#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIF1B	23095	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10328310	10328310	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:10328310T>C	ENST00000377086.1	+	7	911	c.709T>C	c.(709-711)Tcc>Ccc	p.S237P	KIF1B_ENST00000263934.6_Missense_Mutation_p.S237P|KIF1B_ENST00000377081.1_Missense_Mutation_p.S237P|KIF1B_ENST00000377083.1_Missense_Mutation_p.S237P|KIF1B_ENST00000377093.4_Missense_Mutation_p.S237P			O60333	KIF1B_HUMAN	kinesin family member 1B	237	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.			NLSTE -> ILATV (in Ref. 3; AAK49332, 4; AAK85155 and 5; AAN17742). {ECO:0000305}.	anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GACCAACCTTTCCACTGAGAA	0.448																																					p.S237P													.	KIF1B-93	0			c.T709C						.						81.0	71.0	74.0					1																	10328310		2203	4300	6503	SO:0001583	missense	23095	exon7			AACCTTTCCACTG	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.709T>C	1.37:g.10328310T>C	ENSP00000366290:p.Ser237Pro	144	1		110	26	NM_183416	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	T	20.9	4.073545	0.76415	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	5.94	4.8	0.61643	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.86944	0.6055	N	0.20610	0.595	0.58432	D	0.999998	P;P;P;P;B;D;B	0.62365	0.62;0.62;0.853;0.736;0.032;0.991;0.142	P;P;P;P;B;P;B	0.56088	0.53;0.53;0.53;0.53;0.05;0.791;0.103	D	0.86389	0.1734	10	0.44086	T	0.13	.	12.4278	0.55557	0.126:0.0:0.0:0.874	.	237;237;237;237;237;237;237	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	P	237	ENSP00000263934:S237P;ENSP00000366297:S237P;ENSP00000366290:S237P;ENSP00000366287:S237P;ENSP00000366284:S237P	ENSP00000263934:S237P	S	+	1	0	KIF1B	10250897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.719000	0.47244	1.040000	0.40099	0.528000	0.53228	TCC	.		0.448	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
HMGCL	3155	hgsc.bcm.edu	37	1	24151846	24151846	+	Splice_Site	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:24151846A>G	ENST00000374490.3	-	1	103	c.60T>C	c.(58-60)gcT>gcC	p.A20A	HMGCL_ENST00000436439.2_Splice_Site_p.A20A|HMGCL_ENST00000374483.4_Intron|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	20					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		GGGCACTTACAGCCCGGAGGG	0.706																																					p.A20A		.											.	HMGCL-90	0			c.T60C						.						10.0	11.0	10.0					1																	24151846		2085	4077	6162	SO:0001630	splice_region_variant	3155	exon1			ACTTACAGCCCGG	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.60+1T>C	1.37:g.24151846A>G		8	0		87	27	NM_000191	0	0	1	1	0	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Silent	SNP	ENST00000374490.3	37	CCDS243.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.232145	0.58777	.	.	ENSG00000117305	ENST00000235958	.	.	.	5.66	2.13	0.27403	.	.	.	.	.	T	0.54549	0.1865	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45483	-0.9258	4	.	.	.	-1.3076	6.689	0.23161	0.7318:0.0:0.2682:0.0	.	.	.	.	P	16	.	.	L	-	2	0	HMGCL	24024433	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	0.764000	0.26532	0.516000	0.28340	0.533000	0.62120	CTG	.		0.706	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	Silent
SYNC	81493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	33161106	33161106	+	Missense_Mutation	SNP	T	T	G	rs554437078		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:33161106T>G	ENST00000409190.3	-	2	1051	c.593A>C	c.(592-594)cAt>cCt	p.H198P	SYNC_ENST00000373484.3_Missense_Mutation_p.H198P	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	198	Coil 1A.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						TACAAGCTCATGGATGAGCTG	0.567																																					p.H198P		.											.	SYNC-91	0			c.A593C						.						89.0	78.0	82.0					1																	33161106		692	1591	2283	SO:0001583	missense	81493	exon2			AGCTCATGGATGA	AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.593A>C	1.37:g.33161106T>G	ENSP00000386439:p.His198Pro	131	0		88	24	NM_001161708	0	0	5	6	1	B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	ENST00000409190.3	37	CCDS367.2	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123508	0.56613	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	T;T	0.24350	1.86;1.86	4.57	4.57	0.56435	Filament (1);	.	.	.	.	T	0.27559	0.0677	N	0.14661	0.345	0.31839	N	0.623691	D;D	0.76494	0.998;0.999	P;D	0.75020	0.905;0.985	T	0.17471	-1.0368	9	0.31617	T	0.26	-9.3582	5.8491	0.18683	0.0:0.0877:0.1689:0.7435	.	198;198	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	P	198	ENSP00000362583:H198P;ENSP00000386439:H198P	ENSP00000362583:H198P	H	-	2	0	SYNC	32933693	0.988000	0.35896	0.997000	0.53966	0.958000	0.62258	1.916000	0.39986	1.853000	0.53794	0.459000	0.35465	CAT	.		0.567	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022129.3	NM_030786	
ZC3H12A	80149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	37949045	37949045	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:37949045A>T	ENST00000373087.6	+	6	1749	c.1633A>T	c.(1633-1635)Agg>Tgg	p.R545W		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCGTGGGGCAGGGCAGGCAG	0.647																																					p.R545W		.											.	ZC3H12A-92	0			c.A1633T						.						48.0	58.0	55.0					1																	37949045		2203	4300	6503	SO:0001583	missense	80149	exon6			TGGGGCAGGGCAG		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1633A>T	1.37:g.37949045A>T	ENSP00000362179:p.Arg545Trp	135	0		196	53	NM_025079	0	0	11	19	8		Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.033050	0.35893	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.45668	0.89	5.15	2.9	0.33743	.	0.653715	0.14763	N	0.299862	T	0.37544	0.1007	N	0.22421	0.69	0.09310	N	0.999998	D;P	0.59767	0.986;0.923	P;B	0.52554	0.702;0.221	T	0.14868	-1.0457	10	0.66056	D	0.02	-9.4135	7.823	0.29298	0.2651:0.0:0.7349:0.0	.	340;545	B3KSD3;Q5D1E8	.;ZC12A_HUMAN	W	545	ENSP00000362179:R545W	ENSP00000362174:R545W	R	+	1	2	ZC3H12A	37721632	0.000000	0.05858	0.097000	0.21041	0.675000	0.39556	0.003000	0.13083	0.284000	0.22305	0.459000	0.35465	AGG	.		0.647	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
KTI12	112970	hgsc.bcm.edu	37	1	52499078	52499078	+	Missense_Mutation	SNP	A	A	G	rs563103084|rs377187997	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:52499078A>G	ENST00000371614.1	-	1	410	c.356T>C	c.(355-357)gTg>gCg	p.V119A	TXNDC12_ENST00000371626.4_Intron|RP11-91A18.4_ENST00000425802.1_RNA	NM_138417.2	NP_612426.1	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated (S. cerevisiae)	119							ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)|urinary_tract(1)	12						CGCGCCCGCCACCTGAGGTCC	0.721																																					p.V119A		.											.	KTI12-91	0			c.T356C						.						28.0	34.0	32.0					1																	52499078		2194	4277	6471	SO:0001583	missense	112970	exon1			CCCGCCACCTGAG		CCDS562.1	1p32.3	2008-02-05			ENSG00000198841	ENSG00000198841			25160	protein-coding gene	gene with protein product						11929532	Standard	NM_138417		Approved	TOT4, MGC20419, SBBI81	uc001ctj.1	Q96EK9	OTTHUMG00000008630	ENST00000371614.1:c.356T>C	1.37:g.52499078A>G	ENSP00000360676:p.Val119Ala	1	0		43	13	NM_138417	0	0	2	8	6		Missense_Mutation	SNP	ENST00000371614.1	37	CCDS562.1	.	.	.	.	.	.	.	.	.	.	A	9.740	1.164503	0.21538	.	.	ENSG00000198841	ENST00000371614	T	0.39997	1.05	4.93	-9.87	0.00470	.	.	.	.	.	T	0.11750	0.0286	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15150	-1.0447	9	0.05959	T	0.93	.	2.3401	0.04257	0.1327:0.1704:0.3566:0.3403	.	119	Q96EK9	KTI12_HUMAN	A	119	ENSP00000360676:V119A	ENSP00000360676:V119A	V	-	2	0	KTI12	52271666	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.926000	0.00691	-2.213000	0.00735	-0.256000	0.11100	GTG	.		0.721	KTI12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023821.1	NM_138417	
DHCR24	1718	broad.mit.edu	37	1	55317995	55317995	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:55317995A>C	ENST00000371269.3	-	9	1560	c.1462T>G	c.(1462-1464)Tcc>Gcc	p.S488A	DHCR24_ENST00000537443.1_Missense_Mutation_p.S272A|DHCR24_ENST00000535035.1_Missense_Mutation_p.S447A	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	488					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						TGGTACAAGGAGCCATCAAAC	0.597																																					p.S488A	Pancreas(39;516 1021 24601 30715 32780)												.	DHCR24-91	0			c.T1462G						.						141.0	123.0	130.0					1																	55317995		2203	4300	6503	SO:0001583	missense	1718	exon9			ACAAGGAGCCATC	AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.1462T>G	1.37:g.55317995A>C	ENSP00000360316:p.Ser488Ala	94	0		90	4	NM_014762	0	0	176	178	2	B7Z817|D3DQ51|Q9HBA8	Missense_Mutation	SNP	ENST00000371269.3	37	CCDS600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.52|13.52	2.262766|2.262766	0.39995|0.39995	.|.	.|.	ENSG00000116133|ENSG00000116133	ENST00000436604|ENST00000539536;ENST00000371269;ENST00000537443;ENST00000535035	.|T;T;T	.|0.69306	.|-0.39;-0.39;-0.39	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.277164	.|0.40064	.|N	.|0.001199	T|T	0.47451|0.47451	0.1446|0.1446	N|N	0.16478|0.16478	0.41|0.41	0.36209|0.36209	D|D	0.851231|0.851231	.|B;B;B	.|0.16166	.|0.016;0.007;0.016	.|B;B;B	.|0.14023	.|0.01;0.004;0.007	T|T	0.51236|0.51236	-0.8731|-0.8731	5|10	.|0.14252	.|T	.|0.57	-42.9406|-42.9406	11.5029|11.5029	0.50448|0.50448	0.8501:0.1499:0.0:0.0|0.8501:0.1499:0.0:0.0	.|.	.|447;447;488	.|B7Z817;B7ZAV4;Q15392	.|.;.;DHC24_HUMAN	R|A	125|214;488;272;447	.|ENSP00000360316:S488A;ENSP00000439852:S272A;ENSP00000440191:S447A	.|ENSP00000360316:S488A	L|S	-|-	2|1	0|0	DHCR24|DHCR24	55090583|55090583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.827000|0.827000	0.46813|0.46813	3.617000|3.617000	0.54181|0.54181	2.079000|2.079000	0.62486|0.62486	0.379000|0.379000	0.24179|0.24179	CTC|TCC	.		0.597	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115256491	115256491	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:115256491T>A	ENST00000369535.4	-	3	473	c.220A>T	c.(220-222)Aca>Tca	p.T74S		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	74					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTTCGCCTGTCCTCATGTAT	0.418		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.T74S		.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	.	NRAS-32773	0			c.A220T						.						186.0	159.0	168.0					1																	115256491		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CGCCTGTCCTCAT	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.220A>T	1.37:g.115256491T>A	ENSP00000358548:p.Thr74Ser	102	0		74	28	NM_002524	0	0	7	13	6	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.602254	0.87055	.	.	ENSG00000213281	ENST00000369535	T	0.76186	-1.0	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000022	T	0.46054	0.1373	N	0.04373	-0.215	0.80722	D	1	B	0.31640	0.333	B	0.37833	0.259	T	0.59209	-0.7497	10	0.51188	T	0.08	.	15.0132	0.71565	0.0:0.0:0.0:1.0	.	74	P01111	RASN_HUMAN	S	74	ENSP00000358548:T74S	ENSP00000358548:T74S	T	-	1	0	NRAS	115058014	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.787000	0.85759	2.120000	0.65058	0.533000	0.62120	ACA	.		0.418	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
GON4L	54856	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155723012	155723012	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:155723012C>G	ENST00000368331.1	-	29	5873	c.5825G>C	c.(5824-5826)gGa>gCa	p.G1942A	GON4L_ENST00000437809.1_Missense_Mutation_p.G1942A|GON4L_ENST00000271883.5_Missense_Mutation_p.G1942A	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1942					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGGCATCTCTCCCTTTCTGGT	0.562																																					p.G1942A													.	GON4L-93	0			c.G5825C						.						87.0	97.0	94.0					1																	155723012		2081	4197	6278	SO:0001583	missense	54856	exon29			ATCTCTCCCTTTC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5825G>C	1.37:g.155723012C>G	ENSP00000357315:p.Gly1942Ala	182	1		176	51	NM_001037533	0	0	10	14	4	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	16.55	3.155475	0.57259	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.11385	2.78;2.78;2.78	5.19	3.29	0.37713	.	0.446861	0.22376	N	0.060873	T	0.05731	0.0150	L	0.34521	1.04	0.31285	N	0.690131	P;D	0.55385	0.952;0.971	B;P	0.50617	0.444;0.646	T	0.14337	-1.0476	10	0.62326	D	0.03	.	8.7526	0.34626	0.0:0.7683:0.1511:0.0806	.	1942;1942	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	A	1942	ENSP00000396117:G1942A;ENSP00000357315:G1942A;ENSP00000271883:G1942A	ENSP00000271883:G1942A	G	-	2	0	GON4L	153989636	0.112000	0.22096	0.988000	0.46212	0.791000	0.44710	0.586000	0.23894	0.739000	0.32628	0.557000	0.71058	GGA	.		0.562	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
C1orf61	10485	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156386616	156386616	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:156386616C>A	ENST00000368243.1	-	3	132	c.16G>T	c.(16-18)Gat>Tat	p.D6Y		NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61	6						nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					GTTATGAGATCCTCAGTCAGG	0.438																																					p.D6Y													.	C1orf61-91	0			c.G16T						.						117.0	117.0	117.0					1																	156386616		2203	4300	6503	SO:0001583	missense	10485	exon3			TGAGATCCTCAGT		CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.16G>T	1.37:g.156386616C>A	ENSP00000357226:p.Asp6Tyr	172	1		153	42	NM_006365	0	0	0	0	0	B1ALL5|B1ALL8	Missense_Mutation	SNP	ENST00000368243.1	37	CCDS1142.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690548	0.29962	.	.	ENSG00000125462	ENST00000368243	.	.	.	2.88	-0.293	0.12835	.	.	.	.	.	T	0.15435	0.0372	N	0.14661	0.345	0.09310	N	1	D	0.58268	0.982	P	0.58780	0.845	T	0.04678	-1.0934	8	0.87932	D	0	.	3.3	0.06979	0.0:0.5063:0.2219:0.2718	.	6	Q13536	CROC4_HUMAN	Y	6	.	ENSP00000357226:D6Y	D	-	1	0	C1orf61	154653240	0.000000	0.05858	0.008000	0.14137	0.014000	0.08584	-0.398000	0.07259	-0.056000	0.13221	0.491000	0.48974	GAT	.		0.438	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075988.1	NM_006365	
DDR2	4921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	162729664	162729664	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:162729664G>A	ENST00000367922.3	+	9	1188	c.750G>A	c.(748-750)gtG>gtA	p.V250V	DDR2_ENST00000367921.3_Silent_p.V250V	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	250					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	AATACCACGTGTGGCCCGGCT	0.532																																					p.V250V	NSCLC(161;314 2006 8283 19651 23192)	.											.	DDR2-1464	0			c.G750A						.						119.0	105.0	110.0					1																	162729664		2203	4300	6503	SO:0001819	synonymous_variant	4921	exon9			CCACGTGTGGCCC	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.750G>A	1.37:g.162729664G>A		198	0		172	52	NM_001014796	0	0	0	0	0	Q7Z730	Silent	SNP	ENST00000367922.3	37	CCDS1241.1																																																																																			.		0.532	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
SFMBT2	57713	hgsc.bcm.edu	37	10	7214001	7214001	+	Silent	SNP	G	G	A	rs370293109		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:7214001G>A	ENST00000361972.4	-	19	2361	c.2271C>T	c.(2269-2271)ccC>ccT	p.P757P	SFMBT2_ENST00000397167.1_Silent_p.P757P	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	757					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CGGCCCTCCGGGGCCGGGCCG	0.746																																					p.P757P		.											.	SFMBT2-141	0			c.C2271T						.	G	,	0,4346		0,0,2173	12.0	15.0	14.0		2271,2271	0.9	1.0	10		14	1,8505		0,1,4252	no	coding-synonymous,coding-synonymous	SFMBT2	NM_001018039.1,NM_001029880.2	,	0,1,6425	AA,AG,GG		0.0118,0.0,0.0078	,	757/895,757/895	7214001	1,12851	2173	4253	6426	SO:0001819	synonymous_variant	57713	exon19			CCTCCGGGGCCGG	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2271C>T	10.37:g.7214001G>A		1	0		8	6	NM_001029880	0	0	0	0	0	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																			.		0.746	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
PLXDC2	84898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	20335920	20335920	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:20335920G>T	ENST00000377252.4	+	3	1288	c.447G>T	c.(445-447)ttG>ttT	p.L149F	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Intron	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	149					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						ATGGAATATTGTCCAATACTC	0.373																																					p.L149F		.											.	PLXDC2-93	0			c.G447T						.						95.0	93.0	93.0					10																	20335920		2203	4300	6503	SO:0001583	missense	84898	exon3			AATATTGTCCAAT	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.447G>T	10.37:g.20335920G>T	ENSP00000366460:p.Leu149Phe	56	0		58	5	NM_032812	0	0	16	22	6	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294191	0.60086	.	.	ENSG00000120594	ENST00000377252;ENST00000377238;ENST00000536022	T	0.78364	-1.17	5.61	0.195	0.15151	.	0.000000	0.85682	D	0.000000	D	0.82499	0.5050	M	0.79343	2.45	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	T	0.77335	-0.2626	10	0.87932	D	0	.	2.1328	0.03754	0.1312:0.2504:0.2267:0.3917	.	149	Q6UX71	PXDC2_HUMAN	F	149;12;135	ENSP00000366460:L149F	ENSP00000366446:L12F	L	+	3	2	PLXDC2	20375926	0.996000	0.38824	0.683000	0.30040	0.886000	0.51366	0.297000	0.19101	-0.233000	0.09797	-0.133000	0.14855	TTG	.		0.373	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70332130	70332130	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:70332130T>C	ENST00000373644.4	+	2	244	c.35T>C	c.(34-36)tTa>tCa	p.L12S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	12					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCTTCCAGATTAGTCAGGAAG	0.433																																					p.L12S		.											.	TET1-663	0			c.T35C						.						38.0	38.0	38.0					10																	70332130		2199	4299	6498	SO:0001583	missense	80312	exon2			CCAGATTAGTCAG	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.35T>C	10.37:g.70332130T>C	ENSP00000362748:p.Leu12Ser	93	0		85	28	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	13.35	2.210522	0.39102	.	.	ENSG00000138336	ENST00000373644	T	0.08458	3.09	5.24	0.299	0.15771	.	4.959980	0.00166	N	0.000012	T	0.06735	0.0172	N	0.19112	0.55	0.23501	N	0.997547	B	0.28512	0.214	B	0.21151	0.033	T	0.37502	-0.9703	10	0.28530	T	0.3	.	9.3061	0.37876	0.0:0.403:0.0:0.597	.	12	Q8NFU7	TET1_HUMAN	S	12	ENSP00000362748:L12S	ENSP00000362748:L12S	L	+	2	0	TET1	70002136	0.998000	0.40836	0.679000	0.29978	0.998000	0.95712	0.421000	0.21280	-0.188000	0.10499	0.460000	0.39030	TTA	.		0.433	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
OIT3	170392	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	74692266	74692266	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:74692266T>G	ENST00000334011.5	+	9	1840	c.1622T>G	c.(1621-1623)aTc>aGc	p.I541S		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	541						nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					CCGATCCGCATCGACTGGGAG	0.637																																					p.I541S	Colon(7;19 345 13446 17537)												.	OIT3-70	0			c.T1622G						.						53.0	50.0	51.0					10																	74692266		2203	4300	6503	SO:0001583	missense	170392	exon9			TCCGCATCGACTG		CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1622T>G	10.37:g.74692266T>G	ENSP00000333900:p.Ile541Ser	58	1		69	16	NM_152635	0	0	0	0	0	A0AVP3|Q8N1M8	Missense_Mutation	SNP	ENST00000334011.5	37	CCDS7318.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.591915	0.66219	.	.	ENSG00000138315	ENST00000334011	D	0.84070	-1.8	6.06	6.06	0.98353	.	0.000000	0.56097	D	0.000026	D	0.90566	0.7043	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.91387	0.5132	10	0.87932	D	0	-21.1478	16.6093	0.84858	0.0:0.0:0.0:1.0	.	541	Q8WWZ8	OIT3_HUMAN	S	541	ENSP00000333900:I541S	ENSP00000333900:I541S	I	+	2	0	OIT3	74362272	1.000000	0.71417	0.984000	0.44739	0.036000	0.12997	6.791000	0.75120	2.324000	0.78689	0.533000	0.62120	ATC	.		0.637	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048596.1	NM_152635	
KCNMA1	3778	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	78651371	78651371	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:78651371C>G	ENST00000286628.8	-	26	3253	c.3254G>C	c.(3253-3255)gGc>gCc	p.G1085A	RP11-443A13.5_ENST00000429850.2_RNA|KCNMA1_ENST00000354353.5_Missense_Mutation_p.G1088A|KCNMA1_ENST00000372440.1_Missense_Mutation_p.G1027A|RP11-443A13.5_ENST00000595702.1_RNA|KCNMA1_ENST00000404857.1_Missense_Mutation_p.G1068A|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000609102.1_RNA|KCNMA1_ENST00000286627.5_Missense_Mutation_p.G1027A|KCNMA1_ENST00000406533.3_Missense_Mutation_p.G1089A|KCNMA1_ENST00000372443.1_Missense_Mutation_p.G1054A|KCNMA1_ENST00000404771.3_Missense_Mutation_p.G1085A	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1085					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	GGTGCTGTAGCCACCTCTAAG	0.602																																					p.G1085A													.	KCNMA1-93	0			c.G3254C						.						53.0	51.0	52.0					10																	78651371		2203	4300	6503	SO:0001583	missense	3778	exon26			CTGTAGCCACCTC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.3254G>C	10.37:g.78651371C>G	ENSP00000286628:p.Gly1085Ala	65	1		45	14	NM_001161352	0	0	1	1	0	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	16.97|16.97|16.97	3.269439|3.269439|3.269439	0.59540|0.59540|0.59540	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	.|D;D;D;D;D;D;D;D;D|.	.|0.85088|.	.|-1.87;-1.88;-1.9;-1.91;-1.84;-1.87;-1.94;-1.94;-1.88|.	5.52|5.52|5.52	5.52|5.52|5.52	0.82312|0.82312|0.82312	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.69486|0.69486|0.69486	0.3116|0.3116|0.3116	L|L|L	0.46741|0.46741|0.46741	1.465|1.465|1.465	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P;B;B;P;B;B;B;B|.	.|0.47191|.	.|0.891;0.037;0.125;0.823;0.123;0.004;0.227;0.037|.	.|P;B;B;P;B;B;B;B|.	.|0.46144|.	.|0.453;0.037;0.109;0.505;0.081;0.023;0.168;0.051|.	T|T|T	0.64905|0.64905|0.64905	-0.6297|-0.6297|-0.6297	5|10|5	.|0.49607|.	.|T|.	.|0.09|.	-14.3897|-14.3897|-14.3897	19.4341|19.4341|19.4341	0.94783|0.94783|0.94783	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|1056;1057;1068;1085;1027;838;1088;1054|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	P|A|C	978|1027;964;1020;1059;1022;1054;1027;1059;1089;1088;1068;838|1015;734	.|ENSP00000361517:G1027A;ENSP00000361485:G964A;ENSP00000361514:G1020A;ENSP00000396608:G1059A;ENSP00000361520:G1054A;ENSP00000286627:G1027A;ENSP00000385552:G1089A;ENSP00000346321:G1088A;ENSP00000385806:G1068A|.	.|ENSP00000286627:G1027A|.	A|G|W	-|-|-	1|2|3	0|0|0	KCNMA1|KCNMA1|KCNMA1	78321377|78321377|78321377	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.757000|0.757000|0.757000	0.42996|0.42996|0.42996	7.487000|7.487000|7.487000	0.81328|0.81328|0.81328	2.607000|2.607000|2.607000	0.88179|0.88179|0.88179	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GCT|GGC|TGG	.		0.602	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	89717690	89717690	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:89717690A>G	ENST00000371953.3	+	7	2072	c.715A>G	c.(715-717)Atg>Gtg	p.M239V	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	239	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R234fs*9(1)|p.K237_Y240>N(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGACAAGTTCATGTACTTTGA	0.418		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.M239V		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN-17735	50	Whole gene deletion(37)|Deletion - Frameshift(10)|Complex - deletion inframe(1)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|breast(4)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.A715G						.						153.0	130.0	138.0					10																	89717690		2203	4300	6503	SO:0001583	missense	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	AAGTTCATGTACT	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.715A>G	10.37:g.89717690A>G	ENSP00000361021:p.Met239Val	163	0		171	49	NM_000314	1	0	50	87	36	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980414	0.34942	.	.	ENSG00000171862	ENST00000371953	D	0.84660	-1.88	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.038168	0.85682	D	0.000000	T	0.73567	0.3603	N	0.13352	0.335	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.67983	-0.5529	9	.	.	.	-3.0578	14.9657	0.71193	1.0:0.0:0.0:0.0	.	239	P60484	PTEN_HUMAN	V	239	ENSP00000361021:M239V	.	M	+	1	0	PTEN	89707670	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.918000	0.92759	1.928000	0.55862	0.477000	0.44152	ATG	.		0.418	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
CFAP43	80217	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105928500	105928500	+	Splice_Site	SNP	A	A	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:105928500A>T	ENST00000278064.2	-	21	2810		c.e21+1		WDR96_ENST00000357060.3_Splice_Site|WDR96_ENST00000428666.1_Splice_Site																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCTATCTGTTACCTTAAGAGC	0.363																																					.													.	WDR96-95	0			c.2691+2T>A						.						140.0	130.0	134.0					10																	105928500		2203	4300	6503	SO:0001630	splice_region_variant	80217	exon22			TCTGTTACCTTAA																												ENST00000278064.2:c.2484+1T>A	10.37:g.105928500A>T		32	0		22	4	NM_025145	0	0	0	0	0		Splice_Site	SNP	ENST00000278064.2	37		.	.	.	.	.	.	.	.	.	.	A	19.19	3.779896	0.70222	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000434629;ENST00000278064	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4421	0.75190	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR96	105918490	1.000000	0.71417	0.998000	0.56505	0.747000	0.42532	6.878000	0.75567	2.170000	0.68504	0.533000	0.62120	.	.		0.363	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		Intron
PDZD8	118987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	119043959	119043959	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:119043959G>T	ENST00000334464.5	-	5	2524	c.2285C>A	c.(2284-2286)cCt>cAt	p.P762H	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	762					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TATAGCCTTAGGTGAGGGGGC	0.403																																					p.P762H		.											.	PDZD8-90	0			c.C2285A						.						125.0	111.0	116.0					10																	119043959		2203	4300	6503	SO:0001583	missense	118987	exon5			GCCTTAGGTGAGG	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2285C>A	10.37:g.119043959G>T	ENSP00000334642:p.Pro762His	70	0		68	23	NM_173791	0	0	10	21	11	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075899	0.76415	.	.	ENSG00000165650	ENST00000334464	D	0.87256	-2.23	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.90889	0.7137	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90836	0.4720	10	0.59425	D	0.04	-12.5235	20.4116	0.99017	0.0:0.0:1.0:0.0	.	762	Q8NEN9	PDZD8_HUMAN	H	762	ENSP00000334642:P762H	ENSP00000334642:P762H	P	-	2	0	PDZD8	119033949	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	9.869000	0.99810	2.827000	0.97445	0.655000	0.94253	CCT	.		0.403	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PWWP2B	170394	hgsc.bcm.edu	37	10	134218416	134218416	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:134218416C>T	ENST00000305233.5	+	2	471	c.412C>T	c.(412-414)Ctg>Ttg	p.L138L	PWWP2B_ENST00000368609.4_Silent_p.L138L	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	138	Pro-rich.									central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CACGTACAAGCTGTGGGTGCC	0.731																																					p.L138L		.											.	PWWP2B-90	0			c.C412T						.						11.0	10.0	10.0					10																	134218416		1839	3661	5500	SO:0001819	synonymous_variant	170394	exon2			TACAAGCTGTGGG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.412C>T	10.37:g.134218416C>T		0	0		5	4	NM_001098637	0	0	3	3	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			.		0.731	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1018068	1018068	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:1018068G>A	ENST00000421673.2	-	31	4783	c.4733C>T	c.(4732-4734)cCa>cTa	p.P1578L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1578	Pro-rich.|Thr-rich.		P -> S (in dbSNP:rs10736904).		cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCTGTAGGTGGGGAGTGTGT	0.582																																					p.P1578L		.											.	MUC6-23	0			c.C4733T						.						259.0	265.0	263.0					11																	1018068		2174	4263	6437	SO:0001583	missense	4588	exon31			GTAGGTGGGGAGT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4733C>T	11.37:g.1018068G>A	ENSP00000406861:p.Pro1578Leu	394	0		411	70	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	9.977	1.227087	0.22542	.	.	ENSG00000184956	ENST00000421673	T	0.15603	2.41	2.31	1.29	0.21616	.	.	.	.	.	T	0.12689	0.0308	L	0.46157	1.445	0.09310	N	1	B	0.24963	0.115	B	0.19946	0.027	T	0.38520	-0.9657	9	0.10902	T	0.67	.	8.0503	0.30575	0.0:0.0:0.7368:0.2632	.	1578	Q6W4X9	MUC6_HUMAN	L	1578	ENSP00000406861:P1578L	ENSP00000406861:P1578L	P	-	2	0	MUC6	1008068	0.000000	0.05858	0.001000	0.08648	0.150000	0.21749	-0.194000	0.09559	0.226000	0.20979	0.297000	0.19635	CCA	.		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	19	0		89	8	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1267042	1267042	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:1267042A>G	ENST00000529681.1	+	31	8990	c.8932A>G	c.(8932-8934)Agc>Ggc	p.S2978G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S2981G|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2978	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCGGCCACCAGCTCTACGGC	0.607																																					p.S2978G													.	.	0			c.A8932G						.						99.0	124.0	115.0					11																	1267042		2045	4175	6220	SO:0001583	missense	727897	exon31			GCCACCAGCTCTA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8932A>G	11.37:g.1267042A>G	ENSP00000436812:p.Ser2978Gly	589	3		843	248	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.432	-0.569998	0.03910	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.17370	2.28;2.46	3.57	-7.15	0.01521	.	.	.	.	.	T	0.13114	0.0318	L	0.53249	1.67	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.10450	0.003;0.005	T	0.33420	-0.9869	9	0.87932	D	0	.	4.0918	0.09973	0.1277:0.4665:0.2229:0.1828	.	3561;2981	A7Y9J9;E9PBJ0	.;.	G	2978;2981;2950;2938	ENSP00000436812:S2978G;ENSP00000415793:S2981G	ENSP00000343037:S2950G	S	+	1	0	MUC5B	1223618	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	1.206000	0.32321	-5.261000	0.00018	-0.449000	0.05564	AGC	.		0.607	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
AHNAK	79026	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62297916	62297916	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:62297916T>C	ENST00000378024.4	-	5	4247	c.3973A>G	c.(3973-3975)Atg>Gtg	p.M1325V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1325					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACATCAGGCATGGAGATCTTG	0.507																																					p.M1325V													.	AHNAK-109	0			c.A3973G						.						178.0	183.0	181.0					11																	62297916		2202	4299	6501	SO:0001583	missense	79026	exon5			CAGGCATGGAGAT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3973A>G	11.37:g.62297916T>C	ENSP00000367263:p.Met1325Val	186	1		185	67	NM_001620	0	0	3	9	6	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	12.65	2.001709	0.35320	.	.	ENSG00000124942	ENST00000378024	T	0.01745	4.66	4.63	3.5	0.40072	.	0.000000	0.38111	U	0.001806	T	0.03695	0.0105	M	0.81497	2.545	0.29409	N	0.861345	B	0.24675	0.109	B	0.33042	0.157	T	0.19224	-1.0312	10	0.12766	T	0.61	.	9.8561	0.41086	0.0:0.0827:0.0:0.9173	.	1325	Q09666	AHNK_HUMAN	V	1325	ENSP00000367263:M1325V	ENSP00000367263:M1325V	M	-	1	0	AHNAK	62054492	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.831000	0.39141	0.753000	0.32945	0.515000	0.50301	ATG	.		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
EEF1G	1937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62334912	62334912	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:62334912A>C	ENST00000329251.4	-	6	741	c.611T>G	c.(610-612)tTg>tGg	p.L204W	EEF1G_ENST00000378019.3_Missense_Mutation_p.L254W|MIR3654_ENST00000496634.2_3'UTR	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	204	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CACTTCGCCCAAGACAGCCCG	0.552																																					p.L204W		.											.	.	0			c.T611G						.						44.0	41.0	42.0					11																	62334912		1926	4135	6061	SO:0001583	missense	1937	exon6			TCGCCCAAGACAG	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.611T>G	11.37:g.62334912A>C	ENSP00000331901:p.Leu204Trp	70	0		99	32	NM_001404	0	0	1505	2605	1100	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	ENST00000329251.4	37	CCDS44626.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662133	0.88251	.	.	ENSG00000254772	ENST00000329251;ENST00000378019	T;T	0.21932	1.98;1.98	4.8	4.8	0.61643	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.64402	D	0.000002	T	0.54159	0.1841	M	0.92459	3.31	0.53005	D	0.999968	D;P	0.89917	1.0;0.905	D;P	0.80764	0.994;0.703	T	0.65487	-0.6156	10	0.72032	D	0.01	.	12.5918	0.56447	1.0:0.0:0.0:0.0	.	254;204	B4DTG2;P26641	.;EF1G_HUMAN	W	204;254	ENSP00000331901:L204W;ENSP00000367258:L254W	ENSP00000331901:L204W	L	-	2	0	EEF1G	62091488	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.903000	0.92573	1.928000	0.55862	0.459000	0.35465	TTG	.		0.552	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395047.1	NM_001404	
DGAT2	84649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	75509414	75509414	+	Missense_Mutation	SNP	G	G	C	rs145750206		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:75509414G>C	ENST00000228027.7	+	7	1212	c.952G>C	c.(952-954)Ggc>Cgc	p.G318R	RP11-535A19.1_ENST00000534354.1_RNA|DGAT2_ENST00000376262.3_Missense_Mutation_p.G275R	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2	318					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					CCATGGTCGAGGCCTCTTCTC	0.582																																					p.G318R	Melanoma(35;811 1096 8354 24009 39363)	.											.	DGAT2-226	0			c.G952C						.						84.0	72.0	76.0					11																	75509414		2200	4293	6493	SO:0001583	missense	84649	exon7			GGTCGAGGCCTCT		CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.952G>C	11.37:g.75509414G>C	ENSP00000228027:p.Gly318Arg	77	0		97	33	NM_032564	0	0	1	1	0	A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Missense_Mutation	SNP	ENST00000228027.7	37	CCDS31642.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248066	0.80024	.	.	ENSG00000062282	ENST00000228027;ENST00000376262;ENST00000525612	T;T	0.18960	2.18;2.18	5.59	4.68	0.58851	.	0.090338	0.85682	D	0.000000	T	0.44498	0.1296	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.74674	0.984;0.955	T	0.44862	-0.9300	10	0.87932	D	0	-19.5496	9.867	0.41150	0.1582:0.0:0.8418:0.0	.	275;318	Q96PD7-2;Q96PD7	.;DGAT2_HUMAN	R	318;275;272	ENSP00000228027:G318R;ENSP00000365438:G275R	ENSP00000228027:G318R	G	+	1	0	DGAT2	75187062	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.726000	0.68515	1.501000	0.48654	0.655000	0.94253	GGC	G|0.999;A|0.001		0.582	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383506.1	NM_032564	
DDX11	1663	ucsc.edu	37	12	31244689	31244689	+	Missense_Mutation	SNP	G	G	A	rs397842879		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:31244689G>A	ENST00000407793.2	+	10	1377	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T	DDX11_ENST00000350437.4_Missense_Mutation_p.A376T|DDX11_ENST00000228264.6_Missense_Mutation_p.A350T|DDX11_ENST00000545668.1_Missense_Mutation_p.A376T|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Missense_Mutation_p.A376T	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	376	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GCTGCATGCGGCCACTCGGCA	0.672										Multiple Myeloma(12;0.14)																											p.A376T													.	DDX11-229	0			c.G1126A						.						26.0	25.0	26.0					12																	31244689		2194	4289	6483	SO:0001583	missense	1663	exon10			CATGCGGCCACTC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1126G>A	12.37:g.31244689G>A	ENSP00000384703:p.Ala376Thr	128	20		344	30	NM_030653	0	0	3	7	4	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	7.984	0.751761	0.15778	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.71461	-0.57;1.0;-0.57;1.0;1.0	3.05	3.05	0.35203	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.324166	0.32703	N	0.005754	T	0.68109	0.2965	L	0.55834	1.745	0.80722	D	1	P;P;D;P;P	0.59767	0.633;0.814;0.986;0.814;0.905	P;B;P;B;B	0.49799	0.507;0.313;0.622;0.294;0.392	T	0.69300	-0.5181	10	0.56958	D	0.05	.	7.318	0.26511	0.0:0.0:0.738:0.262	.	101;350;376;376;376	Q93000;Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;.;DDX11_HUMAN;.;.	T	376;376;101;350;376;376	ENSP00000443426:A376T;ENSP00000384703:A376T;ENSP00000228264:A350T;ENSP00000440402:A376T;ENSP00000309965:A376T	ENSP00000228264:A350T	A	+	1	0	DDX11	31135956	0.935000	0.31712	0.573000	0.28510	0.048000	0.14542	1.665000	0.37449	1.535000	0.49220	0.505000	0.49811	GCC	.		0.672	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	31551284	31551284	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:31551284C>T	ENST00000389082.5	-	17	3345	c.3081G>A	c.(3079-3081)ggG>ggA	p.G1027G	DENND5B_ENST00000536562.1_Silent_p.G1062G|RNU6-618P_ENST00000363518.1_RNA|DENND5B_ENST00000306833.6_Silent_p.G1062G	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1027	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CCAGCCACCGCCCACATGGGA	0.453																																					p.G1027G		.											.	DENND5B-24	0			c.G3081A						.						45.0	41.0	42.0					12																	31551284		1778	3993	5771	SO:0001819	synonymous_variant	160518	exon17			CCACCGCCCACAT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3081G>A	12.37:g.31551284C>T		44	0		24	9	NM_144973	0	0	3	5	2	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	ENST00000389082.5	37	CCDS44857.1																																																																																			.		0.453	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
PRPH	5630	hgsc.bcm.edu	37	12	49689459	49689459	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:49689459G>A	ENST00000257860.4	+	1	1975	c.476G>A	c.(475-477)gGc>gAc	p.G159D	RP11-161H23.9_ENST00000553259.1_RNA	NM_006262.3	NP_006253.2	P23942	PRPH2_HUMAN	peripherin	0					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(8)|skin(1)	12						GAGCTGTTGGGCCGCGAGCGT	0.766																																					p.G159D		.											.	PRPH-90	0			c.G476A						.						2.0	3.0	3.0					12																	49689459		1611	3196	4807	SO:0001583	missense	5630	exon1			TGTTGGGCCGCGA		CCDS8783.1	12q12-q13	2013-01-16						"""Intermediate filaments type III"""	9461	protein-coding gene	gene with protein product		170710		NEF4		1378416	Standard	XM_005269025		Approved	PRPH1	uc001rtu.3	P41219		ENST00000257860.4:c.476G>A	12.37:g.49689459G>A	ENSP00000257860:p.Gly159Asp	0	0		7	4	NM_006262	0	0	0	0	0	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000257860.4	37	CCDS8783.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422107	0.62622	.	.	ENSG00000135406	ENST00000257860;ENST00000451891	D	0.88741	-2.42	4.51	2.61	0.31194	Filament (1);	0.000000	0.40554	N	0.001080	D	0.89022	0.6597	L	0.58669	1.825	0.46096	D	0.998869	P	0.46987	0.888	P	0.52109	0.69	D	0.84585	0.0663	10	0.18710	T	0.47	.	12.3528	0.55157	0.0:0.3262:0.6738:0.0	.	159	P41219	PERI_HUMAN	D	159;46	ENSP00000257860:G159D	ENSP00000257860:G159D	G	+	2	0	PRPH	47975726	0.835000	0.29415	0.999000	0.59377	0.608000	0.37181	1.757000	0.38400	0.501000	0.28013	0.462000	0.41574	GGC	.		0.766	PRPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393381.1	NM_006262	
KRT2	3849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53045499	53045499	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:53045499G>C	ENST00000309680.3	-	1	449	c.428C>G	c.(427-429)cCt>cGt	p.P143R		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	143	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GTATCCTCCAGGCCCAAAGCC	0.597																																					p.P143R		.											.	KRT2-92	0			c.C428G						.						82.0	83.0	83.0					12																	53045499		2203	4300	6503	SO:0001583	missense	3849	exon1			CCTCCAGGCCCAA		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.428C>G	12.37:g.53045499G>C	ENSP00000310861:p.Pro143Arg	120	0		117	39	NM_000423	0	0	0	0	0	Q4VAQ2	Missense_Mutation	SNP	ENST00000309680.3	37	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938619	0.52972	.	.	ENSG00000172867	ENST00000309680	D	0.85556	-2.0	5.54	5.54	0.83059	.	.	.	.	.	D	0.92296	0.7556	M	0.83603	2.65	0.38710	D	0.953191	D	0.76494	0.999	D	0.69307	0.963	D	0.93716	0.7028	9	0.87932	D	0	.	15.3671	0.74531	0.0:0.0:1.0:0.0	.	143	P35908	K22E_HUMAN	R	143	ENSP00000310861:P143R	ENSP00000310861:P143R	P	-	2	0	KRT2	51331766	0.164000	0.22935	0.998000	0.56505	0.983000	0.72400	-0.229000	0.09098	2.791000	0.96007	0.655000	0.94253	CCT	.		0.597	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A													.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	42	1		76	4	NM_001256282	0	0	329	329	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
MDM1	56890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	68696605	68696605	+	Silent	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:68696605T>A	ENST00000303145.7	-	12	1853	c.1767A>T	c.(1765-1767)atA>atT	p.I589I	MDM1_ENST00000411698.2_Silent_p.I554I|MDM1_ENST00000540418.1_Silent_p.I309I	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	589					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CAACTGTTTTTATACCAGCAG	0.358																																					p.I589I		.											.	MDM1-95	0			c.A1767T						.						90.0	92.0	91.0					12																	68696605		2203	4300	6503	SO:0001819	synonymous_variant	56890	exon12			TGTTTTTATACCA	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.1767A>T	12.37:g.68696605T>A		37	0		27	6	NM_017440	0	0	10	10	0	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Silent	SNP	ENST00000303145.7	37	CCDS8983.1																																																																																			.		0.358	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
BTBD11	121551	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	108035881	108035881	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:108035881T>G	ENST00000280758.5	+	14	3383	c.2855T>G	c.(2854-2856)cTc>cGc	p.L952R	BTBD11_ENST00000357167.4_Missense_Mutation_p.L489R|BTBD11_ENST00000420571.2_Missense_Mutation_p.L833R|BTBD11_ENST00000490090.2_Missense_Mutation_p.L952R|BTBD11_ENST00000494235.2_Missense_Mutation_p.L31R	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	952	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AAAGCACTCCTCTCCAGCAAG	0.458																																					p.L952R													.	BTBD11-93	0			c.T2855G						.						149.0	141.0	144.0					12																	108035881		2203	4300	6503	SO:0001583	missense	121551	exon14			CACTCCTCTCCAG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2855T>G	12.37:g.108035881T>G	ENSP00000280758:p.Leu952Arg	69	1		82	26	NM_001018072	0	0	1	1	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.034913	0.75617	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167;ENST00000494235	T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52	5.31	5.31	0.75309	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.059561	0.64402	D	0.000002	D	0.87931	0.6302	M	0.94021	3.485	0.40862	D	0.983844	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.83275	0.996;0.982;0.992	D	0.91528	0.5240	10	0.87932	D	0	.	15.2236	0.73333	0.0:0.0:0.0:1.0	.	489;952;952	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	R	952;833;952;489;31	ENSP00000280758:L952R;ENSP00000413889:L833R;ENSP00000447319:L952R;ENSP00000349690:L489R;ENSP00000448322:L31R	ENSP00000280758:L952R	L	+	2	0	BTBD11	106560011	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	6.855000	0.75445	2.138000	0.66242	0.459000	0.35465	CTC	.		0.458	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
SRRM4	84530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	119583229	119583229	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:119583229C>A	ENST00000267260.4	+	9	1203	c.815C>A	c.(814-816)gCc>gAc	p.A272D		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	272	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						ACCAAAACAGCCAGCCCGCTC	0.597																																					p.A272D		.											.	SRRM4-2	0			c.C815A						.						27.0	29.0	29.0					12																	119583229		1987	4156	6143	SO:0001583	missense	84530	exon9			AAACAGCCAGCCC	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.815C>A	12.37:g.119583229C>A	ENSP00000267260:p.Ala272Asp	81	0		106	28	NM_194286	0	0	0	0	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431158	0.43122	.	.	ENSG00000139767	ENST00000267260	T	0.23147	1.92	5.48	3.26	0.37387	.	0.608931	0.17277	N	0.180174	T	0.16854	0.0405	L	0.40543	1.245	0.33704	D	0.614946	B	0.12013	0.005	B	0.09377	0.004	T	0.13469	-1.0508	9	.	.	.	-16.4361	4.1827	0.10383	0.2661:0.5295:0.1154:0.089	.	272	A7MD48	SRRM4_HUMAN	D	272	ENSP00000267260:A272D	.	A	+	2	0	SRRM4	118067612	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.389000	0.34453	1.274000	0.44362	0.655000	0.94253	GCC	.		0.597	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
ATP12A	479	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	25265339	25265339	+	Missense_Mutation	SNP	T	T	C	rs372819883		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr13:25265339T>C	ENST00000381946.3	+	8	1186	c.1019T>C	c.(1018-1020)aTt>aCt	p.I340T	ATP12A_ENST00000218548.6_Missense_Mutation_p.I346T			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	340					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		ATCTTCCTCATTGGCATCATT	0.547																																					p.I346T	Pancreas(156;1582 1935 18898 22665 26498)												.	ATP12A-137	0			c.T1037C						.	T	THR/ILE,THR/ILE	1,4405	2.1+/-5.4	0,1,2202	106.0	79.0	88.0		1037,1019	5.2	1.0	13		88	0,8600		0,0,4300	no	missense,missense	ATP12A	NM_001185085.1,NM_001676.5	89,89	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging,probably-damaging	346/1046,340/1040	25265339	1,13005	2203	4300	6503	SO:0001583	missense	479	exon8			TCCTCATTGGCAT	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1019T>C	13.37:g.25265339T>C	ENSP00000371372:p.Ile340Thr	80	1		101	37	NM_001185085	0	0	0	0	0	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104092	0.76983	2.27E-4	0.0	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.92199	-2.99;-2.99	5.16	5.16	0.70880	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.96962	0.9008	H	0.94503	3.545	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.91635	0.995;0.999	D	0.97789	1.0237	10	0.87932	D	0	.	12.9956	0.58644	0.0:0.0:0.0:1.0	.	346;340	P54707-2;P54707	.;AT12A_HUMAN	T	346;340	ENSP00000218548:I346T;ENSP00000371372:I340T	ENSP00000218548:I346T	I	+	2	0	ATP12A	24163339	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.649000	0.83500	2.170000	0.68504	0.379000	0.24179	ATT	.		0.547	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
RABGGTA	5875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24734893	24734893	+	Silent	SNP	C	C	T	rs369935041		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:24734893C>T	ENST00000399409.3	-	16	2115	c.1632G>A	c.(1630-1632)ccG>ccA	p.P544P	RABGGTA_ENST00000216840.6_Silent_p.P544P|RABGGTA_ENST00000560777.1_Silent_p.P153P|TGM1_ENST00000206765.6_5'Flank|TGM1_ENST00000544573.1_5'Flank	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	544					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		CTTGGCACAGCGGGTTACCCT	0.612																																					p.P544P		.											.	.	0			c.G1632A						.	C	,	0,4034		0,0,2017	38.0	42.0	41.0		1632,1632	-4.9	0.9	14		41	1,8365		0,1,4182	no	coding-synonymous,coding-synonymous	RABGGTA	NM_004581.3,NM_182836.1	,	0,1,6199	TT,TC,CC		0.012,0.0,0.0081	,	544/568,544/568	24734893	1,12399	2017	4183	6200	SO:0001819	synonymous_variant	5875	exon16			GCACAGCGGGTTA		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.1632G>A	14.37:g.24734893C>T		119	0		116	40	NM_004581	0	0	19	27	8	A8K5N2|D3DS69	Silent	SNP	ENST00000399409.3	37	CCDS45088.1																																																																																			.		0.612	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836	
RALGAPA1	253959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	36143779	36143779	+	Silent	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:36143779A>C	ENST00000389698.3	-	22	3633	c.3243T>G	c.(3241-3243)ccT>ccG	p.P1081P	RALGAPA1_ENST00000382366.3_Silent_p.P1094P|RALGAPA1_ENST00000258840.6_Silent_p.P1128P|RALGAPA1_ENST00000307138.6_Silent_p.P1081P	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1081					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CATGTATTTCAGGATCCATGA	0.388																																					p.P1081P		.											.	RALGAPA1-138	0			c.T3243G						.						26.0	27.0	27.0					14																	36143779		2201	4288	6489	SO:0001819	synonymous_variant	253959	exon22			TATTTCAGGATCC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.3243T>G	14.37:g.36143779A>C		246	0		243	72	NM_194301	0	0	2	5	3	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	ENST00000389698.3	37	CCDS32065.1																																																																																			.		0.388	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
NPAP1	23742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	24923342	24923342	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr15:24923342C>T	ENST00000329468.2	+	1	2802	c.2328C>T	c.(2326-2328)gcC>gcT	p.A776A		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	776					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A776A(1)									AATTTGGGGCCCCTGATGGGC	0.552																																					p.A776A		.											.	.	1	Substitution - coding silent(1)	lung(1)	c.C2328T						.						109.0	128.0	121.0					15																	24923342		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			TGGGGCCCCTGAT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2328C>T	15.37:g.24923342C>T		20	0		34	14	NM_018958	0	0	0	0	0		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																			.		0.552	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
CILP	8483	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65495764	65495764	+	Missense_Mutation	SNP	C	C	G	rs185181701	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr15:65495764C>G	ENST00000261883.4	-	7	1130	c.964G>C	c.(964-966)Gct>Cct	p.A322P		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	322	Ig-like C2-type.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CTCTGCCCAGCTCTCCGTGCT	0.498																																					p.A322P													.	CILP-97	0			c.G964C						.						115.0	101.0	106.0					15																	65495764		2201	4299	6500	SO:0001583	missense	8483	exon7			GCCCAGCTCTCCG	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.964G>C	15.37:g.65495764C>G	ENSP00000261883:p.Ala322Pro	87	0		94	29	NM_003613	0	0	0	0	0	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511219	0.85389	.	.	ENSG00000138615	ENST00000261883	T	0.14391	2.51	5.24	4.12	0.48240	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.166542	0.52532	D	0.000066	T	0.20455	0.0492	L	0.42581	1.335	0.39174	D	0.962657	P	0.52316	0.952	P	0.51701	0.677	T	0.01537	-1.1330	10	0.59425	D	0.04	-1.8098	13.8023	0.63208	0.0:0.912:0.0:0.088	.	322	O75339	CILP1_HUMAN	P	322	ENSP00000261883:A322P	ENSP00000261883:A322P	A	-	1	0	CILP	63282817	0.977000	0.34250	1.000000	0.80357	0.978000	0.69477	4.030000	0.57260	2.446000	0.82766	0.561000	0.74099	GCT	C|0.999;T|0.001		0.498	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
ZNF75A	7627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3363138	3363138	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:3363138T>A	ENST00000574298.1	+	4	536	c.63T>A	c.(61-63)gaT>gaA	p.D21E	ZNF75A_ENST00000498240.2_Intron	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						TCTACAATGATGTAATGCAGG	0.408																																					p.D21E		.											.	ZNF75A-153	0			c.T63A						.						131.0	118.0	122.0					16																	3363138		2197	4300	6497	SO:0001583	missense	7627	exon4			CAATGATGTAATG	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.63T>A	16.37:g.3363138T>A	ENSP00000459566:p.Asp21Glu	112	0		170	84	NM_153028	0	0	1	3	2	Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	37	CCDS10501.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.452955	0.43531	.	.	ENSG00000162086	ENST00000293995	.	.	.	3.48	1.13	0.20643	Krueppel-associated box (4);	.	.	.	.	T	0.40694	0.1127	L	0.42487	1.325	0.80722	D	1	B	0.16603	0.018	B	0.16722	0.016	T	0.12760	-1.0535	8	0.22706	T	0.39	.	2.7142	0.05183	0.1927:0.2235:0.0:0.5838	.	21	Q96N20	ZN75A_HUMAN	E	21	.	ENSP00000293995:D21E	D	+	3	2	ZNF75A	3303139	0.292000	0.24362	0.996000	0.52242	0.996000	0.88848	-0.885000	0.04161	0.207000	0.20607	0.379000	0.24179	GAT	.		0.408	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251506.2	NM_153028	
IRX3	79191	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	54319068	54319068	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:54319068C>T	ENST00000329734.3	-	2	1437	c.725G>A	c.(724-726)gGc>gAc	p.G242D		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	242	Asp/Glu-rich (acidic).				mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						caggccctcgccccccgtgtc	0.687																																					p.G242D	GBM(143;1830 1866 4487 4646 37383)												.	IRX3-90	0			c.G725A						.						52.0	31.0	39.0					16																	54319068		2197	4299	6496	SO:0001583	missense	79191	exon2			CCCTCGCCCCCCG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.725G>A	16.37:g.54319068C>T	ENSP00000331608:p.Gly242Asp	48	1		130	37	NM_024336	0	0	27	50	23	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330432	0.24167	.	.	ENSG00000177508	ENST00000329734	T	0.52295	0.67	4.3	4.3	0.51218	.	0.274240	0.31257	N	0.007970	T	0.33440	0.0863	L	0.36672	1.1	0.32156	N	0.583631	P	0.38504	0.634	B	0.33690	0.168	T	0.36962	-0.9726	10	0.11182	T	0.66	-12.5443	14.2989	0.66334	0.0:1.0:0.0:0.0	.	242	P78415	IRX3_HUMAN	D	242	ENSP00000331608:G242D	ENSP00000331608:G242D	G	-	2	0	IRX3	52876569	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.575000	0.53870	2.221000	0.72209	0.455000	0.32223	GGC	.		0.687	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
GAS8	2622	bcgsc.ca	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S|GAS8_ENST00000536122.1_Intron|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																					p.G65S													.	C16orf3-90	1	Substitution - Missense(1)	lung(1)	c.G193A						.						25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	750	exon1			GGCAGCCTACGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T		134	1		324	17	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
ACADVL	37	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7127679	7127679	+	Silent	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:7127679T>C	ENST00000356839.5	+	16	1751	c.1572T>C	c.(1570-1572)ctT>ctC	p.L524L	MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000543245.2_Silent_p.L547L|ACADVL_ENST00000350303.5_Silent_p.L502L	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	524					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TCAGCGGACTTGTCCACCCGG	0.657																																					p.L547L		.											.	ACADVL-93	0			c.T1641C						.						54.0	54.0	54.0					17																	7127679		2203	4300	6503	SO:0001819	synonymous_variant	37	exon17			CGGACTTGTCCAC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1572T>C	17.37:g.7127679T>C		73	0		106	49	NM_001270447	1	0	178	507	328	B4DEB6|F5H2A9|O76056|Q8WUL0	Silent	SNP	ENST00000356839.5	37	CCDS11090.1																																																																																			.		0.657	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
POLR2A	5430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7405000	7405000	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:7405000G>A	ENST00000322644.6	+	14	2700	c.2301G>A	c.(2299-2301)aaG>aaA	p.K767K		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	767					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				ATAACTTCAAGTCTATGGTCG	0.488																																					p.K767K		.											.	POLR2A-91	0			c.G2301A						.						71.0	67.0	68.0					17																	7405000		2203	4300	6503	SO:0001819	synonymous_variant	5430	exon14			CTTCAAGTCTATG			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2301G>A	17.37:g.7405000G>A		88	0		140	34	NM_000937	0	0	0	0	0	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	37	CCDS32548.1																																																																																			.		0.488	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
SLC46A1	113235	ucsc.edu;bcgsc.ca	37	17	26731871	26731871	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:26731871A>C	ENST00000440501.1	-	2	939	c.844T>G	c.(844-846)Ttt>Gtt	p.F282V	SLC46A1_ENST00000321666.5_Missense_Mutation_p.F282V|CTD-2350C19.2_ENST00000580714.1_RNA|SLC46A1_ENST00000584729.1_5'UTR|CTD-2350C19.1_ENST00000583956.1_RNA	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1	282					cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	TGGGCCCCAAAGTGCACAGTG	0.532																																					p.F282V													.	SLC46A1-22	0			c.T844G						.						110.0	118.0	115.0					17																	26731871		2016	4183	6199	SO:0001583	missense	113235	exon2			CCCCAAAGTGCAC	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.844T>G	17.37:g.26731871A>C	ENSP00000395653:p.Phe282Val	196	2		256	48	NM_001242366	0	0	7	9	2	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Missense_Mutation	SNP	ENST00000440501.1	37		.	.	.	.	.	.	.	.	.	.	A	12.80	2.046796	0.36085	.	.	ENSG00000076351	ENST00000440501;ENST00000321666	T;T	0.81078	-1.45;-1.45	5.35	4.28	0.50868	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.461581	0.26262	N	0.025398	T	0.64972	0.2647	.	.	.	0.42947	D	0.994369	B;B;B	0.23249	0.009;0.082;0.026	B;B;B	0.25140	0.022;0.058;0.035	T	0.53823	-0.8384	9	0.16420	T	0.52	-7.2339	5.5623	0.17150	0.7666:0.0:0.0822:0.1512	.	282;282;282	B4DJ17;Q96NT5-2;Q96NT5	.;.;PCFT_HUMAN	V	282	ENSP00000395653:F282V;ENSP00000318828:F282V	ENSP00000318828:F282V	F	-	1	0	SLC46A1	23755998	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.341000	0.52151	0.893000	0.36288	0.460000	0.39030	TTT	.		0.532	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
MRPL45	84311	broad.mit.edu;bcgsc.ca	37	17	36478132	36478132	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:36478132C>T	ENST00000312513.5	+	7	945	c.784C>T	c.(784-786)Cat>Tat	p.H262Y		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	262						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTGGAGAATGCATACCAAGAT	0.507											OREG0024353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H262Y													.	MRPL45-90	0			c.C784T						.						127.0	105.0	112.0					17																	36478132		2203	4300	6503	SO:0001583	missense	84311	exon7			AGAATGCATACCA	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.784C>T	17.37:g.36478132C>T	ENSP00000308901:p.His262Tyr	92	2	863	119	63	NM_032351	0	0	28	82	54	A1L436|Q6ZMJ5	Missense_Mutation	SNP	ENST00000312513.5	37	CCDS11326.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.186161	0.57909	.	.	ENSG00000174100	ENST00000312513	T	0.18338	2.22	5.97	5.97	0.96955	.	0.094381	0.64402	N	0.000001	T	0.47154	0.1430	M	0.88181	2.935	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.51212	-0.8734	10	0.06625	T	0.88	-14.6417	20.0942	0.97832	0.0:1.0:0.0:0.0	.	262	Q9BRJ2	RM45_HUMAN	Y	262	ENSP00000308901:H262Y	ENSP00000308901:H262Y	H	+	1	0	MRPL45	33731659	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.771000	0.85420	2.855000	0.98099	0.536000	0.68110	CAT	.		0.507	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256792.3	NM_032351	
GPR179	440435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36492994	36492994	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:36492994C>T	ENST00000342292.4	-	4	1114	c.1094G>A	c.(1093-1095)aGc>aAc	p.S365N		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	365					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATCCATGCAGCTGGTGCAGCC	0.632																																					p.S365N		.											.	GPR179-93	0			c.G1094A						.						27.0	31.0	29.0					17																	36492994		2097	4237	6334	SO:0001583	missense	440435	exon4			ATGCAGCTGGTGC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1094G>A	17.37:g.36492994C>T	ENSP00000345060:p.Ser365Asn	25	0		78	14	NM_001004334	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554853	0.65425	.	.	ENSG00000188888	ENST00000342292	T	0.52295	0.67	5.19	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.36248	0.0960	L	0.46157	1.445	0.32221	N	0.57526	B	0.34290	0.447	B	0.32149	0.141	T	0.46331	-0.9199	10	0.37606	T	0.19	-10.9887	7.967	0.30104	0.0:0.6539:0.2598:0.0863	.	365	Q6PRD1	GP179_HUMAN	N	365	ENSP00000345060:S365N	ENSP00000345060:S365N	S	-	2	0	GPR179	33746520	0.669000	0.27502	0.999000	0.59377	0.940000	0.58332	0.856000	0.27818	2.709000	0.92574	0.561000	0.74099	AGC	.		0.632	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	12	0		69	15	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
OTOP3	347741	broad.mit.edu	37	17	72942796	72942796	+	Silent	SNP	G	G	A	rs200903740		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:72942796G>A	ENST00000328801.4	+	6	846	c.846G>A	c.(844-846)gcG>gcA	p.A282A		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	282						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					ATGCCACCGCGTGTGAAGCTT	0.567																																					p.A282A													.	OTOP3-69	0			c.G846A						.	G		0,4406		0,0,2203	132.0	125.0	127.0		846	2.1	0.1	17		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OTOP3	NM_178233.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		282/597	72942796	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	347741	exon6			CACCGCGTGTGAA	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.846G>A	17.37:g.72942796G>A		60	0		90	4	NM_178233	0	0	0	0	0		Silent	SNP	ENST00000328801.4	37	CCDS11709.1																																																																																			G|0.999;A|0.001		0.567	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233	
FLJ45079	400624	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	75879250	75879250	+	5'Flank	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:75879250C>T	ENST00000374983.2	-	0	0																								BRCA - Breast invasive adenocarcinoma(99;0.00524)|Lung(188;0.154)			CAGCCTTGGCCCTAGAGTGGG	0.597																																					.													.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CTTGGCCCTAGAG																													17.37:g.75879250C>T	Exception_encountered	51	0		66	16	.	0	0	0	0	0		RNA	SNP	ENST00000374983.2	37																																																																																				.		0.597	FLJ45079-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
CCDC40	55036	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	78055491	78055491	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:78055491C>A	ENST00000397545.4	+	11	1736	c.1709C>A	c.(1708-1710)aCc>aAc	p.T570N	CCDC40_ENST00000374877.3_Missense_Mutation_p.T570N	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	570					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AAGCTCACCACCCAGTGCCTG	0.562																																					p.T570N													.	CCDC40-71	0			c.C1709A						.						40.0	47.0	45.0					17																	78055491		2110	4238	6348	SO:0001583	missense	55036	exon11			TCACCACCCAGTG	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1709C>A	17.37:g.78055491C>A	ENSP00000380679:p.Thr570Asn	138	1		230	56	NM_017950	0	0	7	12	5	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	C	7.817	0.716970	0.15372	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.44482	0.92;0.94	5.35	3.24	0.37175	.	.	.	.	.	T	0.26991	0.0661	N	0.19112	0.55	0.09310	N	1	P;P	0.38767	0.514;0.646	B;B	0.33295	0.106;0.161	T	0.04737	-1.0930	9	0.20046	T	0.44	-8.4893	15.6447	0.77039	0.0:0.7408:0.2592:0.0	.	570;353	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	N	570	ENSP00000364011:T570N;ENSP00000380679:T570N	ENSP00000364011:T570N	T	+	2	0	CCDC40	75670086	0.009000	0.17119	0.131000	0.22000	0.525000	0.34531	1.890000	0.39728	1.203000	0.43233	0.655000	0.94253	ACC	.		0.562	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
MYL12B	103910	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	3273023	3273023	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr18:3273023C>G	ENST00000581193.1	+	2	510	c.127C>G	c.(127-129)Cag>Gag	p.Q43E	MYL12B_ENST00000237500.5_Missense_Mutation_p.Q43E|MYL12B_ENST00000584539.1_Missense_Mutation_p.Q43E|MYL12B_ENST00000400175.5_Missense_Mutation_p.Q43E	NM_001144945.1	NP_001138417.1	O14950	ML12B_HUMAN	myosin, light chain 12B, regulatory	43	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|regulation of cell shape (GO:0008360)	apical part of cell (GO:0045177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)|lung(2)	4						CATGATTGATCAGAACAGAGA	0.403																																					p.Q43E													.	MYL12B-90	0			c.C127G						.						202.0	190.0	194.0					18																	3273023		2203	4300	6503	SO:0001583	missense	103910	exon2			ATTGATCAGAACA	AY320408	CCDS11831.1	18p11.31	2013-01-10			ENSG00000118680	ENSG00000118680		"""Myosins / Light chain"", ""EF-hand domain containing"""	29827	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2"""	609211				11942626	Standard	NM_033546		Approved	MRLC2	uc002klt.4	O14950	OTTHUMG00000131510	ENST00000581193.1:c.127C>G	18.37:g.3273023C>G	ENSP00000463559:p.Gln43Glu	171	2		177	54	NM_033546	0	1	695	1283	587	D3DUH6|Q13182|Q7Z5Z4	Missense_Mutation	SNP	ENST00000581193.1	37	CCDS11831.1	.	.	.	.	.	.	.	.	.	.	C	33	5.221026	0.95139	.	.	ENSG00000118680	ENST00000237500;ENST00000400177;ENST00000400175;ENST00000400174	T;T	0.71103	-0.54;-0.54	5.66	5.66	0.87406	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81837	0.4907	M	0.82433	2.59	0.80722	D	1	D	0.60160	0.987	P	0.51833	0.681	D	0.84469	0.0598	10	0.87932	D	0	.	20.1076	0.97898	0.0:1.0:0.0:0.0	.	43	O14950	ML12B_HUMAN	E	43	ENSP00000237500:Q43E;ENSP00000383037:Q43E	ENSP00000237500:Q43E	Q	+	1	0	MYL12B	3263023	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.760000	0.85248	2.823000	0.97156	0.650000	0.86243	CAG	.		0.403	MYL12B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258908.1	NM_033546	
HMHA1	23526	hgsc.bcm.edu	37	19	1081736	1081736	+	Splice_Site	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:1081736A>C	ENST00000313093.2	+	18	2609	c.2378A>C	c.(2377-2379)aAg>aCg	p.K793T	HMHA1_ENST00000543365.1_Splice_Site_p.K676T|HMHA1_ENST00000590214.1_Splice_Site_p.K820T|HMHA1_ENST00000586866.1_Splice_Site_p.K797T|HMHA1_ENST00000590577.1_Splice_Site_p.K428T|HMHA1_ENST00000536472.1_Splice_Site_p.K661T|HMHA1_ENST00000539243.2_Splice_Site_p.K809T	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	793	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCGCACCAAGGTGAGGCGG	0.731																																					p.K809T		.											.	HMHA1-91	0			c.A2426C						.						6.0	7.0	7.0					19																	1081736		2129	4218	6347	SO:0001630	splice_region_variant	23526	exon18			GCACCAAGGTGAG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2379+1A>C	19.37:g.1081736A>C		2	0		31	10	NM_001258328	0	0	0	1	1	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	a	22.3	4.273106	0.80580	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	4.55	4.55	0.56014	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.43787	0.1263	L	0.49455	1.56	0.58432	D	0.999996	D;D;D;D;D	0.69078	0.997;0.993;0.996;0.993;0.995	D;D;D;P;D	0.74674	0.928;0.945;0.984;0.892;0.967	T	0.40421	-0.9564	10	0.87932	D	0	-45.2741	13.1017	0.59224	1.0:0.0:0.0:0.0	.	661;809;428;676;793	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	T	809;793;793;661;787;676	ENSP00000439601:K809T;ENSP00000316772:K793T;ENSP00000445109:K661T;ENSP00000438979:K676T	ENSP00000316772:K793T	K	+	2	0	HMHA1	1032736	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	8.654000	0.91092	1.684000	0.51022	0.449000	0.29647	AAG	.		0.731	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		Missense_Mutation
EVI5L	115704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7917990	7917990	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:7917990C>G	ENST00000270530.4	+	9	1202	c.1006C>G	c.(1006-1008)Ccc>Gcc	p.P336A	EVI5L_ENST00000538904.2_Missense_Mutation_p.P336A	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	336					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						GAGAGTGATCCCCCACCAGTT	0.627											OREG0025211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P336A		.											.	EVI5L-91	0			c.C1006G						.						123.0	122.0	123.0					19																	7917990		2203	4300	6503	SO:0001583	missense	115704	exon8			GTGATCCCCCACC	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1006C>G	19.37:g.7917990C>G	ENSP00000270530:p.Pro336Ala	79	0	645	112	43	NM_001159944	0	0	10	19	9	B9A6I9	Missense_Mutation	SNP	ENST00000270530.4	37	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277895	0.80692	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	T;T	0.23147	1.92;1.92	3.8	3.8	0.43715	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.46639	0.1403	M	0.64567	1.98	0.58432	D	0.999999	D;P	0.89917	1.0;0.951	D;P	0.91635	0.999;0.727	T	0.47497	-0.9113	10	0.59425	D	0.04	-42.9871	13.5149	0.61535	0.0:1.0:0.0:0.0	.	336;336	B9A6I9;Q96CN4	.;EVI5L_HUMAN	A	336	ENSP00000270530:P336A;ENSP00000445905:P336A	ENSP00000270530:P336A	P	+	1	0	EVI5L	7823990	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.584000	0.82572	2.124000	0.65301	0.462000	0.41574	CCC	.		0.627	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461347.1	NM_145245	
PGLYRP2	114770	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	15582776	15582776	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:15582776G>A	ENST00000340880.4	-	3	1748	c.1268C>T	c.(1267-1269)aCg>aTg	p.T423M	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.T423M	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	423					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						TGCGCAGCGCGTGAAGTCCGT	0.672																																					p.T423M		.											.	PGLYRP2-93	0			c.C1268T						.						63.0	53.0	56.0					19																	15582776		2203	4300	6503	SO:0001583	missense	114770	exon3			CAGCGCGTGAAGT	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1268C>T	19.37:g.15582776G>A	ENSP00000345968:p.Thr423Met	59	0		88	5	NM_052890	0	0	0	0	0	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	37	CCDS12330.2	.	.	.	.	.	.	.	.	.	.	G	6.484	0.457468	0.12342	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.14391	2.51;2.51	4.62	-7.33	0.01431	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	2.474620	0.01368	N	0.012465	T	0.17704	0.0425	L	0.60455	1.87	0.09310	N	1	P;P	0.52316	0.952;0.889	P;P	0.49597	0.616;0.505	T	0.48068	-0.9067	10	0.52906	T	0.07	-14.711	4.6458	0.12572	0.0767:0.2083:0.1616:0.5534	.	423;423	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	M	423	ENSP00000345968:T423M;ENSP00000292609:T423M	ENSP00000292609:T423M	T	-	2	0	PGLYRP2	15443776	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.143000	0.10296	-1.075000	0.03129	-1.001000	0.02504	ACG	.		0.672	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890	
TMEM38A	79041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16793291	16793291	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:16793291G>C	ENST00000187762.2	+	4	617	c.526G>C	c.(526-528)Gag>Cag	p.E176Q		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	176						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CTGGAAGCCAGAGACCAACGA	0.582																																					p.E176Q		.											.	TMEM38A-92	0			c.G526C						.						149.0	123.0	132.0					19																	16793291		2203	4300	6503	SO:0001583	missense	79041	exon4			AAGCCAGAGACCA	AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.526G>C	19.37:g.16793291G>C	ENSP00000187762:p.Glu176Gln	92	0		133	42	NM_024074	0	0	4	8	4	A8K9P9	Missense_Mutation	SNP	ENST00000187762.2	37	CCDS12349.1	.	.	.	.	.	.	.	.	.	.	g	24.0	4.482621	0.84747	.	.	ENSG00000072954	ENST00000187762	.	.	.	5.38	4.35	0.52113	.	0.053986	0.64402	D	0.000001	T	0.72835	0.3510	M	0.71206	2.165	0.58432	D	0.999998	D	0.57571	0.98	P	0.58130	0.833	T	0.74325	-0.3702	9	0.46703	T	0.11	-30.6059	13.1225	0.59336	0.077:0.0:0.923:0.0	.	176	Q9H6F2	TM38A_HUMAN	Q	176	.	ENSP00000187762:E176Q	E	+	1	0	TMEM38A	16654291	1.000000	0.71417	0.674000	0.29902	0.978000	0.69477	7.723000	0.84788	1.258000	0.44101	0.655000	0.94253	GAG	.		0.582	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462841.1	NM_024074	
BABAM1	29086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17384931	17384931	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:17384931T>C	ENST00000359435.4	+	5	674	c.481T>C	c.(481-483)Tcc>Ccc	p.S161P	BABAM1_ENST00000447614.2_Missense_Mutation_p.S161P|CTD-2278I10.6_ENST00000596542.1_Missense_Mutation_p.S83P|BABAM1_ENST00000601043.1_Missense_Mutation_p.S161P|BABAM1_ENST00000595632.1_Intron|BABAM1_ENST00000598188.1_Missense_Mutation_p.S161P|BABAM1_ENST00000448635.2_Intron	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	161	VWFA-like.				chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						TGGCCTGACCTCCGACCCCCG	0.667																																					p.S161P		.											.	.	0			c.T481C						.						57.0	66.0	63.0					19																	17384931		2060	4203	6263	SO:0001583	missense	29086	exon5			CTGACCTCCGACC	AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.481T>C	19.37:g.17384931T>C	ENSP00000352408:p.Ser161Pro	40	0		51	23	NM_014173	0	0	45	73	28	A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	ENST00000359435.4	37	CCDS46012.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812432	0.70912	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000300965	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.66939	2.045	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.77885	-0.2421	9	0.52906	T	0.07	-27.2018	14.0114	0.64498	0.0:0.0:0.0:1.0	.	161	Q9NWV8	BABA1_HUMAN	P	161;161;83	.	ENSP00000300965:S83P	S	+	1	0	BABAM1	17245931	1.000000	0.71417	0.979000	0.43373	0.276000	0.26787	5.510000	0.67018	2.192000	0.70111	0.533000	0.62120	TCC	.		0.667	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463471.1	NM_014173	
UNC13A	23025	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17767189	17767189	+	Silent	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:17767189G>T	ENST00000519716.2	-	10	785	c.786C>A	c.(784-786)cgC>cgA	p.R262R	UNC13A_ENST00000252773.7_Silent_p.R262R|UNC13A_ENST00000552293.1_Silent_p.R262R|UNC13A_ENST00000550896.1_Silent_p.R262R|UNC13A_ENST00000551649.1_Silent_p.R262R|UNC13A_ENST00000428389.2_Silent_p.R350R	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	262					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AAGAGGCATAGCGGCTGCTAC	0.632																																					p.R262R													.	UNC13A-25	0			c.C786A						.						8.0	8.0	8.0					19																	17767189		1983	4138	6121	SO:0001819	synonymous_variant	23025	exon10			GGCATAGCGGCTG	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.786C>A	19.37:g.17767189G>T		34	0		27	7	NM_001080421	0	0	0	0	0	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																			.		0.632	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
SUGP2	10147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19106027	19106027	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:19106027C>T	ENST00000601879.1	-	9	3351	c.3054G>A	c.(3052-3054)atG>atA	p.M1018I	SUGP2_ENST00000456085.2_Missense_Mutation_p.M787I|SUGP2_ENST00000600377.1_Missense_Mutation_p.M1032I|SUGP2_ENST00000452918.2_Missense_Mutation_p.M1018I|SUGP2_ENST00000337018.6_Missense_Mutation_p.M1018I|AC004447.2_ENST00000594142.1_RNA			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	1018	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCTTCTGCAGCATCTGGAAGC	0.627																																					p.M1018I		.											.	SUGP2-91	0			c.G3054A						.						64.0	53.0	57.0					19																	19106027		2203	4300	6503	SO:0001583	missense	10147	exon9			CTGCAGCATCTGG	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.3054G>A	19.37:g.19106027C>T	ENSP00000472286:p.Met1018Ile	61	0		57	19	NM_014884	0	0	21	39	18	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017731	0.93404	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.05	5.05	0.67936	D111/G-patch (3);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	M	0.73962	2.25	0.58432	D	0.999999	D;D;D	0.59357	0.969;0.985;0.969	D;D;D	0.72338	0.968;0.977;0.951	T	0.65627	-0.6122	10	0.72032	D	0.01	-26.6822	16.9459	0.86230	0.0:1.0:0.0:0.0	.	787;1018;1018	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	I	1018;966;1018;787	ENSP00000337926:M1018I;ENSP00000332373:M966I;ENSP00000389380:M1018I;ENSP00000409603:M787I	ENSP00000332373:M966I	M	-	3	0	SUGP2	18967027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.709000	0.74665	2.349000	0.79799	0.462000	0.41574	ATG	.		0.627	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
VSTM2B	342865	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	30018151	30018151	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:30018151T>C	ENST00000335523.7	+	2	201	c.116T>C	c.(115-117)gTa>gCa	p.V39A	CTC-525D6.1_ENST00000582581.1_RNA|CTC-525D6.2_ENST00000579268.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	39	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						GATGTGACAGTACGGGAGGGA	0.617																																					p.V39A		.											.	VSTM2B-68	0			c.T116C						.						48.0	55.0	53.0					19																	30018151		692	1591	2283	SO:0001583	missense	342865	exon2			TGACAGTACGGGA		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.116T>C	19.37:g.30018151T>C	ENSP00000335038:p.Val39Ala	52	0		69	13	NM_001146339	0	0	0	0	0		Missense_Mutation	SNP	ENST00000335523.7	37	CCDS46034.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545112	0.27652	.	.	ENSG00000187135	ENST00000335523	T	0.68903	-0.36	4.59	4.59	0.56863	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.084546	0.46442	D	0.000299	T	0.50633	0.1627	N	0.25380	0.74	0.36591	D	0.874093	B	0.30605	0.287	B	0.34138	0.176	T	0.51888	-0.8648	10	0.05721	T	0.95	-17.0186	13.3667	0.60689	0.0:0.0:0.0:1.0	.	39	A6NLU5	VTM2B_HUMAN	A	39	ENSP00000335038:V39A	ENSP00000335038:V39A	V	+	2	0	VSTM2B	34709991	0.958000	0.32768	0.995000	0.50966	0.994000	0.84299	1.650000	0.37292	1.938000	0.56188	0.444000	0.29173	GTA	.		0.617	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
TTC27	55622	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	33002960	33002960	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:33002960G>A	ENST00000317907.4	+	14	1923	c.1692G>A	c.(1690-1692)tgG>tgA	p.W564*		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	564										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						TCGGGGTGTGGTTTTCTCTCG	0.403																																					p.W564X													.	TTC27-90	0			c.G1692A						.						225.0	214.0	218.0					2																	33002960		2203	4300	6503	SO:0001587	stop_gained	55622	exon14			GGTGTGGTTTTCT	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1692G>A	2.37:g.33002960G>A	ENSP00000313953:p.Trp564*	142	1		114	40	NM_017735	0	0	8	9	1	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Nonsense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	40	8.398930	0.98794	.	.	ENSG00000018699	ENST00000317907	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7926	19.3169	0.94218	0.0:0.0:1.0:0.0	.	.	.	.	X	564	.	ENSP00000313953:W564X	W	+	3	0	TTC27	32856464	1.000000	0.71417	1.000000	0.80357	0.256000	0.26092	9.537000	0.98070	2.553000	0.86117	0.557000	0.71058	TGG	.		0.403	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
FAM98A	25940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	33813426	33813426	+	Silent	SNP	T	T	C	rs561820764		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:33813426T>C	ENST00000238823.8	-	4	638	c.498A>G	c.(496-498)caA>caG	p.Q166Q	FAM98A_ENST00000498340.1_Intron|FAM98A_ENST00000403368.1_Silent_p.Q166Q|FAM98A_ENST00000441530.2_Intron			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	166							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					CGCTGAAGAATTGGAACATAG	0.363																																					p.Q166Q		.											.	FAM98A-91	0			c.A498G						.						173.0	175.0	174.0					2																	33813426		2203	4300	6503	SO:0001819	synonymous_variant	25940	exon4			GAAGAATTGGAAC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.498A>G	2.37:g.33813426T>C		79	0		75	32	NM_015475	0	0	9	24	15	B2RNA2|Q9Y3Y6	Silent	SNP	ENST00000238823.8	37	CCDS33179.1																																																																																			.		0.363	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
ANTXR1	84168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	69409663	69409663	+	Silent	SNP	T	T	G	rs138963459	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:69409663T>G	ENST00000303714.4	+	16	1546	c.1224T>G	c.(1222-1224)gcT>gcG	p.A408A	RNU6-1216P_ENST00000362590.2_RNA|RNA5SP96_ENST00000516041.1_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	408					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						AAGAAGGTGCTAAGTTGGAAA	0.428									Familial Infantile Hemangioma				T|||	2	0.000399361	0.0	0.0	5008	,	,		20375	0.002		0.0	False		,,,				2504	0.0				p.A408A		.											.	ANTXR1-94	0			c.T1224G						.						119.0	112.0	114.0					2																	69409663		2203	4300	6503	SO:0001819	synonymous_variant	84168	exon16	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	AGGTGCTAAGTTG	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1224T>G	2.37:g.69409663T>G		93	0		85	24	NM_032208	0	0	14	22	8	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	37	CCDS1892.1																																																																																			T|1.000;G|0.000		0.428	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
TTC31	64427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74718487	74718487	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:74718487G>A	ENST00000233623.5	+	7	676	c.669G>A	c.(667-669)caG>caA	p.Q223Q	TTC31_ENST00000410003.1_Silent_p.Q223Q|TTC31_ENST00000442235.2_Silent_p.Q79Q|TTC31_ENST00000463189.1_3'UTR	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	223										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						TTCAGGGACAGTGTGGTGAAG	0.537																																					p.Q223Q		.											.	TTC31-90	0			c.G669A						.						127.0	138.0	134.0					2																	74718487		1930	4124	6054	SO:0001819	synonymous_variant	64427	exon7			GGGACAGTGTGGT	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.669G>A	2.37:g.74718487G>A		99	0		84	22	NM_022492	0	0	8	14	6	Q4KN40|Q53FD4|Q9H9F7	Silent	SNP	ENST00000233623.5	37	CCDS42701.1																																																																																			.		0.537	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	
SUCLG1	8802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	84652539	84652539	+	Splice_Site	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:84652539C>T	ENST00000393868.2	-	8	1224	c.1014G>A	c.(1012-1014)aaG>aaA	p.K338K	SUCLG1_ENST00000491123.1_5'UTR	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	338					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	TGGAGCTCACCTTGTAGATCG	0.532																																					p.K338K	Ovarian(48;203 1101 37206 40305 50790)	.											.	SUCLG1-90	0			c.G1014A						.						77.0	69.0	71.0					2																	84652539		2203	4300	6503	SO:0001630	splice_region_variant	8802	exon8			GCTCACCTTGTAG	Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.1014+1G>A	2.37:g.84652539C>T		98	0		119	36	NM_003849	0	0	2	4	2	Q9BWB0|Q9UNP6	Silent	SNP	ENST00000393868.2	37	CCDS1967.2																																																																																			.		0.532	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2	NM_003849	Silent
KCNIP3	30818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95976175	95976175	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:95976175A>G	ENST00000295225.5	+	2	223	c.88A>G	c.(88-90)Atc>Gtc	p.I30V	KCNIP3_ENST00000377181.2_Intron|KCNIP3_ENST00000360990.3_Missense_Mutation_p.I30V	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	30					apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		GAAGGAGGGTATCAAGTGGCA	0.622																																					p.I30V		.											.	KCNIP3-154	0			c.A88G						.						79.0	86.0	84.0					2																	95976175		2203	4300	6503	SO:0001583	missense	30818	exon2			GAGGGTATCAAGT	AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.88A>G	2.37:g.95976175A>G	ENSP00000295225:p.Ile30Val	356	1		364	110	NM_013434	0	0	0	0	0	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Missense_Mutation	SNP	ENST00000295225.5	37	CCDS2013.1	.	.	.	.	.	.	.	.	.	.	A	0.862	-0.734899	0.03111	.	.	ENSG00000115041	ENST00000295225;ENST00000360990	T;T	0.69926	-0.27;-0.44	5.02	-2.69	0.06022	.	1.487590	0.04089	N	0.310881	T	0.38983	0.1061	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23547	-1.0185	10	0.20519	T	0.43	.	11.1112	0.48235	0.6262:0.0:0.3738:0.0	.	30;30	Q9Y2W7;Q3YAC4	CSEN_HUMAN;.	V	30	ENSP00000295225:I30V;ENSP00000354261:I30V	ENSP00000295225:I30V	I	+	1	0	KCNIP3	95339902	0.154000	0.22792	0.361000	0.25849	0.847000	0.48162	0.311000	0.19380	-0.418000	0.07450	-0.810000	0.03169	ATC	.		0.622	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434	
KCNIP3	30818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	95976177	95976177	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:95976177C>T	ENST00000295225.5	+	2	225	c.90C>T	c.(88-90)atC>atT	p.I30I	KCNIP3_ENST00000377181.2_Intron|KCNIP3_ENST00000360990.3_Silent_p.I30I	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	30					apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		AGGAGGGTATCAAGTGGCAGA	0.627																																					p.I30I		.											.	KCNIP3-154	0			c.C90T						.						79.0	86.0	83.0					2																	95976177		2203	4300	6503	SO:0001819	synonymous_variant	30818	exon2			GGGTATCAAGTGG	AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.90C>T	2.37:g.95976177C>T		352	1		361	109	NM_013434	0	0	0	0	0	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Silent	SNP	ENST00000295225.5	37	CCDS2013.1																																																																																			.		0.627	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434	
SLC5A7	60482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	108604763	108604763	+	Nonsense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:108604763T>A	ENST00000264047.2	+	2	428	c.152T>A	c.(151-153)tTa>tAa	p.L51*	SLC5A7_ENST00000409059.1_Nonsense_Mutation_p.L51*|SLC5A7_ENST00000540517.1_Intron	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	51					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GATATTGGTTTATTGGTTGGT	0.532																																					p.L51X		.											.	SLC5A7-93	0			c.T152A						.						148.0	131.0	137.0					2																	108604763		2203	4300	6503	SO:0001587	stop_gained	60482	exon2			TTGGTTTATTGGT	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.152T>A	2.37:g.108604763T>A	ENSP00000264047:p.Leu51*	133	0		142	41	NM_021815	0	0	0	0	0	Q53TF2	Nonsense_Mutation	SNP	ENST00000264047.2	37	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	T	38	6.986976	0.97983	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-15.1779	16.3634	0.83296	0.0:0.0:0.0:1.0	.	.	.	.	X	51	.	ENSP00000264047:L51X	L	+	2	0	SLC5A7	107971195	1.000000	0.71417	0.256000	0.24389	0.386000	0.30323	7.655000	0.83696	2.324000	0.78689	0.533000	0.62120	TTA	.		0.532	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
ZRANB3	84083	hgsc.bcm.edu;broad.mit.edu	37	2	135988115	135988115	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:135988115C>T	ENST00000264159.6	-	13	2038	c.1922G>A	c.(1921-1923)tGt>tAt	p.C641Y	ZRANB3_ENST00000401392.1_Missense_Mutation_p.C641Y|ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000536680.1_Missense_Mutation_p.C641Y	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	641					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		ACACATTTCACAATAAGGTAA	0.473																																					p.C641Y		.											.	ZRANB3-658	0			c.G1922A						.						111.0	103.0	105.0					2																	135988115		1967	4164	6131	SO:0001583	missense	84083	exon13			ATTTCACAATAAG	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1922G>A	2.37:g.135988115C>T	ENSP00000264159:p.Cys641Tyr	94	0		96	5	NM_032143	0	0	6	6	0	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360568	0.61403	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.99797	-6.79;-6.79;-6.79	5.61	5.61	0.85477	Zinc finger, RanBP2-type (4);	0.047816	0.85682	D	0.000000	D	0.99864	0.9936	H	0.96175	3.78	0.49213	D	0.999763	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96707	0.9522	10	0.87932	D	0	-12.7436	17.4074	0.87477	0.0:1.0:0.0:0.0	.	641;641	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	Y	106;106;641;641;641	ENSP00000383979:C641Y;ENSP00000264159:C641Y;ENSP00000441320:C641Y	ENSP00000264159:C641Y	C	-	2	0	ZRANB3	135704585	1.000000	0.71417	0.995000	0.50966	0.454000	0.32378	5.258000	0.65479	2.638000	0.89438	0.563000	0.77884	TGT	.		0.473	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
SSB	6741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170667495	170667495	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:170667495A>C	ENST00000409333.1	+	10	1185	c.938A>C	c.(937-939)gAa>gCa	p.E313A	METTL5_ENST00000409837.1_Intron|SSB_ENST00000260956.4_Missense_Mutation_p.E313A			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	313					histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GTGGAAAAAGAAGCACTGAAG	0.348																																					p.E313A		.											.	SSB-94	0			c.A938C						.						66.0	68.0	67.0					2																	170667495		2203	4299	6502	SO:0001583	missense	6741	exon10			AAAAAGAAGCACT		CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.938A>C	2.37:g.170667495A>C	ENSP00000386636:p.Glu313Ala	139	0		133	42	NM_003142	0	0	64	121	57	Q15367|Q53XJ4	Missense_Mutation	SNP	ENST00000409333.1	37	CCDS2237.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.217202	0.39201	.	.	ENSG00000138385	ENST00000260956;ENST00000409005;ENST00000409333	T;T	0.47528	0.84;0.84	4.86	-0.881	0.10607	Nucleotide-binding, alpha-beta plait (1);RNA-binding motif (1);	0.493908	0.22411	N	0.060419	T	0.49508	0.1561	M	0.85710	2.77	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.12156	0.003;0.007	T	0.50285	-0.8846	10	0.31617	T	0.26	-0.5081	14.1431	0.65331	0.4664:0.5336:0.0:0.0	.	313;313	E9PFH8;P05455	.;LA_HUMAN	A	313	ENSP00000260956:E313A;ENSP00000386636:E313A	ENSP00000260956:E313A	E	+	2	0	SSB	170375741	1.000000	0.71417	0.890000	0.34922	0.989000	0.77384	1.295000	0.33377	-0.310000	0.08766	0.383000	0.25322	GAA	.		0.348	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333316.1	NM_003142	
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218678511	218678511	+	Silent	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:218678511C>G	ENST00000171887.4	-	26	4898	c.4446G>C	c.(4444-4446)ccG>ccC	p.P1482P	TNS1_ENST00000419504.1_Silent_p.P1469P|TNS1_ENST00000430930.1_Silent_p.P1461P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1482	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.P1482P(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGAAGGCCCCCGGCTCCTGGT	0.572																																					p.P1482P		.											.	TNS1-156	1	Substitution - coding silent(1)	large_intestine(1)	c.G4446C						.						58.0	58.0	58.0					2																	218678511		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon26			GGCCCCCGGCTCC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4446G>C	2.37:g.218678511C>G		124	0		110	34	NM_022648	0	0	16	22	6	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																			.		0.572	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
PTPRN	5798	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220164041	220164041	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:220164041A>T	ENST00000295718.2	-	11	1829	c.1589T>A	c.(1588-1590)gTg>gAg	p.V530E	PTPRN_ENST00000409251.3_Missense_Mutation_p.V501E|PTPRN_ENST00000497977.1_5'Flank|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Missense_Mutation_p.V440E	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	530					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TTGTTGGGTCACATCAGCCAA	0.557											OREG0015221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V530E													.	PTPRN-229	0			c.T1589A						.						167.0	161.0	163.0					2																	220164041		2203	4300	6503	SO:0001583	missense	5798	exon11			TGGGTCACATCAG		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1589T>A	2.37:g.220164041A>T	ENSP00000295718:p.Val530Glu	138	1	2264	138	57	NM_002846	0	0	0	0	0	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813832	0.90790	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.07800	3.36;3.17;3.16	5.59	5.59	0.84812	.	0.198382	0.31834	N	0.006989	T	0.27098	0.0664	M	0.68952	2.095	0.58432	D	0.999996	D;D	0.76494	0.999;0.992	D;D	0.68483	0.958;0.958	T	0.00756	-1.1579	10	0.87932	D	0	.	15.4479	0.75248	1.0:0.0:0.0:0.0	.	501;530	Q6NSL1;Q16849	.;PTPRN_HUMAN	E	501;530;501;440	ENSP00000386638:V501E;ENSP00000295718:V530E;ENSP00000444244:V440E	ENSP00000295718:V530E	V	-	2	0	PTPRN	219872285	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.728000	0.84847	2.120000	0.65058	0.459000	0.35465	GTG	.		0.557	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
PTPRN	5798	bcgsc.ca	37	2	220164916	220164916	+	Silent	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:220164916A>G	ENST00000295718.2	-	9	1467	c.1227T>C	c.(1225-1227)ccT>ccC	p.P409P	PTPRN_ENST00000409251.3_Silent_p.P409P|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.P319P	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	409					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TGGGGTGTCCAGGCATGGGGG	0.637																																					p.P409P													.	PTPRN-229	0			c.T1227C						.						61.0	69.0	66.0					2																	220164916		2203	4300	6503	SO:0001819	synonymous_variant	5798	exon9			GTGTCCAGGCATG		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1227T>C	2.37:g.220164916A>G		46	0		45	4	NM_002846	0	0	0	0	0	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	CCDS2440.1																																																																																			.		0.637	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
ANKMY1	51281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241465102	241465102	+	Splice_Site	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:241465102C>T	ENST00000272972.3	-	6	1282	c.1068G>A	c.(1066-1068)caG>caA	p.Q356Q	ANKMY1_ENST00000405002.1_Splice_Site_p.Q126Q|ANKMY1_ENST00000405523.3_Splice_Site_p.Q215Q|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000401804.1_Splice_Site_p.Q445Q|ANKMY1_ENST00000391987.1_Splice_Site_p.Q356Q|ANKMY1_ENST00000373320.4_Splice_Site_p.Q126Q|ANKMY1_ENST00000536462.1_Splice_Site_p.Q168Q|ANKMY1_ENST00000361678.4_Splice_Site_p.Q215Q|ANKMY1_ENST00000373318.2_Splice_Site_p.Q215Q|ANKMY1_ENST00000403283.1_Splice_Site_p.Q294Q|ANKMY1_ENST00000406958.1_Splice_Site_p.Q215Q	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	356							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGGGGCTTACCTGGGGCTCAG	0.587																																					p.Q356Q		.											.	ANKMY1-90	0			c.G1068A						.						78.0	68.0	72.0					2																	241465102		2202	4300	6502	SO:0001630	splice_region_variant	51281	exon6			GCTTACCTGGGGC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1068+1G>A	2.37:g.241465102C>T		118	0		121	45	NM_016552	0	0	0	0	0	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1																																																																																			.		0.587	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	Silent
JAG1	182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	10653490	10653490	+	Nonsense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:10653490A>C	ENST00000254958.5	-	2	761	c.246T>G	c.(244-246)taT>taG	p.Y82*	RP11-103J8.1_ENST00000605292.1_RNA	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	82					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CGCGGGACTGATACTCCTTGA	0.662									Alagille Syndrome																												p.Y82X		.											.	JAG1-1273	0			c.T246G						.						51.0	50.0	51.0					20																	10653490		2203	4299	6502	SO:0001587	stop_gained	182	exon2	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGACTGATACTCC	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.246T>G	20.37:g.10653490A>C	ENSP00000254958:p.Tyr82*	49	0		94	25	NM_000214	0	0	15	20	5	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Nonsense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	A	41	8.923643	0.99004	.	.	ENSG00000101384	ENST00000254958	.	.	.	5.28	1.45	0.22620	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9719	0.41759	0.4136:0.0:0.5864:0.0	.	.	.	.	X	82	.	ENSP00000254958:Y82X	Y	-	3	2	JAG1	10601490	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.053000	0.41326	0.554000	0.29061	0.459000	0.35465	TAT	.		0.662	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
DZANK1	55184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	18414380	18414380	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:18414380C>T	ENST00000358866.6	-	8	799	c.777G>A	c.(775-777)ttG>ttA	p.L259L	DZANK1_ENST00000329494.5_Silent_p.L261L|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000262547.5_Silent_p.L259L|RNA5SP476_ENST00000516613.1_RNA|DZANK1_ENST00000357236.4_Silent_p.L145L			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	259							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TCATGGGTACCAAGCTTCTGC	0.458																																					p.L259L		.											.	.	0			c.G777A						.						112.0	109.0	110.0					20																	18414380		2000	4182	6182	SO:0001819	synonymous_variant	55184	exon9			GGGTACCAAGCTT	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.777G>A	20.37:g.18414380C>T		68	0		61	14	NM_001099407	0	0	1	1	0	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Silent	SNP	ENST00000358866.6	37	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	C	0.837	-0.743265	0.03088	.	.	ENSG00000089091	ENST00000358866	.	.	.	4.97	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.6738	10.7045	0.45948	0.0:0.9065:0.0:0.0935	.	.	.	.	X	58	.	.	W	-	2	0	C20orf12	18362380	1.000000	0.71417	0.803000	0.32268	0.023000	0.10783	1.732000	0.38146	2.448000	0.82819	0.655000	0.94253	TGG	.		0.458	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
TRPC4AP	26133	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33622951	33622951	+	Silent	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:33622951G>T	ENST00000252015.2	-	8	1115	c.1026C>A	c.(1024-1026)gcC>gcA	p.A342A	TRPC4AP_ENST00000451813.2_Silent_p.A342A|TRPC4AP_ENST00000432634.2_Silent_p.A303A|TRPC4AP_ENST00000539834.1_5'UTR			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	342	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			ACTCCTCATTGGCCACTCGCA	0.537																																					p.A342A													.	TRPC4AP-91	0			c.C1026A						.						141.0	123.0	129.0					20																	33622951		2203	4300	6503	SO:0001819	synonymous_variant	26133	exon8			CTCATTGGCCACT	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1026C>A	20.37:g.33622951G>T		107	2		130	57	NM_199368	0	0	24	40	16	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Silent	SNP	ENST00000252015.2	37	CCDS13246.1																																																																																			.		0.537	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
SS18L1	26039	hgsc.bcm.edu	37	20	60738629	60738629	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:60738629C>A	ENST00000331758.3	+	6	698	c.672C>A	c.(670-672)agC>agA	p.S224R	SS18L1_ENST00000421564.1_Missense_Mutation_p.S224R|SS18L1_ENST00000370848.4_Missense_Mutation_p.S227R	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	224	Gln-rich.|Methionine-rich intra-molecular domain. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			GCCAGGGGAGCAGCATGATGG	0.731			T	SSX1	synovial sarcoma																																p.S224R		.		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	.	SS18L1-660	0			c.C672A						.						23.0	25.0	25.0					20																	60738629		2195	4294	6489	SO:0001583	missense	26039	exon6			GGGGAGCAGCATG	AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.672C>A	20.37:g.60738629C>A	ENSP00000333012:p.Ser224Arg	2	0		98	43	NM_198935	0	0	1	1	0	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Missense_Mutation	SNP	ENST00000331758.3	37	CCDS13491.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499248	0.64298	.	.	ENSG00000184402	ENST00000421564;ENST00000331758;ENST00000370848	T;T;T	0.32515	1.45;1.45;1.46	4.99	3.03	0.35002	.	0.269496	0.44483	D	0.000453	T	0.28499	0.0705	L	0.47716	1.5	0.25078	N	0.990947	P;P	0.45902	0.651;0.868	B;B	0.42319	0.198;0.383	T	0.11036	-1.0604	10	0.87932	D	0	-10.1574	11.0441	0.47849	0.0:0.8465:0.0:0.1535	.	224;224	B4DSR7;O75177	.;CREST_HUMAN	R	224;224;227	ENSP00000393999:S224R;ENSP00000333012:S224R;ENSP00000359885:S227R	ENSP00000333012:S224R	S	+	3	2	SS18L1	60172024	1.000000	0.71417	0.766000	0.31476	0.987000	0.75469	1.854000	0.39368	0.498000	0.27948	0.467000	0.42956	AGC	.		0.731	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2		
LAMA5	3911	broad.mit.edu	37	20	60895706	60895706	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:60895706A>C	ENST00000252999.3	-	50	6734	c.6668T>G	c.(6667-6669)cTg>cGg	p.L2223R		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2223	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.L2223R(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCGGGGGCCCAGGGGGCTCCG	0.706																																					p.L2223R													.	LAMA5-93	1	Substitution - Missense(1)	kidney(1)	c.T6668G						.																																			SO:0001583	missense	3911	exon50			GGGCCCAGGGGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6668T>G	20.37:g.60895706A>C	ENSP00000252999:p.Leu2223Arg	18	1		73	20	NM_005560	0	0	37	38	1	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	1.825	-0.471240	0.04445	.	.	ENSG00000130702	ENST00000252999	T	0.10860	2.83	4.01	-3.35	0.04928	Laminin I (1);	1.233460	0.05846	U	0.620293	T	0.06781	0.0173	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.43278	-0.9401	10	0.13470	T	0.59	.	6.2822	0.21013	0.5127:0.1317:0.3557:0.0	.	2223	O15230	LAMA5_HUMAN	R	2223	ENSP00000252999:L2223R	ENSP00000252999:L2223R	L	-	2	0	LAMA5	60329101	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-2.320000	0.01119	-0.781000	0.04548	-0.402000	0.06365	CTG	.		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
PWP2	5822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45534138	45534138	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr21:45534138T>C	ENST00000291576.7	+	4	432	c.305T>C	c.(304-306)gTg>gCg	p.V102A		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	102					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GTGCACAGTGTGTCCTTCTCC	0.652											OREG0026247	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V102A		.											.	PWP2-91	0			c.T305C						.						113.0	94.0	100.0					21																	45534138		2203	4300	6503	SO:0001583	missense	5822	exon4			ACAGTGTGTCCTT		CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.305T>C	21.37:g.45534138T>C	ENSP00000291576:p.Val102Ala	89	0	932	85	17	NM_005049	0	0	1	1	0	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	37	CCDS33579.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498423	0.64298	.	.	ENSG00000241945	ENST00000291576	T	0.50001	0.76	4.8	4.8	0.61643	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.213399	0.38720	N	0.001592	T	0.35451	0.0932	L	0.33624	1.015	0.46131	D	0.998884	B	0.31383	0.321	B	0.25506	0.061	T	0.21999	-1.0229	10	0.42905	T	0.14	-8.6121	12.8724	0.57972	0.0:0.0:0.0:1.0	.	102	Q15269	PWP2_HUMAN	A	102	ENSP00000291576:V102A	ENSP00000291576:V102A	V	+	2	0	PWP2	44358566	0.995000	0.38212	0.948000	0.38648	0.736000	0.42039	5.690000	0.68241	1.929000	0.55896	0.402000	0.26972	GTG	.		0.652	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
C22orf15	150248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24106287	24106287	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:24106287G>A	ENST00000402217.3	+	2	292	c.39G>A	c.(37-39)gtG>gtA	p.V13V	C22orf15_ENST00000305199.5_Silent_p.V13V|C22orf15_ENST00000382821.3_Silent_p.V13V	NM_182520.2	NP_872326.2	Q8WYQ4	CV015_HUMAN	chromosome 22 open reading frame 15	13										breast(1)|pancreas(1)	2		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				GCTGCTCGGTGCTGGTGAACA	0.602																																					p.V13V		.											.	C22orf15-90	0			c.G39A						.						86.0	90.0	89.0					22																	24106287		692	1591	2283	SO:0001819	synonymous_variant	150248	exon2			CTCGGTGCTGGTG	AB050773	CCDS13814.2	22q11.23	2012-11-13			ENSG00000169314	ENSG00000169314			15558	protein-coding gene	gene with protein product							Standard	NM_182520		Approved	FLJ36561, N27C7-3	uc011aja.2	Q8WYQ4	OTTHUMG00000150740	ENST00000402217.3:c.39G>A	22.37:g.24106287G>A		95	0		65	25	NM_182520	0	0	0	0	0	Q6ICJ7	Silent	SNP	ENST00000402217.3	37	CCDS13814.2																																																																																			.		0.602	C22orf15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319887.2	NM_182520	
GATSL3	652968	hgsc.bcm.edu	37	22	30685454	30685454	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:30685454C>T	ENST00000407689.3	-	1	162	c.33G>A	c.(31-33)cgG>cgA	p.R11R	GATSL3_ENST00000404953.3_Silent_p.R11R|GATSL3_ENST00000459785.1_5'Flank|RP1-130H16.18_ENST00000447976.1_Intron	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	11										breast(1)|endometrium(1)|lung(1)	3						CGCTCAGCACCCGCACCCGGT	0.741																																					p.R11R		.											.	GATSL3-135	0			c.G33A						.						11.0	18.0	16.0					22																	30685454		1870	4079	5949	SO:0001819	synonymous_variant	652968	exon1			CAGCACCCGCACC		CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.33G>A	22.37:g.30685454C>T		8	0		56	20	NM_001037666	0	0	2	3	1	O76052|Q96ND9|Q9UIE8	Silent	SNP	ENST00000407689.3	37	CCDS43001.1																																																																																			.		0.741	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320581.2	NM_001037666	
CBY1	25776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	39066951	39066951	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:39066951G>A	ENST00000216029.3	+	3	275	c.141G>A	c.(139-141)ctG>ctA	p.L47L	RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA|RP3-508I15.10_ENST00000423346.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	47					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					CTATGAACCTGGCAGGGCAAA	0.527																																					p.L90L		.											.	CBY1-91	0			c.G270A						.						144.0	143.0	143.0					22																	39066951		2203	4300	6503	SO:0001819	synonymous_variant	25776	exon4			GAACCTGGCAGGG	BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.141G>A	22.37:g.39066951G>A		64	0		67	14	NM_001002880	0	0	41	68	27	B2R4S2|Q66GT6|Q9UIK9	Silent	SNP	ENST00000216029.3	37	CCDS13974.1																																																																																			.		0.527	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320832.1	NM_015373	
KIAA0930	23313	broad.mit.edu	37	22	45599044	45599044	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:45599044C>T	ENST00000336156.5	-	7	744	c.679G>A	c.(679-681)Gca>Aca	p.A227T	KIAA0930_ENST00000474515.1_5'Flank|KIAA0930_ENST00000391627.2_Missense_Mutation_p.A193T|KIAA0930_ENST00000443310.3_Missense_Mutation_p.A209T|MIR1249_ENST00000408671.1_RNA|KIAA0930_ENST00000251993.7_Missense_Mutation_p.A232T	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	227										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						ATCTTCTGTGCCATGCGGGCG	0.667																																					p.A232T													.	KIAA0930-90	0			c.G694A						.						93.0	99.0	97.0					22																	45599044		2203	4300	6503	SO:0001583	missense	23313	exon7			TCTGTGCCATGCG	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.679G>A	22.37:g.45599044C>T	ENSP00000336720:p.Ala227Thr	39	1		98	30	NM_015264	0	0	41	73	32	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Missense_Mutation	SNP	ENST00000336156.5	37	CCDS33665.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.924082	0.73213	.	.	ENSG00000100364	ENST00000336156;ENST00000423262;ENST00000251993;ENST00000391627;ENST00000443310	.	.	.	4.88	3.85	0.44370	.	0.279975	0.39985	N	0.001216	T	0.54159	0.1841	L	0.49350	1.555	0.58432	D	0.999999	B;B;P;B	0.36990	0.089;0.294;0.577;0.437	B;B;B;B	0.38264	0.094;0.206;0.269;0.235	T	0.58885	-0.7557	9	0.62326	D	0.03	-31.0172	14.6102	0.68510	0.1469:0.8531:0.0:0.0	.	209;227;232;298	B0AZU2;Q6ICG6;Q6ICG6-2;Q8IUY4	.;K0930_HUMAN;.;.	T	227;112;232;193;209	.	ENSP00000251993:A232T	A	-	1	0	KIAA0930	43977708	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	7.226000	0.78060	1.052000	0.40392	0.555000	0.69702	GCA	.		0.667	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880	
CAMP	820	bcgsc.ca	37	3	48266885	48266885	+	Missense_Mutation	SNP	C	C	T	rs374668266		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:48266885C>T	ENST00000576243.1	+	4	624	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	CAMP_ENST00000296435.2_Missense_Mutation_p.R165W			P49913	CAMP_HUMAN	cathelicidin antimicrobial peptide	162					antibacterial humoral response (GO:0019731)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptidoglycan (GO:0071224)|cellular response to tumor necrosis factor (GO:0071356)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of growth of symbiont on or near host surface (GO:0044140)|phagosome maturation (GO:0090382)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	cell projection (GO:0042995)|cell wall (GO:0005618)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|specific granule (GO:0042581)		p.R162W(1)		endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000614)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGATTTTTTGCGGAATCTTGT	0.443																																					p.R165W													.	CAMP-91	1	Substitution - Missense(1)	endometrium(1)	c.C493T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	107.0	118.0	114.0		484	-9.0	0.0	3		114	0,8600		0,0,4300	no	missense	CAMP	NM_004345.4	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	162/171	48266885	1,13005	2203	4300	6503	SO:0001583	missense	820	exon4			TTTTTGCGGAATC	BC055089	CCDS2762.1, CCDS2762.2	3p21.3	2014-01-30			ENSG00000164047	ENSG00000164047		"""Endogenous ligands"""	1472	protein-coding gene	gene with protein product		600474				7624374	Standard	NM_004345		Approved	CAP18, FALL39, FALL-39, LL37	uc003csj.3	P49913	OTTHUMG00000133526	ENST00000576243.1:c.484C>T	3.37:g.48266885C>T	ENSP00000458149:p.Arg162Trp	36	0		62	5	NM_004345	0	0	0	0	0	Q71SN9	Missense_Mutation	SNP	ENST00000576243.1	37		.	.	.	.	.	.	.	.	.	.	C	11.52	1.662538	0.29515	2.27E-4	0.0	ENSG00000164047	ENST00000296435	.	.	.	4.51	-9.01	0.00744	Cathelicidin, antimicrobial peptide, C-terminal (1);	4.491740	0.00397	N	0.000045	T	0.18173	0.0436	N	0.19112	0.55	0.09310	N	1	D	0.58620	0.983	P	0.44394	0.448	T	0.47799	-0.9089	9	0.66056	D	0.02	-7.4456	4.5323	0.12011	0.416:0.3384:0.1735:0.0721	.	162	P49913	CAMP_HUMAN	W	162	.	ENSP00000296435:R162W	R	+	1	2	CAMP	48241889	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.240000	0.02914	-1.762000	0.01308	-2.178000	0.00318	CGG	.		0.443	CAMP-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_004345	
UBA7	7318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49842183	49842183	+	IGR	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:49842183A>C	ENST00000333486.3	-	0	3299				FAM212A_ENST00000333323.4_Missense_Mutation_p.E209D|MIR5193_ENST00000584510.1_RNA	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGGGAGTGAAGGGGGTGACG	0.652																																					p.E209D		.											.	.	0			c.A627C						.						78.0	78.0	78.0					3																	49842183		2203	4300	6503	SO:0001628	intergenic_variant	389119	exon2			GAGTGAAGGGGGT	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		3.37:g.49842183A>C		93	0		305	151	NM_203370	0	0	1	1	0	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673205	0.47781	.	.	ENSG00000185614	ENST00000333323	.	.	.	5.64	-0.363	0.12556	.	0.000000	0.52532	D	0.000077	T	0.61627	0.2362	L	0.44542	1.39	0.39146	D	0.962132	D	0.71674	0.998	D	0.63488	0.915	T	0.62358	-0.6871	9	0.56958	D	0.05	.	10.7234	0.46052	0.5054:0.0:0.4946:0.0	.	207	Q96EL1	CC054_HUMAN	D	209	.	ENSP00000329735:E209D	E	+	3	2	C3orf54	49817187	1.000000	0.71417	0.885000	0.34714	0.348000	0.29142	0.471000	0.22100	-0.003000	0.14444	0.459000	0.35465	GAA	.		0.652	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
ARHGAP31	57514	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	119099827	119099827	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:119099827A>G	ENST00000264245.4	+	4	957	c.425A>G	c.(424-426)cAc>cGc	p.H142R		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	142	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CCTCCATCCCACTATAGGTAA	0.493																																					p.H142R	Pancreas(7;176 297 5394 51128 51241)												.	ARHGAP31-92	0			c.A425G						.						84.0	84.0	84.0					3																	119099827		1967	4162	6129	SO:0001583	missense	57514	exon4			CATCCCACTATAG		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.425A>G	3.37:g.119099827A>G	ENSP00000264245:p.His142Arg	172	1		173	79	NM_020754	0	0	0	0	0	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119225	0.77323	.	.	ENSG00000031081	ENST00000264245;ENST00000543280;ENST00000482743	T;T	0.24538	2.66;1.85	5.18	5.18	0.71444	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.57460	0.2055	M	0.89840	3.065	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.66567	-0.5891	10	0.87932	D	0	.	12.9105	0.58177	1.0:0.0:0.0:0.0	.	142	Q2M1Z3	RHG31_HUMAN	R	142;142;113	ENSP00000264245:H142R;ENSP00000418429:H113R	ENSP00000264245:H142R	H	+	2	0	ARHGAP31	120582517	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.109000	0.89561	2.171000	0.68590	0.482000	0.46254	CAC	.		0.493	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121415217	121415217	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:121415217G>A	ENST00000340645.5	-	13	4263	c.4138C>T	c.(4138-4140)Caa>Taa	p.Q1380*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.Q1385*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1380					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CCAGCAATTTGTAGTTGGCTG	0.413																																					p.Q1385X		.											.	GOLGB1-161	0			c.C4153T						.						157.0	162.0	160.0					3																	121415217		2203	4299	6502	SO:0001587	stop_gained	2804	exon13			CAATTTGTAGTTG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.4138C>T	3.37:g.121415217G>A	ENSP00000341848:p.Gln1380*	40	0		59	12	NM_001256486	0	0	22	23	1	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	39	7.740962	0.98465	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	.	.	.	6.17	3.41	0.39046	.	0.324362	0.26746	N	0.022716	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.993	0.19478	0.0:0.6622:0.1652:0.1726	.	.	.	.	X	1380;1385;1344	.	ENSP00000341848:Q1380X	Q	-	1	0	GOLGB1	122897907	0.273000	0.24181	0.748000	0.31131	0.666000	0.39218	0.959000	0.29240	0.464000	0.27142	-0.165000	0.13383	CAA	.		0.413	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
ARMC8	25852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137982982	137982982	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:137982982C>T	ENST00000469044.1	+	14	1498	c.1227C>T	c.(1225-1227)caC>caT	p.H409H	NME9_ENST00000383180.2_Intron|NME9_ENST00000317876.4_Intron|ARMC8_ENST00000485396.1_Silent_p.H336H|ARMC8_ENST00000461822.1_Silent_p.H342H|ARMC8_ENST00000491704.1_Silent_p.H367H|ARMC8_ENST00000538260.1_Silent_p.H378H|NME9_ENST00000341790.5_Intron|ARMC8_ENST00000393058.3_Silent_p.H399H|NME9_ENST00000484930.1_Intron|ARMC8_ENST00000481646.1_Silent_p.H395H|NME9_ENST00000536478.1_Intron	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	409										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GATGTTTGCACAGTTTATCCA	0.368																																					p.H395H		.											.	ARMC8-90	0			c.C1185T						.						100.0	89.0	92.0					3																	137982982		1850	4099	5949	SO:0001819	synonymous_variant	25852	exon15			TTTGCACAGTTTA		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1227C>T	3.37:g.137982982C>T		55	0		83	24	NM_015396	0	0	0	0	0	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	ENST00000469044.1	37																																																																																				.		0.368	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
RBP1	5947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	139237296	139237296	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:139237296C>A	ENST00000232219.2	-	3	617	c.507G>T	c.(505-507)tgG>tgT	p.W169C	RP11-319G6.1_ENST00000515247.1_RNA	NM_002899.3	NP_002890.2	P09455	RET1_HUMAN	retinol binding protein 1, cellular	107					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	TCCACTGGGTCCAGCCACGCC	0.592																																					p.W169C		.											.	RBP1-514	0			c.G507T						.						120.0	95.0	104.0					3																	139237296		2203	4300	6503	SO:0001583	missense	5947	exon3			CTGGGTCCAGCCA		CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000232219.2:c.507G>T	3.37:g.139237296C>A	ENSP00000232219:p.Trp169Cys	69	0		86	25	NM_002899	0	0	40	43	3	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000232219.2	37	CCDS3110.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491184	0.84962	.	.	ENSG00000114115	ENST00000232219	T	0.23147	1.92	5.93	5.93	0.95920	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.54759	0.1878	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55477	-0.8135	10	0.72032	D	0.01	.	17.8376	0.88704	0.0:1.0:0.0:0.0	.	107	P09455	RET1_HUMAN	C	169	ENSP00000232219:W169C	ENSP00000232219:W169C	W	-	3	0	RBP1	140719986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.088000	0.76901	2.815000	0.96918	0.561000	0.74099	TGG	.		0.592	RBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341495.1	NM_002899	
LEPREL1	55214	ucsc.edu	37	3	189711953	189711953	+	Silent	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:189711953A>G	ENST00000319332.5	-	3	950	c.753T>C	c.(751-753)tgT>tgC	p.C251C	LEPREL1_ENST00000427335.2_Silent_p.C70C	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	251					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GAGGCCCCTCACATAGGGTCC	0.378																																					p.C251C													.	LEPREL1-155	0			c.T753C						.						78.0	79.0	78.0					3																	189711953		2203	4300	6503	SO:0001819	synonymous_variant	55214	exon3			CCCCTCACATAGG		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.753T>C	3.37:g.189711953A>G		30	0		40	4	NM_018192	0	0	22	22	0	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Silent	SNP	ENST00000319332.5	37	CCDS3294.1																																																																																			.		0.378	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
EXOC1	55763	hgsc.bcm.edu	37	4	56738102	56738102	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:56738102T>C	ENST00000381295.2	+	8	1400	c.1052T>C	c.(1051-1053)cTc>cCc	p.L351P	EXOC1_ENST00000346134.7_Missense_Mutation_p.L351P|EXOC1_ENST00000349598.6_Missense_Mutation_p.L351P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	351					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					GCCAGTCACCTCAACAATGTT	0.393																																					p.L351P		.											.	EXOC1-950	0			c.T1052C						.						76.0	76.0	76.0					4																	56738102		2203	4300	6503	SO:0001583	missense	55763	exon8			GTCACCTCAACAA	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1052T>C	4.37:g.56738102T>C	ENSP00000370695:p.Leu351Pro	129	0		73	4	NM_018261	0	0	22	22	0	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548026	0.86022	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.80813	0.4695	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83261	-0.0048	9	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	351;351	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	351	.	ENSP00000326514:L351P	L	+	2	0	EXOC1	56432859	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.546000	0.82137	2.323000	0.78572	0.528000	0.53228	CTC	.		0.393	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
REST	5978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57797826	57797826	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:57797826A>C	ENST00000309042.7	+	4	3116	c.2802A>C	c.(2800-2802)ttA>ttC	p.L934F		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	934					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					GTGAAACTTTAAATGGTAAAC	0.393																																					p.L934F		.											.	REST-232	0			c.A2802C						.						63.0	61.0	62.0					4																	57797826		2203	4300	6503	SO:0001583	missense	5978	exon4			AACTTTAAATGGT	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.2802A>C	4.37:g.57797826A>C	ENSP00000311816:p.Leu934Phe	153	0		110	43	NM_001193508	0	0	12	14	2	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	37	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698194	0.30142	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.09445	2.98	5.44	-0.433	0.12287	.	1.916850	0.03006	N	0.148774	T	0.10337	0.0253	L	0.44542	1.39	0.09310	N	1	B;B	0.22146	0.065;0.002	B;B	0.19946	0.027;0.003	T	0.36890	-0.9729	10	0.62326	D	0.03	3.7839	2.7257	0.05213	0.5094:0.2758:0.0816:0.1332	.	911;934	F8WAN5;Q13127	.;REST_HUMAN	F	934;911	ENSP00000311816:L934F	ENSP00000311816:L934F	L	+	3	2	REST	57492583	0.001000	0.12720	0.000000	0.03702	0.092000	0.18411	0.791000	0.26915	0.082000	0.17018	0.459000	0.35465	TTA	.		0.393	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
RAPGEF2	9693	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	160268070	160268070	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:160268070T>C	ENST00000264431.4	+	19	3568	c.3149T>C	c.(3148-3150)aTc>aCc	p.I1050T		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1050					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GCACATAAAATCAACCAGGGA	0.522																																					p.I1050T													.	RAPGEF2-637	0			c.T3149C						.						77.0	90.0	86.0					4																	160268070		2010	4186	6196	SO:0001583	missense	9693	exon19			ATAAAATCAACCA	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.3149T>C	4.37:g.160268070T>C	ENSP00000264431:p.Ile1050Thr	72	1		72	22	NM_014247	0	0	6	9	3	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.351|7.351	0.622902|0.622902	0.14193|0.14193	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000264431|ENST00000510253	T|.	0.36878|.	1.23|.	6.17|6.17	-4.18|-4.18	0.03846|0.03846	.|.	1.187630|.	0.05843|.	N|.	0.619694|.	T|T	0.15132|0.15132	0.0365|0.0365	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.12156|.	0.007|.	T|T	0.30909|0.30909	-0.9962|-0.9962	10|5	0.10636|.	T|.	0.68|.	.|.	7.3539|7.3539	0.26709|0.26709	0.0:0.3427:0.2057:0.4516|0.0:0.3427:0.2057:0.4516	.|.	1050|.	Q9Y4G8|.	RPGF2_HUMAN|.	T|P	1050|82	ENSP00000264431:I1050T|.	ENSP00000264431:I1050T|.	I|S	+|+	2|1	0|0	RAPGEF2|RAPGEF2	160487520|160487520	0.005000|0.005000	0.15991|0.15991	0.000000|0.000000	0.03702|0.03702	0.300000|0.300000	0.27592|0.27592	-0.012000|-0.012000	0.12699|0.12699	-0.941000|-0.941000	0.03700|0.03700	-1.931000|-1.931000	0.00510|0.00510	ATC|TCA	.		0.522	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
UFSP2	55325	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186334930	186334930	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:186334930T>C	ENST00000264689.6	-	7	897	c.781A>G	c.(781-783)Att>Gtt	p.I261V	Y_RNA_ENST00000384502.1_RNA|UFSP2_ENST00000502282.1_5'Flank	NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	261						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GGATTTCTAATGTAACCATCT	0.363																																					p.I261V													.	UFSP2-90	0			c.A781G						.						178.0	177.0	177.0					4																	186334930		2203	4300	6503	SO:0001583	missense	55325	exon7			TTCTAATGTAACC	AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.781A>G	4.37:g.186334930T>C	ENSP00000264689:p.Ile261Val	149	1		145	42	NM_018359	0	0	18	33	15	Q6IA77|Q96FS3	Missense_Mutation	SNP	ENST00000264689.6	37	CCDS3842.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.46|14.46	2.540584|2.540584	0.45280|0.45280	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000511485|ENST00000264689	.|T	.|0.30448	.|1.53	6.04|6.04	3.62|3.62	0.41486|0.41486	.|.	.|0.130647	.|0.52532	.|D	.|0.000066	T|T	0.24470|0.24470	0.0593|0.0593	L|L	0.44542|0.44542	1.39|1.39	0.36491|0.36491	D|D	0.86842|0.86842	.|B;B	.|0.15473	.|0.013;0.001	.|B;B	.|0.14023	.|0.006;0.01	T|T	0.14671|0.14671	-1.0464|-1.0464	5|10	.|0.49607	.|T	.|0.09	-25.5742|-25.5742	8.1278|8.1278	0.31010|0.31010	0.0:0.0717:0.3242:0.6041|0.0:0.0717:0.3242:0.6041	.|.	.|261;161	.|Q9NUQ7;B3KRI4	.|UFSP2_HUMAN;.	R|V	174|261	.|ENSP00000264689:I261V	.|ENSP00000264689:I261V	H|I	-|-	2|1	0|0	UFSP2|UFSP2	186571924|186571924	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.485000|4.485000	0.60279|0.60279	1.085000|1.085000	0.41206|0.41206	0.459000|0.459000	0.35465|0.35465	CAT|ATT	.		0.363	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360589.2	NM_018359	
C5orf30	90355	ucsc.edu;bcgsc.ca	37	5	102611692	102611692	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr5:102611692C>T	ENST00000319933.2	+	3	380	c.72C>T	c.(70-72)aaC>aaT	p.N24N	C5orf30_ENST00000510890.1_Silent_p.N24N|C5orf30_ENST00000515669.1_Silent_p.N24N	NM_033211.2	NP_149988.1	Q96GV9	CE030_HUMAN	chromosome 5 open reading frame 30	24					cilium morphogenesis (GO:0060271)|protein transport (GO:0015031)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9		all_cancers(142;2.22e-05)|all_epithelial(76;9.54e-08)|Prostate(80;0.0174)|Colorectal(57;0.0551)|Ovarian(225;0.11)|Lung NSC(167;0.136)|all_lung(232;0.18)		Epithelial(69;2.84e-14)|COAD - Colon adenocarcinoma(37;0.00762)		CTGAGGCCAACTCCCCGGGAA	0.567																																					p.N24N													.	C5orf30-68	0			c.C72T						.						41.0	42.0	42.0					5																	102611692		2203	4299	6502	SO:0001819	synonymous_variant	90355	exon3			GGCCAACTCCCCG		CCDS4095.1	5q21.1	2012-02-23			ENSG00000181751	ENSG00000181751			25052	protein-coding gene	gene with protein product						22085962	Standard	NM_033211		Approved	FLJ25291	uc003kog.1	Q96GV9	OTTHUMG00000128738	ENST00000319933.2:c.72C>T	5.37:g.102611692C>T		245	3		250	87	NM_033211	0	0	2	4	2		Silent	SNP	ENST00000319933.2	37	CCDS4095.1																																																																																			.		0.567	C5orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250649.1	NM_033211	
NQO2	4835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	3010268	3010268	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:3010268T>C	ENST00000338130.2	+	6	729	c.17T>C	c.(16-18)gTa>gCa	p.V6A	NQO2_ENST00000380430.1_Missense_Mutation_p.V6A|NQO2_ENST00000380455.4_Missense_Mutation_p.V6A|NQO2_ENST00000380441.1_Missense_Mutation_p.V6A|NQO2_ENST00000380454.4_Missense_Mutation_p.V6A|NQO2_ENST00000606474.1_3'UTR			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2	6					memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	GGTAAGAAAGTACTCATTGTC	0.423																																					p.V6A		.											.	NQO2-91	0			c.T17C						.						97.0	87.0	90.0					6																	3010268		2203	4300	6503	SO:0001583	missense	4835	exon3			AGAAAGTACTCAT	U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.17T>C	6.37:g.3010268T>C	ENSP00000337773:p.Val6Ala	123	0		104	30	NM_000904	0	0	0	0	0	B2R492|Q5TD04	Missense_Mutation	SNP	ENST00000338130.2	37	CCDS4481.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.034069	0.35893	.	.	ENSG00000124588	ENST00000426637;ENST00000380472;ENST00000538898;ENST00000397717;ENST00000338130;ENST00000380441;ENST00000380455;ENST00000380454;ENST00000380430	T;T;T;T;T;T;T;T	0.11930	2.81;2.73;2.73;2.81;2.81;2.81;2.81;2.81	5.63	5.63	0.86233	Flavodoxin-like fold (1);	0.123571	0.56097	D	0.000034	T	0.18800	0.0451	L	0.52823	1.66	0.44771	D	0.997777	P;D	0.89917	0.613;1.0	P;D	0.91635	0.851;0.999	T	0.06516	-1.0822	10	0.16896	T	0.51	-27.3633	13.5807	0.61901	0.0:0.0:0.0:1.0	.	6;53	P16083;Q59EN2	NQO2_HUMAN;.	A	6;6;53;6;6;6;6;6;6	ENSP00000406951:V6A;ENSP00000369839:V6A;ENSP00000380829:V6A;ENSP00000337773:V6A;ENSP00000369806:V6A;ENSP00000369822:V6A;ENSP00000369821:V6A;ENSP00000369795:V6A	ENSP00000337773:V6A	V	+	2	0	NQO2	2955267	0.985000	0.35326	1.000000	0.80357	0.371000	0.29859	1.927000	0.40094	2.140000	0.66376	0.460000	0.39030	GTA	.		0.423	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039651.1		
GABBR1	2550	hgsc.bcm.edu	37	6	29595420	29595420	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:29595420C>T	ENST00000377034.4	-	6	835	c.500G>A	c.(499-501)cGg>cAg	p.R167Q	GABBR1_ENST00000355973.3_Missense_Mutation_p.R50Q|GABBR1_ENST00000377016.4_Missense_Mutation_p.R105Q|GABBR1_ENST00000376977.3_Missense_Mutation_p.R167Q|GABBR1_ENST00000377012.4_Missense_Mutation_p.R50Q	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	167					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CACTGCGCGCCGTTCTGAGGA	0.716																																					p.R167Q		.											.	GABBR1-521	0			c.G500A						.						5.0	5.0	5.0					6																	29595420		1961	3937	5898	SO:0001583	missense	2550	exon6			GCGCGCCGTTCTG	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.500G>A	6.37:g.29595420C>T	ENSP00000366233:p.Arg167Gln	5	0		34	14	NM_001470	0	0	4	6	2	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313674	0.60414	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;T;D;D;T	0.82984	-1.67;-0.98;-1.57;-1.67;-0.45	3.25	3.25	0.37280	.	0.279410	0.27912	U	0.017356	T	0.57257	0.2041	L	0.46157	1.445	0.33376	D	0.574201	B;B;B;B	0.28208	0.071;0.065;0.063;0.203	B;B;B;B	0.21151	0.033;0.01;0.011;0.028	T	0.49263	-0.8958	10	0.22109	T	0.4	-24.9114	6.2007	0.20575	0.0:0.8596:0.0:0.1404	.	167;105;167;50	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	Q	50;167;105;50;167	ENSP00000348248:R50Q;ENSP00000366176:R167Q;ENSP00000366215:R105Q;ENSP00000366211:R50Q;ENSP00000366233:R167Q	ENSP00000348248:R50Q	R	-	2	0	GABBR1	29703399	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.661000	0.46758	1.645000	0.50612	0.455000	0.32223	CGG	.		0.716	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
NFKBIL1	4795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31526116	31526116	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:31526116G>A	ENST00000376148.4	+	4	988	c.874G>A	c.(874-876)Ggc>Agc	p.G292S	NFKBIL1_ENST00000376145.4_Missense_Mutation_p.G277S	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	292					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						AGCGGGGAGGGGCAGCCTCTG	0.711																																					p.G292S		.											.	NFKBIL1-90	0			c.G874A						.						7.0	7.0	7.0					6																	31526116		1474	2672	4146	SO:0001583	missense	4795	exon4			GGGAGGGGCAGCC	X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.874G>A	6.37:g.31526116G>A	ENSP00000365318:p.Gly292Ser	24	0		69	23	NM_005007	0	0	12	27	15	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Missense_Mutation	SNP	ENST00000376148.4	37	CCDS4700.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218538	0.39201	.	.	ENSG00000204498	ENST00000376146;ENST00000376148;ENST00000376145	T;T;T	0.30448	1.53;1.53;1.53	5.95	3.09	0.35607	.	0.261597	0.36555	N	0.002538	T	0.04318	0.0119	N	0.11560	0.145	0.31038	N	0.71666	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.39820	-0.9595	10	0.17369	T	0.5	-13.1009	5.6448	0.17584	0.1708:0.1613:0.6679:0.0	.	269;277;292	Q5STV6;Q5STV4;Q9UBC1	.;.;IKBL1_HUMAN	S	269;292;277	ENSP00000365316:G269S;ENSP00000365318:G292S;ENSP00000365315:G277S	ENSP00000365315:G277S	G	+	1	0	NFKBIL1	31634095	0.998000	0.40836	0.997000	0.53966	0.980000	0.70556	0.920000	0.28705	0.863000	0.35553	0.563000	0.77884	GGC	.		0.711	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076036.3	NM_005007	
ZBTB22	9278	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33284267	33284267	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:33284267A>G	ENST00000431845.2	-	2	578	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R	TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000489157.1_5'Flank|TAPBP_ENST00000434618.2_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.C143R	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						AGTTCAGTGCACTTGTCCACA	0.587																																					p.C143R													.	ZBTB22-69	0			c.T427C						.						111.0	108.0	109.0					6																	33284267		2203	4300	6503	SO:0001583	missense	9278	exon2			CAGTGCACTTGTC	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.427T>C	6.37:g.33284267A>G	ENSP00000407545:p.Cys143Arg	119	1		131	57	NM_001145338	0	0	16	29	13	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	37	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	A	16.56	3.158170	0.57368	.	.	ENSG00000236104	ENST00000418724;ENST00000431845;ENST00000441117	T;T;T	0.33438	1.41;1.41;1.41	4.24	4.24	0.50183	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.36555	N	0.002524	T	0.62270	0.2414	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75563	-0.3274	10	0.72032	D	0.01	.	11.3566	0.49620	1.0:0.0:0.0:0.0	.	143	O15209	ZBT22_HUMAN	R	143	ENSP00000404403:C143R;ENSP00000407545:C143R;ENSP00000413172:C143R	ENSP00000404403:C143R	C	-	1	0	ZBTB22	33392245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.104000	0.94239	1.784000	0.52394	0.450000	0.29827	TGC	.		0.587	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
LINC00336	401253	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33560882	33560882	+	RNA	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:33560882T>C	ENST00000477984.1	-	0	233					NR_027908.1		Q6ZUF6	NC336_HUMAN	long intergenic non-protein coding RNA 336																		GGGGACTTTGTCTCCATCATC	0.706																																					.													.	.	0			.						.						12.0	14.0	13.0					6																	33560882		2156	4204	6360			401253	.			ACTTTGTCTCCAT	AK125740		6p21.31	2012-10-12	2011-08-10	2011-08-10	ENSG00000197251	ENSG00000197251		"""Long non-coding RNAs"""	33813	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 227"", ""non-protein coding RNA 336"""	C6orf227, NCRNA00336			Standard	NR_027908		Approved	FLJ43752	uc003oew.1	Q6ZUF6	OTTHUMG00000159733		6.37:g.33560882T>C		51	0		106	44	.	0	0	0	0	0		RNA	SNP	ENST00000477984.1	37																																																																																				.		0.706	LINC00336-001	KNOWN	basic	antisense	antisense	OTTHUMT00000357085.1		
HCRTR2	3062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	55039411	55039411	+	Missense_Mutation	SNP	C	C	G	rs76774128		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:55039411C>G	ENST00000370862.3	+	1	362	c.26C>G	c.(25-27)tCc>tGc	p.S9C		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	9					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.P11fs*11(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTGGAGGACTCCCCCCCTTGT	0.567																																					p.S9C		.											.	HCRTR2-525	1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)	c.C26G						.						101.0	96.0	98.0					6																	55039411		2203	4300	6503	SO:0001583	missense	3062	exon1			AGGACTCCCCCCC	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.26C>G	6.37:g.55039411C>G	ENSP00000359899:p.Ser9Cys	91	0		130	47	NM_001526	0	0	0	0	0	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922205	0.33908	.	.	ENSG00000137252	ENST00000370862	T	0.62232	0.04	4.81	3.94	0.45596	.	0.414369	0.27084	N	0.021005	T	0.30572	0.0769	L	0.36672	1.1	0.32083	N	0.592878	B	0.02656	0.0	B	0.04013	0.001	T	0.14227	-1.0480	10	0.42905	T	0.14	.	8.2548	0.31748	0.0:0.7582:0.1587:0.0831	.	9	O43614	OX2R_HUMAN	C	9	ENSP00000359899:S9C	ENSP00000359899:S9C	S	+	2	0	HCRTR2	55147370	0.019000	0.18553	1.000000	0.80357	0.907000	0.53573	0.521000	0.22893	1.246000	0.43901	-0.257000	0.10917	TCC	.		0.567	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	75848659	75848659	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:75848659G>T	ENST00000322507.8	-	28	5285	c.4976C>A	c.(4975-4977)aCa>aAa	p.T1659K	COL12A1_ENST00000483888.2_Missense_Mutation_p.T1659K|COL12A1_ENST00000345356.6_Missense_Mutation_p.T495K|COL12A1_ENST00000416123.2_Missense_Mutation_p.T1659K	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1659	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTTTAAGTTTGTTGGGGCTGG	0.403																																					p.T1659K		.											.	COL12A1-142	0			c.C4976A						.						102.0	102.0	102.0					6																	75848659		1847	4078	5925	SO:0001583	missense	1303	exon28			AAGTTTGTTGGGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4976C>A	6.37:g.75848659G>T	ENSP00000325146:p.Thr1659Lys	64	0		63	16	NM_004370	0	0	2	2	0	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.188|0.188	-1.055736|-1.055736	0.01965|0.01965	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|T;T;T;T	.|0.57752	.|0.38;0.38;0.38;0.38	5.95|5.95	4.98|4.98	0.66077|0.66077	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.429258	.|0.26428	.|N	.|0.024432	T|T	0.11410|0.11410	0.0278|0.0278	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.08055	.|0.002;0.003	T|T	0.34850|0.34850	-0.9812|-0.9812	5|10	.|0.02654	.|T	.|1	.|.	5.5016|5.5016	0.16831|0.16831	0.1314:0.0:0.661:0.2076|0.1314:0.0:0.661:0.2076	.|.	.|495;1659	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	K|K	400|1659;1659;495;1659;1659	.|ENSP00000325146:T1659K;ENSP00000305147:T495K;ENSP00000412864:T1659K;ENSP00000421216:T1659K	.|ENSP00000325146:T1659K	N|T	-|-	3|2	2|0	COL12A1|COL12A1	75905379|75905379	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.021000|0.021000	0.10359|0.10359	2.434000|2.434000	0.44802|0.44802	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	AAC|ACA	.		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
FOXK1	221937	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	4794196	4794196	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:4794196A>C	ENST00000328914.4	+	3	853	c.853A>C	c.(853-855)Aag>Cag	p.K285Q	FOXK1_ENST00000446823.1_Missense_Mutation_p.K122Q	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GTTTGCAGCAAAGGCCGCGTC	0.662																																					p.K285Q													.	FOXK1-516	0			c.A853C						.						63.0	51.0	55.0					7																	4794196		2203	4300	6503	SO:0001583	missense	221937	exon3			GCAGCAAAGGCCG	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.853A>C	7.37:g.4794196A>C	ENSP00000328720:p.Lys285Gln	42	1		109	58	NM_001037165	0	0	2	6	4		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.336663	0.60963	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95918	-3.51;-3.85	5.23	5.23	0.72850	.	0.049490	0.85682	D	0.000000	D	0.88680	0.6502	L	0.29908	0.895	0.45342	D	0.998338	P;B;B	0.38922	0.651;0.053;0.045	B;B;B	0.30495	0.116;0.053;0.02	D	0.86192	0.1613	10	0.17832	T	0.49	.	8.9324	0.35680	0.9174:0.0:0.0826:0.0	.	285;168;122	P85037;F5H8G8;P85037-2	FOXK1_HUMAN;.;.	Q	122;49;285;168	ENSP00000394442:K122Q;ENSP00000328720:K285Q	ENSP00000328720:K285Q	K	+	1	0	FOXK1	4760722	1.000000	0.71417	0.901000	0.35422	0.980000	0.70556	7.413000	0.80104	1.977000	0.57605	0.528000	0.53228	AAG	.		0.662	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
AHR	196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	17375399	17375399	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:17375399G>C	ENST00000242057.4	+	9	1792	c.1149G>C	c.(1147-1149)caG>caC	p.Q383H	AHR_ENST00000492120.1_3'UTR	NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	383	PAC.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q383H(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TTGTAACTCAGAGACCACTAA	0.348																																					p.Q383H		.											.	AHR-227	2	Substitution - Missense(2)	lung(2)	c.G1149C						.						71.0	63.0	66.0					7																	17375399		2202	4300	6502	SO:0001583	missense	196	exon9			AACTCAGAGACCA	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.1149G>C	7.37:g.17375399G>C	ENSP00000242057:p.Gln383His	57	0		71	40	NM_001621	0	0	0	0	0	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930150	0.52759	.	.	ENSG00000106546	ENST00000242057	T	0.05447	3.44	5.98	-1.41	0.08941	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.43152	1.355	0.44798	D	0.997802	B	0.28128	0.201	B	0.31390	0.129	T	0.22277	-1.0221	10	0.62326	D	0.03	.	12.8346	0.57765	0.6126:0.0:0.3874:0.0	.	383	P35869	AHR_HUMAN	H	383	ENSP00000242057:Q383H	ENSP00000242057:Q383H	Q	+	3	2	AHR	17341924	0.995000	0.38212	0.977000	0.42913	0.859000	0.49053	0.361000	0.20267	-0.292000	0.08999	0.591000	0.81541	CAG	.		0.348	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AUTS2	26053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	69364300	69364300	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:69364300G>A	ENST00000342771.4	+	2	659	c.338G>A	c.(337-339)cGt>cAt	p.R113H	AUTS2_ENST00000403018.2_Missense_Mutation_p.R113H|AUTS2_ENST00000406775.2_Missense_Mutation_p.R113H	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	113								p.R113L(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCTCAGGAACGTGTGGAGAAA	0.473																																					p.R113H		.											.	AUTS2-92	1	Substitution - Missense(1)	lung(1)	c.G338A						.						86.0	79.0	81.0					7																	69364300		2203	4300	6503	SO:0001583	missense	26053	exon2			AGGAACGTGTGGA	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.338G>A	7.37:g.69364300G>A	ENSP00000344087:p.Arg113His	73	0		130	22	NM_001127231	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345953	0.82022	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	T;T	0.39787	1.06;1.08	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000019	T	0.56187	0.1968	L	0.46157	1.445	0.23872	N	0.9966	D;D;D	0.89917	0.997;0.994;1.0	P;P;D	0.69824	0.862;0.754;0.966	T	0.48980	-0.8986	9	.	.	.	-11.4592	14.7871	0.69810	0.0:0.2577:0.7423:0.0	.	113;113;113	Q8WXX7-2;Q8WXX7;Q6PJU5	.;AUTS2_HUMAN;.	H	113	ENSP00000385263:R113H;ENSP00000344087:R113H	.	R	+	2	0	AUTS2	69002236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.796000	0.62496	2.941000	0.99782	0.655000	0.94253	CGT	.		0.473	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
BAZ1B	9031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	72873963	72873963	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:72873963A>G	ENST00000339594.4	-	13	3673	c.3335T>C	c.(3334-3336)tTc>tCc	p.F1112S	BAZ1B_ENST00000404251.1_Missense_Mutation_p.F1112S	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1112					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGGAGCCATGAAGCCTTGGAG	0.398																																					p.F1112S	Esophageal Squamous(112;1167 1561 21085 43672 48228)	.											.	BAZ1B-159	0			c.T3335C						.						146.0	140.0	142.0					7																	72873963		2203	4300	6503	SO:0001583	missense	9031	exon13			GCCATGAAGCCTT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.3335T>C	7.37:g.72873963A>G	ENSP00000342434:p.Phe1112Ser	60	0		70	43	NM_032408	0	0	23	96	73	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	37	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.902860	0.92035	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.59364	0.27;0.27	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	L	0.32530	0.975	0.58432	D	0.999999	D	0.71674	0.998	D	0.71656	0.974	T	0.59963	-0.7355	10	0.22109	T	0.4	-20.6332	14.9627	0.71169	1.0:0.0:0.0:0.0	.	1112	Q9UIG0	BAZ1B_HUMAN	S	1112	ENSP00000342434:F1112S;ENSP00000385442:F1112S	ENSP00000342434:F1112S	F	-	2	0	BAZ1B	72511899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.697000	0.91307	2.125000	0.65367	0.533000	0.62120	TTC	.		0.398	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
CUX1	1523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	101882763	101882763	+	Silent	SNP	G	G	A	rs140169027		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:101882763G>A	ENST00000292535.7	+	23	3824	c.3786G>A	c.(3784-3786)gcG>gcA	p.A1262A	CUX1_ENST00000437600.4_Intron|AC005088.1_ENST00000580604.1_RNA|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000360264.3_Silent_p.A1273A|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.A1104A|CUX1_ENST00000546411.2_Silent_p.A1160A|CUX1_ENST00000549414.2_Silent_p.A1240A|CUX1_ENST00000550008.2_Silent_p.A1206A|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000547394.2_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1262					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TGAAACGAGCGTATCAGCAAA	0.597																																					p.A1273A		.											.	CUX1-160	0			c.G3819A						.	G	,,,,,,	0,4406		0,0,2203	113.0	109.0	110.0		3819,,,,,,3786	-9.8	0.0	7	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron,intron,intron,intron,intron,coding-synonymous	CUX1	NM_001202543.1,NM_001202544.1,NM_001202545.1,NM_001202546.1,NM_001913.3,NM_181500.2,NM_181552.3	,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	1273/1517,,,,,,1262/1506	101882763	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1523	exon23			ACGAGCGTATCAG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3786G>A	7.37:g.101882763G>A		57	0		158	98	NM_001202543	0	0	2	4	2	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	37	CCDS5721.1																																																																																			G|1.000;A|0.000		0.597	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151845991	151845991	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:151845991C>A	ENST00000262189.6	-	52	13239	c.13021G>T	c.(13021-13023)Ggg>Tgg	p.G4341W	KMT2C_ENST00000355193.2_Missense_Mutation_p.G4398W	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4341					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCTTCAAACCCACCATGGACA	0.493																																					p.G4341W		.											.	MLL3-1398	0			c.G13021T						.						63.0	59.0	60.0					7																	151845991		2203	4300	6503	SO:0001583	missense	58508	exon52			CAAACCCACCATG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13021G>T	7.37:g.151845991C>A	ENSP00000262189:p.Gly4341Trp	62	0		97	23	NM_170606	0	0	10	18	8	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.63|13.63	2.295838|2.295838	0.40594|0.40594	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.88975|.	-1.77;-1.77;-2.45|.	5.4|5.4	4.52|4.52	0.55395|0.55395	.|.	0.152286|.	0.29892|.	U|.	0.010923|.	T|T	0.64670|0.64670	0.2619|0.2619	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	D;D;D|.	0.69078|.	0.997;0.997;0.997|.	P;D;D|.	0.68483|.	0.907;0.958;0.958|.	T|T	0.63637|0.63637	-0.6592|-0.6592	10|5	0.49607|.	T|.	0.09|.	.|.	10.7105|10.7105	0.45980|0.45980	0.0:0.8351:0.0:0.1649|0.0:0.8351:0.0:0.1649	.|.	4341;3459;4398|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	W|L	4341;4398;958|1901	ENSP00000262189:G4341W;ENSP00000347325:G4398W;ENSP00000410411:G958W|.	ENSP00000262189:G4341W|.	G|W	-|-	1|2	0|0	MLL3|MLL3	151476924|151476924	0.007000|0.007000	0.16637|0.16637	0.015000|0.015000	0.15790|0.15790	0.970000|0.970000	0.65996|0.65996	1.934000|1.934000	0.40163|0.40163	1.273000|1.273000	0.44346|0.44346	0.650000|0.650000	0.86243|0.86243	GGG|TGG	.		0.493	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
VDAC3	7419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42259309	42259309	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:42259309G>C	ENST00000022615.4	+	7	395	c.327G>C	c.(325-327)aaG>aaC	p.K109N	VDAC3_ENST00000521158.1_Missense_Mutation_p.K110N|VDAC3_ENST00000392935.3_Missense_Mutation_p.K110N|VDAC3_ENST00000522572.1_Missense_Mutation_p.K110N			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	109					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATTGCAGAAAGAAGAGTGGGA	0.378																																					p.K110N		.											.	VDAC3-91	0			c.G330C						.						100.0	100.0	100.0					8																	42259309		2203	4300	6503	SO:0001583	missense	7419	exon7			CAGAAAGAAGAGT	AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.327G>C	8.37:g.42259309G>C	ENSP00000022615:p.Lys109Asn	64	0		72	22	NM_001135694	0	0	0	0	0	Q9UIS0	Missense_Mutation	SNP	ENST00000022615.4	37	CCDS6131.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761925	0.69763	.	.	ENSG00000078668	ENST00000518563;ENST00000392935;ENST00000520115;ENST00000522069;ENST00000522572;ENST00000521158;ENST00000022615	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.64713	0.2623	M	0.73962	2.25	0.80722	D	1	D	0.67145	0.996	D	0.70935	0.971	T	0.61936	-0.6960	10	0.40728	T	0.16	-12.3041	17.6115	0.88055	0.0:0.0:1.0:0.0	.	109	Q9Y277	VDAC3_HUMAN	N	77;110;109;109;110;110;109	ENSP00000428977:K77N;ENSP00000442811:K110N;ENSP00000428519:K109N;ENSP00000429006:K109N;ENSP00000428029:K110N;ENSP00000428845:K110N;ENSP00000022615:K109N	ENSP00000022615:K109N	K	+	3	2	VDAC3	42378466	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.582000	0.74049	2.832000	0.97577	0.650000	0.86243	AAG	.		0.378	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377574.1		
KCNS2	3788	bcgsc.ca	37	8	99440470	99440470	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:99440470G>A	ENST00000287042.4	+	2	613	c.263G>A	c.(262-264)gGc>gAc	p.G88D	KCNS2_ENST00000521839.1_Missense_Mutation_p.G88D	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	88					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.G88D(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TATCACACCGGCAAGCTTCAC	0.542																																					p.G88D	Pancreas(138;844 2489 9202 24627)												.	KCNS2-91	1	Substitution - Missense(1)	lung(1)	c.G263A						.						135.0	109.0	118.0					8																	99440470		2203	4300	6503	SO:0001583	missense	3788	exon2			ACACCGGCAAGCT	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.263G>A	8.37:g.99440470G>A	ENSP00000287042:p.Gly88Asp	91	2		105	36	NM_020697	0	0	0	0	0	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376631	0.82682	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	T;T	0.55930	0.49;0.49	5.41	5.41	0.78517	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.055844	0.64402	D	0.000001	T	0.80864	0.4705	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85918	0.1444	10	0.87932	D	0	.	19.1973	0.93695	0.0:0.0:1.0:0.0	.	88	Q9ULS6	KCNS2_HUMAN	D	88	ENSP00000287042:G88D;ENSP00000430712:G88D	ENSP00000287042:G88D	G	+	2	0	KCNS2	99509646	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.527000	0.85204	0.563000	0.77884	GGC	.		0.542	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
KIFC2	90990	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145694989	145694989	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:145694989C>A	ENST00000301332.2	+	12	1716	c.1339C>A	c.(1339-1341)Cgc>Agc	p.R447S	KIFC2_ENST00000301331.5_Missense_Mutation_p.R195S	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	447	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TCGTCGATTCCGCCTAGACTG	0.627																																					p.R447S													.	KIFC2-92	0			c.C1339A						.						54.0	52.0	52.0					8																	145694989		2203	4300	6503	SO:0001583	missense	90990	exon12			CGATTCCGCCTAG	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.1339C>A	8.37:g.145694989C>A	ENSP00000301332:p.Arg447Ser	42	1		49	22	NM_145754	0	0	10	23	13	E9PHB2|Q96NN6	Missense_Mutation	SNP	ENST00000301332.2	37	CCDS6427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.86|15.86	2.956735|2.956735	0.53293|0.53293	.|.	.|.	ENSG00000167702|ENSG00000167702	ENST00000528415|ENST00000301332;ENST00000301331	.|T;T	.|0.74002	.|-0.8;-0.8	4.89|4.89	2.09|2.09	0.27110|0.27110	.|Kinesin, motor domain (4);	.|0.254051	.|0.20863	.|N	.|0.084308	T|T	0.43964|0.43964	0.1271|0.1271	N|N	0.04090|0.04090	-0.28|-0.28	0.25734|0.25734	N|N	0.985236|0.985236	.|B	.|0.17268	.|0.021	.|B	.|0.18871	.|0.023	T|T	0.22836|0.22836	-1.0205|-1.0205	5|10	.|0.11794	.|T	.|0.64	-4.4523|-4.4523	4.0973|4.0973	0.09996|0.09996	0.0:0.5439:0.1773:0.2788|0.0:0.5439:0.1773:0.2788	.|.	.|447	.|Q96AC6	.|KIFC2_HUMAN	Q|S	267|447;195	.|ENSP00000301332:R447S;ENSP00000301331:R195S	.|ENSP00000301331:R195S	P|R	+|+	2|1	0|0	KIFC2|KIFC2	145665797|145665797	0.995000|0.995000	0.38212|0.38212	0.990000|0.990000	0.47175|0.47175	0.988000|0.988000	0.76386|0.76386	1.369000|1.369000	0.34227|0.34227	0.481000|0.481000	0.27557|0.27557	0.591000|0.591000	0.81541|0.81541	CCG|CGC	.		0.627	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754	
LINGO2	158038	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	27950499	27950499	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr9:27950499G>A	ENST00000379992.2	-	6	620	c.171C>T	c.(169-171)atC>atT	p.I57I	LINGO2_ENST00000308675.3_Silent_p.I57I	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	57	LRRNT.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTTTGGTTTCGATGGGAATGC	0.488																																					p.I57I													.	LINGO2-516	0			c.C171T						.						171.0	173.0	172.0					9																	27950499		2203	4300	6503	SO:0001819	synonymous_variant	158038	exon7			GGTTTCGATGGGA	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.171C>T	9.37:g.27950499G>A		210	1		184	54	NM_001258282	0	0	0	1	1	A8K4K7|B2RPM5|Q6ZMD0	Silent	SNP	ENST00000379992.2	37	CCDS6524.1																																																																																			.		0.488	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
CEP78	84131	broad.mit.edu;bcgsc.ca	37	9	80856624	80856624	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr9:80856624G>T	ENST00000424347.2	+	4	801	c.512G>T	c.(511-513)gGt>gTt	p.G171V	CEP78_ENST00000415759.2_Missense_Mutation_p.G171V|CEP78_ENST00000277082.5_Missense_Mutation_p.G171V|CEP78_ENST00000376597.4_Missense_Mutation_p.G171V|CEP78_ENST00000376598.2_Missense_Mutation_p.G171V			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	171					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						ATTTGTCAAGGTATAAAGAGC	0.343																																					p.G171V													.	CEP78-69	0			c.G512T						.						107.0	106.0	106.0					9																	80856624		1871	4098	5969	SO:0001583	missense	84131	exon4			GTCAAGGTATAAA	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.512G>T	9.37:g.80856624G>T	ENSP00000411284:p.Gly171Val	90	2		87	37	NM_001098802	0	0	0	0	0	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Missense_Mutation	SNP	ENST00000424347.2	37		.	.	.	.	.	.	.	.	.	.	g	14.78	2.638860	0.47153	.	.	ENSG00000148019	ENST00000424347;ENST00000415085;ENST00000415759;ENST00000376597;ENST00000277082;ENST00000376598	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.47	2.5	0.30297	.	0.389211	0.24111	N	0.041443	T	0.38348	0.1037	N	0.14661	0.345	0.51012	D	0.999906	B;P;P;B	0.52316	0.172;0.919;0.952;0.178	B;B;P;B	0.46543	0.05;0.321;0.52;0.035	T	0.26121	-1.0112	10	0.56958	D	0.05	-16.8963	10.0132	0.41999	0.0729:0.256:0.6711:0.0	.	84;171;171;171	B7Z8H9;E9PHX5;Q5JTW2-2;Q5JTW2	.;.;.;CEP78_HUMAN	V	171	ENSP00000411284:G171V;ENSP00000399286:G171V;ENSP00000365782:G171V;ENSP00000277082:G171V;ENSP00000365783:G171V	ENSP00000277082:G171V	G	+	2	0	CEP78	80046444	1.000000	0.71417	0.987000	0.45799	0.969000	0.65631	4.855000	0.62925	0.627000	0.30340	0.645000	0.84053	GGT	.		0.343	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
CRB2	286204	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	126125164	126125164	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr9:126125164C>T	ENST00000373631.3	+	2	116	c.115C>T	c.(115-117)Ccc>Tcc	p.P39S	CRB2_ENST00000359999.3_Missense_Mutation_p.P39S	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	39					cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TTCAGAGCCCCCCAGTGCCTG	0.652																																					p.P39S													.	CRB2-91	0			c.C115T						.						53.0	59.0	57.0					9																	126125164		2202	4294	6496	SO:0001583	missense	286204	exon2			GAGCCCCCCAGTG	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.115C>T	9.37:g.126125164C>T	ENSP00000362734:p.Pro39Ser	61	1		75	27	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297123	0.60086	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.85556	-2.0;-1.87	4.7	2.76	0.32466	.	1.331010	0.05353	N	0.532203	T	0.72293	0.3442	N	0.11064	0.09	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.58434	-0.7637	10	0.25106	T	0.35	.	8.3197	0.32121	0.0:0.7535:0.1563:0.0903	.	39;39	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	S	39	ENSP00000353092:P39S;ENSP00000362734:P39S	ENSP00000353092:P39S	P	+	1	0	CRB2	125164985	0.036000	0.19791	0.005000	0.12908	0.812000	0.45895	2.227000	0.42972	1.208000	0.43306	0.448000	0.29417	CCC	.		0.652	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
FIBCD1	84929	hgsc.bcm.edu	37	9	133813948	133813948	+	Missense_Mutation	SNP	T	T	C	rs199804534	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr9:133813948T>C	ENST00000372338.4	-	1	289	c.47A>G	c.(46-48)gAg>gGg	p.E16G	FIBCD1_ENST00000372337.2_5'Flank|FIBCD1_ENST00000253018.4_5'UTR|FIBCD1_ENST00000486250.1_5'UTR|RP11-83J21.3_ENST00000421067.1_RNA|FIBCD1_ENST00000448616.1_Missense_Mutation_p.E16G	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	16						integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CGGCCGGTCCTCAAGTTGGGC	0.771													T|||	2	0.000399361	0.0	0.0	5008	,	,		7809	0.0		0.002	False		,,,				2504	0.0				p.E16G		.											.	FIBCD1-90	0			c.A47G						.	T	GLY/GLU,GLY/GLU	0,3824		0,0,1912	5.0	5.0	5.0		47,47	4.0	1.0	9		5	11,7363		0,11,3676	yes	missense,missense	FIBCD1	NM_001145106.1,NM_032843.4	98,98	0,11,5588	CC,CT,TT		0.1492,0.0,0.0982	probably-damaging,probably-damaging	16/462,16/462	133813948	11,11187	1912	3687	5599	SO:0001583	missense	84929	exon2			CGGTCCTCAAGTT	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.47A>G	9.37:g.133813948T>C	ENSP00000361413:p.Glu16Gly	0	0		7	7	NM_001145106	0	0	0	0	0	A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	ENST00000372338.4	37	CCDS6937.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094138	0.76870	0.0	0.001492	ENSG00000130720	ENST00000448616;ENST00000454493;ENST00000372338;ENST00000451466	T;T;T	0.55413	0.52;0.52;1.07	4.01	4.01	0.46588	.	0.145716	0.45606	D	0.000357	T	0.50188	0.1601	L	0.32530	0.975	0.41099	D	0.985659	D;D	0.61080	0.989;0.989	P;P	0.52031	0.688;0.688	T	0.54655	-0.8261	10	0.72032	D	0.01	.	10.366	0.44024	0.0:0.0:0.0:1.0	.	16;16	A8K8X4;Q8N539	.;FBCD1_HUMAN	G	16	ENSP00000414501:E16G;ENSP00000361413:E16G;ENSP00000393894:E16G	ENSP00000361413:E16G	E	-	2	0	FIBCD1	132803769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.841000	0.55850	1.460000	0.47911	0.358000	0.22013	GAG	.		0.771	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	
SSX6	280657	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47976491	47976491	+	RNA	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chrX:47976491G>C	ENST00000509958.1	+	0	26							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						TGCCCGCCGGGAAAAGCAAGT	0.527																																					.													.	SSX6-130	0			.						.						113.0	112.0	112.0					X																	47976491		2197	4290	6487			280657	.			CGCCGGGAAAAGC	BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47976491G>C		549	0		566	163	.	0	0	0	0	0		RNA	SNP	ENST00000509958.1	37		.	.	.	.	.	.	.	.	.	.	.	11.30	1.598732	0.28445	.	.	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.70399	2.53;-0.48	2.19	0.35	0.16037	.	1.324090	0.05649	N	0.584860	T	0.55625	0.1932	.	.	.	0.09310	N	1	P	0.35507	0.506	B	0.32090	0.14	T	0.46020	-0.9221	9	0.48119	T	0.1	.	4.1214	0.10108	0.4024:0.0:0.5976:0.0	.	143	Q7RTT6	SSX6_HUMAN	A	143;45	ENSP00000366131:G143A;ENSP00000325176:G45A	ENSP00000325176:G45A	G	+	2	0	SSX6	47861435	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-1.099000	0.03343	-0.019000	0.14055	0.415000	0.27848	GGA	.		0.527	SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366	
SLC6A14	11254	broad.mit.edu	37	X	115568961	115568961	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chrX:115568961G>C	ENST00000371900.4	+	2	140	c.52G>C	c.(52-54)Gtg>Ctg	p.V18L		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	18					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TCCCCAGAAAGTGTCGGCTTC	0.393																																					p.V18L													.	SLC6A14-133	0			c.G52C						.						172.0	184.0	180.0					X																	115568961		2203	4300	6503	SO:0001583	missense	11254	exon2			CAGAAAGTGTCGG	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.52G>C	X.37:g.115568961G>C	ENSP00000360967:p.Val18Leu	56	2		43	10	NM_007231	0	0	0	0	0	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117382	0.37339	.	.	ENSG00000087916	ENST00000371900	T	0.72725	-0.68	5.17	5.17	0.71159	.	0.572600	0.16156	N	0.227033	T	0.46600	0.1401	N	0.08118	0	0.28155	N	0.929232	B	0.12013	0.005	B	0.09377	0.004	T	0.16600	-1.0397	10	0.05620	T	0.96	.	12.6956	0.57001	0.0:0.0:1.0:0.0	.	18	Q9UN76	S6A14_HUMAN	L	18	ENSP00000360967:V18L	ENSP00000360967:V18L	V	+	1	0	SLC6A14	115482989	0.995000	0.38212	0.976000	0.42696	0.957000	0.61999	2.073000	0.41519	2.393000	0.81446	0.544000	0.68410	GTG	.		0.393	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
VPS13D	55187	bcgsc.ca	37	1	12378145	12378145	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:12378145delT	ENST00000358136.3	+	31	7295	c.7165delT	c.(7165-7167)tccfs	p.S2389fs	VPS13D_ENST00000356315.4_Frame_Shift_Del_p.S2389fs	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAAGGATTCCTCCTGCTTTAC	0.358																																					p.S2389fs													.	VPS13D-95	0			c.7165delT						.						174.0	178.0	177.0					1																	12378145		2203	4300	6503	SO:0001589	frameshift_variant	55187	exon31			GATTCCTCCTGCT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7165delT	1.37:g.12378145delT	ENSP00000350854:p.Ser2389fs	51	0		30	6	NM_015378	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000358136.3	37	CCDS30588.1																																																																																			.		0.358	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
CCDC181	57821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169390718	169390718	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:169390718delA	ENST00000367806.3	-	3	1103	c.951delT	c.(949-951)tctfs	p.S317fs	CCDC181_ENST00000545005.1_Frame_Shift_Del_p.S317fs|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000367805.3_Frame_Shift_Del_p.S317fs	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	317						nucleus (GO:0005634)											TCCTGTGATTAGATTTCCCAT	0.463																																					p.S317fs		.											.	C1orf114-68	0			c.951delT						.						159.0	145.0	150.0					1																	169390718		2203	4300	6503	SO:0001589	frameshift_variant	57821	exon3			.	AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.951delT	1.37:g.169390718delA	ENSP00000356780:p.Ser317fs	73	0		77	35	NM_021179	0	0	0	0	0	O60780|Q53FD5|Q5TID9|Q8TC48	Frame_Shift_Del	DEL	ENST00000367806.3	37																																																																																				.		0.463	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1	NM_021179	
KLRC3	3823	hgsc.bcm.edu;broad.mit.edu	37	12	10573086	10573086	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:10573086delT	ENST00000396439.2	-	1	108	c.64delA	c.(64-66)aggfs	p.R22fs	NKG2-E_ENST00000539033.1_Intron|KLRC3_ENST00000381903.2_Frame_Shift_Del_p.R22fs|KLRC3_ENST00000381904.2_Frame_Shift_Del_p.R22fs	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	22					cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						TTAGGTTTCCTTTGCTGCCAC	0.438																																					p.R22fs		.											.	KLRC3-517	0			c.64delA						.						98.0	96.0	97.0					12																	10573086		2203	4297	6500	SO:0001589	frameshift_variant	3823	exon1			.	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.64delA	12.37:g.10573086delT	ENSP00000379716:p.Arg22fs	68	0		48	13	NM_007333	0	0	0	0	0	Q8WXA4|Q96RL0|Q9UP04	Frame_Shift_Del	DEL	ENST00000396439.2	37	CCDS41755.1																																																																																			.		0.438	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393471.1	NM_002261	
KLRC3	3823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	10588522	10588522	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:10588522delT	ENST00000539033.1	-	1	78	c.64delA	c.(64-66)aggfs	p.R22fs	KLRC2_ENST00000381902.2_Frame_Shift_Del_p.R22fs|KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381901.1_Frame_Shift_Del_p.R22fs																							TTAGGTTTCCTTTGCTGCCGC	0.438																																					p.R22fs		.											.	KLRC2-514	0			c.64delA						.						250.0	250.0	250.0					12																	10588522		2203	4300	6503	SO:0001589	frameshift_variant	3822	exon1			.																												ENST00000539033.1:c.64delA	12.37:g.10588522delT	ENSP00000437563:p.Arg22fs	146	0		154	34	NM_002260	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000539033.1	37																																																																																				.		0.438	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
TTLL5	23093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	76243163	76243163	+	Frame_Shift_Del	DEL	A	A	-	rs372279209		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:76243163delA	ENST00000298832.9	+	23	2562	c.2357delA	c.(2356-2358)gaafs	p.E786fs	TTLL5_ENST00000554510.1_Frame_Shift_Del_p.E295fs|TTLL5_ENST00000557636.1_Frame_Shift_Del_p.E800fs|TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000556893.1_Frame_Shift_Del_p.E337fs	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	786					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTGAATATGGAAAACTTTCAG	0.403																																					p.E786fs		.											.	TTLL5-92	0			c.2357delA						.						130.0	127.0	128.0					14																	76243163		2203	4300	6503	SO:0001589	frameshift_variant	23093	exon23			.	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2357delA	14.37:g.76243163delA	ENSP00000298832:p.Glu786fs	92	0		97	21	NM_015072	0	0	0	0	0	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Frame_Shift_Del	DEL	ENST00000298832.9	37	CCDS32124.1																																																																																			.		0.403	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
LOC81691	81691	broad.mit.edu;bcgsc.ca	37	16	20851720	20851720	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:20851720delG	ENST00000261377.6	+	15	1765	c.1556delG	c.(1555-1557)aggfs	p.R519fs	AC004381.6_ENST00000348433.6_Frame_Shift_Del_p.R519fs|ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000564274.1_Frame_Shift_Del_p.R519fs	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TGCAATCTCAGGGCTCTGAAG	0.408																																					p.R519fs													.	LOC81691-92	0			c.1556delG						.						113.0	115.0	115.0					16																	20851720		2201	4300	6501	SO:0001589	frameshift_variant	0	exon15			ATCTCAGGGCTCT																												ENST00000261377.6:c.1556delG	16.37:g.20851720delG	ENSP00000261377:p.Arg519fs	73	0		70	34	NM_030941	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000261377.6	37	CCDS10591.1																																																																																			.		0.408	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
GPATCH8	23131	hgsc.bcm.edu;bcgsc.ca	37	17	42475173	42475176	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TGAG	TGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:42475173_42475176delTGAG	ENST00000591680.1	-	8	4299_4302	c.4269_4272delCTCA	c.(4267-4272)cactcafs	p.HS1423fs	GPATCH8_ENST00000434000.1_Frame_Shift_Del_p.HS1345fs	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1423							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CAGGGATGATTGAGTGAGTGAGGT	0.588																																					p.1423_1424del		.											.	GPATCH8-94	0			c.4269_4272del						.																																			SO:0001589	frameshift_variant	23131	exon8			.	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.4269_4272delCTCA	17.37:g.42475181_42475184delTGAG	ENSP00000467556:p.His1423fs	206	0		263	112	NM_001002909	0	0	0	0	0	B9EGP9|O60300|Q8TB99	Frame_Shift_Del	DEL	ENST00000591680.1	37	CCDS32666.1																																																																																			.		0.588	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
HOOK2	29911	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	12874398	12874398	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:12874398delT	ENST00000397668.3	-	22	2027	c.1954delA	c.(1954-1956)agcfs	p.S652fs	HOOK2_ENST00000589965.1_5'Flank|HOOK2_ENST00000264827.5_Frame_Shift_Del_p.S650fs	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	652	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TGACTTCGGCTTTTCTCAAAG	0.522																																					p.S652fs		.											.	HOOK2-92	0			c.1954delA						.						185.0	194.0	191.0					19																	12874398		2203	4300	6503	SO:0001589	frameshift_variant	29911	exon22			.	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1954delA	19.37:g.12874398delT	ENSP00000380785:p.Ser652fs	121	0		118	40	NM_013312	0	0	0	0	0	O60562	Frame_Shift_Del	DEL	ENST00000397668.3	37	CCDS42508.1																																																																																			.		0.522	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	
NUP62	23636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50411616	50411633	+	In_Frame_Del	DEL	GTCCATGTGCGCATTGAG	GTCCATGTGCGCATTGAG	-	rs139913264|rs61751953|rs151075180		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	GTCCATGTGCGCATTGAG	GTCCATGTGCGCATTGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:50411616_50411633delGTCCATGTGCGCATTGAG	ENST00000596217.1	-	2	3319_3336	c.1432_1449delCTCAATGCGCACATGGAC	c.(1432-1449)ctcaatgcgcacatggacdel	p.LNAHMD478del	IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_In_Frame_Del_p.LNAHMD478del|NUP62_ENST00000597029.1_In_Frame_Del_p.LNAHMD478del|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597723.1_In_Frame_Del_p.LNAHMD402del|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000413454.1_In_Frame_Del_p.LNAHMD478del|NUP62_ENST00000422090.2_In_Frame_Del_p.LNAHMD478del			P37198	NUP62_HUMAN	nucleoporin 62kDa	478					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.A480A(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACTGCAGTGAGTCCATGTGCGCATTGAGGATCTTGCAG	0.628																																					p.478_483del		.											.	NUP62-615	1	Substitution - coding silent(1)	lung(1)	c.1432_1449del						.																																			SO:0001651	inframe_deletion	23636	exon3			.	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1432_1449delCTCAATGCGCACATGGAC	19.37:g.50411616_50411633delGTCCATGTGCGCATTGAG	ENSP00000471191:p.Leu478_Asp483del	47	0		62	17	NM_153719	0	0	0	0	0	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	In_Frame_Del	DEL	ENST00000596217.1	37	CCDS12788.1																																																																																			.		0.628	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
PRKCG	5582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	54401854	54401854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:54401854delC	ENST00000263431.3	+	11	1535	c.1253delC	c.(1252-1254)accfs	p.T418fs	PRKCG_ENST00000540413.1_Frame_Shift_Del_p.T418fs|PRKCG_ENST00000542049.1_Frame_Shift_Del_p.T305fs	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CACTTCCTCACCCAGCTCCAC	0.662																																					p.T418fs		.											.	PRKCG-1367	0			c.1253delC						.						12.0	13.0	13.0					19																	54401854		2200	4285	6485	SO:0001589	frameshift_variant	5582	exon11			.	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1253delC	19.37:g.54401854delC	ENSP00000263431:p.Thr418fs	52	0		71	28	NM_002739	0	0	0	0	0	B7Z8Q0	Frame_Shift_Del	DEL	ENST00000263431.3	37	CCDS12867.1																																																																																			.		0.662	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
BPIFA1	51297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	31829269	31829269	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:31829269delG	ENST00000354297.4	+	6	731	c.660delG	c.(658-660)cagfs	p.Q220fs	BPIFA1_ENST00000375413.4_Frame_Shift_Del_p.Q220fs|BPIFA1_ENST00000375422.2_Frame_Shift_Del_p.Q220fs	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	220				Q -> K (in Ref. 1; AAF70860). {ECO:0000305}.	antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										AGTTGGTTCAGGGCAACGTAA	0.512																																					p.Q220fs		.											.	.	0			c.660delG						.						164.0	158.0	160.0					20																	31829269		2203	4300	6503	SO:0001589	frameshift_variant	51297	exon6			.	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.660delG	20.37:g.31829269delG	ENSP00000346251:p.Gln220fs	115	0		85	20	NM_016583	0	0	0	0	0	A8K9R3|E1P5M9|Q9NZT0	Frame_Shift_Del	DEL	ENST00000354297.4	37	CCDS13217.1																																																																																			.		0.512	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
ROBO1	6091	broad.mit.edu	37	3	79639003	79639003	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:79639003delT	ENST00000464233.1	-	2	172	c.59delA	c.(58-60)aatfs	p.N20fs		NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	20					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAACAGGTGATTTGGGGATAA	0.393																																					p.N20fs													.	ROBO1-67	0			c.59delA						.						165.0	164.0	164.0					3																	79639003		1916	4117	6033	SO:0001589	frameshift_variant	6091	exon2			AGGTGATTTGGGG	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.59delA	3.37:g.79639003delT	ENSP00000420321:p.Asn20fs	153	0		167	11	NM_002941	0	0	0	0	0	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Frame_Shift_Del	DEL	ENST00000464233.1	37	CCDS54611.1																																																																																			.		0.393	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
PRPF4B	8899	bcgsc.ca	37	6	4032300	4032315	+	Frame_Shift_Del	DEL	AAGTAAAAGCAGATCC	AAGTAAAAGCAGATCC	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	AAGTAAAAGCAGATCC	AAGTAAAAGCAGATCC	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:4032300_4032315delAAGTAAAAGCAGATCC	ENST00000337659.6	+	2	649_664	c.549_564delAAGTAAAAGCAGATCC	c.(547-564)cgaagtaaaagcagatccfs	p.RSKSRS183fs	PRPF4B_ENST00000538861.1_Frame_Shift_Del_p.RSKSRS169fs	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	183	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CAAAGAAACGAAGTAAAAGCAGATCCAAAGAACGGA	0.356																																					p.183_188del													.	PRPF4B-1308	0			c.549_564del						.																																			SO:0001589	frameshift_variant	8899	exon2			GAAACGAAGTAAA	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.549_564delAAGTAAAAGCAGATCC	6.37:g.4032300_4032315delAAGTAAAAGCAGATCC	ENSP00000337194:p.Arg183fs	120	0		77	8	NM_003913	0	0	0	0	0	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Frame_Shift_Del	DEL	ENST00000337659.6	37	CCDS4488.1																																																																																			.		0.356	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
RSPH3	83861	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	159398820	159398821	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:159398820_159398821delTG	ENST00000252655.1	-	8	1621_1622	c.1432_1433delCA	c.(1432-1434)catfs	p.H478fs	RSPH3_ENST00000297262.3_Frame_Shift_Del_p.H382fs|RSPH3_ENST00000449822.1_Frame_Shift_Del_p.H240fs|RSPH3_ENST00000607398.1_5'Flank|RSPH3_ENST00000367069.2_Frame_Shift_Del_p.H336fs	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	478										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TGGAGACTGATGTGTGTCTTCC	0.48																																					p.478_478del		.											.	RSPH3-92	0			c.1432_1433del						.																																			SO:0001589	frameshift_variant	83861	exon8			.	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1432_1433delCA	6.37:g.159398824_159398825delTG	ENSP00000252655:p.His478fs	72	0		77	23	NM_031924	0	0	0	0	0	Q96LQ5|Q96LX2|Q9BX75	Frame_Shift_Del	DEL	ENST00000252655.1	37	CCDS5260.1																																																																																			.		0.480	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151873882	151873883	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:151873882_151873883delTT	ENST00000262189.6	-	38	8873_8874	c.8655_8656delAA	c.(8653-8658)gaaactfs	p.ET2885fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.ET2885fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2885					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGGCCAGCAGTTTCTCGATTGG	0.441																																					p.2885_2886del		.											.	MLL3-1398	0			c.8655_8656del						.																																			SO:0001589	frameshift_variant	58508	exon38			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8655_8656delAA	7.37:g.151873882_151873883delTT	ENSP00000262189:p.Glu2885fs	98	0		164	98	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.441	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SLC7A13	157724	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	87235298	87235298	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:87235298delT	ENST00000297524.3	-	2	823	c.720delA	c.(718-720)aaafs	p.K240fs	SLC7A13_ENST00000520624.1_5'UTR|SLC7A13_ENST00000419776.2_Frame_Shift_Del_p.K231fs	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	240						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						TAAATATGCATTTGGGAATTG	0.363																																					p.K240fs		.											.	SLC7A13-90	0			c.720delA						.						147.0	152.0	150.0					8																	87235298		2203	4300	6503	SO:0001589	frameshift_variant	157724	exon2			.	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.720delA	8.37:g.87235298delT	ENSP00000297524:p.Lys240fs	47	0		55	16	NM_138817	0	0	0	0	0	Q05C37|Q08AH9|Q96N84	Frame_Shift_Del	DEL	ENST00000297524.3	37	CCDS34917.1																																																																																			.		0.363	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
KIAA0368	23392	broad.mit.edu	37	9	114125936	114125936	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr9:114125936delT	ENST00000338205.5	-	48	5531	c.5312delA	c.(5311-5313)aatfs	p.N1771fs	KIAA0368_ENST00000259335.4_Frame_Shift_Del_p.N1949fs|KIAA0368_ENST00000465499.1_5'Flank|KIAA0368_ENST00000374378.3_Intron			Q5VYK3	ECM29_HUMAN	KIAA0368	1777					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						GTAGGTCTTATTTTCTAAAAA	0.358																																					p.N1949fs													.	KIAA0368-68	0			c.5846delA						.						64.0	62.0	63.0					9																	114125936		1812	4070	5882	SO:0001589	frameshift_variant	23392	exon50			GTCTTATTTTCTA	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.5312delA	9.37:g.114125936delT	ENSP00000339889:p.Asn1771fs	17	0		11	4	NM_001080398	0	0	0	0	0	O15074|Q8WU82	Frame_Shift_Del	DEL	ENST00000338205.5	37																																																																																				.		0.358	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
KRTAP4-5	85289	hgsc.bcm.edu;broad.mit.edu	37	17	39305911	39305912	+	In_Frame_Ins	INS	-	-	GCAGCAGGTGGTCCT	rs557154279|rs141058010	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:39305911_39305912insGCAGCAGGTGGTCCT	ENST00000343246.4	-	1	142_143	c.108_109insAGGACCACCTGCTGC	c.(106-111)tgccgc>tgcAGGACCACCTGCTGCcgc	p.36_37CR>CRTTCCR		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	36	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTGGGGCGGCAGCAGGTGG	0.658														26	0.00519169	0.0	0.0115	5008	,	,		16446	0.0		0.0149	False		,,,				2504	0.0031				p.R37delinsRTTCCR		.											.	KRTAP4-5-90	0			c.109_110insAGGACCACCTGCTGC						.			55,4055		3,49,2003						-1.8	0.7			27	192,7870		2,188,3841	no	coding	KRTAP4-5	NM_033188.3		5,237,5844	A1A1,A1R,RR		2.3815,1.3382,2.0292				247,11925				SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.94_108dupAGGACCACCTGCTGC	17.37:g.39305911_39305912insGCAGCAGGTGGTCCT	ENSP00000340546:p.Arg32_Cys36dup	41	0		106	33	NM_033188	0	0	0	0	0		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.658	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
SIRT6	51548	broad.mit.edu	37	19	4175089	4175090	+	Frame_Shift_Ins	INS	-	-	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:4175089_4175090insG	ENST00000337491.2	-	7	737_738	c.673_674insC	c.(673-675)ctgfs	p.L225fs	SIRT6_ENST00000601488.1_Frame_Shift_Ins_p.C151fs|SIRT6_ENST00000305232.6_Frame_Shift_Ins_p.L198fs|SIRT6_ENST00000381935.3_Frame_Shift_Ins_p.L153fs|SIRT6_ENST00000594279.1_Frame_Shift_Ins_p.C140fs	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	225	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCAGCGGCAGGTTCCCGCTG	0.688																																					p.L225fs													.	SIRT6-227	0			c.674_675insC						.																																			SO:0001589	frameshift_variant	51548	exon7			AGCGGCAGGTTCC	AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.674dupC	19.37:g.4175091_4175091dupG	ENSP00000337332:p.Leu225fs	31	0		165	7	NM_016539	0	0	0	0	0	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Frame_Shift_Ins	INS	ENST00000337491.2	37	CCDS12122.1																																																																																			.		0.688	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457931.2		
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	67588157	67588158	+	Frame_Shift_Ins	INS	-	-	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr5:67588157_67588158insG	ENST00000521381.1	+	8	1603_1604	c.987_988insG	c.(988-990)gatfs	p.D330fs	PIK3R1_ENST00000274335.5_Frame_Shift_Ins_p.D330fs|PIK3R1_ENST00000320694.8_Frame_Shift_Ins_p.D30fs|PIK3R1_ENST00000336483.5_Frame_Shift_Ins_p.D60fs|PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000521657.1_Frame_Shift_Ins_p.D330fs|PIK3R1_ENST00000396611.1_Frame_Shift_Ins_p.D330fs	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	330				D -> N (in Ref. 1; M61906). {ECO:0000305}.	B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TGTCCTTACAAGATGCTGAATG	0.396			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.Q329fs		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.987_988insG						.																																			SO:0001589	frameshift_variant	5295	exon8			.	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.988dupG	5.37:g.67588158_67588158dupG	ENSP00000428056:p.Asp330fs	51	0		55	24	NM_181523	0	0	0	0	0	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Frame_Shift_Ins	INS	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.396	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	11486930	11486931	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:11486930_11486931insT	ENST00000423059.4	-	12	2977_2978	c.2726_2727insA	c.(2725-2727)ttgfs	p.L909fs	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	909	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACCAGCTGGTCAATTGACAGTC	0.53										HNSCC(18;0.044)																											p.L909fs		.											.	THSD7A-71	0			c.2727_2728insA						.																																			SO:0001589	frameshift_variant	221981	exon12			.		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2726_2727insA	7.37:g.11486930_11486931insT	ENSP00000406482:p.Leu909fs	85	0		167	84	NM_015204	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000423059.4	37	CCDS47543.1																																																																																			.		0.530	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
ETHE1	23474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44030496	44030497	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:44030496_44030497TA>AT	ENST00000292147.2	-	3	297_298	c.231_232TA>AT	c.(229-234)aaTAcc>aaATcc	p.77_78NT>KS	ZNF575_ENST00000458714.2_Intron|ETHE1_ENST00000600651.1_Missense_Mutation_p.77_78NT>KS	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	77					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				TGGCAGTGGGTATTCACTGGGA	0.634																																					p.NT77KS		.											.	ETHE1-90	0			c.T231A						.																																			SO:0001583	missense	23474	exon3			GTGGGTATTCACT		CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.231_232delinsAT	19.37:g.44030496_44030497delinsAT	ENSP00000292147:p.N77_T78delinsKS	143.0	0.0		131.0	43.0	NM_014297	0	0	0	0	0	Q96HR0|Q9H001	Missense_Mutation	DNP	ENST00000292147.2	37	CCDS12622.1																																																																																			.		0.634	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463184.1	NM_014297	
