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr18:10487950G>A	ENST00000355285.5	+	5	1814	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q		NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CTGTATGGCCGGGCCCCTGGG	0.592													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15602	0.0		0.0	False		,,,				2504	0.0				p.R487Q		.											.	APCDD1-90	0			c.G1460A						.	G	GLN/ARG	3,4399	6.2+/-15.9	0,3,2198	50.0	57.0	55.0		1460	0.4	0.0	18	dbSNP_132	55	0,8600		0,0,4300	yes	missense	APCDD1	NM_153000.4	43	0,3,6498	AA,AG,GG		0.0,0.0682,0.0231	benign	487/515	10487950	3,12999	2201	4300	6501	SO:0001583	missense	147495	exon5			ATGGCCGGGCCCC	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1460G>A	18.37:g.10487950G>A	ENSP00000347433:p.Arg487Gln	152	1		149	44	NM_153000	1	0	6	7	0		Missense_Mutation	SNP	ENST00000355285.5	37	CCDS11849.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.83	1.755053	0.31046	6.82E-4	0.0	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.36699	1.24	5.32	0.44	0.16572	.	1.125910	0.06382	N	0.715392	T	0.30823	0.0777	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26815	-1.0092	10	0.37606	T	0.19	-4.4675	5.3468	0.16014	0.2761:0.2485:0.4753:0.0	.	487	Q8J025	APCD1_HUMAN	Q	487;538	ENSP00000347433:R487Q	ENSP00000347433:R487Q	R	+	2	0	APCDD1	10477950	0.001000	0.12720	0.003000	0.11579	0.069000	0.16628	0.165000	0.16564	-0.217000	0.10033	0.563000	0.77884	CGG	G|0.999;A|0.001		0.592	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
DSG4	147409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	28980927	28980927	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr18:28980927A>T	ENST00000308128.4	+	10	1496	c.1361A>T	c.(1360-1362)aAg>aTg	p.K454M	DSG4_ENST00000359747.4_Missense_Mutation_p.K454M|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GAATTTGATAAGAAGTCAAAA	0.289																																					p.K454M		.											.	DSG4-177	0			c.A1361T						.						43.0	48.0	47.0					18																	28980927		2199	4283	6482	SO:0001583	missense	147409	exon10			TTGATAAGAAGTC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1361A>T	18.37:g.28980927A>T	ENSP00000311859:p.Lys454Met	77	0		78	37	NM_001134453	0	0	0	0	0	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710083	0.30322	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.52754	0.65;0.65	5.24	-7.62	0.01294	Cadherin (4);Cadherin-like (1);	1.092760	0.07279	N	0.870439	T	0.14657	0.0354	N	0.01188	-0.97	0.21740	N	0.999565	B;B	0.18013	0.025;0.003	B;B	0.19666	0.025;0.026	T	0.23226	-1.0194	10	0.62326	D	0.03	.	2.8038	0.05422	0.1395:0.4432:0.1978:0.2195	.	454;454	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	M	454	ENSP00000311859:K454M;ENSP00000352785:K454M	ENSP00000311859:K454M	K	+	2	0	DSG4	27234925	0.528000	0.26314	0.657000	0.29651	0.818000	0.46254	0.238000	0.18004	-1.023000	0.03342	-2.955000	0.00083	AAG	.		0.289	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
WDR18	57418	hgsc.bcm.edu;broad.mit.edu	37	19	992048	992048	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:992048A>G	ENST00000251289.5	+	8	1048	c.1025A>G	c.(1024-1026)cAc>cGc	p.H342R	WDR18_ENST00000587001.2_Missense_Mutation_p.H342R	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	342					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCAACAAGCACCTGCTGGGC	0.716																																					p.H342R		.											.	WDR18-91	0			c.A1025G						.						9.0	10.0	9.0					19																	992048		2129	4155	6284	SO:0001583	missense	57418	exon8			ACAAGCACCTGCT		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.1025A>G	19.37:g.992048A>G	ENSP00000251289:p.His342Arg	9	0		27	16	NM_024100	1	0	37	65	27	O60390|Q9BWR2	Missense_Mutation	SNP	ENST00000251289.5	37	CCDS12051.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692269	0.30052	.	.	ENSG00000065268	ENST00000251289	T	0.69435	-0.4	4.28	4.28	0.50868	.	0.056115	0.64402	D	0.000001	T	0.60843	0.2300	M	0.63843	1.955	0.44798	D	0.997803	P	0.50272	0.933	B	0.44108	0.441	T	0.62020	-0.6942	10	0.06757	T	0.87	.	12.3826	0.55315	1.0:0.0:0.0:0.0	.	342	Q9BV38	WDR18_HUMAN	R	342	ENSP00000251289:H342R	ENSP00000251289:H342R	H	+	2	0	WDR18	943048	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	5.202000	0.65169	1.806000	0.52798	0.402000	0.26972	CAC	.		0.716	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
NDUFA11	126328	ucsc.edu	37	19	5897010	5897010	+	Splice_Site	SNP	T	T	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:5897010T>A	ENST00000308961.4	-	2	145		c.e2-2		FUT5_ENST00000252675.5_Splice_Site|AC104532.3_ENST00000589277.1_RNA|AC024592.12_ENST00000586349.1_Splice_Site|NDUFA11_ENST00000418389.2_Splice_Site|AC104532.3_ENST00000590441.1_RNA|NDUFA11_ENST00000592634.1_Splice_Site	NM_175614.4	NP_783313.1	Q86Y39	NDUAB_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa						cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(1)	2						CGGTCAGGCCTGCGAGACAGA	0.612																																					.													.	NDUFA11-90	0			c.98-2A>T						.						118.0	102.0	108.0					19																	5897010		2203	4300	6503	SO:0001630	splice_region_variant	126328	exon3			CAGGCCTGCGAGA	AJ539081	CCDS12155.1, CCDS54203.1	19p13.3	2011-07-04				ENSG00000174886		"""Mitochondrial respiratory chain complex / Complex I"""	20371	protein-coding gene	gene with protein product	"""complex I B14.7 subunit"""	612638				12381726	Standard	NM_001193375		Approved	B14.7	uc002mdp.2	Q86Y39		ENST00000308961.4:c.98-2A>T	19.37:g.5897010T>A		129	0		102	1	NM_001193375	0	0	0	0	0	C9JT23|Q6ZS66	Splice_Site	SNP	ENST00000308961.4	37	CCDS12155.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620763	0.46736	.	.	ENSG00000174886	ENST00000418389;ENST00000308961	.	.	.	3.96	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5079	0.39058	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NDUFA11	5848010	0.976000	0.34144	0.906000	0.35671	0.227000	0.25037	2.368000	0.44222	1.583000	0.49898	0.334000	0.21626	.	.		0.612	NDUFA11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452218.1	NM_175614	Intron
TSHZ3	57616	hgsc.bcm.edu	37	19	31770237	31770237	+	Silent	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:31770237A>G	ENST00000240587.4	-	2	789	c.462T>C	c.(460-462)agT>agC	p.S154S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	154	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					tgctgctgctactgctgctgc	0.607																																					p.S154S		.											.	TSHZ3-232	0			c.T462C						.						39.0	44.0	42.0					19																	31770237		2184	4294	6478	SO:0001819	synonymous_variant	57616	exon2			GCTGCTACTGCTG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.462T>C	19.37:g.31770237A>G		35	0		29	2	NM_020856	4	2	33	6569	6530	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.		0.607	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
AKT2	208	hgsc.bcm.edu	37	19	40743950	40743950	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:40743950G>A	ENST00000392038.2	-	9	1055	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W	AKT2_ENST00000424901.1_Missense_Mutation_p.R253W|AKT2_ENST00000311278.6_Missense_Mutation_p.R253W|AKT2_ENST00000579047.1_Missense_Mutation_p.R191W	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CCATAAAACCGGGCCCGCTCC	0.622			A		"""ovarian, pancreatic """																																p.R253W		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2-978	0			c.C757T						.						105.0	80.0	88.0					19																	40743950		2203	4300	6503	SO:0001583	missense	208	exon9			AAAACCGGGCCCG	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.757C>T	19.37:g.40743950G>A	ENSP00000375892:p.Arg253Trp	26	0		27	2	NM_001626	0	0	228	242	14	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818854	0.90873	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.27104	1.69;1.69;1.69	4.7	3.66	0.41972	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	T	0.57596	-0.7784	10	0.87932	D	0	.	12.1535	0.54064	0.0852:0.0:0.9148:0.0	.	191;253;253	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	W	253;154;253;253;73	ENSP00000375892:R253W;ENSP00000399532:R253W;ENSP00000309428:R253W	ENSP00000309428:R253W	R	-	1	2	AKT2	45435790	1.000000	0.71417	0.925000	0.36789	0.991000	0.79684	7.677000	0.84024	1.342000	0.45619	0.655000	0.94253	CGG	.		0.622	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
KLK7	5650	hgsc.bcm.edu	37	19	51485616	51485616	+	Missense_Mutation	SNP	G	G	C	rs372381913		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:51485616G>C	ENST00000391807.1	-	2	141	c.40C>G	c.(40-42)Cta>Gta	p.L14V	CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000595638.1_5'UTR|KLK7_ENST00000597707.1_Intron|KLK7_ENST00000336317.4_5'UTR|KLK7_ENST00000595820.1_Missense_Mutation_p.L14V	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	14					epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		GCTAAGGATAGCAGTAAGATC	0.607																																					p.A56G		.											.	KLK7-650	0			c.C167G						.						62.0	47.0	52.0					19																	51485616		2203	4298	6501	SO:0001583	missense	5650	exon2			AGGATAGCAGTAA	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.40C>G	19.37:g.51485616G>C	ENSP00000375683:p.Leu14Val	16	2		9	3	NM_001243126	0	0	0	0	0	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	g	6.488	0.458260	0.12342	.	.	ENSG00000169035	ENST00000304045;ENST00000391807	D	0.92965	-3.14	2.77	1.72	0.24424	.	.	.	.	.	D	0.89880	0.6843	N	0.20483	0.58	0.21933	N	0.999467	D	0.63880	0.993	D	0.73708	0.981	T	0.79741	-0.1676	9	0.22109	T	0.4	.	5.6632	0.17680	0.1529:0.0:0.8471:0.0	.	14	P49862	KLK7_HUMAN	V	14	ENSP00000375683:L14V	ENSP00000304791:L14V	L	-	1	2	KLK7	56177428	0.779000	0.28652	0.175000	0.22980	0.024000	0.10985	1.316000	0.33620	0.749000	0.32854	0.645000	0.84053	CTA	.		0.607	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046	
NLRP5	126206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56511120	56511120	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:56511120G>A	ENST00000390649.3	+	1	29	c.29G>A	c.(28-30)gGa>gAa	p.G10E		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	10					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		cttgaacttggagctgcTGCT	0.517																																					p.G10E		.											.	NLRP5-162	0			c.G29A						.						208.0	212.0	210.0					19																	56511120		2101	4218	6319	SO:0001583	missense	126206	exon1			AACTTGGAGCTGC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.29G>A	19.37:g.56511120G>A	ENSP00000375063:p.Gly10Glu	241	0		234	35	NM_153447	0	0	0	0	0	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	7.564	0.665223	0.14710	.	.	ENSG00000171487	ENST00000390649	T	0.74106	-0.81	0.492	0.492	0.16872	.	.	.	.	.	T	0.68860	0.3047	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.59215	-0.7496	8	0.87932	D	0	.	.	.	.	.	10	P59047	NALP5_HUMAN	E	10	ENSP00000375063:G10E	ENSP00000375063:G10E	G	+	2	0	NLRP5	61202932	0.005000	0.15991	0.037000	0.18230	0.032000	0.12392	-0.354000	0.07681	0.528000	0.28580	0.298000	0.19748	GGA	.		0.517	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
APOB	338	bcgsc.ca	37	2	21232458	21232458	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr2:21232458T>G	ENST00000233242.1	-	26	7409	c.7282A>C	c.(7282-7284)Aag>Cag	p.K2428Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2428					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAAATGACTTTAATTTCTTT	0.338																																					p.K2428Q													.	APOB-175	0			c.A7282C						.						76.0	74.0	75.0					2																	21232458		2203	4300	6503	SO:0001583	missense	338	exon26			ATGACTTTAATTT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7282A>C	2.37:g.21232458T>G	ENSP00000233242:p.Lys2428Gln	108	0		107	4	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	11.80	1.746669	0.30955	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00976	5.48	5.49	1.64	0.23874	.	0.368885	0.23635	N	0.046088	T	0.01061	0.0035	L	0.43152	1.355	0.09310	N	0.999995	B	0.17038	0.02	B	0.13407	0.009	T	0.44590	-0.9318	10	0.44086	T	0.13	.	8.4238	0.32716	0.0:0.0716:0.2644:0.664	.	2428	P04114	APOB_HUMAN	Q	2428	ENSP00000233242:K2428Q	ENSP00000233242:K2428Q	K	-	1	0	APOB	21085963	0.794000	0.28838	0.972000	0.41901	0.981000	0.71138	2.774000	0.47694	0.870000	0.35726	0.459000	0.35465	AAG	.		0.338	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
PROM2	150696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95941238	95941238	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr2:95941238G>A	ENST00000317620.9	+	2	407	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	PROM2_ENST00000403131.2_Missense_Mutation_p.A92T|PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000542147.1_Missense_Mutation_p.A92T|PROM2_ENST00000317668.4_Missense_Mutation_p.A92T	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	92					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GAATGAGCTGGCCTCCGTGAA	0.602																																					p.A92T		.											.	PROM2-91	0			c.G274A						.						99.0	87.0	91.0					2																	95941238		2203	4300	6503	SO:0001583	missense	150696	exon2			GAGCTGGCCTCCG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.274G>A	2.37:g.95941238G>A	ENSP00000318270:p.Ala92Thr	88	0		82	27	NM_001165977	0	0	0	0	0	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194115	0.38707	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.57	-4.2	0.03823	.	1.178410	0.06360	N	0.711489	T	0.34077	0.0885	L	0.44542	1.39	0.09310	N	1	P	0.43578	0.811	B	0.40602	0.334	T	0.37079	-0.9721	10	0.14252	T	0.57	-1.8729	15.0393	0.71777	0.0:0.0:0.1886:0.8114	.	92	Q8N271	PROM2_HUMAN	T	92	ENSP00000385716:A92T;ENSP00000318520:A92T;ENSP00000318270:A92T;ENSP00000442542:A92T	ENSP00000318270:A92T	A	+	1	0	PROM2	95304965	0.000000	0.05858	0.001000	0.08648	0.580000	0.36256	-2.235000	0.01202	-0.468000	0.06922	0.462000	0.41574	GCC	.		0.602	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
ATG16L1	55054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234173559	234173559	+	Silent	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr2:234173559T>C	ENST00000392017.4	+	5	668	c.411T>C	c.(409-411)acT>acC	p.T137T	ATG16L1_ENST00000392020.4_Silent_p.T137T|ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392018.1_Silent_p.T137T|ATG16L1_ENST00000347464.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	137					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GTTTGCAGACTATCTCTGACC	0.527																																					p.T137T		.											.	ATG16L1-90	0			c.T411C						.						109.0	97.0	101.0					2																	234173559		2203	4300	6503	SO:0001819	synonymous_variant	55054	exon5			GCAGACTATCTCT	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.411T>C	2.37:g.234173559T>C		129	0		114	38	NM_017974	0	0	17	25	8	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Silent	SNP	ENST00000392017.4	37	CCDS2503.2																																																																																			.		0.527	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
DZANK1	55184	hgsc.bcm.edu	37	20	18435935	18435935	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr20:18435935G>C	ENST00000358866.6	-	3	356	c.334C>G	c.(334-336)Cct>Gct	p.P112A	DZANK1_ENST00000357236.4_5'UTR|DZANK1_ENST00000262547.5_Missense_Mutation_p.P112A|DZANK1_ENST00000487128.1_5'Flank|DZANK1_ENST00000329494.5_Missense_Mutation_p.P112A			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	112							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TTGTCTTCAGGAGAGACTATA	0.353																																					p.P112A		.											.	.	0			c.C334G						.						118.0	107.0	110.0					20																	18435935		1877	4108	5985	SO:0001583	missense	55184	exon4			CTTCAGGAGAGAC	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.334C>G	20.37:g.18435935G>C	ENSP00000351734:p.Pro112Ala	18	0		25	2	NM_001099407	0	0	6	6	0	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	ENST00000358866.6	37	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.212554	0.00289	.	.	ENSG00000089091	ENST00000262547;ENST00000329494	T;T	0.62498	0.02;0.71	5.82	2.33	0.28932	.	0.424852	0.22007	U	0.065935	T	0.37265	0.0997	N	0.14661	0.345	0.09310	N	0.999996	B;B	0.15473	0.013;0.013	B;B	0.13407	0.009;0.009	T	0.14811	-1.0459	10	0.22109	T	0.4	-0.7175	4.7495	0.13054	0.7013:0.0:0.1593:0.1394	.	112;112	B7Z631;Q9NVP4	.;DZAN1_HUMAN	A	112	ENSP00000262547:P112A;ENSP00000328866:P112A	ENSP00000262547:P112A	P	-	1	0	C20orf12	18383935	0.321000	0.24625	0.014000	0.15608	0.019000	0.09904	0.431000	0.21444	0.127000	0.18452	-1.284000	0.01376	CCT	.		0.353	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
SLC19A1	6573	hgsc.bcm.edu	37	21	46935688	46935688	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr21:46935688A>G	ENST00000311124.4	-	6	1812	c.1660T>C	c.(1660-1662)Tca>Cca	p.S554P	SLC19A1_ENST00000380010.4_Intron|SLC19A1_ENST00000485649.2_Missense_Mutation_p.S514P|SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000567670.1_Intron	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	554					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	TCAGGGCCTGAGGCTTGGGCG	0.637																																					p.S554P		.											.	SLC19A1-90	0			c.T1660C						.						44.0	44.0	44.0					21																	46935688		2203	4300	6503	SO:0001583	missense	6573	exon6			GGCCTGAGGCTTG	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.1660T>C	21.37:g.46935688A>G	ENSP00000308895:p.Ser554Pro	65	0		57	4	NM_194255	0	0	14	14	0	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000311124.4	37	CCDS13725.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.430071	0.43122	.	.	ENSG00000173638	ENST00000311124;ENST00000485649	D;D	0.84944	-1.91;-1.92	2.86	-2.08	0.07254	.	.	.	.	.	T	0.64713	0.2623	N	0.19112	0.55	0.09310	N	1	P;P	0.42078	0.77;0.77	B;B	0.32090	0.14;0.14	T	0.59700	-0.7405	9	0.87932	D	0	.	0.6492	0.00823	0.4614:0.2055:0.1326:0.2004	.	514;554	B7Z8C3;P41440	.;S19A1_HUMAN	P	554;514	ENSP00000308895:S554P;ENSP00000441772:S514P	ENSP00000308895:S554P	S	-	1	0	SLC19A1	45760116	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	-0.670000	0.05256	-0.524000	0.06400	-0.456000	0.05471	TCA	.		0.637	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1		
TNXB	7148	hgsc.bcm.edu	37	6	32023635	32023635	+	Silent	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr6:32023635A>G	ENST00000375244.3	-	24	8661	c.8460T>C	c.(8458-8460)ggT>ggC	p.G2820G	TNXB_ENST00000375247.2_Silent_p.G2820G			P22105	TENX_HUMAN	tenascin XB	2878	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.G2820G(1)|p.G2907G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CACCTGTCACACCCACGGTGG	0.582																																					p.G2820G		.											.	TNXB-90	2	Substitution - coding silent(2)	lung(2)	c.T8460C						.						55.0	62.0	59.0					6																	32023635		1258	2556	3814	SO:0001819	synonymous_variant	7148	exon24			TGTCACACCCACG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8460T>C	6.37:g.32023635A>G		109	0		71	5	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.		0.582	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
SCRN1	9805	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	29994945	29994945	+	Missense_Mutation	SNP	C	C	T	rs75604334	byFrequency	TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:29994945C>T	ENST00000426154.1	-	3	367	c.191G>A	c.(190-192)aGg>aAg	p.R64K	SCRN1_ENST00000434476.2_Missense_Mutation_p.R84K|SCRN1_ENST00000242059.5_Missense_Mutation_p.R64K|SCRN1_ENST00000425819.2_5'UTR|SCRN1_ENST00000409570.1_Missense_Mutation_p.R64K|SCRN1_ENST00000416113.2_5'Flank|SCRN1_ENST00000494620.1_5'UTR|SCRN1_ENST00000409497.1_Missense_Mutation_p.R64K	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	64					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						GGCATAGGTCCTTGGAACTTG	0.488																																					p.R84K		.											.	SCRN1-92	0			c.G251A						.						109.0	105.0	107.0					7																	29994945		2203	4300	6503	SO:0001583	missense	9805	exon3			TAGGTCCTTGGAA	D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.191G>A	7.37:g.29994945C>T	ENSP00000409068:p.Arg64Lys	124	0		164	53	NM_001145514	0	0	97	152	55	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	ENST00000426154.1	37	CCDS5422.1	.	.	.	.	.	.	.	.	.	.	C	5.644	0.303441	0.10678	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000409497;ENST00000434476;ENST00000421434;ENST00000438497;ENST00000409570	T;T;T;T;T;T;T	0.28666	3.37;3.37;3.37;3.35;2.36;1.63;1.6	5.7	3.89	0.44902	.	0.133460	0.52532	N	0.000069	T	0.14184	0.0343	N	0.11789	0.175	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.09487	-1.0672	9	.	.	.	-20.2169	6.2825	0.21015	0.0:0.6834:0.0:0.3166	.	84;64	C9JPG0;Q12765	.;SCRN1_HUMAN	K	64;64;64;84;64;64;64	ENSP00000242059:R64K;ENSP00000409068:R64K;ENSP00000386872:R64K;ENSP00000388942:R84K;ENSP00000413184:R64K;ENSP00000406289:R64K;ENSP00000387052:R64K	.	R	-	2	0	SCRN1	29961470	1.000000	0.71417	0.996000	0.52242	0.879000	0.50718	1.824000	0.39072	1.426000	0.47256	0.557000	0.71058	AGG	C|0.982;G|0.018		0.488	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	111368503	111368503	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:111368503G>C	ENST00000437633.1	-	52	5984	c.5728C>G	c.(5728-5730)Ctg>Gtg	p.L1910V	DOCK4_ENST00000494651.2_Missense_Mutation_p.L793V|DOCK4_ENST00000428084.1_Missense_Mutation_p.L1919V	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1910	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GGGCGCCGCAGAGTCCGCTCG	0.726																																					p.L1910V		.											.	DOCK4-26	0			c.C5728G						.						22.0	29.0	27.0					7																	111368503		2060	4183	6243	SO:0001583	missense	9732	exon52			GCCGCAGAGTCCG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5728C>G	7.37:g.111368503G>C	ENSP00000404179:p.Leu1910Val	98	0		113	6	NM_014705	0	0	21	21	0	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.033027	0.35893	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	T;T;T	0.32023	1.47;1.47;1.47	5.59	3.43	0.39272	.	0.139401	0.49305	N	0.000144	T	0.15392	0.0371	N	0.19112	0.55	0.29489	N	0.855803	B;B;B;B;B;P	0.39181	0.0;0.045;0.046;0.001;0.036;0.663	B;B;B;B;B;B	0.33196	0.002;0.045;0.019;0.002;0.009;0.159	T	0.07635	-1.0762	10	0.34782	T	0.22	.	7.1126	0.25399	0.1735:0.1686:0.6579:0.0	.	779;793;1955;1910;1881;223	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4	.;.;.;DOCK4_HUMAN;.;.	V	1898;1919;793;1910;1869	ENSP00000410746:L1919V;ENSP00000440944:L793V;ENSP00000404179:L1910V	ENSP00000345432:L1869V	L	-	1	2	DOCK4	111155739	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.165000	0.31822	1.340000	0.45581	0.655000	0.94253	CTG	.		0.726	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
GALNT11	63917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151805279	151805279	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:151805279T>C	ENST00000434507.1	+	8	1306	c.869T>C	c.(868-870)gTc>gCc	p.V290A	GALNT11_ENST00000430044.2_Missense_Mutation_p.V290A|GALNT11_ENST00000452146.2_Missense_Mutation_p.V209A|GALNT11_ENST00000320311.2_Missense_Mutation_p.V290A|GALNT11_ENST00000422997.2_3'UTR			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	290					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		TCCCCTGTCGTCCGCGGAGGG	0.602																																					p.V290A		.											.	GALNT11-90	0			c.T869C						.						70.0	69.0	69.0					7																	151805279		2203	4300	6503	SO:0001583	missense	63917	exon6			CTGTCGTCCGCGG	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.869T>C	7.37:g.151805279T>C	ENSP00000416787:p.Val290Ala	90	0		143	106	NM_022087	0	0	155	418	263	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	37	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690916	0.88735	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	N	0.13235	0.315	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.998	D;D;D	0.91635	0.934;0.999;0.971	T	0.58301	-0.7660	10	0.22109	T	0.4	.	15.2076	0.73192	0.0:0.0:0.0:1.0	.	209;290;290	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	A	290;209;290;290;290	ENSP00000395122:V290A;ENSP00000393399:V209A;ENSP00000416787:V290A;ENSP00000315835:V290A	ENSP00000315835:V290A	V	+	2	0	GALNT11	151436212	1.000000	0.71417	0.696000	0.30242	0.671000	0.39405	6.290000	0.72712	1.980000	0.57719	0.528000	0.53228	GTC	.		0.602	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2063780	2063780	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr8:2063780C>T	ENST00000262113.4	+	26	3350	c.3209C>T	c.(3208-3210)aCt>aTt	p.T1070I	MYOM2_ENST00000523438.1_Missense_Mutation_p.T495I	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1070					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GACAAAGCTACTGGCATTATT	0.383																																					p.T1070I		.											.	MYOM2-95	0			c.C3209T						.						180.0	173.0	175.0					8																	2063780		2203	4300	6503	SO:0001583	missense	9172	exon26			AAGCTACTGGCAT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3209C>T	8.37:g.2063780C>T	ENSP00000262113:p.Thr1070Ile	128	0		79	36	NM_003970	0	0	0	1	1	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106096	0.37145	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.43688	0.94;0.94	5.32	5.32	0.75619	.	0.155634	0.56097	D	0.000032	T	0.50292	0.1607	M	0.72118	2.19	0.09310	N	1	P	0.43542	0.81	P	0.47118	0.538	T	0.53627	-0.8412	10	0.72032	D	0.01	.	11.9689	0.53051	0.1347:0.7352:0.13:0.0	.	1070	P54296	MYOM2_HUMAN	I	1070;495	ENSP00000262113:T1070I;ENSP00000428396:T495I	ENSP00000262113:T1070I	T	+	2	0	MYOM2	2051187	0.950000	0.32346	0.017000	0.16124	0.264000	0.26372	3.170000	0.50816	2.495000	0.84180	0.655000	0.94253	ACT	.		0.383	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
OPLAH	26873	hgsc.bcm.edu	37	8	145110805	145110805	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr8:145110805T>C	ENST00000426825.1	-	16	2215	c.2134A>G	c.(2134-2136)Acc>Gcc	p.T712A	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	712					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGTCTTGGTCACCTCTGCC	0.652																																					p.T712A		.											.	OPLAH-68	0			c.A2134G						.						36.0	37.0	37.0					8																	145110805		2033	4178	6211	SO:0001583	missense	26873	exon16			TCTTGGTCACCTC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2134A>G	8.37:g.145110805T>C	ENSP00000475943:p.Thr712Ala	16	0		14	2	NM_017570	0	0	21	21	0	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	T	10.89	1.477922	0.26511	.	.	ENSG00000178814	ENST00000426825	.	.	.	5.54	5.54	0.83059	.	0.144870	0.64402	D	0.000009	T	0.54191	0.1843	.	.	.	0.44547	D	0.997501	B	0.23806	0.091	B	0.33254	0.16	T	0.62789	-0.6780	7	0.45353	T	0.12	.	13.6163	0.62110	0.0:0.0:0.0:1.0	.	712	O14841	OPLA_HUMAN	A	712	.	ENSP00000412071:T712A	T	-	1	0	OPLAH	145182793	1.000000	0.71417	0.860000	0.33809	0.281000	0.26958	5.722000	0.68485	2.108000	0.64289	0.533000	0.62120	ACC	.		0.652	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
CCDC180	100499483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100117239	100117239	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:100117239A>G	ENST00000357054.1	+	35	4193	c.3258A>G	c.(3256-3258)atA>atG	p.I1086M	CCDC180_ENST00000529487.1_Missense_Mutation_p.I1115M|CCDC180_ENST00000375202.2_Missense_Mutation_p.I1115M|CCDC180_ENST00000395220.1_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1086						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TTATTTTCATAGAGAAAATCC	0.418																																					p.I1115M		.											.	.	0			c.A3345G						.						74.0	75.0	75.0					9																	100117239		2203	4300	6503	SO:0001583	missense	0	exon24			TTTCATAGAGAAA	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3258A>G	9.37:g.100117239A>G	ENSP00000349562:p.Ile1086Met	112	0		108	48	NM_020893	0	0	0	1	1	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	A	14.21	2.467293	0.43839	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.10099	3.17;2.91;2.91	5.16	-0.113	0.13568	.	0.642133	0.16850	N	0.196982	T	0.04952	0.0133	N	0.16478	0.41	0.80722	D	1	B;P	0.37370	0.083;0.592	B;B	0.35240	0.044;0.198	T	0.49707	-0.8911	10	0.27785	T	0.31	-2.8056	4.2902	0.10874	0.6091:0.0:0.2494:0.1415	.	1254;1086	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	M	1086;1115;1115	ENSP00000349562:I1086M;ENSP00000364348:I1115M;ENSP00000434727:I1115M	ENSP00000349562:I1086M	I	+	3	3	C9orf174	99157060	0.990000	0.36364	0.986000	0.45419	0.999000	0.98932	0.166000	0.16583	0.022000	0.15160	0.533000	0.62120	ATA	.		0.418	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
GNG10	2790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	114429094	114429094	+	Splice_Site	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:114429094G>A	ENST00000374293.4	+	2	381		c.e2-1		DNAJC25-GNG10_ENST00000374294.3_Splice_Site|DNAJC25_ENST00000556107.1_Splice_Site	NM_001017998.3|NM_001198664.1	NP_001017998.1|NP_001185593.1	P50151	GBG10_HUMAN	guanine nucleotide binding protein (G protein), gamma 10						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			kidney(1)	1						CTTTGTTTCAGGTCTCTCAGG	0.522																																					.		.											.	DNAJC25-GNG10-159	0			c.337-1G>A						.						80.0	67.0	71.0					9																	114429094		2203	4300	6503	SO:0001630	splice_region_variant	552891	exon2			GTTTCAGGTCTCT		CCDS35107.1	9q31.3	2010-08-17			ENSG00000242616	ENSG00000242616			4402	protein-coding gene	gene with protein product		604389				7665596	Standard	NM_001017998		Approved			P50151	OTTHUMG00000157193	ENST00000374293.4:c.82-1G>A	9.37:g.114429094G>A		56	0		43	14	NM_004125	0	0	0	1	1	Q3B7K2|Q4VC27	Splice_Site	SNP	ENST00000374293.4	37	CCDS35107.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486423	0.84854	.	.	ENSG00000059769;ENSG00000244115;ENSG00000242616	ENST00000556107;ENST00000374294;ENST00000374293	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1488	0.93479	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJC25-GNG10;GNG10;DNAJC25	113468915	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	9.460000	0.97641	2.688000	0.91661	0.655000	0.94253	.	.		0.522	GNG10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053644.2		Intron
ZER1	10444	hgsc.bcm.edu	37	9	131513498	131513498	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:131513498T>C	ENST00000291900.2	-	7	1494	c.1088A>G	c.(1087-1089)tAc>tGc	p.Y363C	ZER1_ENST00000494461.1_5'Flank|snoU13_ENST00000459043.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	363					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						GTGCTCCGTGTAGGCCTCGAT	0.602																																					p.Y363C		.											.	ZER1-91	0			c.A1088G						.						93.0	76.0	82.0					9																	131513498		2203	4300	6503	SO:0001583	missense	10444	exon7			TCCGTGTAGGCCT	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1088A>G	9.37:g.131513498T>C	ENSP00000291900:p.Tyr363Cys	32	0		34	3	NM_006336	0	0	61	61	0	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785754	0.70337	.	.	ENSG00000160445	ENST00000291900	T	0.07688	3.17	5.24	5.24	0.73138	Armadillo-type fold (1);	0.060055	0.64402	D	0.000002	T	0.22781	0.0550	L	0.51914	1.62	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.00425	-1.1747	10	0.44086	T	0.13	-35.0868	14.3759	0.66874	0.0:0.0:0.0:1.0	.	363	Q7Z7L7	ZER1_HUMAN	C	363	ENSP00000291900:Y363C	ENSP00000291900:Y363C	Y	-	2	0	ZER1	130553319	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.499000	0.81566	2.011000	0.59026	0.254000	0.18369	TAC	.		0.602	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
CHDC2	286464	hgsc.bcm.edu	37	X	36156552	36156552	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chrX:36156552T>C	ENST00000313548.4	+	10	1417	c.1231T>C	c.(1231-1233)Tat>Cat	p.Y411H		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	411	CH.					integral component of membrane (GO:0016021)											AAATACTCTTTATGAAATTGA	0.289																																					p.Y411H		.											.	.	0			c.T1231C						.						76.0	71.0	72.0					X																	36156552		2201	4293	6494	SO:0001583	missense	286464	exon10			ACTCTTTATGAAA	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1231T>C	X.37:g.36156552T>C	ENSP00000324767:p.Tyr411His	33	0		31	2	NM_173695	0	0	1	1	0		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.826393	0.00589	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.16	1.19	0.21007	Calponin homology domain (1);	1.689990	0.03708	N	0.249711	T	0.10252	0.0251	N	0.00707	-1.245	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21655	-1.0239	9	0.19147	T	0.46	-5.0E-4	6.2666	0.20930	0.1325:0.6632:0.0:0.2043	.	411	Q8N9S7	CX059_HUMAN	H	411	.	ENSP00000324767:Y411H	Y	+	1	0	CXorf59	36066473	0.004000	0.15560	0.000000	0.03702	0.002000	0.02628	0.719000	0.25881	-0.165000	0.10908	-1.043000	0.02367	TAT	.		0.289	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
ZBTB33	10009	broad.mit.edu	37	X	119387346	119387346	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chrX:119387346C>T	ENST00000326624.2	+	2	304	c.76C>T	c.(76-78)Cgt>Tgt	p.R26C	ZBTB33_ENST00000557385.1_Missense_Mutation_p.R26C	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	26	Interaction with NCOR1.|Self-association. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						GAATGAGCAACGTGGCCATGG	0.448																																					p.R26C													.	ZBTB33-132	0			c.C76T						.						161.0	153.0	156.0					X																	119387346		2203	4300	6503	SO:0001583	missense	10009	exon2			GAGCAACGTGGCC	BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.76C>T	X.37:g.119387346C>T	ENSP00000314153:p.Arg26Cys	131	0		148	6	NM_006777	0	0	14	15	1	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190149	0.58017	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.26067	1.76;1.76	5.96	5.96	0.96718	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73805	-0.3867	10	0.87932	D	0	-10.6374	18.2055	0.89853	0.0:1.0:0.0:0.0	.	26	Q86T24	KAISO_HUMAN	C	26	ENSP00000314153:R26C;ENSP00000450969:R26C	ENSP00000314153:R26C	R	+	1	0	ZBTB33;AC002086.1	119271374	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.500000	0.60387	2.523000	0.85059	0.594000	0.82650	CGT	.		0.448	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777	
GPALPP1	55425	broad.mit.edu	37	13	45580365	45580367	+	In_Frame_Del	DEL	GAT	GAT	-	rs138421508		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr13:45580365_45580367delGAT	ENST00000379151.4	+	3	353_355	c.250_252delGAT	c.(250-252)gatdel	p.D88del	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_In_Frame_Del_p.D88del|GPALPP1_ENST00000357537.3_De_novo_Start_InFrame	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	88	Poly-Asp.																Ggatgatgacgatgatgatgatg	0.335																																					p.84_84del													.	KIAA1704-92	0			c.250_252del						.			311,3953		154,3,1975						-7.1	0.0			182	654,7600		325,4,3798	no	coding	KIAA1704	NM_018559.2		479,7,5773	A1A1,A1R,RR		7.9234,7.2936,7.7089				965,11553				SO:0001651	inframe_deletion	55425	exon3			GATGACGATGATG	AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.250_252delGAT	13.37:g.45580374_45580376delGAT	ENSP00000368447:p.Asp88del	221	0		204	7	NM_018559	0	0	0	0	0	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	In_Frame_Del	DEL	ENST00000379151.4	37	CCDS9394.1																																																																																			.		0.335	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2	NM_018559	
PVRL2	5819	broad.mit.edu	37	19	45349842	45349844	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:45349842_45349844delGCT	ENST00000252483.5	+	1	60_62	c.60_62delGCT	c.(58-63)ccgctg>ccg	p.L27del	PVRL2_ENST00000252485.4_In_Frame_Del_p.L27del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)	27					acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		tgctgtggccgctgctgctgctg	0.759																																					p.20_21del													.	PVRL2-90	0			c.60_62del						.		,	17,1559		4,9,775					,	-4.8	0.0			1	20,3132		3,14,1559	no	coding,coding	PVRL2	NM_002856.2,NM_001042724.1	,	7,23,2334	A1A1,A1R,RR		0.6345,1.0787,0.7826	,	,		37,4691				SO:0001651	inframe_deletion	5819	exon1			GTGGCCGCTGCTG	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.60_62delGCT	19.37:g.45349851_45349853delGCT	ENSP00000252483:p.Leu27del	6	0		6	3	NM_002856	0	0	0	0	0	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	ENST00000252483.5	37	CCDS42576.1																																																																																			.		0.759	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
ARHGAP21	57584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	24885703	24885704	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr10:24885703_24885704insG	ENST00000396432.2	-	17	3928_3929	c.3442_3443insC	c.(3442-3444)cgafs	p.R1148fs	ARHGAP21_ENST00000493154.1_5'Flank|ARHGAP21_ENST00000320481.6_Frame_Shift_Ins_p.R935fs	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1147	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GTCATCTAGTCGGACGCCGAAA	0.455																																					p.R1148fs		.											.	ARHGAP21-235	0			c.3443_3444insC						.																																			SO:0001589	frameshift_variant	57584	exon17			.	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3443dupC	10.37:g.24885705_24885705dupG	ENSP00000379709:p.Arg1148fs	119	0		99	42	NM_020824	0	0	0	0	0	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Frame_Shift_Ins	INS	ENST00000396432.2	37	CCDS7144.2																																																																																			.		0.455	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
PTGDR	5729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	52734893	52734894	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr14:52734893_52734894CT>AG	ENST00000306051.2	+	1	463_464	c.361_362CT>AG	c.(361-363)CTg>AGg	p.L121R	PTGDR_ENST00000553372.1_Missense_Mutation_p.L121R	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	121					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CTCCTCGACACTGCAACTCCTG	0.629																																					p.L121R		.											.	PTGDR	0			c.T362G						.																																			SO:0001583	missense	5729	exon1			CGACACTGCAACT	U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	Exception_encountered	14.37:g.52734893_52734894delinsAG	ENSP00000303424:p.Leu121Arg	309.0	0.0		231.0	81.0		0	0	0	0	0	G3V5L3|Q13250|Q13251|Q1ZZ52	Missense_Mutation	DNP	ENST00000306051.2	37	CCDS9707.1																																																																																			.		0.629	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276889.1	NM_000953	
