#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	22012589	22012589	+	Silent	SNP	C	C	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr12:22012589C>A	ENST00000261201.4	-	20	2435	c.2436G>T	c.(2434-2436)ctG>ctT	p.L812L	ABCC9_ENST00000345162.2_Silent_p.L776L|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Silent_p.L812L	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	812	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GTCCCCCACTCAGGTTGATGC	0.383																																																0													169.0	170.0	169.0					12																	22012589		2203	4300	6503	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2436G>T	12.37:g.22012589C>A			O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																				0.383	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		20	159	20	159
SART3	9733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	108938934	108938934	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr12:108938934G>A	ENST00000228284.3	-	4	944	c.710C>T	c.(709-711)gCg>gTg	p.A237V	SART3_ENST00000552221.1_5'Flank|SART3_ENST00000431469.2_Missense_Mutation_p.A237V	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	237					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						TTCCACAATCGCACTTTCAAA	0.493									Porokeratosis																																							0													185.0	183.0	184.0					12																	108938934		2203	4300	6503	SO:0001583	missense	9733	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.710C>T	12.37:g.108938934G>A	ENSP00000228284:p.Ala237Val		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078270	0.55753	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000412617;ENST00000546815;ENST00000550322;ENST00000550619	T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31	5.97	5.97	0.96955	.	0.157087	0.56097	D	0.000024	T	0.50616	0.1626	L	0.49126	1.545	0.80722	D	1	D;P;D;D	0.61697	0.99;0.956;0.984;0.965	P;B;B;B	0.56042	0.79;0.412;0.33;0.232	T	0.20240	-1.0281	10	0.32370	T	0.25	-27.6207	20.428	0.99075	0.0:0.0:1.0:0.0	.	185;237;237;237	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	V	237;237;185;237;105;105	ENSP00000228284:A237V;ENSP00000414453:A237V;ENSP00000449386:A237V;ENSP00000447324:A105V;ENSP00000449602:A105V	ENSP00000228284:A237V	A	-	2	0	SART3	107463064	1.000000	0.71417	0.906000	0.35671	0.607000	0.37147	6.363000	0.73082	2.837000	0.97791	0.655000	0.94253	GCG		0.493	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1			62	229	62	229
SNX20	124460	hgsc.bcm.edu;broad.mit.edu	37	16	50707432	50707432	+	Missense_Mutation	SNP	G	G	A	rs375118669		TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr16:50707432G>A	ENST00000330943.4	-	4	1007	c.836C>T	c.(835-837)gCg>gTg	p.A279V	RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000300590.3_Intron|SNX20_ENST00000423026.2_Intron|RP11-401P9.5_ENST00000570241.2_RNA	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	279					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CTTGCCCAGCGCGTAGGCCAG	0.697																																																0								G	,,VAL/ALA	1,4395		0,1,2197	33.0	34.0	34.0		,,836	-5.4	0.0	16		34	0,8596		0,0,4298	no	intron,intron,missense	SNX20	NM_001144972.1,NM_153337.2,NM_182854.2	,,64	0,1,6495	AA,AG,GG		0.0,0.0227,0.0077	,,benign	,,279/317	50707432	1,12991	2198	4298	6496	SO:0001583	missense	124460			AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.836C>T	16.37:g.50707432G>A	ENSP00000332062:p.Ala279Val		A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	37	CCDS10745.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.122875	0.37436	2.27E-4	0.0	ENSG00000167208	ENST00000330943	T	0.64803	-0.12	5.67	-5.38	0.02673	.	1.734210	0.02300	N	0.071071	T	0.40932	0.1137	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.14200	-1.0481	10	0.40728	T	0.16	-0.7851	1.2037	0.01890	0.4008:0.0961:0.1911:0.312	.	279	Q7Z614	SNX20_HUMAN	V	279	ENSP00000332062:A279V	ENSP00000332062:A279V	A	-	2	0	SNX20	49264933	0.004000	0.15560	0.037000	0.18230	0.861000	0.49209	0.488000	0.22371	-0.467000	0.06932	-0.367000	0.07326	GCG		0.697	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337		6	81	6	81
GJC1	10052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	42882004	42882004	+	Silent	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr17:42882004G>A	ENST00000426548.1	-	3	1451	c.1182C>T	c.(1180-1182)gtC>gtT	p.V394V	GJC1_ENST00000590758.1_Silent_p.V394V|GJC1_ENST00000592524.1_Silent_p.V394V|GJC1_ENST00000330514.4_Silent_p.V394V	NM_001080383.1|NM_005497.3	NP_001073852.1|NP_005488.2	P36383	CXG1_HUMAN	gap junction protein, gamma 1, 45kDa	394					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle tissue development (GO:0048738)|cell development (GO:0048468)|cell-cell junction assembly (GO:0007043)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vasculogenesis (GO:0001570)|visual perception (GO:0007601)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion channel activity (GO:0005216)			NS(1)|kidney(1)|large_intestine(5)|liver(1)|lung(10)|prostate(1)	19		Prostate(33;0.0959)				ATTAAATCCAGACGGAGGTCT	0.488																																																0													102.0	99.0	100.0					17																	42882004		2203	4300	6503	SO:0001819	synonymous_variant	10052			U03493	CCDS11487.1	17q21.31	2008-02-04	2007-11-06	2007-11-06		ENSG00000182963		"""Ion channels / Gap junction proteins (connexins)"""	4280	protein-coding gene	gene with protein product	"""connexin 45"""	608655	"""gap junction protein, alpha 7, 45kDa"""	GJA7		7966354	Standard	NM_005497		Approved	CX45	uc002ihl.3	P36383		ENST00000426548.1:c.1182C>T	17.37:g.42882004G>A			B3KW68|Q4VAY0	Silent	SNP	ENST00000426548.1	37	CCDS11487.1																																																																																				0.488	GJC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448661.1	NM_005497		16	134	16	134
HAUS1	115106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	43700024	43700024	+	Silent	SNP	A	A	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr18:43700024A>G	ENST00000282058.6	+	4	554	c.474A>G	c.(472-474)caA>caG	p.Q158Q	HAUS1_ENST00000585518.1_Intron|HAUS1_ENST00000588704.1_3'UTR|RNU6-1278P_ENST00000516130.1_RNA	NM_138443.3	NP_612452.1	Q96CS2	HAUS1_HUMAN	HAUS augmin-like complex, subunit 1	158					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						AATGTCTACAAGAGTAAGTAA	0.294																																					NSCLC(79;183 1423 5813 15597 38427)											0													33.0	35.0	34.0					18																	43700024		2197	4295	6492	SO:0001819	synonymous_variant	115106			AY360137	CCDS11928.1	18q21.1	2013-10-11	2009-04-20	2009-04-20	ENSG00000152240	ENSG00000152240		"""HAUS augmin-like complex subunits"""	25174	protein-coding gene	gene with protein product		608775	"""coiled-coil domain containing 5 (spindle associated)"""	CCDC5		19427217	Standard	NR_026978		Approved	HEI-C, HsT1461, FLJ40084	uc002lbu.3	Q96CS2	OTTHUMG00000132638	ENST00000282058.6:c.474A>G	18.37:g.43700024A>G			B2RDM7|Q8N837	Silent	SNP	ENST00000282058.6	37	CCDS11928.1																																																																																				0.294	HAUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255885.1	NM_138443		7	19	7	19
NACC1	112939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	13248162	13248162	+	Missense_Mutation	SNP	C	C	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr19:13248162C>G	ENST00000292431.4	+	4	1324	c.1198C>G	c.(1198-1200)Cgg>Ggg	p.R400G	CTC-250I14.3_ENST00000591825.1_RNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	400	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						GGTCCTACTGCGGCGGCTCCT	0.647																																																0													60.0	63.0	62.0					19																	13248162		2203	4300	6503	SO:0001583	missense	112939			AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.1198C>G	19.37:g.13248162C>G	ENSP00000292431:p.Arg400Gly			Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.348298	0.61183	.	.	ENSG00000160877	ENST00000292431	T	0.50548	0.74	5.16	5.16	0.70880	BEN domain (2);	0.060136	0.64402	D	0.000005	T	0.46852	0.1414	N	0.14661	0.345	0.39313	D	0.96511	P	0.47962	0.903	P	0.54460	0.753	T	0.55817	-0.8081	10	0.72032	D	0.01	.	16.175	0.81844	0.0:1.0:0.0:0.0	.	400	Q96RE7	NACC1_HUMAN	G	400	ENSP00000292431:R400G	ENSP00000292431:R400G	R	+	1	2	NACC1	13109162	0.997000	0.39634	1.000000	0.80357	0.699000	0.40488	1.867000	0.39499	2.419000	0.82065	0.555000	0.69702	CGG		0.647	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876		9	94	9	94
ZNF85	7639	hgsc.bcm.edu;ucsc.edu	37	19	21132211	21132211	+	Silent	SNP	A	A	G	rs11665995	byFrequency	TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr19:21132211A>G	ENST00000328178.8	+	4	1004	c.891A>G	c.(889-891)cgA>cgG	p.R297R	ZNF85_ENST00000345030.6_Silent_p.R264R|ZNF85_ENST00000601023.1_Silent_p.R238R	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	297					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						CTTTTAACCGATCTTCAACCC	0.363																																																0													33.0	35.0	35.0					19																	21132211		2202	4300	6502	SO:0001819	synonymous_variant	7639			U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.891A>G	19.37:g.21132211A>G			B9ZVP4|Q6NVI0	Silent	SNP	ENST00000328178.8	37	CCDS32977.1																																																																																				0.363	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429		6	30	6	30
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42791802	42791802	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr19:42791802G>A	ENST00000575354.2	+	5	728	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	CIC_ENST00000160740.3_Missense_Mutation_p.V230I|CIC_ENST00000572681.2_Missense_Mutation_p.V1139I	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V230I(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CAACCGGACCGTCAGCAAGAT	0.617			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	prostate(1)											81.0	74.0	77.0					19																	42791802		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.688G>A	19.37:g.42791802G>A	ENSP00000458663:p.Val230Ile		Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712331	0.48517	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.39	4.39	0.52855	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	.	.	.	.	T	0.53899	0.1825	N	0.11131	0.1	0.58432	D	0.999997	D	0.76494	0.999	D	0.79108	0.992	T	0.63681	-0.6582	8	0.87932	D	0	-22.6506	14.5138	0.67807	0.0:0.0:1.0:0.0	.	230	Q96RK0	CIC_HUMAN	I	230	.	ENSP00000160740:V230I	V	+	1	0	CIC	47483642	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	7.343000	0.79319	2.284000	0.76573	0.555000	0.69702	GTC		0.617	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			11	69	11	69
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu	37	1	42046935	42046935	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr1:42046935C>T	ENST00000372583.1	-	4	4419	c.3534G>A	c.(3532-3534)atG>atA	p.M1178I	HIVEP3_ENST00000429157.2_Missense_Mutation_p.M1178I|HIVEP3_ENST00000372584.1_Missense_Mutation_p.M1178I|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Missense_Mutation_p.M1178I	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1178					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GAAGTGGGGGCATGGAGTATG	0.577																																																0													122.0	108.0	113.0					1																	42046935		2203	4300	6503	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3534G>A	1.37:g.42046935C>T	ENSP00000361664:p.Met1178Ile		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	C	6.786	0.513926	0.12944	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.05717	3.41;3.4;3.4;3.41	4.61	4.61	0.57282	.	0.204155	0.34555	N	0.003871	T	0.04588	0.0125	N	0.24115	0.695	0.33132	D	0.543215	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.16808	-1.0390	10	0.24483	T	0.36	-0.3682	9.2219	0.37382	0.1621:0.6807:0.1572:0.0	.	1178;1178	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	I	1178	ENSP00000361665:M1178I;ENSP00000361664:M1178I;ENSP00000247584:M1178I;ENSP00000410828:M1178I	ENSP00000247584:M1178I	M	-	3	0	HIVEP3	41819522	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.405000	0.34635	2.392000	0.81423	0.467000	0.42956	ATG		0.577	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503		7	126	7	126
OR10X1	128367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	158548933	158548933	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr1:158548933C>T	ENST00000368150.1	-	1	756	c.757G>A	c.(757-759)Gcc>Acc	p.A253T		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					GTGGTGAAGGCCTTCTGCTTG	0.483																																																0													142.0	141.0	141.0					1																	158548933		2203	4300	6503	SO:0001583	missense	128367			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.757G>A	1.37:g.158548933C>T	ENSP00000357132:p.Ala253Thr		Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.564852	0.45694	.	.	ENSG00000186400	ENST00000368150	T	0.00357	7.89	4.8	4.8	0.61643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000180	T	0.00300	0.0009	L	0.53617	1.68	0.31960	N	0.608493	D	0.89917	1.0	D	0.91635	0.999	T	0.58685	-0.7593	10	0.66056	D	0.02	.	10.9713	0.47441	0.0:0.9098:0.0:0.0902	.	253	Q8NGY0	O10X1_HUMAN	T	253	ENSP00000357132:A253T	ENSP00000357132:A253T	A	-	1	0	OR10X1	156815557	0.868000	0.29978	0.947000	0.38551	0.308000	0.27856	2.021000	0.41020	2.473000	0.83533	0.563000	0.77884	GCC		0.483	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		20	136	20	136
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	50312662	50312662	+	Missense_Mutation	SNP	T	T	C			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr20:50312662T>C	ENST00000338821.5	-	6	781	c.517A>G	c.(517-519)Atg>Gtg	p.M173V	ATP9A_ENST00000402822.1_Intron|ATP9A_ENST00000311637.5_Intron	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	173					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AGGAAGATCATGTCGGCAGGG	0.448																																																0													148.0	133.0	138.0					20																	50312662		2203	4300	6503	SO:0001583	missense	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.517A>G	20.37:g.50312662T>C	ENSP00000342481:p.Met173Val		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	T	11.14	1.552094	0.27739	.	.	ENSG00000054793	ENST00000338821	D	0.90004	-2.6	5.54	5.54	0.83059	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	T	0.77274	0.4106	N	0.10645	0.015	0.80722	D	1	B	0.31893	0.345	B	0.29267	0.1	T	0.75772	-0.3200	10	0.15499	T	0.54	-56.1254	15.6502	0.77084	0.0:0.0:0.0:1.0	.	173	O75110	ATP9A_HUMAN	V	173	ENSP00000342481:M173V	ENSP00000342481:M173V	M	-	1	0	ATP9A	49746069	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.769000	0.68865	2.097000	0.63578	0.482000	0.46254	ATG		0.448	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		7	47	7	47
UBASH3A	53347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	43833168	43833168	+	Silent	SNP	G	G	A	rs141710800		TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr21:43833168G>A	ENST00000319294.6	+	4	421	c.390G>A	c.(388-390)gcG>gcA	p.A130A	UBASH3A_ENST00000398367.1_Silent_p.A130A|UBASH3A_ENST00000291535.6_Silent_p.A130A	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	130					negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						TGTACGAGGCGCTGAAGAGAG	0.547																																																0								G	,	1,4405	2.1+/-5.4	0,1,2202	120.0	120.0	120.0		390,390	-10.4	0.1	21	dbSNP_134	120	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	UBASH3A	NM_001001895.2,NM_018961.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	130/624,130/662	43833168	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	53347			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.390G>A	21.37:g.43833168G>A			G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	ENST00000319294.6	37	CCDS13687.1																																																																																				0.547	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895		21	207	21	207
EP300	2033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	41566476	41566476	+	Silent	SNP	T	T	C	rs373752539		TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr22:41566476T>C	ENST00000263253.7	+	27	5572	c.4353T>C	c.(4351-4353)caT>caC	p.H1451H	RP1-85F18.6_ENST00000415054.1_RNA|RNU6-375P_ENST00000517050.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1451	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TCCATTGCCATCCTCCTGACC	0.428			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																														Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0								T		0,4406		0,0,2203	149.0	130.0	137.0		4353	1.0	1.0	22		137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EP300	NM_001429.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		1451/2415	41566476	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4353T>C	22.37:g.41566476T>C			B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																				0.428	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429		10	66	10	66
SNRNP200	23020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	96956065	96956065	+	Splice_Site	SNP	T	T	C			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr2:96956065T>C	ENST00000323853.5	-	20	2818	c.2741A>G	c.(2740-2742)aAg>aGg	p.K914R	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	914	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CTCCCCTACCTTGGCATTCTG	0.532																																																0													173.0	156.0	162.0					2																	96956065		2203	4300	6503	SO:0001630	splice_region_variant	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.2742+1A>G	2.37:g.96956065T>C			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Splice_Site	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	T	13.36	2.212498	0.39102	.	.	ENSG00000144028	ENST00000323853;ENST00000540328	T	0.43294	0.95	5.74	5.74	0.90152	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	N	0.03194	-0.395	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.13442	-1.0509	10	0.13853	T	0.58	-24.5602	15.0302	0.71701	0.0:0.0:0.0:1.0	.	914	O75643	U520_HUMAN	R	914;589	ENSP00000317123:K914R	ENSP00000317123:K914R	K	-	2	0	SNRNP200	96319792	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	7.983000	0.88140	2.190000	0.69967	0.460000	0.39030	AAG		0.532	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	Missense_Mutation	18	145	18	145
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			19	45	19	45
PIKFYVE	200576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209169012	209169012	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr2:209169012A>G	ENST00000264380.4	+	11	1596	c.1438A>G	c.(1438-1440)Ata>Gta	p.I480V	PIKFYVE_ENST00000308862.6_Missense_Mutation_p.I394V|PIKFYVE_ENST00000392202.3_Missense_Mutation_p.I383V|PIKFYVE_ENST00000407449.1_Missense_Mutation_p.I480V	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	480					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CACAGAACAGATAGCTGAAGA	0.403																																																0													149.0	136.0	140.0					2																	209169012		2203	4300	6503	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1438A>G	2.37:g.209169012A>G	ENSP00000264380:p.Ile480Val		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	A	2.486	-0.318580	0.05386	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000392200;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46	5.4	5.4	0.78164	.	0.209202	0.42420	D	0.000720	T	0.10981	0.0268	N	0.14661	0.345	0.37848	D	0.929291	B;B;B;B;B	0.30146	0.07;0.048;0.27;0.003;0.126	B;B;B;B;B	0.25506	0.016;0.024;0.061;0.003;0.042	T	0.24476	-1.0159	10	0.25751	T	0.34	-13.8668	15.7191	0.77694	1.0:0.0:0.0:0.0	.	480;480;394;480;383	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	V	383;480;112;480;394;480	ENSP00000376038:I383V;ENSP00000264380:I480V;ENSP00000384356:I480V;ENSP00000308715:I394V;ENSP00000405736:I480V	ENSP00000264380:I480V	I	+	1	0	PIKFYVE	208877257	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.520000	0.73773	2.176000	0.68965	0.374000	0.22700	ATA		0.403	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		18	57	18	57
ZBTB20	26137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	114058203	114058203	+	Missense_Mutation	SNP	C	C	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr3:114058203C>G	ENST00000474710.1	-	5	2053	c.1875G>C	c.(1873-1875)atG>atC	p.M625I	ZBTB20_ENST00000471418.1_Missense_Mutation_p.M552I|ZBTB20_ENST00000464560.1_Missense_Mutation_p.M552I|ZBTB20_ENST00000357258.3_Missense_Mutation_p.M552I|ZBTB20_ENST00000481632.1_Missense_Mutation_p.M552I|ZBTB20_ENST00000393785.2_Missense_Mutation_p.M552I|ZBTB20_ENST00000462705.1_Missense_Mutation_p.M552I	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	625						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TGTGTGTCACCATGTGCTTGA	0.537																																					NSCLC(69;748 1344 9802 11203 30933)											0													169.0	144.0	152.0					3																	114058203		2203	4300	6503	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1875G>C	3.37:g.114058203C>G	ENSP00000419153:p.Met625Ile		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434079	0.62955	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	L	0.28458	0.855	0.80722	D	1	D	0.53312	0.959	P	0.60236	0.871	T	0.00078	-1.2113	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	625	Q9HC78	ZBT20_HUMAN	I	552;552;552;552;625;552;552	ENSP00000420324:M552I;ENSP00000377375:M552I;ENSP00000418092:M552I;ENSP00000419902:M552I;ENSP00000419153:M625I;ENSP00000349803:M552I;ENSP00000417307:M552I	ENSP00000349803:M552I	M	-	3	0	ZBTB20	115540893	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ATG		0.537	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		27	80	27	80
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr3:178928079G>A	ENST00000263967.3	+	8	1514	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)											137.0	130.0	132.0					3																	178928079		1829	4090	5919	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>A	3.37:g.178928079G>A	ENSP00000263967:p.Glu453Lys		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164616	0.94727	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.68317	2.08	0.80722	D	1	P	0.50528	0.936	P	0.50970	0.655	T	0.72500	-0.4274	10	0.20046	T	0.44	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	K	453	ENSP00000263967:E453K	ENSP00000263967:E453K	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			7	68	7	68
USP53	54532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	120192691	120192691	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr4:120192691A>G	ENST00000274030.6	+	16	2855	c.1676A>G	c.(1675-1677)gAc>gGc	p.D559G	USP53_ENST00000450251.1_Missense_Mutation_p.D559G	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						ACTGGATATGACACAGACAGC	0.423																																																0													83.0	83.0	83.0					4																	120192691		1901	4136	6037	SO:0001583	missense	54532			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1676A>G	4.37:g.120192691A>G	ENSP00000274030:p.Asp559Gly			Missense_Mutation	SNP	ENST00000274030.6	37	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.824486	0.71143	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.27720	1.65;1.65	5.84	4.67	0.58626	.	0.317736	0.31347	N	0.007810	T	0.43122	0.1233	M	0.67953	2.075	0.37016	D	0.89594	D	0.59767	0.986	P	0.53266	0.722	T	0.53620	-0.8413	10	0.72032	D	0.01	-7.3077	10.478	0.44676	0.9268:0.0:0.0732:0.0	.	559	Q70EK8	UBP53_HUMAN	G	559	ENSP00000274030:D559G;ENSP00000409906:D559G	ENSP00000274030:D559G	D	+	2	0	USP53	120412139	1.000000	0.71417	0.317000	0.25265	0.803000	0.45373	6.913000	0.75759	1.046000	0.40249	0.528000	0.53228	GAC		0.423	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597		11	81	11	81
TAS2R1	50834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	9630017	9630017	+	Missense_Mutation	SNP	G	G	A	rs2234231	byFrequency	TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr5:9630017G>A	ENST00000382492.2	-	1	446	c.128C>T	c.(127-129)cCg>cTg	p.P43L	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	43					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GAGATCCAGCGGAGCCATTTT	0.378													G|||	5	0.000998403	0.0038	0.0	5008	,	,		16133	0.0		0.0	False		,,,				2504	0.0															0								G	LEU/PRO	13,4391	21.2+/-45.6	0,13,2189	56.0	60.0	59.0		128	4.4	0.0	5	dbSNP_98	59	0,8600		0,0,4300	yes	missense	TAS2R1	NM_019599.2	98	0,13,6489	AA,AG,GG		0.0,0.2952,0.1	probably-damaging	43/300	9630017	13,12991	2202	4300	6502	SO:0001583	missense	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.128C>T	5.37:g.9630017G>A	ENSP00000371932:p.Pro43Leu		Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	CCDS3876.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165005	0.57476	0.002952	0.0	ENSG00000169777	ENST00000382492	T	0.48836	0.8	5.32	4.45	0.53987	.	0.220266	0.37348	N	0.002122	T	0.53642	0.1809	L	0.33339	1.005	0.09310	N	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.41822	-0.9487	9	.	.	.	.	9.9678	0.41734	0.0913:0.0:0.9087:0.0	rs2234231;rs2234231	43	Q9NYW7	TA2R1_HUMAN	L	43	ENSP00000371932:P43L	.	P	-	2	0	TAS2R1	9683017	0.061000	0.20836	0.002000	0.10522	0.006000	0.05464	2.671000	0.46842	1.477000	0.48234	0.655000	0.94253	CCG		0.378	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			22	75	22	75
PCDHGC5	56097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140871058	140871058	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr5:140871058G>A	ENST00000252087.1	+	1	2251	c.2251G>A	c.(2251-2253)Gtg>Atg	p.V751M	PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	751					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACCTGCAGGTGAGCTCGGA	0.652																																																0													45.0	45.0	45.0					5																	140871058		2203	4300	6503	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2251G>A	5.37:g.140871058G>A	ENSP00000252087:p.Val751Met		Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924006	0.34002	.	.	ENSG00000240764	ENST00000252087	T	0.50813	0.73	4.9	4.0	0.46444	.	0.159468	0.29572	N	0.011763	T	0.35189	0.0923	L	0.45137	1.4	0.80722	D	1	B;B	0.23316	0.065;0.083	B;B	0.24541	0.054;0.023	T	0.41378	-0.9512	10	0.62326	D	0.03	.	3.8766	0.09059	0.0928:0.3095:0.4667:0.1311	.	751;751	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	M	751	ENSP00000252087:V751M	ENSP00000252087:V751M	V	+	1	0	PCDHGC5	140851242	1.000000	0.71417	0.967000	0.41034	0.856000	0.48823	1.775000	0.38584	2.534000	0.85438	0.561000	0.74099	GTG		0.652	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		7	61	7	61
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	169435568	169435568	+	Missense_Mutation	SNP	T	T	C	rs145444170	byFrequency	TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr5:169435568T>C	ENST00000256935.8	+	31	3220	c.3140T>C	c.(3139-3141)tTc>tCc	p.F1047S	DOCK2_ENST00000540750.1_Missense_Mutation_p.F108S|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.F539S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1047	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGAGCAGTTCTCACACGCC	0.448																																																0													134.0	129.0	130.0					5																	169435568		2203	4300	6503	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3140T>C	5.37:g.169435568T>C	ENSP00000256935:p.Phe1047Ser		Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.960782	0.92791	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.34275	1.37;1.37;1.37	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.65780	0.2724	M	0.86651	2.83	0.54753	D	0.999981	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.71892	-0.4455	10	0.62326	D	0.03	.	15.9958	0.80243	0.0:0.0:0.0:1.0	.	539;1047	E7ERW7;Q92608	.;DOCK2_HUMAN	S	1047;539;108	ENSP00000256935:F1047S;ENSP00000429283:F539S;ENSP00000438827:F108S	ENSP00000256935:F1047S	F	+	2	0	DOCK2	169368146	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.188000	0.69820	0.533000	0.62120	TTC		0.448	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		7	65	7	65
CNGB3	54714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	87656896	87656896	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr8:87656896A>G	ENST00000320005.5	-	9	1056	c.1009T>C	c.(1009-1011)Ttt>Ctt	p.F337L		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	337					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TGATGATTAAATTCAAAAAAT	0.274																																																0													50.0	51.0	50.0					8																	87656896		2195	4290	6485	SO:0001583	missense	54714			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1009T>C	8.37:g.87656896A>G	ENSP00000316605:p.Phe337Leu		C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.699190	0.88830	.	.	ENSG00000170289	ENST00000320005	D	0.96265	-3.96	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.97990	0.9338	M	0.82132	2.575	0.80722	D	1	D;D	0.55605	0.966;0.972	P;D	0.66716	0.881;0.946	D	0.98693	1.0697	10	0.72032	D	0.01	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	337;337	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	L	337	ENSP00000316605:F337L	ENSP00000316605:F337L	F	-	1	0	CNGB3	87726012	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.275000	0.89892	2.302000	0.77476	0.533000	0.62120	TTT		0.274	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		7	14	7	14
BICD2	23299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	95481529	95481529	+	Silent	SNP	C	C	T			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr9:95481529C>T	ENST00000375512.3	-	5	1465	c.1398G>A	c.(1396-1398)caG>caA	p.Q466Q	BICD2_ENST00000356884.6_Silent_p.Q466Q	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	466					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CCTCGGCGTGCTGGGCCTCAC	0.667																																																0													66.0	60.0	62.0					9																	95481529		2203	4299	6502	SO:0001819	synonymous_variant	23299			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.1398G>A	9.37:g.95481529C>T			O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Silent	SNP	ENST00000375512.3	37	CCDS6700.1																																																																																				0.667	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250		20	40	20	40
BEND2	139105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	18183208	18183208	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chrX:18183208G>A	ENST00000380033.4	-	14	2453	c.2321C>T	c.(2320-2322)tCg>tTg	p.S774L		NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	774								p.S774L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TGCTGGAAGCGACTGAGACCT	0.557																																																1	Substitution - Missense(1)	prostate(1)											152.0	136.0	142.0					X																	18183208		2203	4300	6503	SO:0001583	missense	139105			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2321C>T	X.37:g.18183208G>A	ENSP00000369372:p.Ser774Leu		E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223307	0.39300	.	.	ENSG00000177324	ENST00000380033	T	0.25579	1.79	5.17	-5.97	0.02227	.	5.907280	0.00508	N	0.000168	T	0.10252	0.0251	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.12630	-1.0540	10	0.21540	T	0.41	4.4762	2.0192	0.03505	0.4864:0.102:0.129:0.2827	.	774	Q8NDZ0	BEND2_HUMAN	L	774	ENSP00000369372:S774L	ENSP00000369372:S774L	S	-	2	0	BEND2	18093129	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.312000	0.02720	-1.416000	0.02019	0.544000	0.68410	TCG		0.557	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346		16	90	16	90
NEUROG3	50674	broad.mit.edu;ucsc.edu	37	10	71332578	71332578	+	Missense_Mutation	SNP	C	C	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr10:71332578C>G	ENST00000242462.4	-	2	251	c.222G>C	c.(220-222)gaG>gaC	p.E74D	RP11-343J3.2_ENST00000428753.1_RNA	NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	74					central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						TCAGTGCCAACTCGCTCTTAG	0.692																																																0													52.0	32.0	39.0					10																	71332578		2203	4299	6502	SO:0001583	missense	50674			AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.222G>C	10.37:g.71332578C>G	ENSP00000242462:p.Glu74Asp		Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	ENST00000242462.4	37	CCDS31212.1	.	.	.	.	.	.	.	.	.	.	C	7.812	0.715819	0.15306	.	.	ENSG00000122859	ENST00000242462	D	0.94497	-3.44	4.79	-0.561	0.11785	.	0.171241	0.27720	N	0.018121	T	0.82263	0.4999	N	0.12746	0.255	0.09310	N	0.99999	B	0.09022	0.002	B	0.11329	0.006	T	0.67960	-0.5535	10	0.20046	T	0.44	-25.0203	1.085	0.01650	0.1378:0.3482:0.2413:0.2728	.	74	Q9Y4Z2	NGN3_HUMAN	D	74	ENSP00000242462:E74D	ENSP00000242462:E74D	E	-	3	2	NEUROG3	71002584	0.000000	0.05858	0.956000	0.39512	0.489000	0.33432	-0.568000	0.05909	0.217000	0.20800	0.655000	0.94253	GAG		0.692	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999		3	18	3	18
FUBP1	8880	broad.mit.edu	37	1	78430553	78430553	+	Splice_Site	SNP	A	A	G			TCGA-DB-A64V-01A-11D-A29Q-08	TCGA-DB-A64V-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cbd199b2-da43-4864-a647-3c36b2034f00	4047e4fc-39cc-4c30-bec3-fc4dffdf607c	g.chr1:78430553A>G	ENST00000370768.2	-	9	817		c.e9+1		FUBP1_ENST00000436586.2_Splice_Site|FUBP1_ENST00000370767.1_Splice_Site	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1						positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						AGTTAAGTTTACTTGAACTTT	0.368			"""F, N"""		oligodendroglioma																																		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0													55.0	61.0	59.0					1																	78430553		2203	4300	6503	SO:0001630	splice_region_variant	8880			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.735+1T>C	1.37:g.78430553A>G			Q12828	Splice_Site	SNP	ENST00000370768.2	37	CCDS683.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557293	0.86231	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2988	0.82793	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FUBP1	78203141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.228000	0.95250	2.246000	0.74042	0.528000	0.53228	.		0.368	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	Intron	5	46	5	46
