#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	26500781	26500781	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr10:26500781G>A	ENST00000265944.5	+	35	4906	c.4740G>A	c.(4738-4740)gcG>gcA	p.A1580A	MYO3A_ENST00000543632.1_Missense_Mutation_p.G596S	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1580					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GGTGCTGGGCGGCGGAGAGCC	0.662																																																0													41.0	46.0	45.0					10																	26500781		2203	4300	6503	SO:0001819	synonymous_variant	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4740G>A	10.37:g.26500781G>A			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607023	0.46527	.	.	ENSG00000095777	ENST00000543632	T	0.75367	-0.93	4.4	-0.958	0.10347	.	.	.	.	.	T	0.40645	0.1125	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.34527	-0.9825	8	0.02654	T	1	.	1.4101	0.02289	0.2173:0.1059:0.3708:0.306	.	596	F5H0U9	.	S	596	ENSP00000445909:G596S	ENSP00000445909:G596S	G	+	1	0	MYO3A	26540787	0.009000	0.17119	0.381000	0.26106	0.814000	0.46013	0.004000	0.13106	0.008000	0.14787	0.462000	0.41574	GGC		0.662	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		14	48	14	48
F2	2147	hgsc.bcm.edu;broad.mit.edu	37	11	46747678	46747678	+	Missense_Mutation	SNP	G	G	C			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr11:46747678G>C	ENST00000311907.5	+	7	885	c.829G>C	c.(829-831)Gcc>Ccc	p.A277P	F2_ENST00000530231.1_Missense_Mutation_p.A277P	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	277	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	GTGCTATGTGGCCGGGAAGCC	0.597																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)											0													76.0	88.0	84.0					11																	46747678		2201	4299	6500	SO:0001583	missense	2147			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.829G>C	11.37:g.46747678G>C	ENSP00000308541:p.Ala277Pro		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891614	0.33442	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	T;T;T	0.67865	-0.29;-0.29;-0.29	5.37	4.44	0.53790	Kringle (4);Kringle-like fold (1);	0.749252	0.13221	N	0.404377	T	0.72350	0.3449	M	0.62723	1.935	0.26178	N	0.979761	P	0.45428	0.858	P	0.49387	0.609	T	0.65166	-0.6234	10	0.87932	D	0	.	13.0778	0.59097	0.0:0.0:0.6918:0.3082	.	277	P00734	THRB_HUMAN	P	277;277;267	ENSP00000308541:A277P;ENSP00000433907:A277P;ENSP00000387413:A267P	ENSP00000308541:A277P	A	+	1	0	F2	46704254	0.722000	0.28017	0.726000	0.30738	0.331000	0.28603	1.949000	0.40313	1.216000	0.43427	0.563000	0.77884	GCC		0.597	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			7	137	7	137
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	26639240	26639240	+	Missense_Mutation	SNP	C	C	G			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr12:26639240C>G	ENST00000381340.3	-	41	6024	c.5608G>C	c.(5608-5610)Gct>Cct	p.A1870P		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1870					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GCTGAAGAAGCTTCTGTTAAT	0.363																																																0													177.0	164.0	168.0					12																	26639240		1867	4093	5960	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5608G>C	12.37:g.26639240C>G	ENSP00000370744:p.Ala1870Pro		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676676	0.88445	.	.	ENSG00000123104	ENST00000381340	D	0.92752	-3.1	4.92	4.92	0.64577	.	0.115347	0.64402	D	0.000016	D	0.92427	0.7596	M	0.67700	2.07	0.80722	D	1	P	0.50617	0.937	P	0.46110	0.504	D	0.92783	0.6242	10	0.49607	T	0.09	.	18.3171	0.90225	0.0:1.0:0.0:0.0	.	1870	Q14571	ITPR2_HUMAN	P	1870	ENSP00000370744:A1870P	ENSP00000370744:A1870P	A	-	1	0	ITPR2	26530507	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.200000	0.77838	2.550000	0.86006	0.655000	0.94253	GCT		0.363	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		13	49	13	49
DCN	1634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	91546926	91546926	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr12:91546926G>A	ENST00000052754.5	-	6	1194	c.693C>T	c.(691-693)aaC>aaT	p.N231N	DCN_ENST00000456569.2_Intron|DCN_ENST00000552962.1_Silent_p.N231N|DCN_ENST00000393155.1_Silent_p.N231N|DCN_ENST00000441303.2_Intron|DCN_ENST00000303320.3_Intron|DCN_ENST00000425043.1_Silent_p.N84N|DCN_ENST00000228329.5_Silent_p.N122N|DCN_ENST00000547568.2_Silent_p.N84N|DCN_ENST00000420120.2_Silent_p.N122N	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	231					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						TGCTGATTTTGTTGCCATCAA	0.358																																																0													144.0	136.0	139.0					12																	91546926		2203	4300	6503	SO:0001819	synonymous_variant	1634			AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.693C>T	12.37:g.91546926G>A			Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Silent	SNP	ENST00000052754.5	37	CCDS9039.1	.	.	.	.	.	.	.	.	.	.	G	9.695	1.152850	0.21371	.	.	ENSG00000011465	ENST00000550758	.	.	.	5.33	3.43	0.39272	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5199	0.44912	0.1641:0.0:0.8359:0.0	.	.	.	.	X	1	.	.	Q	-	1	0	DCN	90071057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.118000	0.57884	0.576000	0.29452	-0.229000	0.12294	CAA		0.358	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507		10	86	10	86
LATS2	26524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	21563346	21563346	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr13:21563346G>A	ENST00000382592.4	-	4	978	c.573C>T	c.(571-573)taC>taT	p.Y191Y	LATS2_ENST00000542899.1_Silent_p.Y191Y|LATS2_ENST00000472754.1_5'UTR	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTGGGCCCTCGTAGGGGGTAC	0.687																																																0													73.0	63.0	66.0					13																	21563346		2203	4299	6502	SO:0001819	synonymous_variant	26524			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.573C>T	13.37:g.21563346G>A				Silent	SNP	ENST00000382592.4	37	CCDS9294.1																																																																																				0.687	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			12	116	12	116
RNF31	55072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	24619440	24619441	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr14:24619440_24619441GA>TT	ENST00000324103.6	+	7	1300_1301	c.980_981GA>TT	c.(979-981)cGA>cTT	p.R327L	RNF31_ENST00000559275.1_Missense_Mutation_p.R176L|RNF31_ENST00000382687.3_Missense_Mutation_p.R176L|RP11-468E2.4_ENST00000558468.1_5'Flank	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	327	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GATCGGCCCCGAGGCTGTAAGG	0.604																																																0																																										SO:0001583	missense	55072			AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	Exception_encountered	14.37:g.24619440_24619441delinsTT	ENSP00000315112:p.Arg327Leu		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation|Silent	SNP	ENST00000324103.6	37	CCDS41931.1																																																																																				0.604	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		31	49|51	31	49
TBPL2	387332	hgsc.bcm.edu;broad.mit.edu	37	14	55907119	55907119	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr14:55907119C>T	ENST00000247219.5	-	1	215	c.145G>A	c.(145-147)Gct>Act	p.A49T		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						CTCACCTGAGCGGCGCACTGG	0.622																																																0													39.0	40.0	40.0					14																	55907119		2110	4136	6246	SO:0001583	missense	387332			AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.145G>A	14.37:g.55907119C>T	ENSP00000247219:p.Ala49Thr			Missense_Mutation	SNP	ENST00000247219.5	37	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	C	7.832	0.720018	0.15372	.	.	ENSG00000182521	ENST00000247219	T	0.44482	0.92	5.12	1.77	0.24775	.	0.953359	0.08743	N	0.900274	T	0.36166	0.0957	L	0.47716	1.5	0.09310	N	1	B	0.17852	0.024	B	0.06405	0.002	T	0.29882	-0.9997	10	0.44086	T	0.13	0.3082	9.4559	0.38753	0.0:0.6697:0.0:0.3303	.	49	Q6SJ96	TBPL2_HUMAN	T	49	ENSP00000247219:A49T	ENSP00000247219:A49T	A	-	1	0	TBPL2	54976872	0.001000	0.12720	0.317000	0.25265	0.073000	0.16967	0.225000	0.17757	0.552000	0.29026	0.462000	0.41574	GCT		0.622	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047		7	123	7	123
ADCY9	115	hgsc.bcm.edu;broad.mit.edu	37	16	4016491	4016491	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr16:4016491G>A	ENST00000294016.3	-	11	3885	c.3347C>T	c.(3346-3348)gCg>gTg	p.A1116V		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1116	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCCTGACGCCGCCATGTACGT	0.622																																																0													88.0	77.0	81.0					16																	4016491		2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3347C>T	16.37:g.4016491G>A	ENSP00000294016:p.Ala1116Val		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024744	0.93518	.	.	ENSG00000162104	ENST00000294016	T	0.35048	1.33	5.52	5.52	0.82312	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.55829	-0.8079	10	0.87932	D	0	.	19.7885	0.96447	0.0:0.0:1.0:0.0	.	1116	O60503	ADCY9_HUMAN	V	1116	ENSP00000294016:A1116V	ENSP00000294016:A1116V	A	-	2	0	ADCY9	3956492	1.000000	0.71417	0.967000	0.41034	0.918000	0.54935	9.813000	0.99286	2.752000	0.94435	0.655000	0.94253	GCG		0.622	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			8	126	8	126
PHKB	5257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	47730353	47730353	+	Missense_Mutation	SNP	C	C	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr16:47730353C>A	ENST00000323584.5	+	29	2981	c.2957C>A	c.(2956-2958)aCg>aAg	p.T986K	PHKB_ENST00000566044.1_Missense_Mutation_p.T979K|PHKB_ENST00000299167.8_Missense_Mutation_p.T986K|PHKB_ENST00000455779.1_Missense_Mutation_p.T979K	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	986					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GTTGAAGACACGTTGGGAAAT	0.408																																																0													133.0	116.0	122.0					16																	47730353		2201	4300	6501	SO:0001583	missense	5257				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.2957C>A	16.37:g.47730353C>A	ENSP00000313504:p.Thr986Lys		Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076135	0.36662	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	T;T	0.68181	-0.31;-0.31	5.55	3.3	0.37823	.	0.282154	0.43747	D	0.000524	T	0.57227	0.2039	L	0.53249	1.67	0.43226	D	0.995114	B;B;B	0.34313	0.448;0.029;0.03	B;B;B	0.26770	0.04;0.073;0.038	T	0.56450	-0.7977	10	0.72032	D	0.01	-8.2061	10.9116	0.47112	0.0:0.0868:0.0:0.9132	.	227;986;979	B3KVX5;Q93100;Q93100-4	.;KPBB_HUMAN;.	K	979;979;986	ENSP00000414345:T979K;ENSP00000313504:T986K	ENSP00000299167:T979K	T	+	2	0	PHKB	46287854	1.000000	0.71417	0.719000	0.30619	0.403000	0.30841	4.789000	0.62446	0.415000	0.25817	-0.142000	0.14014	ACG		0.408	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1			15	67	15	67
NOD2	64127	hgsc.bcm.edu;ucsc.edu	37	16	50756571	50756571	+	Missense_Mutation	SNP	C	C	A	rs104895452	byFrequency	TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr16:50756571C>A	ENST00000300589.2	+	8	2858	c.2753C>A	c.(2752-2754)gCc>gAc	p.A918D		NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	918			A -> D (associated with Crohn disease; dbSNP:rs104895452). {ECO:0000269|PubMed:11385576}.		activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				GGGGCCCAGGCCCTGGCTGAA	0.527													C|||	3	0.000599042	0.0	0.0014	5008	,	,		18623	0.0		0.002	False		,,,				2504	0.0															0			GRCh37	CM020665	NOD2	M	rs104895452	C	ASP/ALA	0,4396		0,0,2198	228.0	246.0	240.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2753	5.9	1.0	16	dbSNP_132	240	7,8593	5.7+/-21.5	0,7,4293	yes	missense	NOD2	NM_022162.1	126	0,7,6491	AA,AC,CC		0.0814,0.0,0.0539	probably-damaging	918/1041	50756571	7,12989	2198	4300	6498	SO:0001583	missense	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2753C>A	16.37:g.50756571C>A	ENSP00000300589:p.Ala918Asp		E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	25.9	4.687596	0.88639	0.0	8.14E-4	ENSG00000167207	ENST00000526417;ENST00000300589;ENST00000431240	T	0.55930	0.49	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	T	0.73048	0.3537	M	0.76838	2.35	0.47698	D	0.99949	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.72747	-0.4200	10	0.46703	T	0.11	.	15.7964	0.78412	0.0:1.0:0.0:0.0	.	891;918	Q9HC29-2;Q9HC29	.;NOD2_HUMAN	D	891;918;58	ENSP00000300589:A918D	ENSP00000300589:A918D	A	+	2	0	NOD2	49314072	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.297000	0.59061	2.813000	0.96785	0.655000	0.94253	GCC		0.527	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162		73	506	73	506
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	54446754	54446754	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr18:54446754C>T	ENST00000254442.3	+	18	3251	c.3040C>T	c.(3040-3042)Cga>Tga	p.R1014*	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Nonsense_Mutation_p.R981*	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1014					hematopoietic progenitor cell differentiation (GO:0002244)			p.R1014R(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GATGCTGGCCCGAAGATGGCA	0.413																																																1	Substitution - coding silent(1)	lung(1)											108.0	94.0	99.0					18																	54446754		2203	4300	6503	SO:0001587	stop_gained	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3040C>T	18.37:g.54446754C>T	ENSP00000254442:p.Arg1014*		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Nonsense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	C	44	10.553455	0.99426	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1865	0.89795	0.0:1.0:0.0:0.0	.	.	.	.	X	1014;981;339;981	.	ENSP00000254442:R1014X	R	+	1	2	WDR7	52597752	0.967000	0.33354	1.000000	0.80357	0.999000	0.98932	2.298000	0.43602	2.379000	0.81126	0.655000	0.94253	CGA		0.413	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			6	44	6	44
OR1M1	125963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	9204546	9204546	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr19:9204546C>T	ENST00000429566.3	+	1	692	c.626C>T	c.(625-627)aCg>aTg	p.T209M		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GTGATAGCCACGCCCTTTGTC	0.567																																																0													129.0	104.0	113.0					19																	9204546		2203	4300	6503	SO:0001583	missense	125963				CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.626C>T	19.37:g.9204546C>T	ENSP00000401966:p.Thr209Met		B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	c	10.00	1.233263	0.22626	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.37411	1.2	3.8	-4.65	0.03339	GPCR, rhodopsin-like superfamily (1);	0.868487	0.10040	N	0.723505	T	0.17619	0.0423	N	0.17901	0.54	0.09310	N	1	B	0.27316	0.175	B	0.24541	0.054	T	0.17806	-1.0357	10	0.33940	T	0.23	.	5.7238	0.18002	0.0:0.3708:0.2348:0.3943	.	209	Q8NGA1	OR1M1_HUMAN	M	212;209	ENSP00000401966:T209M	ENSP00000303195:T212M	T	+	2	0	OR1M1	9065546	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	0.053000	0.14184	-0.892000	0.03935	-0.147000	0.13772	ACG		0.567	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1			52	78	52	78
HIPK4	147746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	40895408	40895408	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr19:40895408G>A	ENST00000291823.2	-	1	686	c.402C>T	c.(400-402)caC>caT	p.H134H		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			TGAGATCAGCGTGGATGATAG	0.627																																																0													60.0	57.0	58.0					19																	40895408		2203	4300	6503	SO:0001819	synonymous_variant	147746			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.402C>T	19.37:g.40895408G>A			A8K863|Q96M54	Silent	SNP	ENST00000291823.2	37	CCDS12555.1																																																																																				0.627	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	NM_144685		4	31	4	31
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	19168269	19168269	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr1:19168269G>A	ENST00000375371.3	-	5	1566	c.1545C>T	c.(1543-1545)ttC>ttT	p.F515F		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	515					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CGATGCACTCGAAGCAGCAGA	0.597																																																0													145.0	111.0	122.0					1																	19168269		2203	4300	6503	SO:0001819	synonymous_variant	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1545C>T	1.37:g.19168269G>A			Q5TZ19	Silent	SNP	ENST00000375371.3	37	CCDS187.1																																																																																				0.597	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			25	43	25	43
ZP4	57829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	238048465	238048465	+	Splice_Site	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr1:238048465C>T	ENST00000366570.4	-	9	1469	c.1311G>A	c.(1309-1311)ccG>ccA	p.P437P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	437	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AACATCCTACCGGTCCCCTGA	0.522																																					NSCLC(166;160 2029 11600 18754 19936)											0													77.0	82.0	80.0					1																	238048465		2203	4300	6503	SO:0001630	splice_region_variant	57829			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1311+1G>A	1.37:g.238048465C>T			B2RAE1	Splice_Site	SNP	ENST00000366570.4	37	CCDS1615.1																																																																																				0.522	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		Silent	24	48	24	48
PAK7	57144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	9561502	9561502	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr20:9561502C>T	ENST00000378429.3	-	5	826	c.280G>A	c.(280-282)Gtg>Atg	p.V94M	PAK7_ENST00000353224.5_Missense_Mutation_p.V94M|PAK7_ENST00000378423.1_Missense_Mutation_p.V94M	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	94	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GAGCGAGTCACCGAGATGTTG	0.517																																																0													122.0	122.0	122.0					20																	9561502		2203	4300	6503	SO:0001583	missense	57144			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.280G>A	20.37:g.9561502C>T	ENSP00000367686:p.Val94Met		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864803	0.91511	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.47528	0.84;0.84;0.84	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.70780	0.3263	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.68930	-0.5279	9	.	.	.	.	20.0897	0.97814	0.0:1.0:0.0:0.0	.	94;94	B0AZM9;Q9P286	.;PAK7_HUMAN	M	94;94;94;42	ENSP00000367686:V94M;ENSP00000322957:V94M;ENSP00000367679:V94M	.	V	-	1	0	PAK7	9509502	1.000000	0.71417	0.960000	0.40013	0.974000	0.67602	7.814000	0.86154	2.744000	0.94065	0.655000	0.94253	GTG		0.517	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			91	145	91	145
SRBD1	55133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	45774700	45774700	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:45774700C>T	ENST00000263736.4	-	13	1789	c.1727G>A	c.(1726-1728)cGa>cAa	p.R576Q	SRBD1_ENST00000535761.1_Missense_Mutation_p.R95Q	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	576					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CTCCGCCTCTCGGAAGCCTTG	0.333																																																0													66.0	65.0	66.0					2																	45774700		2203	4299	6502	SO:0001583	missense	55133			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1727G>A	2.37:g.45774700C>T	ENSP00000263736:p.Arg576Gln		Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577650	0.45902	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.39997	1.05;1.05	5.24	3.43	0.39272	YqgF/RNase H-like domain (2);	0.204155	0.41500	N	0.000866	T	0.28433	0.0703	L	0.31065	0.9	0.35119	D	0.766877	B	0.16802	0.019	B	0.08055	0.003	T	0.21690	-1.0238	10	0.44086	T	0.13	.	8.1694	0.31245	0.0:0.6937:0.0:0.3063	.	576	Q8N5C6	SRBD1_HUMAN	Q	576;95	ENSP00000263736:R576Q;ENSP00000441272:R95Q	ENSP00000263736:R576Q	R	-	2	0	SRBD1	45628204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.055000	0.30467	0.685000	0.31468	0.655000	0.94253	CGA		0.333	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079		26	32	26	32
VAMP5	10791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	85818866	85818866	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:85818866C>T	ENST00000306384.4	+	2	105	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W		NM_006634.2	NP_006625.1	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5	8	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cell differentiation (GO:0030154)|Golgi to plasma membrane protein transport (GO:0043001)|muscle organ development (GO:0007517)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R8W(1)		NS(1)|large_intestine(3)|lung(1)	5						AGAGTTGGAGCGGTGCCAGCA	0.602																																																1	Substitution - Missense(1)	large_intestine(1)											99.0	86.0	90.0					2																	85818866		2203	4300	6503	SO:0001583	missense	10791			AF054825	CCDS1980.1	2p11.2	2013-02-13	2012-10-17		ENSG00000168899	ENSG00000168899		"""Vesicle-associated membrane proteins"""	12646	protein-coding gene	gene with protein product	"""myobrevin"""	607029				9725904	Standard	NM_006634		Approved		uc002spu.1	O95183	OTTHUMG00000130169	ENST00000306384.4:c.22C>T	2.37:g.85818866C>T	ENSP00000305647:p.Arg8Trp		Q9P0T2	Missense_Mutation	SNP	ENST00000306384.4	37	CCDS1980.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966516	0.74131	.	.	ENSG00000168899	ENST00000306384	T	0.46451	0.87	4.84	3.86	0.44501	Synaptobrevin (2);	0.510677	0.16936	N	0.193481	T	0.58163	0.2103	M	0.78456	2.415	0.26041	N	0.981608	D	0.76494	0.999	P	0.57846	0.828	T	0.52895	-0.8514	10	0.87932	D	0	.	11.017	0.47696	0.199:0.801:0.0:0.0	.	8	O95183	VAMP5_HUMAN	W	8	ENSP00000305647:R8W	ENSP00000305647:R8W	R	+	1	2	VAMP5	85672377	0.838000	0.29461	0.993000	0.49108	0.993000	0.82548	1.643000	0.37217	2.240000	0.73641	0.561000	0.74099	CGG		0.602	VAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252484.2	NM_006634		10	94	10	94
SLC9A2	6549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	103281660	103281660	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:103281660G>A	ENST00000233969.2	+	3	997	c.855G>A	c.(853-855)ggG>ggA	p.G285G		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	285					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GAATCGGTGGGGTGCTGATTG	0.443																																																0													218.0	198.0	205.0					2																	103281660		2203	4300	6503	SO:0001819	synonymous_variant	6549				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.855G>A	2.37:g.103281660G>A			B2RMS2	Silent	SNP	ENST00000233969.2	37	CCDS2062.1																																																																																				0.443	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			61	73	61	73
CHRNA1	1134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	175613522	175613522	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:175613522A>G	ENST00000261007.5	-	9	1169	c.1103T>C	c.(1102-1104)aTc>aCc	p.I368T	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.I261T|CHRNA1_ENST00000348749.5_Missense_Mutation_p.I343T|CHRNA1_ENST00000409219.1_Intron	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	368					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GAAAAACATGATATTTGGGAT	0.348											OREG0015079	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													97.0	93.0	94.0					2																	175613522		2203	4300	6503	SO:0001583	missense	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1103T>C	2.37:g.175613522A>G	ENSP00000261007:p.Ile368Thr	1924	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313102	0.60414	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542	D;D;D	0.85861	-2.04;-2.04;-2.04	5.51	5.51	0.81932	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.232408	0.50627	D	0.000109	D	0.87241	0.6128	M	0.78456	2.415	0.80722	D	1	B;P	0.35575	0.143;0.51	B;B	0.39339	0.112;0.297	D	0.88337	0.2972	10	0.72032	D	0.01	.	15.924	0.79597	1.0:0.0:0.0:0.0	.	343;368	Q53SH4;P02708	.;ACHA_HUMAN	T	343;368;261	ENSP00000261008:I343T;ENSP00000261007:I368T;ENSP00000387026:I261T	ENSP00000261007:I368T	I	-	2	0	CHRNA1	175321768	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.287000	0.95975	2.217000	0.71921	0.533000	0.62120	ATC		0.348	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			30	31	30	31
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000446179.1_Missense_Mutation_p.R132H|IDH1_ENST00000345146.2_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			28	40	28	40
TRANK1	9881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	36874112	36874112	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr3:36874112C>T	ENST00000429976.2	-	21	7077	c.6830G>A	c.(6829-6831)cGc>cAc	p.R2277H	TRANK1_ENST00000301807.6_Missense_Mutation_p.R1727H|TRANK1_ENST00000428977.2_Missense_Mutation_p.R1727H	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2277							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCGGCGGTTGCGTGCGCTTTC	0.478																																																0													61.0	62.0	61.0					3																	36874112		1883	4100	5983	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6830G>A	3.37:g.36874112C>T	ENSP00000416168:p.Arg2277His		Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	5.908	0.351583	0.11182	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.33865	1.39;1.8;1.39	5.05	3.23	0.37069	.	0.131761	0.33477	N	0.004876	T	0.19525	0.0469	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.14727	-1.0462	10	0.28530	T	0.3	.	5.3537	0.16050	0.0:0.5517:0.1377:0.3105	.	2277	O15050	TRNK1_HUMAN	H	1727;2277;1727	ENSP00000416826:R1727H;ENSP00000416168:R2277H;ENSP00000301807:R1727H	ENSP00000301807:R1727H	R	-	2	0	TRANK1	36849116	0.000000	0.05858	0.024000	0.17045	0.694000	0.40290	0.080000	0.14802	0.613000	0.30089	0.561000	0.74099	CGC		0.478	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		19	36	19	36
KLHL18	23276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	47384261	47384261	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr3:47384261G>A	ENST00000232766.5	+	9	1299	c.1279G>A	c.(1279-1281)Gtc>Atc	p.V427I	KLHL18_ENST00000455924.2_Missense_Mutation_p.V315I	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	427										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		TGGGGTTACAGTCTTTGAGGG	0.522																																																0													210.0	179.0	189.0					3																	47384261		2203	4300	6503	SO:0001583	missense	23276			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1279G>A	3.37:g.47384261G>A	ENSP00000232766:p.Val427Ile		A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289432	0.59976	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	D;D	0.82803	-1.65;-1.65	5.5	3.71	0.42584	Galactose oxidase, beta-propeller (1);	0.064999	0.64402	N	0.000009	D	0.84483	0.5482	M	0.86097	2.795	0.58432	D	0.999999	B	0.29136	0.234	B	0.32677	0.15	T	0.83005	-0.0175	10	0.62326	D	0.03	.	11.822	0.52245	0.1228:0.0:0.8772:0.0	.	427	O94889	KLH18_HUMAN	I	427;315	ENSP00000232766:V427I;ENSP00000405585:V315I	ENSP00000232766:V427I	V	+	1	0	KLHL18	47359265	1.000000	0.71417	0.693000	0.30195	0.990000	0.78478	3.095000	0.50235	0.801000	0.34066	0.650000	0.86243	GTC		0.522	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010		25	61	25	61
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu	37	3	48690585	48690585	+	Silent	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr3:48690585C>T	ENST00000164024.4	-	10	5764	c.5484G>A	c.(5482-5484)agG>agA	p.R1828R	CELSR3_ENST00000544264.1_Silent_p.R1828R	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1828	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGCCCGAGCCCCTGGTCACTG	0.617																																																0													63.0	52.0	55.0					3																	48690585		2203	4299	6502	SO:0001819	synonymous_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5484G>A	3.37:g.48690585C>T			O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																				0.617	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		7	129	7	129
OR5H2	79310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	98001915	98001915	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr3:98001915A>G	ENST00000355273.2	+	1	184	c.184A>G	c.(184-186)Atc>Gtc	p.I62V	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						ACAACTTCACATCCCCATGTA	0.413																																																0													331.0	309.0	317.0					3																	98001915		2203	4300	6503	SO:0001583	missense	79310				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.184A>G	3.37:g.98001915A>G	ENSP00000347418:p.Ile62Val		Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	.	.	.	.	.	.	.	.	.	.	A	5.389	0.257053	0.10239	.	.	ENSG00000197938	ENST00000355273	T	0.00388	7.59	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.181253	0.26383	U	0.024691	T	0.00271	0.0008	N	0.25201	0.72	0.20403	N	0.999904	P	0.36577	0.558	B	0.39935	0.314	T	0.51694	-0.8673	10	0.72032	D	0.01	.	9.7235	0.40317	1.0:0.0:0.0:0.0	.	62	Q8NGV7	OR5H2_HUMAN	V	62	ENSP00000347418:I62V	ENSP00000347418:I62V	I	+	1	0	OR5H2	99484605	0.001000	0.12720	0.789000	0.31954	0.029000	0.11900	1.623000	0.37008	1.458000	0.47871	0.443000	0.29094	ATC		0.413	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2			120	214	120	214
ZBTB20	26137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	114058129	114058129	+	Missense_Mutation	SNP	T	T	C			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr3:114058129T>C	ENST00000474710.1	-	5	2127	c.1949A>G	c.(1948-1950)aAc>aGc	p.N650S	ZBTB20_ENST00000393785.2_Missense_Mutation_p.N577S|ZBTB20_ENST00000462705.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000357258.3_Missense_Mutation_p.N577S|ZBTB20_ENST00000464560.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000481632.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000471418.1_Missense_Mutation_p.N577S	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	650						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CATGTGCACGTTGAGGGAGCT	0.527																																					NSCLC(69;748 1344 9802 11203 30933)											0													204.0	179.0	187.0					3																	114058129		2203	4300	6503	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1949A>G	3.37:g.114058129T>C	ENSP00000419153:p.Asn650Ser		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.059543	0.55325	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.03272	3.99;3.99;3.99;3.99;3.99;3.99;3.99	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.047714	0.85682	D	0.000000	T	0.02688	0.0081	N	0.04203	-0.255	0.58432	D	0.999999	P	0.43826	0.818	B	0.41466	0.358	T	0.68546	-0.5380	10	0.19590	T	0.45	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	650	Q9HC78	ZBT20_HUMAN	S	577;577;577;577;650;577;577	ENSP00000420324:N577S;ENSP00000377375:N577S;ENSP00000418092:N577S;ENSP00000419902:N577S;ENSP00000419153:N650S;ENSP00000349803:N577S;ENSP00000417307:N577S	ENSP00000349803:N577S	N	-	2	0	ZBTB20	115540819	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	6.139000	0.71728	2.288000	0.76882	0.533000	0.62120	AAC		0.527	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		107	142	107	142
NAT8L	339983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	2065803	2065803	+	Silent	SNP	C	C	G			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr4:2065803C>G	ENST00000423729.2	+	3	858	c.858C>G	c.(856-858)ctC>ctG	p.L286L	NAT8L_ENST00000331662.3_Silent_p.L118L	NM_178557.3	NP_848652.2	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related, putative)	286					metabolic process (GO:0008152)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)	aspartate N-acetyltransferase activity (GO:0017188)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			CTGAGCGCCTCTTCTTCCAGG	0.711																																																0													25.0	21.0	23.0					4																	2065803		2198	4295	6493	SO:0001819	synonymous_variant	339983			AK094797	CCDS3359.1, CCDS3359.2	4p16.3	2011-11-16	2008-09-24		ENSG00000185818	ENSG00000185818			26742	protein-coding gene	gene with protein product		610647	"""N-acetyltransferase 8-like"""			11397015	Standard	NM_178557		Approved	FLJ37478, Hcml3	uc003geq.2	Q8N9F0	OTTHUMG00000121151	ENST00000423729.2:c.858C>G	4.37:g.2065803C>G				Silent	SNP	ENST00000423729.2	37	CCDS3359.2																																																																																				0.711	NAT8L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178557		15	23	15	23
OTOP1	133060	hgsc.bcm.edu;broad.mit.edu	37	4	4199453	4199453	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr4:4199453G>A	ENST00000296358.4	-	5	1132	c.1108C>T	c.(1108-1110)Cgg>Tgg	p.R370W		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	370					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTGTAAATCCGGATTCCAGCC	0.582																																																0													39.0	43.0	42.0					4																	4199453		2203	4300	6503	SO:0001583	missense	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1108C>T	4.37:g.4199453G>A	ENSP00000296358:p.Arg370Trp		A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	4.502	0.093099	0.08632	.	.	ENSG00000163982	ENST00000296358	T	0.08807	3.05	4.8	-2.93	0.05598	.	0.850416	0.10371	N	0.682800	T	0.04588	0.0125	N	0.22421	0.69	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.39461	-0.9613	10	0.44086	T	0.13	-3.6484	3.0919	0.06296	0.3462:0.1054:0.4416:0.1068	.	370	Q7RTM1	OTOP1_HUMAN	W	370	ENSP00000296358:R370W	ENSP00000296358:R370W	R	-	1	2	OTOP1	4250354	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.074000	0.11450	-0.617000	0.05664	0.404000	0.27445	CGG		0.582	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998		6	86	6	86
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	1081825	1081825	+	Silent	SNP	C	C	T	rs138705098		TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr5:1081825C>T	ENST00000264930.5	-	9	1207	c.1164G>A	c.(1162-1164)gcG>gcA	p.A388A		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	388					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCTCCACAAACGCCCCCGCGT	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16120	0.0		0.0	False		,,,				2504	0.0															0								C		1,4401	4.2+/-10.8	0,1,2200	81.0	76.0	78.0		1164	-3.1	0.0	5	dbSNP_134	78	0,8600		0,0,4300	no	coding-synonymous	SLC12A7	NM_006598.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		388/1084	1081825	1,13001	2201	4300	6501	SO:0001819	synonymous_variant	10723			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1164G>A	5.37:g.1081825C>T			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	37	CCDS34129.1																																																																																				0.662	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		9	76	9	76
CDH6	1004	hgsc.bcm.edu;broad.mit.edu	37	5	31323107	31323107	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr5:31323107C>T	ENST00000265071.2	+	12	2330	c.2065C>T	c.(2065-2067)Cga>Tga	p.R689*		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	689					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CAACAAATTACGAAGGGACAT	0.502																																																0													89.0	82.0	84.0					5																	31323107		2203	4300	6503	SO:0001587	stop_gained	1004			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2065C>T	5.37:g.31323107C>T	ENSP00000265071:p.Arg689*		A8K5H5|Q9BWS0	Nonsense_Mutation	SNP	ENST00000265071.2	37	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	C	40	8.383210	0.98786	.	.	ENSG00000113361	ENST00000265071	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8024	0.96513	0.0:1.0:0.0:0.0	.	.	.	.	X	689	.	ENSP00000265071:R689X	R	+	1	2	CDH6	31358864	1.000000	0.71417	0.955000	0.39395	0.845000	0.48019	2.358000	0.44134	2.752000	0.94435	0.655000	0.94253	CGA		0.502	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		6	59	6	59
TPST1	8460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	65705779	65705779	+	Missense_Mutation	SNP	C	C	T	rs377712883		TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr7:65705779C>T	ENST00000304842.5	+	2	792	c.367C>T	c.(367-369)Cgc>Tgc	p.R123C	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	123					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						AGAGAAGATCCGCCTGGATGA	0.512																																																0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	114.0	110.0	111.0		367	5.8	1.0	7		111	0,8600		0,0,4300	no	missense	TPST1	NM_003596.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	123/371	65705779	1,13005	2203	4300	6503	SO:0001583	missense	8460			AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.367C>T	7.37:g.65705779C>T	ENSP00000302413:p.Arg123Cys		A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	37	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189657	0.78789	2.27E-4	0.0	ENSG00000169902	ENST00000304842;ENST00000544114;ENST00000451388	.	.	.	5.78	5.78	0.91487	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.84777	0.5547	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.86877	0.2039	9	0.56958	D	0.05	-12.2145	13.9123	0.63876	0.152:0.848:0.0:0.0	.	123;123	F5H7U7;O60507	.;TPST1_HUMAN	C	123	.	ENSP00000302413:R123C	R	+	1	0	TPST1	65343214	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.692000	0.47018	2.723000	0.93209	0.585000	0.79938	CGC		0.512	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596		31	48	31	48
COL27A1	85301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	116931263	116931263	+	Silent	SNP	C	C	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr9:116931263C>T	ENST00000356083.3	+	3	1819	c.1428C>T	c.(1426-1428)acC>acT	p.T476T		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	476	Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CTGCCCGCACCAGCACCCACA	0.567																																																0													160.0	186.0	177.0					9																	116931263		2203	4300	6503	SO:0001819	synonymous_variant	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.1428C>T	9.37:g.116931263C>T			Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																				0.567	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888		136	213	136	213
PPP1R3F	89801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	49126932	49126932	+	Silent	SNP	G	G	A			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chrX:49126932G>A	ENST00000055335.6	+	1	616	c.600G>A	c.(598-600)ccG>ccA	p.P200P	PPP1R3F_ENST00000466508.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000438316.1_Intron|PPP1R3F_ENST00000495799.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	200	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					GCTACGTCCCGCGCAGCCCGC	0.706																																																0													9.0	10.0	9.0					X																	49126932		2084	4095	6179	SO:0001819	synonymous_variant	89801				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.600G>A	X.37:g.49126932G>A			A2VDJ8|B3KPW2|E9PCM3	Silent	SNP	ENST00000055335.6	37	CCDS35254.1																																																																																				0.706	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215		21	24	21	24
ZNF280C	55609	hgsc.bcm.edu;broad.mit.edu	37	X	129354412	129354412	+	Silent	SNP	A	A	G			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chrX:129354412A>G	ENST00000370978.4	-	13	1591	c.1438T>C	c.(1438-1440)Ttg>Ctg	p.L480L		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						TTGCTGGTCAAAAATTGTAGT	0.393																																																0													135.0	120.0	125.0					X																	129354412		2203	4300	6503	SO:0001819	synonymous_variant	55609			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1438T>C	X.37:g.129354412A>G			A8K2V8|Q9NXR3	Silent	SNP	ENST00000370978.4	37	CCDS14622.1																																																																																				0.393	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666		9	161	9	161
PLAC1	10761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	133700590	133700590	+	Silent	SNP	G	G	C			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chrX:133700590G>C	ENST00000359237.4	-	3	408	c.123C>G	c.(121-123)ccC>ccG	p.P41P	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1											large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					TTAGCATGAAGGGGTGCACTG	0.517																																																0													227.0	200.0	209.0					X																	133700590		2203	4300	6503	SO:0001819	synonymous_variant	10761			AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.123C>G	X.37:g.133700590G>C				Silent	SNP	ENST00000359237.4	37	CCDS14642.1																																																																																				0.517	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058375.1	NM_021796		131	183	131	183
SPANXD	64648	hgsc.bcm.edu;broad.mit.edu	37	X	140785691	140785691	+	Missense_Mutation	SNP	G	G	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chrX:140785691G>T	ENST00000370515.3	-	2	558	c.225C>A	c.(223-225)aaC>aaA	p.N75K		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	75						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					GGTTGATTCTGTTCTTTCGGG	0.443																																																0													210.0	183.0	192.0					X																	140785691		2199	4272	6471	SO:0001583	missense	64648			AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.225C>A	X.37:g.140785691G>T	ENSP00000359546:p.Asn75Lys		Q5JWI1	Missense_Mutation	SNP	ENST00000370515.3	37	CCDS14675.1	.	.	.	.	.	.	.	.	.	.	N	8.571	0.880046	0.17467	.	.	ENSG00000196406	ENST00000370515	T	0.14516	2.5	.	.	.	.	.	.	.	.	T	0.28234	0.0697	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.81914	0.995	T	0.08351	-1.0726	6	0.49607	T	0.09	.	.	.	.	.	75	Q9BXN6	SPNXD_HUMAN	K	75	ENSP00000359546:N75K	ENSP00000359546:N75K	N	-	3	2	SPANXD	140613357	0.018000	0.18449	0.011000	0.14972	0.011000	0.07611	0.075000	0.14686	0.068000	0.16574	0.068000	0.15388	AAC		0.443	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058598.1			25	362	25	362
PARP1	142	broad.mit.edu;ucsc.edu	37	1	226553702	226553702	+	Missense_Mutation	SNP	T	T	C			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr1:226553702T>C	ENST00000366794.5	-	18	2601	c.2458A>G	c.(2458-2460)Aac>Gac	p.N820D	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	820	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GCATGAGTGTTCTTAACATAC	0.468								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																								0													205.0	149.0	168.0					1																	226553702		2203	4300	6503	SO:0001583	missense	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2458A>G	1.37:g.226553702T>C	ENSP00000355759:p.Asn820Asp		B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	T	31	5.060433	0.93846	.	.	ENSG00000143799	ENST00000366794	T	0.14640	2.49	5.68	5.68	0.88126	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	M	0.82923	2.615	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.42899	-0.9424	10	0.72032	D	0.01	.	15.9357	0.79704	0.0:0.0:0.0:1.0	.	820	P09874	PARP1_HUMAN	D	820	ENSP00000355759:N820D	ENSP00000355759:N820D	N	-	1	0	PARP1	224620325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.249000	0.78278	2.177000	0.69029	0.528000	0.53228	AAC		0.468	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618		5	39	5	39
CDC5L	988	broad.mit.edu;ucsc.edu	37	6	44387260	44387260	+	Missense_Mutation	SNP	G	G	C			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr6:44387260G>C	ENST00000371477.3	+	9	1466	c.1167G>C	c.(1165-1167)gaG>gaC	p.E389D		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	389	Interaction with PPP1R8.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CATTGCATGAGAGTGACTTCT	0.438																																																0													161.0	141.0	148.0					6																	44387260		2203	4300	6503	SO:0001583	missense	988			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1167G>C	6.37:g.44387260G>C	ENSP00000360532:p.Glu389Asp		Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	37	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052592	0.36181	.	.	ENSG00000096401	ENST00000371477	T	0.49432	0.78	5.57	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.19167	0.0460	L	0.45137	1.4	0.58432	D	0.999999	B	0.13594	0.008	B	0.18561	0.022	T	0.06534	-1.0821	10	0.23302	T	0.38	-19.9623	7.4271	0.27105	0.3178:0.0:0.6822:0.0	.	389	Q99459	CDC5L_HUMAN	D	389	ENSP00000360532:E389D	ENSP00000360532:E389D	E	+	3	2	CDC5L	44495238	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.486000	0.45259	1.343000	0.45638	0.563000	0.77884	GAG		0.438	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1			19	64	19	64
SMAD6	4091	broad.mit.edu;ucsc.edu	37	15	67073541	67073541	+	Missense_Mutation	SNP	A	A	T			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr15:67073541A>T	ENST00000288840.5	+	4	2190	c.1159A>T	c.(1159-1161)Atc>Ttc	p.I387F	SMAD6_ENST00000338426.4_Missense_Mutation_p.I126F	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	387	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						GCGCAGCAAGATCGGCTTCGG	0.672																																					Esophageal Squamous(179;72 2004 22333 39628 47290)											0													32.0	29.0	30.0					15																	67073541		2200	4298	6498	SO:0001583	missense	4091			BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.1159A>T	15.37:g.67073541A>T	ENSP00000288840:p.Ile387Phe		A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	Missense_Mutation	SNP	ENST00000288840.5	37	CCDS10221.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.794117	0.90453	.	.	ENSG00000137834	ENST00000288840;ENST00000338426	D;D	0.99429	-5.89;-5.17	5.62	5.62	0.85841	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97554	1.0094	10	0.87932	D	0	.	15.8133	0.78581	1.0:0.0:0.0:0.0	.	126;387	O43541-2;O43541	.;SMAD6_HUMAN	F	387;126	ENSP00000288840:I387F;ENSP00000345054:I126F	ENSP00000288840:I387F	I	+	1	0	SMAD6	64860595	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.461000	0.80834	2.141000	0.66446	0.402000	0.26972	ATC		0.672	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256953.2	NM_005585		4	37	4	37
TUBB1	81027	broad.mit.edu;ucsc.edu	37	20	57597953	57597953	+	Silent	SNP	C	C	T	rs150453159	byFrequency	TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr20:57597953C>T	ENST00000217133.1	+	2	380	c.111C>T	c.(109-111)cgC>cgT	p.R37R		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	37					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	GGAGCGACCGCGGGGCCTCGG	0.597													C|||	2	0.000399361	0.0	0.0	5008	,	,		18152	0.0		0.002	False		,,,				2504	0.0															0								C		0,4406		0,0,2203	63.0	58.0	59.0		111	-2.9	0.0	20	dbSNP_134	59	14,8586	10.5+/-38.8	0,14,4286	no	coding-synonymous	TUBB1	NM_030773.3		0,14,6489	TT,TC,CC		0.1628,0.0,0.1076		37/452	57597953	14,12992	2203	4300	6503	SO:0001819	synonymous_variant	81027			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.111C>T	20.37:g.57597953C>T				Silent	SNP	ENST00000217133.1	37	CCDS13475.1																																																																																				0.597	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773		29	39	29	39
ANKRD30A	91074	broad.mit.edu;ucsc.edu	37	10	37430910	37430910	+	Missense_Mutation	SNP	C	C	T	rs200193852	byFrequency	TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr10:37430910C>T	ENST00000602533.1	+	7	1016	c.917C>T	c.(916-918)aCg>aTg	p.T306M	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.T306M|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.T306M			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	362					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AGGGAAATTACGAGTCCTGCA	0.433													.|||	2	0.000399361	0.0015	0.0	5008	,	,		19604	0.0		0.0	False		,,,				2504	0.0															0													92.0	91.0	91.0					10																	37430910		1874	4104	5978	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.917C>T	10.37:g.37430910C>T	ENSP00000473551:p.Thr306Met		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	14.40	2.523711	0.44866	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05382	3.45;3.45	0.5	0.5	0.16919	.	.	.	.	.	T	0.02571	0.0078	N	0.03608	-0.345	0.09310	N	1	B	0.25351	0.124	B	0.10450	0.005	T	0.45366	-0.9266	8	0.33940	T	0.23	.	.	.	.	.	362	Q9BXX3	AN30A_HUMAN	M	306	ENSP00000354432:T306M;ENSP00000363792:T306M	ENSP00000354432:T306M	T	+	2	0	ANKRD30A	37470916	0.012000	0.17670	0.007000	0.13788	0.009000	0.06853	-0.326000	0.07965	0.525000	0.28522	0.134000	0.15878	ACG		0.433	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		67	91	67	91
PIKFYVE	200576	broad.mit.edu;hgsc.bcm.edu	37	2	209200822	209200823	+	In_Frame_Ins	INS	-	-	GTCTTC			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr2:209200822_209200823insGTCTTC	ENST00000264380.4	+	27	4576_4577	c.4418_4419insGTCTTC	c.(4417-4422)atgtct>atGTCTTCgtct	p.1476_1477insSS	PIKFYVE_ENST00000474721.1_3'UTR	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1476					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GCAAGGCTCATGTCTTCCTCTG	0.441																																																0																																										SO:0001652	inframe_insertion	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4419_4424dupGTCTTC	2.37:g.209200823_209200828dupGTCTTC	ENSP00000264380:p.Ser1475_Ser1476dup		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	In_Frame_Ins	INS	ENST00000264380.4	37	CCDS2382.1																																																																																				0.441	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		21	84	21	84
SNX31	169166	broad.mit.edu;hgsc.bcm.edu	37	8	101589305	101589308	+	Splice_Site	DEL	TAGA	TAGA	-			TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr8:101589305_101589308delTAGA	ENST00000311812.2	-	13	1321		c.e13-2		SNX31_ENST00000428383.2_Splice_Site	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31						protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TTCAATCTGCTAGATAGATTAGTG	0.363																																																0																																										SO:0001630	splice_region_variant	169166				CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.1171-2TCTA>-	8.37:g.101589309_101589312delTAGA			C9J6L9|Q8N0U9	Splice_Site	DEL	ENST00000311812.2	37	CCDS6288.1																																																																																				0.363	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628	Intron	43	94	43	94
NDUFA3	4696	broad.mit.edu;hgsc.bcm.edu	37	19	54610132	54610135	+	Frame_Shift_Del	DEL	GATG	GATG	-	rs587775895	byFrequency	TCGA-DB-A4XH-01A-11D-A27K-08	TCGA-DB-A4XH-10A-01D-A27N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62718b87-e510-4dec-a3e5-9ea32d9fe53c	1ba5bcf8-0368-447b-918e-058cfb461883	g.chr19:54610132_54610135delGATG	ENST00000485876.1	+	4	220_223	c.178_181delGATG	c.(178-183)gatgggfs	p.DG60fs	NDUFA3_ENST00000391763.3_3'UTR|NDUFA3_ENST00000391762.1_3'UTR|NDUFA3_ENST00000391764.3_Intron|NDUFA3_ENST00000303553.5_Frame_Shift_Del_p.DG17fs			O95167	NDUA3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa	60					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(1)	2	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					CGTCCGTGATGATGGGAACATGCC	0.642																																																0																																										SO:0001589	frameshift_variant	4696			AF044955	CCDS12877.1	19q13.42	2011-07-04	2002-08-29		ENSG00000170906	ENSG00000170906		"""Mitochondrial respiratory chain complex / Complex I"""	7686	protein-coding gene	gene with protein product	"""complex I B9 subunit"""	603832	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3 (9kD, B9)"""			9878551	Standard	NM_004542		Approved	B9	uc002qde.3	O95167	OTTHUMG00000064972	ENST00000485876.1:c.178_181delGATG	19.37:g.54610132_54610135delGATG	ENSP00000418438:p.Asp60fs			Frame_Shift_Del	DEL	ENST00000485876.1	37	CCDS12877.1																																																																																				0.642	NDUFA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139509.5	NM_004542		11	6	11	6
