#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
NRAP	4892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	115401191	115401191	+	Missense_Mutation	SNP	C	C	T	rs138124439	byFrequency	TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr10:115401191C>T	ENST00000359988.3	-	13	1500	c.1256G>A	c.(1255-1257)cGc>cAc	p.R419H	NRAP_ENST00000369360.3_Missense_Mutation_p.R384H|NRAP_ENST00000369358.4_Missense_Mutation_p.R419H|NRAP_ENST00000360478.3_Missense_Mutation_p.R384H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TCCTTCATAGCGGCCTCTCAT	0.438																																																0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	175.0	157.0	163.0		1151,1256	-2.4	1.0	10	dbSNP_134	163	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	NRAP	NM_006175.3,NM_198060.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	384/1696,419/1731	115401191	2,13004	2203	4300	6503	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1256G>A	10.37:g.115401191C>T	ENSP00000353078:p.Arg419His			Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	4.895	0.166360	0.09339	0.0	2.33E-4	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350;ENST00000369343	T;T;T;T	0.14766	2.66;2.67;2.57;2.48	5.49	-2.37	0.06643	.	0.302649	0.40908	N	0.000983	T	0.01976	0.0062	N	0.00134	-2.025	0.26680	N	0.971557	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40720	-0.9548	10	0.02654	T	1	.	11.0235	0.47732	0.0:0.3952:0.0:0.6048	.	419;384;419	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	H	419;384;419;384;148;148	ENSP00000358365:R419H;ENSP00000358367:R384H;ENSP00000353078:R419H;ENSP00000353666:R384H	ENSP00000353078:R419H	R	-	2	0	NRAP	115391181	1.000000	0.71417	0.971000	0.41717	0.979000	0.70002	0.745000	0.26259	-0.742000	0.04790	-0.291000	0.09656	CGC		0.438	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		29	116	29	116
PRSS23	11098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	86519582	86519582	+	Missense_Mutation	SNP	C	C	A	rs150416218	byFrequency	TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr11:86519582C>A	ENST00000280258.5	+	2	1322	c.897C>A	c.(895-897)gaC>gaA	p.D299E	PRSS23_ENST00000441050.1_Missense_Mutation_p.D267E|PRSS23_ENST00000533902.2_Intron	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	299						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACGTCAAAGACGAGACCTATG	0.557																																																0													102.0	104.0	103.0					11																	86519582		2201	4299	6500	SO:0001583	missense	11098			AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.897C>A	11.37:g.86519582C>A	ENSP00000280258:p.Asp299Glu		B2RDJ1|B4E2J3|Q6IBI0	Missense_Mutation	SNP	ENST00000280258.5	37	CCDS8278.1	.	.	.	.	.	.	.	.	.	.	C	2.953	-0.216312	0.06101	.	.	ENSG00000150687	ENST00000280258;ENST00000441050	T;T	0.41758	0.99;0.99	5.87	-11.7	0.00046	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.047703	0.85682	D	0.000000	T	0.14270	0.0345	N	0.04043	-0.29	0.35628	D	0.810018	B;B	0.15930	0.015;0.006	B;B	0.20767	0.031;0.031	T	0.39583	-0.9607	9	.	.	.	-23.826	15.2777	0.73753	0.0862:0.61:0.0:0.3038	.	267;299	B4E2J3;O95084	.;PRS23_HUMAN	E	299;267	ENSP00000280258:D299E;ENSP00000393015:D267E	.	D	+	3	2	PRSS23	86197230	0.002000	0.14202	0.264000	0.24511	0.832000	0.47134	-1.553000	0.02174	-2.595000	0.00454	-1.910000	0.00522	GAC		0.557	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393805.2	NM_007173		17	133	17	133
ADAMTS15	170689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	130341228	130341228	+	Silent	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr11:130341228G>A	ENST00000299164.2	+	7	2028	c.2028G>A	c.(2026-2028)ggG>ggA	p.G676G		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	676	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GGGTGTGTGGGGGAGACAATA	0.572																																																0													145.0	151.0	149.0					11																	130341228		2201	4297	6498	SO:0001819	synonymous_variant	170689			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2028G>A	11.37:g.130341228G>A			Q32MI6	Silent	SNP	ENST00000299164.2	37	CCDS8488.1																																																																																				0.572	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		14	73	14	73
PIP4K2C	79837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	57989740	57989740	+	Missense_Mutation	SNP	C	C	T	rs144510690		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr12:57989740C>T	ENST00000354947.5	+	4	455	c.439C>T	c.(439-441)Cgg>Tgg	p.R147W	PIP4K2C_ENST00000422156.3_Intron|PIP4K2C_ENST00000540759.2_Missense_Mutation_p.R147W|PIP4K2C_ENST00000550465.1_Missense_Mutation_p.R129W			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	147	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					CTCCTACGATCGGACTCTGGT	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		17852	0.001		0.0	False		,,,				2504	0.0															0								C	TRP/ARG,TRP/ARG,,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	176.0	153.0	161.0		439,385,,439	4.4	1.0	12	dbSNP_134	161	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,intron,missense	PIP4K2C	NM_001146258.1,NM_001146259.1,NM_001146260.1,NM_024779.4	101,101,,101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,,probably-damaging	147/422,129/404,,147/422	57989740	2,13004	2203	4300	6503	SO:0001583	missense	79837			AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.439C>T	12.37:g.57989740C>T	ENSP00000347032:p.Arg147Trp		B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	ENST00000354947.5	37	CCDS8946.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	22.5	4.292082	0.80914	2.27E-4	1.16E-4	ENSG00000166908	ENST00000540759;ENST00000436866;ENST00000551772;ENST00000550465;ENST00000354947	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.35	4.4	0.53042	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.062416	0.64402	D	0.000007	T	0.54382	0.1855	M	0.81341	2.54	0.52501	D	0.999953	D;D	0.76494	0.999;0.998	D;D	0.72625	0.948;0.978	T	0.58008	-0.7712	10	0.72032	D	0.01	-11.9374	11.2869	0.49226	0.3256:0.6744:0.0:0.0	.	129;147	B4DY44;Q8TBX8	.;PI42C_HUMAN	W	147;147;126;129;147	ENSP00000439878:R147W;ENSP00000450197:R126W;ENSP00000447390:R129W;ENSP00000347032:R147W	ENSP00000347032:R147W	R	+	1	2	PIP4K2C	56276007	0.998000	0.40836	1.000000	0.80357	0.922000	0.55478	0.592000	0.23984	2.683000	0.91414	0.455000	0.32223	CGG		0.522	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779		26	117	26	117
CENPJ	55835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	25479612	25479612	+	Missense_Mutation	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr13:25479612C>G	ENST00000381884.4	-	7	2749	c.2564G>C	c.(2563-2565)aGg>aCg	p.R855T	CENPJ_ENST00000545981.1_Missense_Mutation_p.R855T	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	855					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCTGCTCCTCCTGGACTTGCT	0.428																																																0													132.0	118.0	122.0					13																	25479612		2203	4300	6503	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2564G>C	13.37:g.25479612C>G	ENSP00000371308:p.Arg855Thr		Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	1.353	-0.590940	0.03799	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.64085	-0.08;-0.08	5.44	0.575	0.17374	.	0.771349	0.12043	N	0.504890	T	0.39436	0.1078	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17961	-1.0352	10	0.14252	T	0.57	.	1.2916	0.02061	0.2557:0.4118:0.1247:0.2077	.	855	Q9HC77	CENPJ_HUMAN	T	855	ENSP00000371308:R855T;ENSP00000441090:R855T	ENSP00000371308:R855T	R	-	2	0	CENPJ	24377612	0.000000	0.05858	0.000000	0.03702	0.619000	0.37552	0.406000	0.21032	-0.148000	0.11234	0.655000	0.94253	AGG		0.428	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		11	71	11	71
CLEC14A	161198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	38724284	38724284	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr14:38724284G>A	ENST00000342213.2	-	1	1290	c.944C>T	c.(943-945)cCg>cTg	p.P315L		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	315						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TGTTCTCTGCGGCACGGGGCT	0.617																																																0													67.0	68.0	68.0					14																	38724284		2201	4299	6500	SO:0001583	missense	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.944C>T	14.37:g.38724284G>A	ENSP00000353013:p.Pro315Leu		Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	G	9.059	0.994113	0.19043	.	.	ENSG00000176435	ENST00000342213;ENST00000546356	T	0.73469	-0.75	4.05	-2.48	0.06423	.	0.546118	0.13848	N	0.358541	T	0.56717	0.2004	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.14578	0.011	T	0.42582	-0.9443	10	0.62326	D	0.03	-2.3771	6.0792	0.19933	0.1546:0.0:0.3888:0.4567	.	315	Q86T13	CLC14_HUMAN	L	315;80	ENSP00000353013:P315L	ENSP00000353013:P315L	P	-	2	0	CLEC14A	37794035	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.258000	0.18387	-0.872000	0.04037	-3.620000	0.00027	CCG		0.617	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		24	150	24	150
RTN1	6252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	60212786	60212786	+	Missense_Mutation	SNP	C	C	T	rs370447872		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr14:60212786C>T	ENST00000267484.5	-	2	990	c.655G>A	c.(655-657)Gac>Aac	p.D219N		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	219					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AAGTCCAAGTCTTTATCTTCC	0.448																																																0													241.0	238.0	239.0					14																	60212786		2203	4300	6503	SO:0001583	missense	6252			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.655G>A	14.37:g.60212786C>T	ENSP00000267484:p.Asp219Asn		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.412789	0.42817	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.25085	1.82	5.43	4.49	0.54785	.	0.689080	0.14806	N	0.297322	T	0.22513	0.0543	L	0.54323	1.7	0.27406	N	0.954704	P	0.34462	0.454	B	0.30401	0.115	T	0.07597	-1.0764	10	0.30078	T	0.28	.	9.6272	0.39757	0.0:0.7708:0.1456:0.0835	.	219	Q16799	RTN1_HUMAN	N	219;145	ENSP00000267484:D219N	ENSP00000267484:D219N	D	-	1	0	RTN1	59282539	0.893000	0.30496	1.000000	0.80357	0.649000	0.38597	0.713000	0.25794	2.540000	0.85666	0.557000	0.71058	GAC		0.448	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			44	244	44	244
ZNF770	54989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	35274299	35274299	+	Nonsense_Mutation	SNP	G	G	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr15:35274299G>C	ENST00000356321.4	-	3	1681	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	446					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TTCCTCACCTGATGAACCACA	0.343																																																0													86.0	88.0	87.0					15																	35274299		2201	4298	6499	SO:0001587	stop_gained	54989			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1337C>G	15.37:g.35274299G>C	ENSP00000348673:p.Ser446*		Q6ZMZ6|Q9NWV2	Nonsense_Mutation	SNP	ENST00000356321.4	37	CCDS10042.1	.	.	.	.	.	.	.	.	.	.	G	35	5.508105	0.96386	.	.	ENSG00000198146	ENST00000356321	.	.	.	5.49	4.56	0.56223	.	0.652375	0.13885	N	0.356016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	0.4442	10.5811	0.45257	0.0712:0.1348:0.794:0.0	.	.	.	.	X	446	.	ENSP00000348673:S446X	S	-	2	0	ZNF770	33061591	0.430000	0.25538	0.999000	0.59377	0.480000	0.33159	1.060000	0.30530	1.519000	0.48950	0.655000	0.94253	TCA		0.343	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106		13	77	13	77
DUOX2	50506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	45389890	45389890	+	Silent	SNP	G	G	A	rs201261436	byFrequency	TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr15:45389890G>A	ENST00000603300.1	-	28	3817	c.3615C>T	c.(3613-3615)ttC>ttT	p.F1205F	DUOX2_ENST00000389039.6_Silent_p.F1205F	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1205	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GGTGGGAGGCGAAGACATACA	0.617													G|||	12	0.00239617	0.0	0.0	5008	,	,		15962	0.0		0.0	False		,,,				2504	0.0123															0													83.0	80.0	81.0					15																	45389890		2198	4298	6496	SO:0001819	synonymous_variant	50506			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3615C>T	15.37:g.45389890G>A			A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	ENST00000603300.1	37	CCDS10117.1																																																																																				0.617	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080		28	94	28	94
SLC28A1	9154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	85467219	85467219	+	Missense_Mutation	SNP	G	G	A	rs150926643		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr15:85467219G>A	ENST00000286749.3	+	11	1051	c.961G>A	c.(961-963)Gag>Aag	p.E321K	SLC28A1_ENST00000537624.1_Missense_Mutation_p.E321K|SLC28A1_ENST00000537703.1_Missense_Mutation_p.E243K|SLC28A1_ENST00000394573.1_Missense_Mutation_p.E321K|SLC28A1_ENST00000538177.1_Missense_Mutation_p.E321K|SLC28A1_ENST00000537216.1_Missense_Mutation_p.E321K			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	321					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.E321K(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	TTTGCAGACCGAGGCTCCATT	0.567																																																1	Substitution - Missense(1)	skin(1)						G	LYS/GLU	0,4406		0,0,2203	102.0	80.0	87.0		961	4.1	0.9	15	dbSNP_134	87	1,8597	1.2+/-3.3	0,1,4298	yes	missense	SLC28A1	NM_004213.3	56	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	321/650	85467219	1,13003	2203	4299	6502	SO:0001583	missense	9154			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.961G>A	15.37:g.85467219G>A	ENSP00000286749:p.Glu321Lys		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697360	0.88830	0.0	1.16E-4	ENSG00000156222	ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	4.11	4.11	0.48088	Nucleoside recognition (1);	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	H	0.97940	4.11	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.995;1.0	D;P;D;P;D	0.73708	0.954;0.875;0.981;0.899;0.954	T	0.81739	-0.0795	10	0.87932	D	0	-9.9308	14.2507	0.66019	0.0:0.0:1.0:0.0	.	321;321;321;243;321	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337	.;.;.;.;S28A1_HUMAN	K	321;321;321;321;321;243	ENSP00000440546:E321K;ENSP00000443752:E321K;ENSP00000444700:E321K;ENSP00000286749:E321K;ENSP00000378074:E321K;ENSP00000443764:E243K	ENSP00000286749:E321K	E	+	1	0	SLC28A1	83268223	1.000000	0.71417	0.915000	0.36163	0.904000	0.53231	8.784000	0.91818	2.281000	0.76405	0.655000	0.94253	GAG		0.567	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			9	61	9	61
MCTP2	55784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	94943169	94943169	+	Missense_Mutation	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr15:94943169C>G	ENST00000357742.4	+	15	1910	c.1910C>G	c.(1909-1911)aCt>aGt	p.T637S	MCTP2_ENST00000451018.3_Missense_Mutation_p.T637S|MCTP2_ENST00000331706.4_Missense_Mutation_p.T225S|MCTP2_ENST00000557742.1_Missense_Mutation_p.T225S	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	637					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AGTATTAGGACTTTTACTCCC	0.448																																																0													95.0	96.0	96.0					15																	94943169		2197	4298	6495	SO:0001583	missense	55784			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1910C>G	15.37:g.94943169C>G	ENSP00000350377:p.Thr637Ser		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550014	0.65311	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.69561	-0.41;-0.12;-0.22	5.22	4.29	0.51040	C2 calcium/lipid-binding domain, CaLB (1);	0.043223	0.85682	N	0.000000	T	0.76176	0.3951	M	0.67953	2.075	0.52099	D	0.999948	P;D;P	0.54207	0.929;0.965;0.941	P;P;P	0.56216	0.729;0.671;0.794	T	0.78889	-0.2026	10	0.59425	D	0.04	.	15.6419	0.77012	0.0:0.8619:0.1381:0.0	.	637;225;637	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	S	637;225;637	ENSP00000395109:T637S;ENSP00000329646:T225S;ENSP00000350377:T637S	ENSP00000329646:T225S	T	+	2	0	MCTP2	92744173	0.997000	0.39634	0.992000	0.48379	0.815000	0.46073	3.872000	0.56085	1.153000	0.42468	0.563000	0.77884	ACT		0.448	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349		22	146	22	146
SNX29	92017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	12571690	12571690	+	Missense_Mutation	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr16:12571690C>G	ENST00000566228.1	+	19	2221	c.2152C>G	c.(2152-2154)Cca>Gca	p.P718A	SNX29_ENST00000306030.3_Missense_Mutation_p.P333A|SNX29_ENST00000323433.4_Missense_Mutation_p.P333A	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	718	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CTACAACTTCCCACCCAAAAA	0.438																																																0													55.0	53.0	54.0					16																	12571690		1892	4116	6008	SO:0001583	missense	92017			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2152C>G	16.37:g.12571690C>G	ENSP00000456480:p.Pro718Ala		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	37	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743710	0.89663	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.72505	-0.66;-0.66	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.89873	0.6841	H	0.96861	3.895	0.44098	D	0.996869	.	.	.	.	.	.	D	0.92687	0.6163	8	0.87932	D	0	-9.924	17.6471	0.88151	0.0:1.0:0.0:0.0	.	.	.	.	A	333	ENSP00000306940:P333A;ENSP00000322226:P333A	ENSP00000306940:P333A	P	+	1	0	SNX29	12479191	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.303000	0.78871	2.758000	0.94735	0.655000	0.94253	CCA		0.438	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1			6	38	6	38
ADCY7	113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	50347883	50347883	+	Silent	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr16:50347883C>G	ENST00000394697.2	+	23	3106	c.2766C>G	c.(2764-2766)ccC>ccG	p.P922P	ADCY7_ENST00000254235.3_Silent_p.P922P			P51828	ADCY7_HUMAN	adenylate cyclase 7	922	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		TACTGAAGCCCAAGTTCAGCG	0.617																																																0													80.0	74.0	76.0					16																	50347883		2198	4300	6498	SO:0001819	synonymous_variant	113			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2766C>G	16.37:g.50347883C>G			A0AVA6	Silent	SNP	ENST00000394697.2	37	CCDS10741.1																																																																																				0.617	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3			14	81	14	81
IRX6	79190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	55361633	55361633	+	Silent	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr16:55361633C>G	ENST00000290552.7	+	4	1881	c.549C>G	c.(547-549)gcC>gcG	p.A183A	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	183					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TCATGCTGGCCATCATCACCA	0.572																																																0													146.0	114.0	125.0					16																	55361633		2198	4300	6498	SO:0001819	synonymous_variant	79190			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.549C>G	16.37:g.55361633C>G			B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	37	CCDS32449.1																																																																																				0.572	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335		22	116	22	116
ZNF276	92822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	89804475	89804475	+	Missense_Mutation	SNP	T	T	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr16:89804475T>A	ENST00000443381.2	+	11	1763	c.1666T>A	c.(1666-1668)Tgt>Agt	p.C556S	ZNF276_ENST00000446326.2_Missense_Mutation_p.C342S|ZNF276_ENST00000568064.1_3'UTR|FANCA_ENST00000389301.3_3'UTR|ZNF276_ENST00000289816.5_Missense_Mutation_p.C481S	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	556					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GGACTTTGCCTGTGACCAGTG	0.597																																																0													75.0	59.0	64.0					16																	89804475		2198	4300	6498	SO:0001583	missense	92822			AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.1666T>A	16.37:g.89804475T>A	ENSP00000415836:p.Cys556Ser		Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	ENST00000443381.2	37	CCDS45554.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511216	0.85389	.	.	ENSG00000158805	ENST00000446326;ENST00000289816;ENST00000443381	D;D;D	0.99974	-10.2;-10.2;-10.2	5.75	4.65	0.58169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	M	0.87971	2.92	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.70935	0.954;0.966;0.971	D	0.94764	0.7939	10	0.87932	D	0	-12.1241	11.1086	0.48218	0.0:0.0723:0.0:0.9277	.	394;556;342	B4DIT3;Q8N554;A8K186	.;ZN276_HUMAN;.	S	342;481;556	ENSP00000415999:C342S;ENSP00000289816:C481S;ENSP00000415836:C556S	ENSP00000289816:C481S	C	+	1	0	ZNF276	88331976	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.836000	0.86788	0.996000	0.38943	0.459000	0.35465	TGT		0.597	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422517.1	NM_152287		11	47	11	47
USP6	9098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	5072170	5072170	+	Nonsense_Mutation	SNP	C	C	T	rs377066075		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr17:5072170C>T	ENST00000574788.1	+	35	5567	c.3337C>T	c.(3337-3339)Cga>Tga	p.R1113*	USP6_ENST00000304328.5_Nonsense_Mutation_p.R796*|USP6_ENST00000332776.4_3'UTR|USP6_ENST00000250066.6_Nonsense_Mutation_p.R1113*			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1113	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TTTGGTACCACGAGACCCGGC	0.473			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0								C	stop/ARG	0,4406		0,0,2203	107.0	117.0	114.0		3337	1.2	0.9	17		114	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	USP6	NM_004505.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1113/1407	5072170	1,13005	2203	4300	6503	SO:0001587	stop_gained	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3337C>T	17.37:g.5072170C>T	ENSP00000460380:p.Arg1113*		Q15634|Q86WP6|Q8IWT4	Nonsense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	50	17.228432	0.99882	0.0	1.16E-4	ENSG00000129204	ENST00000250066;ENST00000304328	.	.	.	2.35	1.17	0.20885	.	0.041542	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6684	0.23054	0.7529:0.2471:0.0:0.0	.	.	.	.	X	1113;796	.	ENSP00000250066:R1113X	R	+	1	2	USP6	5012894	1.000000	0.71417	0.922000	0.36590	0.070000	0.16714	1.902000	0.39848	0.156000	0.19299	-1.296000	0.01341	CGA		0.473	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505		48	244	48	244
CUEDC1	404093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	55946527	55946527	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr17:55946527G>A	ENST00000577830.1	-	7	1309	c.896C>T	c.(895-897)tCt>tTt	p.S299F	CUEDC1_ENST00000360238.2_Missense_Mutation_p.S299F|CUEDC1_ENST00000577840.1_Missense_Mutation_p.S162F|CUEDC1_ENST00000578357.1_5'UTR|CUEDC1_ENST00000407144.2_Missense_Mutation_p.S299F	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	299										endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						GGCATCTTCAGACACAGCGGG	0.617																																																0													88.0	65.0	73.0					17																	55946527		2203	4300	6503	SO:0001583	missense	404093			AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.896C>T	17.37:g.55946527G>A	ENSP00000462717:p.Ser299Phe		D3DTZ2|Q9NWD0	Missense_Mutation	SNP	ENST00000577830.1	37	CCDS11599.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062119	0.93846	.	.	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.27104	1.69;1.69	5.29	5.29	0.74685	.	0.059905	0.64402	D	0.000001	T	0.39835	0.1093	L	0.59436	1.845	0.58432	D	0.999998	P	0.48998	0.918	P	0.50896	0.653	T	0.25047	-1.0143	10	0.72032	D	0.01	-2.9603	17.9143	0.88944	0.0:0.0:1.0:0.0	.	299	Q9NWM3	CUED1_HUMAN	F	299	ENSP00000384712:S299F;ENSP00000353373:S299F	ENSP00000353373:S299F	S	-	2	0	CUEDC1	53301526	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.524000	0.90579	2.490000	0.84030	0.591000	0.81541	TCT		0.617	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949		7	34	7	34
MYOC	4653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	171605340	171605340	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr1:171605340C>T	ENST00000037502.6	-	3	1311	c.1240G>A	c.(1240-1242)Gaa>Aaa	p.E414K		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	414	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.		E -> K. {ECO:0000269|PubMed:12356829}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)	p.E414K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CAGGTTTGTTCGAGTTCCAGA	0.527																																																1	Substitution - Missense(1)	lung(1)											220.0	201.0	208.0					1																	171605340		2203	4300	6503	SO:0001583	missense	4653			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1240G>A	1.37:g.171605340C>T	ENSP00000037502:p.Glu414Lys		B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	C	7.487	0.649911	0.14516	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591	D	0.89810	-2.57	5.17	3.22	0.36961	Olfactomedin-like (3);	0.264979	0.42420	D	0.000709	T	0.64768	0.2628	L	0.33710	1.025	0.09310	N	1	B;B	0.29627	0.134;0.252	B;B	0.28011	0.038;0.085	T	0.52939	-0.8508	10	0.19147	T	0.46	.	5.3612	0.16089	0.0:0.4938:0.3433:0.163	.	356;414	B4DV44;Q99972	.;MYOC_HUMAN	K	414;367;347	ENSP00000037502:E414K	ENSP00000037502:E414K	E	-	1	0	MYOC	169871963	0.000000	0.05858	0.006000	0.13384	0.209000	0.24338	0.811000	0.27198	1.256000	0.44068	0.555000	0.69702	GAA		0.527	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261		37	150	37	150
SNRPE	6635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	203832798	203832798	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr1:203832798G>A	ENST00000414487.2	+	3	134	c.89G>A	c.(88-90)cGg>cAg	p.R30Q	SNRPE_ENST00000483099.1_3'UTR|SNRPE_ENST00000367208.1_5'UTR	NM_003094.2	NP_003085.1	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E	30					gene expression (GO:0010467)|hair cycle (GO:0042633)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			breast(1)|large_intestine(2)|lung(1)|skin(1)	5	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGAGATCGCGGATTCAGGTG	0.473																																					Ovarian(83;324 1318 17952 32395 39614)											0													111.0	113.0	112.0					1																	203832798		2203	4300	6503	SO:0001583	missense	6635			M37716	CCDS30979.1	1q32	2011-10-11			ENSG00000182004	ENSG00000182004			11161	protein-coding gene	gene with protein product		128260				1835977, 2143747	Standard	NM_003094		Approved	Sm-E	uc001hai.3	P62304	OTTHUMG00000035985	ENST00000414487.2:c.89G>A	1.37:g.203832798G>A	ENSP00000400591:p.Arg30Gln		B2R5B9|P08578|Q15498|Q5BKT2	Missense_Mutation	SNP	ENST00000414487.2	37	CCDS30979.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705089	0.68615	.	.	ENSG00000182004	ENST00000414487	T	0.46063	0.88	5.16	5.16	0.70880	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.206931	0.42682	N	0.000667	T	0.38692	0.1050	.	.	.	0.80722	D	1	B	0.19935	0.04	B	0.19666	0.026	T	0.13980	-1.0489	9	0.39692	T	0.17	.	18.2808	0.90097	0.0:0.0:1.0:0.0	.	30	P62304	RUXE_HUMAN	Q	30	ENSP00000400591:R30Q	ENSP00000400591:R30Q	R	+	2	0	SNRPE	202099421	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.937000	0.87672	2.400000	0.81607	0.650000	0.86243	CGG		0.473	SNRPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087703.1	NM_003094		630	142	630	142
TSHZ2	128553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	51872726	51872726	+	Missense_Mutation	SNP	C	C	T	rs367984099		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr20:51872726C>T	ENST00000371497.5	+	2	3616	c.2729C>T	c.(2728-2730)aCg>aTg	p.T910M	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.T907M|TSHZ2_ENST00000329613.6_Missense_Mutation_p.T907M	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	910					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CTTAGGAAAACGGGCGGGACA	0.488																																																0								C	MET/THR,MET/THR	0,4406		0,0,2203	69.0	70.0	70.0		2720,2729	5.8	1.0	20		70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TSHZ2	NM_001193421.1,NM_173485.5	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	907/1032,910/1035	51872726	1,13005	2203	4300	6503	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2729C>T	20.37:g.51872726C>T	ENSP00000360552:p.Thr910Met		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.871973	0.72180	0.0	1.16E-4	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.24723	1.85;1.84	5.8	5.8	0.92144	Homeobox (1);	0.047096	0.85682	D	0.000000	T	0.43765	0.1262	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.26360	-1.0105	10	0.87932	D	0	-5.5554	20.0431	0.97598	0.0:1.0:0.0:0.0	.	910	Q9NRE2	TSH2_HUMAN	M	910;907;436	ENSP00000360552:T910M;ENSP00000333114:T907M	ENSP00000333114:T907M	T	+	2	0	TSHZ2	51306133	1.000000	0.71417	0.989000	0.46669	0.843000	0.47879	7.482000	0.81143	2.732000	0.93576	0.643000	0.83706	ACG		0.488	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		9	69	9	69
SRBD1	55133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	45616592	45616592	+	Nonsense_Mutation	SNP	G	G	A	rs573722234		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:45616592G>A	ENST00000263736.4	-	21	2907	c.2845C>T	c.(2845-2847)Cga>Tga	p.R949*	SRBD1_ENST00000535761.1_Nonsense_Mutation_p.R468*|SRBD1_ENST00000490133.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	949	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			GTTACATTTCGTATGGGAATC	0.433																																																0													84.0	83.0	84.0					2																	45616592		2203	4300	6503	SO:0001587	stop_gained	55133			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2845C>T	2.37:g.45616592G>A	ENSP00000263736:p.Arg949*		Q53T56|Q96TA4|Q9NW11	Nonsense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505197	0.85282	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	.	.	.	4.14	1.22	0.21188	.	0.067065	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	13.4287	0.61042	0.0:0.0:0.5902:0.4098	.	.	.	.	X	949;468	.	ENSP00000263736:R949X	R	-	1	2	SRBD1	45470096	1.000000	0.71417	0.996000	0.52242	0.396000	0.30629	1.422000	0.34826	0.255000	0.21593	-0.261000	0.10672	CGA		0.433	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079		15	74	15	74
PPP3R1	5534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	68413615	68413615	+	Silent	SNP	A	A	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:68413615A>G	ENST00000234310.3	-	5	853	c.450T>C	c.(448-450)ttT>ttC	p.F150F	PPP3R1_ENST00000409377.1_Silent_p.F140F|RP11-474G23.1_ENST00000406334.3_Silent_p.F140F|PPP3R1_ENST00000409752.1_Silent_p.F169F	NM_000945.3	NP_000936.1	P63098	CANB1_HUMAN	protein phosphatase 3, regulatory subunit B, alpha	150	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lung epithelial cell differentiation (GO:0060487)|NFAT protein import into nucleus (GO:0051531)|patterning of blood vessels (GO:0001569)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein dephosphorylation (GO:0006470)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|protein domain specific binding (GO:0019904)			large_intestine(1)	1						AGAATTCTTCAAAGGATATTC	0.333																																																0													160.0	149.0	152.0					2																	68413615		1861	4118	5979	SO:0001819	synonymous_variant	5534			M30773	CCDS46310.1	2p14	2013-01-10	2010-04-14		ENSG00000221823	ENSG00000221823	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 3, regulatory subunits"", ""EF-hand domain containing"""	9317	protein-coding gene	gene with protein product	"""calcineurin B, type I (19kDa)"", ""protein phosphatase 2B regulatory subunit B alpha"""	601302	"""protein phosphatase 3 (formerly 2B), regulatory subunit B (19kD), alpha isoform (calcineurin B, type I)"", ""protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin B, type I)"", ""protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform"""			8978785, 2558868	Standard	NM_000945		Approved	CALNB1, CNB, CNB1	uc002sei.1	P63098	OTTHUMG00000129561	ENST00000234310.3:c.450T>C	2.37:g.68413615A>G			B2RC10|B5MDU4|P06705|P15117|Q08044|Q53SL0	Silent	SNP	ENST00000234310.3	37	CCDS46310.1																																																																																				0.333	PPP3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326765.4	NM_000945		17	114	17	114
CHST10	9486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	101009737	101009737	+	Silent	SNP	C	C	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:101009737C>A	ENST00000264249.3	-	7	1426	c.1041G>T	c.(1039-1041)ggG>ggT	p.G347G	CHST10_ENST00000542617.1_Silent_p.G395G|CHST10_ENST00000409701.1_Silent_p.G347G	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	347					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						GTTTCTGGTACCCAAAGAGCT	0.448																																																0													118.0	117.0	117.0					2																	101009737		2203	4300	6503	SO:0001819	synonymous_variant	9486			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.1041G>T	2.37:g.101009737C>A			Q53T18	Silent	SNP	ENST00000264249.3	37	CCDS2047.1																																																																																				0.448	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854		19	123	19	123
IL1A	3552	hgsc.bcm.edu;ucsc.edu	37	2	113537124	113537124	+	Missense_Mutation	SNP	C	C	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:113537124C>A	ENST00000263339.3	-	5	594	c.439G>T	c.(439-441)Gcc>Tcc	p.A147S		NM_000575.3	NP_000566.3	P01583	IL1A_HUMAN	interleukin 1, alpha	147					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|response to copper ion (GO:0046688)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	copper ion binding (GO:0005507)|cytokine activity (GO:0005125)			breast(2)|large_intestine(1)|lung(9)	12					Rilonacept(DB06372)	TGATCATTGGCTCGAATTATA	0.413																																																0													163.0	124.0	137.0					2																	113537124		2203	4300	6503	SO:0001583	missense	3552			M28983	CCDS2101.1	2q14	2014-01-30			ENSG00000115008	ENSG00000115008		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5991	protein-coding gene	gene with protein product	"""preinterleukin 1 alpha"", ""hematopoietin-1"", ""pro-interleukin-1-alpha"""	147760		IL1		8188271, 2989698	Standard	NM_000575		Approved	IL1F1, IL-1A, IL1-ALPHA	uc002tig.3	P01583	OTTHUMG00000131315	ENST00000263339.3:c.439G>T	2.37:g.113537124C>A	ENSP00000263339:p.Ala147Ser		Q53QF9|Q7RU02	Missense_Mutation	SNP	ENST00000263339.3	37	CCDS2101.1	.	.	.	.	.	.	.	.	.	.	C	0.957	-0.704642	0.03255	.	.	ENSG00000115008	ENST00000263339	T	0.21191	2.02	4.44	-0.407	0.12385	.	1.656860	0.03119	N	0.163509	T	0.11537	0.0281	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17776	-1.0358	10	0.02654	T	1	-8.6395	4.5037	0.11876	0.0:0.425:0.3086:0.2664	.	147	P01583	IL1A_HUMAN	S	147	ENSP00000263339:A147S	ENSP00000263339:A147S	A	-	1	0	IL1A	113253595	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.017000	0.12590	-0.087000	0.12528	-0.827000	0.03088	GCC		0.413	IL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254084.1	NM_000575		6	58	6	58
MYO7B	4648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	128341815	128341815	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:128341815C>T	ENST00000409816.2	+	12	1494	c.1462C>T	c.(1462-1464)Cac>Tac	p.H488Y	MYO7B_ENST00000428314.1_Missense_Mutation_p.H488Y|MYO7B_ENST00000389524.4_Missense_Mutation_p.H488Y			Q6PIF6	MYO7B_HUMAN	myosin VIIB	488	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GGACTATATCCACTACACCGA	0.577																																																0													86.0	96.0	92.0					2																	128341815		2180	4280	6460	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1462C>T	2.37:g.128341815C>T	ENSP00000386461:p.His488Tyr		Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787636	0.70337	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	T;T;T	0.71698	-0.59;-0.59;-0.59	4.69	0.561	0.17285	Myosin head, motor domain (3);	0.588693	0.17776	N	0.162440	T	0.73171	0.3553	L	0.49126	1.545	0.26725	N	0.970699	D	0.57899	0.981	P	0.54544	0.755	T	0.68659	-0.5350	10	0.87932	D	0	.	12.9452	0.58369	0.0:0.278:0.6452:0.0769	.	488	Q6PIF6	MYO7B_HUMAN	Y	488	ENSP00000374175:H488Y;ENSP00000415090:H488Y;ENSP00000386461:H488Y	ENSP00000374175:H488Y	H	+	1	0	MYO7B	128058285	1.000000	0.71417	0.936000	0.37596	0.946000	0.59487	2.129000	0.42055	-0.002000	0.14469	0.650000	0.86243	CAC		0.577	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		15	92	15	92
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179396156	179396156	+	Silent	SNP	A	A	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:179396156A>G	ENST00000591111.1	-	308	100487	c.100263T>C	c.(100261-100263)taT>taC	p.Y33421Y	TTN_ENST00000342175.6_Silent_p.Y26189Y|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.Y35062Y|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Silent_p.Y32494Y|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Silent_p.Y25997Y|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000359218.5_Silent_p.Y26122Y|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33421					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGAAACAGCATACGCCTCTG	0.473																																																0													118.0	117.0	117.0					2																	179396156		1916	4129	6045	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100263T>C	2.37:g.179396156A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		34	129	34	129
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179585342	179585342	+	Missense_Mutation	SNP	C	C	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:179585342C>A	ENST00000591111.1	-	78	22420	c.22196G>T	c.(22195-22197)gGt>gTt	p.G7399V	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G7716V|TTN_ENST00000342992.6_Missense_Mutation_p.G6472V|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12959	Ig-like 56.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACATCAGAACCTTTAAGAGC	0.393																																																0																																										SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22196G>T	2.37:g.179585342C>A	ENSP00000465570:p.Gly7399Val		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.60	1.987786	0.35036	.	.	ENSG00000155657	ENST00000342992	T	0.81415	-1.49	5.87	5.0	0.66597	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93413	0.7899	H	0.98542	4.26	0.80722	D	1	D	0.62365	0.991	D	0.66196	0.942	D	0.95800	0.8832	9	0.87932	D	0	.	15.3095	0.74019	0.0:0.9328:0.0:0.0672	.	7399	Q8WZ42	TITIN_HUMAN	V	6472	ENSP00000343764:G6472V	ENSP00000343764:G6472V	G	-	2	0	TTN	179293587	0.899000	0.30636	0.999000	0.59377	0.998000	0.95712	1.638000	0.37165	1.480000	0.48289	0.650000	0.86243	GGT		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	35	7	35
PTH2R	5746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209309554	209309554	+	Silent	SNP	C	C	A	rs143390240		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:209309554C>A	ENST00000272847.2	+	7	1008	c.795C>A	c.(793-795)atC>atA	p.I265I	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	265					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	ATAATCTCATCTTTGTGGCTT	0.413																																																0													302.0	292.0	295.0					2																	209309554		2203	4300	6503	SO:0001819	synonymous_variant	5746			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.795C>A	2.37:g.209309554C>A			Q8N429	Silent	SNP	ENST00000272847.2	37	CCDS2383.1																																																																																				0.413	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048		46	217	46	217
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	38755451	38755451	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr3:38755451G>A	ENST00000449082.2	-	21	3801	c.3802C>T	c.(3802-3804)Cgg>Tgg	p.R1268W		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1268					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1268W(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGACTTACCCGCATGCCTTCA	0.552																																																1	Substitution - Missense(1)	endometrium(1)											60.0	61.0	61.0					3																	38755451		2203	4300	6503	SO:0001583	missense	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3802C>T	3.37:g.38755451G>A	ENSP00000390600:p.Arg1268Trp		A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803294	0.70682	.	.	ENSG00000185313	ENST00000449082	D	0.98914	-5.23	4.14	-2.79	0.05841	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99444	0.9803	H	0.99825	4.815	0.44780	D	0.997782	D	0.76494	0.999	D	0.63283	0.913	D	0.98676	1.0690	10	0.87932	D	0	.	15.5813	0.76445	0.0:0.0:0.166:0.8339	.	1268	Q9Y5Y9	SCNAA_HUMAN	W	1268	ENSP00000390600:R1268W	ENSP00000390600:R1268W	R	-	1	2	SCN10A	38730455	1.000000	0.71417	0.996000	0.52242	0.882000	0.50991	1.604000	0.36804	-0.300000	0.08895	0.411000	0.27672	CGG		0.552	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		26	107	26	107
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	47098400	47098400	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr3:47098400G>A	ENST00000409792.3	-	15	6916	c.6874C>T	c.(6874-6876)Caa>Taa	p.Q2292*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2292	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATGGTTGCTTGAGACTGTGCA	0.463			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													116.0	110.0	112.0					3																	47098400		2203	4300	6503	SO:0001587	stop_gained	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6874C>T	3.37:g.47098400G>A	ENSP00000386759:p.Gln2292*		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	47	13.432668	0.99741	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.2	5.2	0.72013	.	0.144289	0.32785	N	0.005652	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.2916	0.94102	0.0:0.0:1.0:0.0	.	.	.	.	X	2292	.	ENSP00000386759:Q2292X	Q	-	1	0	SETD2	47073404	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.143000	0.94623	2.861000	0.98227	0.655000	0.94253	CAA		0.463	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		14	92	14	92
ERC2	26059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	56026258	56026258	+	Silent	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr3:56026258G>A	ENST00000288221.6	-	11	2337	c.2082C>T	c.(2080-2082)gaC>gaT	p.D694D		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	694						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCATCCTGGAGTCATCTTCAA	0.428																																																0													153.0	150.0	151.0					3																	56026258		1882	4115	5997	SO:0001819	synonymous_variant	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2082C>T	3.37:g.56026258G>A			Q2T9F6|Q86TK4	Silent	SNP	ENST00000288221.6	37	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	5.164	0.215901	0.09810	.	.	ENSG00000187672	ENST00000492584	.	.	.	5.69	4.81	0.61882	.	.	.	.	.	T	0.48333	0.1494	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48068	-0.9067	4	.	.	.	-21.9727	3.8195	0.08830	0.0799:0.1493:0.5119:0.2589	.	.	.	.	I	345	.	.	T	-	2	0	ERC2	56001298	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.096000	0.30976	2.699000	0.92147	0.591000	0.81541	ACT		0.428	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576		41	226	41	226
MORC1	27136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	108773665	108773665	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr3:108773665T>A	ENST00000483760.1	-	14	1283	c.1240A>T	c.(1240-1242)Aaa>Taa	p.K414*	MORC1_ENST00000232603.5_Nonsense_Mutation_p.K414*					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AATTCCTGTTTATTATGGGAT	0.383																																																0													144.0	138.0	140.0					3																	108773665		2203	4300	6503	SO:0001587	stop_gained	27136			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1240A>T	3.37:g.108773665T>A	ENSP00000417282:p.Lys414*			Nonsense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	T	38	6.893038	0.97916	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	.	.	.	5.09	5.09	0.68999	.	0.000000	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.3382	12.8546	0.57878	0.0:0.0:0.0:1.0	.	.	.	.	X	414	.	ENSP00000232603:K414X	K	-	1	0	MORC1	110256355	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.896000	0.75665	2.131000	0.65755	0.528000	0.53228	AAA		0.383	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			19	76	19	76
PRLR	5618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	35065590	35065590	+	Silent	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr5:35065590C>T	ENST00000382002.5	-	10	1896	c.1470G>A	c.(1468-1470)acG>acA	p.T490T	PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000231423.3_Intron|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Intron|PRLR_ENST00000511486.1_Silent_p.T389T|PRLR_ENST00000342362.5_Silent_p.T389T	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	490					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.T490T(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	GCAGCCAGGGCGTATCCTGGT	0.483																																																1	Substitution - coding silent(1)	lung(1)											92.0	101.0	98.0					5																	35065590		2203	4300	6503	SO:0001819	synonymous_variant	5618				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.1470G>A	5.37:g.35065590C>T			B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Silent	SNP	ENST00000382002.5	37	CCDS3909.1																																																																																				0.483	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			26	140	26	140
PCDHA2	56146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140176926	140176926	+	Missense_Mutation	SNP	T	T	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr5:140176926T>C	ENST00000526136.1	+	1	2377	c.2377T>C	c.(2377-2379)Tac>Cac	p.Y793H	PCDHA2_ENST00000520672.2_Missense_Mutation_p.Y793H|PCDHA2_ENST00000378132.1_Missense_Mutation_p.Y793H|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	793	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAATCAGAATACGTAGGAAA	0.403																																																0													40.0	45.0	43.0					5																	140176926		2203	4300	6503	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2377T>C	5.37:g.140176926T>C	ENSP00000431748:p.Tyr793His		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	t	4.868	0.161326	0.09287	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.48836	0.9;0.8;2.85	4.61	-3.6	0.04570	.	1.749160	0.04173	N	0.325126	T	0.22044	0.0531	N	0.08118	0	0.09310	N	1	B;B;B	0.15473	0.013;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.002	T	0.10064	-1.0646	10	0.15066	T	0.55	.	4.0489	0.09786	0.0942:0.3536:0.1027:0.4496	.	793;793;793	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	H	793	ENSP00000430584:Y793H;ENSP00000367372:Y793H;ENSP00000431748:Y793H	ENSP00000367372:Y793H	Y	+	1	0	PCDHA2	140157110	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-2.614000	0.00883	-0.427000	0.07350	0.482000	0.46254	TAC		0.403	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		14	51	14	51
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140736510	140736510	+	Silent	SNP	C	C	T	rs374189449		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr5:140736510C>T	ENST00000571252.1	+	1	1743	c.1743C>T	c.(1741-1743)tcC>tcT	p.S581S	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	581	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCCCGCTCCGCAGATTCCG	0.592																																																0								C	,,,,,	6,4394		0,6,2194	138.0	149.0	145.0		,,,1743,,1743	-7.8	1.0	5		145	1,8599		0,1,4299	no	intron,intron,intron,coding-synonymous,intron,coding-synonymous	PCDHGB1,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018922.2,NM_032053.1	,,,,,	0,7,6493	TT,TC,CC		0.0116,0.1364,0.0538	,,,,,	,,,581/932,,581/821	140736510	7,12993	2200	4300	6500	SO:0001819	synonymous_variant	56111			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1743C>T	5.37:g.140736510C>T			Q9Y5D3	Silent	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																				0.592	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		40	210	40	210
RARS	5917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	167921621	167921621	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr5:167921621G>A	ENST00000231572.3	+	5	599	c.545G>A	c.(544-546)gGa>gAa	p.G182E	RARS_ENST00000538719.1_5'UTR	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	182					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		CTAGTGAATGGAGTTCAACTA	0.343																																																0													124.0	133.0	130.0					5																	167921621		2203	4300	6503	SO:0001583	missense	5917			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.545G>A	5.37:g.167921621G>A	ENSP00000231572:p.Gly182Glu		B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	ENST00000231572.3	37	CCDS4367.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617179	0.66672	.	.	ENSG00000113643	ENST00000231572	T	0.64085	-0.08	5.57	5.57	0.84162	Arginyl-tRNA synthetase, class Ia, core (1);Arginyl tRNA synthetase, class Ia, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80439	0.4623	H	0.96547	3.84	0.80722	D	1	P	0.38395	0.629	P	0.45232	0.474	T	0.82957	-0.0199	10	0.36615	T	0.2	-31.0218	19.5418	0.95277	0.0:0.0:1.0:0.0	.	182	P54136	SYRC_HUMAN	E	182	ENSP00000231572:G182E	ENSP00000231572:G182E	G	+	2	0	RARS	167854199	1.000000	0.71417	0.981000	0.43875	0.615000	0.37417	8.543000	0.90651	2.610000	0.88304	0.655000	0.94253	GGA		0.343	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887		15	101	15	101
FARS2	10667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	5431389	5431389	+	Silent	SNP	A	A	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr6:5431389A>G	ENST00000324331.6	+	4	1224	c.888A>G	c.(886-888)caA>caG	p.Q296Q	FARS2_ENST00000274680.4_Silent_p.Q296Q			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	296					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	TGATGGAACAACAACTGGTCA	0.458																																																0													165.0	153.0	157.0					6																	5431389		2203	4300	6503	SO:0001819	synonymous_variant	10667			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.888A>G	6.37:g.5431389A>G			B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Silent	SNP	ENST00000324331.6	37	CCDS4494.1																																																																																				0.458	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467790.1	NM_006567		20	125	20	125
C2	717	hgsc.bcm.edu;ucsc.edu	37	6	31912793	31912793	+	Missense_Mutation	SNP	T	T	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr6:31912793T>A	ENST00000299367.5	+	17	2342	c.2066T>A	c.(2065-2067)tTc>tAc	p.F689Y	CFB_ENST00000456570.1_Intron|C2_ENST00000468407.1_3'UTR|C2_ENST00000469372.1_Missense_Mutation_p.F443Y|CFB_ENST00000477310.1_Intron|C2_ENST00000452323.2_Missense_Mutation_p.F475Y|C2_ENST00000442278.2_Missense_Mutation_p.F557Y|CFB_ENST00000425368.2_5'Flank|CFB_ENST00000556679.1_Intron	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	689	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		GAGCGGAGATTCAGGTTTTTT	0.547																																																0													143.0	156.0	152.0					6																	31912793		1509	2709	4218	SO:0001583	missense	717				CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.2066T>A	6.37:g.31912793T>A	ENSP00000299367:p.Phe689Tyr		B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	37	CCDS4728.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.704|3.704	-0.060947|-0.060947	0.07317|0.07317	.|.	.|.	ENSG00000166278|ENSG00000166278	ENST00000469372;ENST00000452323;ENST00000299367;ENST00000442278|ENST00000383177	T;T;T;T|.	0.28666|.	1.6;1.6;1.6;1.6|.	5.41|5.41	-0.576|-0.576	0.11731|0.11731	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	1.034950|.	0.07707|.	N|.	0.941436|.	T|T	0.05731|0.05731	0.0150|0.0150	N|N	0.01649|0.01649	-0.78|-0.78	0.46149|0.46149	D|D	0.998898|0.998898	B;B;B;B;B;B|.	0.10296|.	0.003;0.001;0.002;0.0;0.001;0.0|.	B;B;B;B;B;B|.	0.12837|.	0.008;0.008;0.006;0.006;0.006;0.001|.	T|T	0.18085|0.18085	-1.0348|-1.0348	10|5	0.02654|.	T|.	1|.	-5.031|-5.031	5.3354|5.3354	0.15955|0.15955	0.6175:0.0966:0.0:0.2859|0.6175:0.0966:0.0:0.2859	.|.	660;475;443;557;557;689|.	B4DV48;B4DPF3;B4DQI1;E9PFN7;B4DV20;P06681|.	.;.;.;.;.;CO2_HUMAN|.	Y|T	443;475;689;557|463	ENSP00000418923:F443Y;ENSP00000392322:F475Y;ENSP00000299367:F689Y;ENSP00000395683:F557Y|.	ENSP00000299367:F689Y|.	F|S	+|+	2|1	0|0	C2|C2	32020772|32020772	0.001000|0.001000	0.12720|0.12720	0.363000|0.363000	0.25875|0.25875	0.974000|0.974000	0.67602|0.67602	-0.830000|-0.830000	0.04410|0.04410	-0.027000|-0.027000	0.13873|0.13873	0.383000|0.383000	0.25322|0.25322	TTC|TCA		0.547	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9			43	173	43	173
SPDEF	25803	hgsc.bcm.edu;broad.mit.edu	37	6	34508917	34508917	+	Silent	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr6:34508917G>A	ENST00000374037.3	-	3	892	c.478C>T	c.(478-480)Ctg>Ttg	p.L160L	SPDEF_ENST00000544425.1_Silent_p.L160L	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	160	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						TCTGTCCACAGGAGCCACTTC	0.642																																																0													36.0	35.0	35.0					6																	34508917		2203	4300	6503	SO:0001819	synonymous_variant	25803			AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.478C>T	6.37:g.34508917G>A			B4DWH8|F5H778	Silent	SNP	ENST00000374037.3	37	CCDS4794.1																																																																																				0.642	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391		8	10	8	10
DSE	29940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	116758080	116758080	+	Missense_Mutation	SNP	A	A	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr6:116758080A>C	ENST00000331677.3	+	7	2893	c.2449A>C	c.(2449-2451)Aaa>Caa	p.K817Q	DSE_ENST00000537543.1_Missense_Mutation_p.K836Q|DSE_ENST00000452085.3_Missense_Mutation_p.K817Q|DSE_ENST00000359564.2_Missense_Mutation_p.K817Q			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	817					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		CAAACGCTATAAATTTGTGGA	0.423																																																0													56.0	58.0	57.0					6																	116758080		2203	4300	6503	SO:0001583	missense	29940			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2449A>C	6.37:g.116758080A>C	ENSP00000332151:p.Lys817Gln		Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	14.37	2.515178	0.44763	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	6.16	6.16	0.99307	.	0.094339	0.64402	D	0.000001	T	0.47377	0.1442	N	0.24115	0.695	0.52501	D	0.999956	P;P	0.51351	0.944;0.944	P;P	0.47470	0.548;0.548	T	0.56866	-0.7908	10	0.72032	D	0.01	-21.909	16.8061	0.85666	1.0:0.0:0.0:0.0	.	836;817	B7Z765;Q9UL01	.;DSE_HUMAN	Q	817;836;817;817	ENSP00000404049:K817Q;ENSP00000441152:K836Q;ENSP00000332151:K817Q;ENSP00000352567:K817Q	ENSP00000332151:K817Q	K	+	1	0	DSE	116864773	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.450000	0.66626	2.367000	0.80283	0.528000	0.53228	AAA		0.423	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352		8	50	8	50
FLNC	2318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	128489530	128489530	+	Silent	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr7:128489530C>T	ENST00000325888.8	+	30	5358	c.5097C>T	c.(5095-5097)gaC>gaT	p.D1699D	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.D1699D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1699					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGAACCATGACGGTACCTTTG	0.612																																																0													95.0	112.0	106.0					7																	128489530		2185	4259	6444	SO:0001819	synonymous_variant	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5097C>T	7.37:g.128489530C>T			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																				0.612	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			11	94	11	94
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	35717307	35717307	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr9:35717307C>T	ENST00000314888.9	-	19	2647	c.2294G>A	c.(2293-2295)cGa>cAa	p.R765Q	TLN1_ENST00000540444.1_Missense_Mutation_p.R765Q	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	765					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCCTACCCCTCGCAACAGTTG	0.617																																																0													70.0	68.0	68.0					9																	35717307		2203	4300	6503	SO:0001583	missense	7094			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.2294G>A	9.37:g.35717307C>T	ENSP00000316029:p.Arg765Gln		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141821	0.57044	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.66280	-0.2;-0.2	5.6	5.6	0.85130	.	0.137501	0.49305	D	0.000152	T	0.41581	0.1165	N	0.19112	0.55	0.35046	D	0.760223	B	0.10296	0.003	B	0.04013	0.001	T	0.47262	-0.9131	10	0.16896	T	0.51	-10.6937	7.3076	0.26457	0.0:0.7982:0.0:0.2018	.	765	Q9Y490	TLN1_HUMAN	Q	765	ENSP00000316029:R765Q;ENSP00000442981:R765Q	ENSP00000316029:R765Q	R	-	2	0	TLN1	35707307	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.964000	0.63701	2.653000	0.90120	0.561000	0.74099	CGA		0.617	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		31	122	31	122
ANXA1	301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	75783993	75783993	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr9:75783993C>T	ENST00000376911.1	+	11	1789	c.907C>T	c.(907-909)Cgt>Tgt	p.R303C	ANXA1_ENST00000257497.6_Missense_Mutation_p.R303C|ANXA1_ENST00000491192.1_3'UTR			P04083	ANXA1_HUMAN	annexin A1	303					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.R303S(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	TATGGTTTCCCGTTCTGAAAT	0.388																																																1	Substitution - Missense(1)	lung(1)											230.0	210.0	217.0					9																	75783993		2203	4300	6503	SO:0001583	missense	301			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.907C>T	9.37:g.75783993C>T	ENSP00000366109:p.Arg303Cys			Missense_Mutation	SNP	ENST00000376911.1	37	CCDS6645.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744472	0.89663	.	.	ENSG00000135046	ENST00000257497;ENST00000376911	T;T	0.12879	2.64;2.64	5.97	5.08	0.68730	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.47581	0.1453	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61657	-0.7018	10	0.87932	D	0	.	14.9487	0.71054	0.0:0.9321:0.0:0.0679	.	303	P04083	ANXA1_HUMAN	C	303	ENSP00000257497:R303C;ENSP00000366109:R303C	ENSP00000257497:R303C	R	+	1	0	ANXA1	74973813	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.929000	0.75852	1.540000	0.49301	0.655000	0.94253	CGT		0.388	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700		30	137	30	137
NIPSNAP3A	25934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	107513272	107513272	+	Silent	SNP	C	C	T	rs146388542	byFrequency	TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr9:107513272C>T	ENST00000374767.4	+	2	201	c.96C>T	c.(94-96)taC>taT	p.Y32Y		NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)	32						cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CCAGACAATACGATGGAATAT	0.363																																																0								C		3,4403	6.2+/-15.9	0,3,2200	96.0	98.0	97.0		96	-10.4	0.0	9	dbSNP_134	97	0,8600		0,0,4300	no	coding-synonymous	NIPSNAP3A	NM_015469.1		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		32/248	107513272	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	25934			BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.96C>T	9.37:g.107513272C>T			A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	Silent	SNP	ENST00000374767.4	37	CCDS6760.1																																																																																				0.363	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053484.1	NM_015469		15	105	15	105
IL1RAPL1	11141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	29972757	29972757	+	Missense_Mutation	SNP	G	G	T	rs377412690		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:29972757G>T	ENST00000378993.1	+	10	1993	c.1320G>T	c.(1318-1320)aaG>aaT	p.K440N	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.K440N	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	440	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.K440K(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGCTTGAAAAGCATTATGGAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)											93.0	82.0	86.0					X																	29972757		2202	4300	6502	SO:0001583	missense	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1320G>T	X.37:g.29972757G>T	ENSP00000368278:p.Lys440Asn		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	7.355	0.623585	0.14193	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.08282	3.11;3.11	5.51	2.76	0.32466	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.08582	0.0213	L	0.31371	0.925	0.51233	D	0.999917	P	0.36222	0.544	B	0.43658	0.426	T	0.37572	-0.9700	9	.	.	.	.	9.4649	0.38806	0.2997:0.0:0.7003:0.0	.	440	Q9NZN1	IRPL1_HUMAN	N	440	ENSP00000368278:K440N;ENSP00000305200:K440N	.	K	+	3	2	IL1RAPL1	29882678	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.851000	0.27751	0.616000	0.30141	0.594000	0.82650	AAG		0.373	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		16	80	16	80
TMEM47	83604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	34648526	34648526	+	Missense_Mutation	SNP	G	G	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:34648526G>T	ENST00000275954.3	-	3	708	c.450C>A	c.(448-450)aaC>aaA	p.N150K		NM_031442.3	NP_113630.1	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47	150						cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						CATAACCCCAGTTGAACTCAT	0.428																																																0													112.0	103.0	106.0					X																	34648526		2202	4300	6502	SO:0001583	missense	83604			AK090917	CCDS14235.1	Xp11.4	2008-02-05	2005-03-21	2005-03-21	ENSG00000147027	ENSG00000147027			18515	protein-coding gene	gene with protein product		300698	"""transmembrane 4 superfamily member 10"""	TM4SF10		11472633	Standard	NM_031442		Approved	BCMP1, DKFZP761J17121, DKFZp564E153	uc004ddh.3	Q9BQJ4	OTTHUMG00000021343	ENST00000275954.3:c.450C>A	X.37:g.34648526G>T	ENSP00000275954:p.Asn150Lys		Q5JR44	Missense_Mutation	SNP	ENST00000275954.3	37	CCDS14235.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983059	0.53827	.	.	ENSG00000147027	ENST00000275954	T	0.68479	-0.33	5.39	-7.06	0.01568	.	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	M	0.69823	2.125	0.58432	D	0.999992	D	0.61697	0.99	P	0.62382	0.901	T	0.79470	-0.1790	10	0.46703	T	0.11	-8.1841	18.2907	0.90129	0.1617:0.0:0.8383:0.0	.	150	Q9BQJ4	TMM47_HUMAN	K	150	ENSP00000275954:N150K	ENSP00000275954:N150K	N	-	3	2	TMEM47	34558447	1.000000	0.71417	0.940000	0.37924	0.977000	0.68977	1.231000	0.32624	-1.251000	0.02494	-0.735000	0.03563	AAC		0.428	TMEM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056209.1	NM_031442		21	126	21	126
FAM47B	170062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	34962764	34962764	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:34962764G>A	ENST00000329357.5	+	1	1852	c.1816G>A	c.(1816-1818)Gtc>Atc	p.V606I		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	606								p.V606I(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AATGCCTGGCGTCATTGAAAA	0.438													G|||	1	0.000264901	0.0	0.0	3775	,	,		14814	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	large_intestine(1)											154.0	143.0	147.0					X																	34962764		2202	4300	6502	SO:0001583	missense	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1816G>A	X.37:g.34962764G>A	ENSP00000328307:p.Val606Ile		Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.508113	0.00010	.	.	ENSG00000189132	ENST00000329357	T	0.14516	2.5	0.843	-1.69	0.08186	.	.	.	.	.	T	0.01870	0.0059	N	0.00289	-1.7	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.18429	-1.0337	8	0.02654	T	1	.	.	.	.	.	606	Q8NA70	FA47B_HUMAN	I	606	ENSP00000328307:V606I	ENSP00000328307:V606I	V	+	1	0	FAM47B	34872685	0.278000	0.24230	0.000000	0.03702	0.028000	0.11728	-0.546000	0.06062	-2.672000	0.00413	-1.891000	0.00535	GTC		0.438	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		52	263	52	263
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	54776462	54776462	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:54776462C>T	ENST00000218436.6	-	13	3837	c.3808G>A	c.(3808-3810)Gtg>Atg	p.V1270M		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1270					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										ATCACAGGCACATCTGGGCCA	0.597																																																0													82.0	51.0	61.0					X																	54776462		2203	4300	6503	SO:0001583	missense	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3808G>A	X.37:g.54776462C>T	ENSP00000218436:p.Val1270Met		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.455685	0.26161	.	.	ENSG00000102313	ENST00000218436	T	0.03152	4.03	3.58	2.71	0.32032	.	14.314200	0.00465	U	0.000106	T	0.05960	0.0155	L	0.41492	1.28	0.09310	N	1	P	0.39216	0.664	B	0.40506	0.331	T	0.32241	-0.9914	10	0.72032	D	0.01	.	5.5601	0.17140	0.0:0.6253:0.0:0.3747	.	1270	Q6UXX5	ITH5L_HUMAN	M	1270	ENSP00000218436:V1270M	ENSP00000218436:V1270M	V	-	1	0	ITIH5L	54793187	0.001000	0.12720	0.044000	0.18714	0.414000	0.31173	0.011000	0.13264	0.380000	0.24823	0.284000	0.19432	GTG		0.597	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		17	54	17	54
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	54785300	54785300	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:54785300C>T	ENST00000218436.6	-	8	1236	c.1207G>A	c.(1207-1209)Ggc>Agc	p.G403S		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	403	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G403S(1)									GTCGTCACGCCGGCCGTGGGC	0.597																																																1	Substitution - Missense(1)	kidney(1)											56.0	44.0	48.0					X																	54785300		2203	4300	6503	SO:0001583	missense	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1207G>A	X.37:g.54785300C>T	ENSP00000218436:p.Gly403Ser		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637957	0.29157	.	.	ENSG00000102313	ENST00000218436	T	0.03745	3.82	3.78	1.99	0.26369	von Willebrand factor, type A (3);	0.069948	0.56097	U	0.000027	T	0.07188	0.0182	M	0.77406	2.37	0.21697	N	0.999583	P	0.40970	0.734	B	0.42112	0.376	T	0.12528	-1.0544	10	0.49607	T	0.09	.	8.4301	0.32753	0.0:0.7908:0.0:0.2092	.	403	Q6UXX5	ITH5L_HUMAN	S	403	ENSP00000218436:G403S	ENSP00000218436:G403S	G	-	1	0	ITIH5L	54802025	0.809000	0.29036	0.000000	0.03702	0.000000	0.00434	2.195000	0.42677	0.038000	0.15604	-0.180000	0.13094	GGC		0.597	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		12	37	12	37
MAGEE2	139599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	75003755	75003755	+	Missense_Mutation	SNP	A	A	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:75003755A>C	ENST00000373359.2	-	1	1324	c.1132T>G	c.(1132-1134)Tac>Gac	p.Y378D		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	378	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACAAGGAGGTAGATGTGCTCA	0.433																																																0													113.0	91.0	99.0					X																	75003755		2203	4300	6503	SO:0001583	missense	139599			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.1132T>G	X.37:g.75003755A>C	ENSP00000362457:p.Tyr378Asp		Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506920	0.44558	.	.	ENSG00000186675	ENST00000373359	T	0.14516	2.5	2.97	2.97	0.34412	.	.	.	.	.	T	0.40222	0.1108	M	0.91612	3.225	0.38280	D	0.94241	D	0.76494	0.999	D	0.85130	0.997	T	0.46803	-0.9165	9	0.87932	D	0	.	6.8014	0.23754	1.0:0.0:0.0:0.0	.	378	Q8TD90	MAGE2_HUMAN	D	378	ENSP00000362457:Y378D	ENSP00000362457:Y378D	Y	-	1	0	MAGEE2	74920480	1.000000	0.71417	0.887000	0.34795	0.983000	0.72400	2.473000	0.45145	1.408000	0.46895	0.345000	0.21793	TAC		0.433	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		24	166	24	166
CERS3	204219	broad.mit.edu;ucsc.edu	37	15	100996220	100996220	+	Missense_Mutation	SNP	A	A	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr15:100996220A>T	ENST00000394113.1	-	13	1567	c.877T>A	c.(877-879)Tat>Aat	p.Y293N	CERS3_ENST00000284382.4_Missense_Mutation_p.Y293N|CERS3_ENST00000560944.1_Intron|CERS3_ENST00000538112.2_Missense_Mutation_p.Y293N			Q8IU89	CERS3_HUMAN	ceramide synthase 3	293	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.Y293H(1)									TCGAGGTGATACATAGGCAAG	0.378																																																1	Substitution - Missense(1)	large_intestine(1)											102.0	93.0	96.0					15																	100996220		2203	4300	6503	SO:0001583	missense	204219				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.877T>A	15.37:g.100996220A>T	ENSP00000377672:p.Tyr293Asn		Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	A	4.350	0.064358	0.08388	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.84730	-1.89;-1.89	5.66	-2.98	0.05513	TRAM/LAG1/CLN8 homology domain (3);	0.781236	0.12551	N	0.459073	T	0.78013	0.4217	L	0.40543	1.245	0.09310	N	1	B	0.24043	0.096	B	0.33890	0.172	T	0.64076	-0.6492	10	0.21540	T	0.41	-2.2365	11.3142	0.49381	0.6826:0.0:0.3174:0.0	.	293	Q8IU89	CERS3_HUMAN	N	293;304;293	ENSP00000284382:Y293N;ENSP00000437640:Y293N	ENSP00000284382:Y293N	Y	-	1	0	CERS3	98813743	0.277000	0.24220	0.013000	0.15412	0.306000	0.27790	-0.476000	0.06591	-0.373000	0.07979	-0.242000	0.12053	TAT		0.378	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842		5	27	5	27
MYO1D	4642	broad.mit.edu;ucsc.edu	37	17	31107759	31107759	+	Missense_Mutation	SNP	C	C	T	rs369774478		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr17:31107759C>T	ENST00000318217.5	-	2	443	c.139G>A	c.(139-141)Gtt>Att	p.V47I	MYO1D_ENST00000583621.1_Missense_Mutation_p.V47I|MYO1D_ENST00000579584.1_Missense_Mutation_p.V47I|MYO1D_ENST00000394649.4_5'UTR	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	47	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TTCACAGAAACGACGACTTCT	0.423																																																0								C	ILE/VAL	0,4406		0,0,2203	99.0	80.0	87.0		139	4.5	0.7	17		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYO1D	NM_015194.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	47/1007	31107759	1,13005	2203	4300	6503	SO:0001583	missense	4642			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.139G>A	17.37:g.31107759C>T	ENSP00000324527:p.Val47Ile		A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472905	0.84640	0.0	1.16E-4	ENSG00000176658	ENST00000318217	D	0.87103	-2.21	4.48	4.48	0.54585	Myosin head, motor domain (3);	0.000000	0.35677	U	0.003054	D	0.89065	0.6609	L	0.37466	1.105	0.58432	D	0.999998	D	0.76494	0.999	D	0.68765	0.96	D	0.87386	0.2360	10	0.32370	T	0.25	.	15.0286	0.71687	0.0:1.0:0.0:0.0	.	47	O94832	MYO1D_HUMAN	I	47	ENSP00000324527:V47I	ENSP00000324527:V47I	V	-	1	0	MYO1D	28131872	1.000000	0.71417	0.740000	0.30986	0.954000	0.61252	7.548000	0.82154	2.482000	0.83794	0.591000	0.81541	GTT		0.423	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1			10	52	10	52
TSPAN33	340348	broad.mit.edu;ucsc.edu	37	7	128802337	128802337	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr7:128802337G>A	ENST00000289407.4	+	3	372	c.263G>A	c.(262-264)cGc>cAc	p.R88H	Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	88					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						GGGTCCCTCCGCGAGAACATC	0.627																																																0													109.0	85.0	93.0					7																	128802337		2203	4300	6503	SO:0001583	missense	340348				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.263G>A	7.37:g.128802337G>A	ENSP00000289407:p.Arg88His			Missense_Mutation	SNP	ENST00000289407.4	37	CCDS5810.1	.	.	.	.	.	.	.	.	.	.	G	35	5.513769	0.96402	.	.	ENSG00000158457	ENST00000289407	T	0.81078	-1.45	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.92541	0.7631	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93845	0.7140	10	0.87932	D	0	-15.1169	17.671	0.88217	0.0:0.0:1.0:0.0	.	88	Q86UF1	TSN33_HUMAN	H	88	ENSP00000289407:R88H	ENSP00000289407:R88H	R	+	2	0	TSPAN33	128589573	1.000000	0.71417	0.961000	0.40146	0.951000	0.60555	8.972000	0.93424	2.778000	0.95560	0.655000	0.94253	CGC		0.627	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562		7	48	7	48
LRRC37A5P	652972	broad.mit.edu;ucsc.edu	37	9	114371450	114371450	+	RNA	SNP	G	G	A	rs551973551		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr9:114371450G>A	ENST00000374304.1	-	0	349							Q49AS3	L37A5_HUMAN	leucine rich repeat containing 37, member A5, pseudogene																		AGTGCAGTCCGTCTTCAAGGT	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23734	0.0		0.0	False		,,,				2504	0.0															0																																												652972			BC031236		9q31.3	2012-10-16	2012-03-07	2012-03-07	ENSG00000204173	ENSG00000204173			23369	pseudogene	pseudogene			"""chromosome 9 open reading frame 29"""	C9orf29			Standard	NR_034087		Approved		uc022bly.1	Q49AS3	OTTHUMG00000020494		9.37:g.114371450G>A			Q5JVP0	RNA	SNP	ENST00000374304.1	37		.	.	.	.	.	.	.	.	.	.	g	2.383	-0.341553	0.05243	.	.	ENSG00000204173	ENST00000374306;ENST00000536054	.	.	.	0.957	-0.408	0.12381	.	.	.	.	.	T	0.10895	0.0266	.	.	.	0.19300	N	0.999975	.	.	.	.	.	.	T	0.36696	-0.9737	4	0.02654	T	1	.	3.0327	0.06111	0.7065:0.0:0.2935:0.0	.	.	.	.	M	53;45	.	ENSP00000363425:T53M	T	-	2	0	C9orf29	113411271	0.956000	0.32656	0.324000	0.25361	0.009000	0.06853	-0.180000	0.09754	-0.082000	0.12640	-0.691000	0.03719	ACG		0.493	LRRC37A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000053655.2	NR_034087		48	175	48	175
TRIM60	166655	broad.mit.edu;ucsc.edu	37	4	165962269	165962269	+	Nonsense_Mutation	SNP	C	C	T	rs368275126		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr4:165962269C>T	ENST00000512596.1	+	3	1261	c.1045C>T	c.(1045-1047)Cga>Tga	p.R349*	TRIM60_ENST00000341062.5_Nonsense_Mutation_p.R349*|TRIM60_ENST00000508504.1_Nonsense_Mutation_p.R349*	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	349	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		TAGTTCTGGCCGACATTACTG	0.433																																																0								C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	105.0	104.0		1045	-5.0	0.0	4		104	0,8600		0,0,4300	no	stop-gained	TRIM60	NM_152620.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		349/472	165962269	1,13005	2203	4300	6503	SO:0001587	stop_gained	166655			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1045C>T	4.37:g.165962269C>T	ENSP00000421142:p.Arg349*		Q8NA35	Nonsense_Mutation	SNP	ENST00000512596.1	37	CCDS3808.1	.	.	.	.	.	.	.	.	.	.	c	14.17	2.456062	0.43634	2.27E-4	0.0	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	.	.	.	2.49	-4.98	0.03019	.	0.000000	0.42053	U	0.000764	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8643	0.41134	0.1642:0.7141:0.0:0.1217	.	.	.	.	X	349	.	ENSP00000343765:R349X	R	+	1	2	TRIM60	166181719	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.536000	0.06135	-1.177000	0.02744	-0.262000	0.10625	CGA		0.433	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620		20	108	20	108
CHD4	1108	broad.mit.edu;ucsc.edu	37	12	6702730	6702730	+	Missense_Mutation	SNP	T	T	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr12:6702730T>C	ENST00000357008.2	-	16	2529	c.2366A>G	c.(2365-2367)aAc>aGc	p.N789S	CHD4_ENST00000309577.6_Missense_Mutation_p.N789S|CHD4_ENST00000544040.1_Missense_Mutation_p.N782S|CHD4_ENST00000544484.1_Missense_Mutation_p.N786S	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	789	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CCGCTCCCAGTTGATGATGGT	0.532																																					Colon(32;586 792 4568 16848 45314)											0													98.0	95.0	96.0					12																	6702730		2203	4300	6503	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2366A>G	12.37:g.6702730T>C	ENSP00000349508:p.Asn789Ser		Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.374532	0.82573	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32	4.8	4.8	0.61643	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97173	0.9076	M	0.91196	3.185	0.80722	D	1	D;D;D	0.76494	0.999;0.974;0.996	D;P;D	0.77557	0.99;0.897;0.98	D	0.98107	1.0418	10	0.87932	D	0	-0.1448	14.5214	0.67853	0.0:0.0:0.0:1.0	.	789;789;782	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	S	786;782;789;789;763	ENSP00000440392:N786S;ENSP00000440542:N782S;ENSP00000312419:N789S;ENSP00000349508:N789S	ENSP00000312419:N789S	N	-	2	0	CHD4	6572991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.841000	0.86834	2.017000	0.59298	0.482000	0.46254	AAC		0.532	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		28	159	28	159
CLEC4C	170482	broad.mit.edu;ucsc.edu	37	12	7883393	7883393	+	Splice_Site	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr12:7883393G>A	ENST00000542353.1	-	6	987	c.497C>T	c.(496-498)aCa>aTa	p.T166I	CLEC4C_ENST00000360345.3_Splice_Site_p.T166I|CLEC4C_ENST00000354629.5_Splice_Site_p.T135I|CLEC4C_ENST00000540085.1_Splice_Site_p.T135I	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	166	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		CTATACTCACGTGACATTTTC	0.433													G|||	3	0.000599042	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0031															0													130.0	115.0	120.0					12																	7883393		2203	4300	6503	SO:0001630	splice_region_variant	170482			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.497+1C>T	12.37:g.7883393G>A			D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Splice_Site	SNP	ENST00000542353.1	37	CCDS8583.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.82|11.82	1.753791|1.753791	0.31046|0.31046	.|.	.|.	ENSG00000198178|ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345;ENST00000543765|ENST00000537530	T;T;T;T;T|T	0.16743|0.02525	2.32;2.32;2.32;2.32;2.32|4.26	1.88|1.88	0.973|0.973	0.19710|0.19710	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);|.	.|.	.|.	.|.	.|.	T|T	0.04318|0.04318	0.0119|0.0119	L|L	0.48642|0.48642	1.525|1.525	0.18873|0.18873	N|N	0.999984|0.999984	P;D|.	0.89917|.	0.826;1.0|.	B;D|.	0.77004|.	0.235;0.989|.	T|T	0.39623|0.39623	-0.9605|-0.9605	9|7	0.46703|0.87932	T|D	0.11|0	.|.	4.5325|4.5325	0.12011|0.12011	0.2003:0.0:0.7997:0.0|0.2003:0.0:0.7997:0.0	.|.	135;166|.	Q8WTT0-2;Q8WTT0|.	.;CLC4C_HUMAN|.	I|M	166;135;135;166;126|88	ENSP00000440428:T166I;ENSP00000346648:T135I;ENSP00000445338:T135I;ENSP00000353500:T166I;ENSP00000442457:T126I|ENSP00000438649:T88M	ENSP00000346648:T135I|ENSP00000438649:T88M	T|T	-|-	2|2	0|0	CLEC4C|CLEC4C	7774660|7774660	0.053000|0.053000	0.20554|0.20554	0.450000|0.450000	0.26969|0.26969	0.017000|0.017000	0.09413|0.09413	-0.344000|-0.344000	0.07780|0.07780	0.354000|0.354000	0.24105|0.24105	-0.254000|-0.254000	0.11334|0.11334	ACA|ACG		0.433	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503	Missense_Mutation	19	109	19	109
GRPR	2925	broad.mit.edu;ucsc.edu	37	X	16168588	16168588	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:16168588A>G	ENST00000380289.2	+	2	972	c.574A>G	c.(574-576)Acc>Gcc	p.T192A	RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000435789.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	192					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					CACCAACCAGACCTTCATTAG	0.502																																																0													230.0	172.0	192.0					X																	16168588		2203	4300	6503	SO:0001583	missense	2925				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.574A>G	X.37:g.16168588A>G	ENSP00000369643:p.Thr192Ala		B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	CCDS14174.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.780235	0.90195	.	.	ENSG00000126010	ENST00000380289	T	0.40476	1.03	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.117848	0.53938	D	0.000041	T	0.51856	0.1699	M	0.67700	2.07	0.58432	D	0.999996	P	0.52316	0.952	P	0.52957	0.714	T	0.48917	-0.8992	10	0.19590	T	0.45	-35.918	13.81	0.63256	1.0:0.0:0.0:0.0	.	192	P30550	GRPR_HUMAN	A	192	ENSP00000369643:T192A	ENSP00000369643:T192A	T	+	1	0	GRPR	16078509	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	1.857000	0.53885	0.486000	0.48141	ACC		0.502	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		37	152	37	152
ZNF691	51058	broad.mit.edu;ucsc.edu	37	1	43317456	43317456	+	Missense_Mutation	SNP	G	G	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr1:43317456G>T	ENST00000372506.1	+	4	1167	c.827G>T	c.(826-828)gGc>gTc	p.G276V	ZNF691_ENST00000372508.3_Missense_Mutation_p.G276V|ZNF691_ENST00000372502.1_Missense_Mutation_p.G298V|ZNF691_ENST00000372504.1_Missense_Mutation_p.G298V|ZNF691_ENST00000372507.1_Missense_Mutation_p.G276V|ZNF691_ENST00000397044.3_Missense_Mutation_p.G307V	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	139						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACTCACTTGGGCGAACAGGCT	0.552																																																0													31.0	34.0	33.0					1																	43317456		2203	4300	6503	SO:0001583	missense	51058				CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.827G>T	1.37:g.43317456G>T	ENSP00000361584:p.Gly276Val		A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	37	CCDS476.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670642	0.67814	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372502	T;T;T;T;T;T	0.12672	2.72;2.72;2.72;2.66;2.67;2.67	5.06	3.18	0.36537	.	.	.	.	.	T	0.18383	0.0441	L	0.41027	1.25	0.47276	D	0.999371	D	0.57257	0.979	P	0.55545	0.778	T	0.01500	-1.1339	9	0.72032	D	0.01	-8.1952	6.1445	0.20278	0.1724:0.1543:0.6733:0.0	.	307	B4DJR7	.	V	276;276;276;307;298;298	ENSP00000361586:G276V;ENSP00000361585:G276V;ENSP00000361584:G276V;ENSP00000380237:G307V;ENSP00000361582:G298V;ENSP00000361580:G298V	ENSP00000361580:G298V	G	+	2	0	ZNF691	43090043	0.992000	0.36948	0.064000	0.19789	0.763000	0.43281	2.646000	0.46630	0.802000	0.34089	-0.232000	0.12228	GGC		0.552	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911		6	54	6	54
WASH6P	653440	broad.mit.edu;ucsc.edu	37	X	155254994	155254994	+	RNA	SNP	G	G	A			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:155254994G>A	ENST00000461007.1	+	0	3910				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGCCCCCACCGCAACAGCCAC	0.637													g|||	2	0.000399361	0.0015	0.0	5008	,	,		22719	0.0		0.0	False		,,,				2504	0.0															0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254994G>A			A6NGF1|Q8N305	RNA	SNP	ENST00000461007.1	37																																																																																					0.637	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		4	28	4	28
ABCA13	154664	broad.mit.edu;ucsc.edu	37	7	48320993	48320993	+	Missense_Mutation	SNP	T	T	C			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr7:48320993T>C	ENST00000435803.1	+	19	8804	c.8780T>C	c.(8779-8781)aTg>aCg	p.M2927T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2927					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCAGAAGCCATGGAGATGCTG	0.438																																																0													125.0	119.0	121.0					7																	48320993		2003	4201	6204	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8780T>C	7.37:g.48320993T>C	ENSP00000411096:p.Met2927Thr		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	8.123	0.781358	0.16120	.	.	ENSG00000179869	ENST00000435803	D	0.86164	-2.08	4.29	1.85	0.25348	.	1.897850	0.02448	N	0.085235	T	0.79040	0.4379	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.21452	0.056;0.033	B;B	0.20955	0.032;0.014	T	0.65573	-0.6135	10	0.87932	D	0	.	3.7281	0.08482	0.1886:0.104:0.0:0.7074	.	629;2927	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	T	2927	ENSP00000411096:M2927T	ENSP00000411096:M2927T	M	+	2	0	ABCA13	48291539	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.142000	0.10311	0.269000	0.21961	-0.256000	0.11100	ATG		0.438	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		4	29	4	29
MUC17	140453	broad.mit.edu;ucsc.edu	37	7	100679593	100679593	+	Silent	SNP	A	A	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr7:100679593A>G	ENST00000306151.4	+	3	4960	c.4896A>G	c.(4894-4896)ctA>ctG	p.L1632L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1632	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGTCCTCTATTAACAAGTA	0.493																																																0													223.0	231.0	228.0					7																	100679593		2203	4300	6503	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4896A>G	7.37:g.100679593A>G			O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																				0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		68	590	68	590
PLXNA3	55558	broad.mit.edu;ucsc.edu	37	X	153698493	153698493	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:153698493C>T	ENST00000369682.3	+	29	5144	c.4969C>T	c.(4969-4971)Cgg>Tgg	p.R1657W	PLXNA3_ENST00000493546.1_3'UTR	NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1657					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTACCTGACACGGCTGCTGGC	0.617																																																0													48.0	41.0	43.0					X																	153698493		2202	4300	6502	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.4969C>T	X.37:g.153698493C>T	ENSP00000358696:p.Arg1657Trp		Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942935	0.73672	.	.	ENSG00000130827	ENST00000369682	T	0.19250	2.16	5.02	4.07	0.47477	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63265	-0.6676	10	0.87932	D	0	.	12.1032	0.53796	0.2153:0.7847:0.0:0.0	.	1657	P51805	PLXA3_HUMAN	W	1657	ENSP00000358696:R1657W	ENSP00000358696:R1657W	R	+	1	2	PLXNA3	153351687	0.942000	0.31987	0.147000	0.22382	0.922000	0.55478	2.161000	0.42358	0.737000	0.32582	0.529000	0.55759	CGG		0.617	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		9	51	9	51
IL1RL1	9173	broad.mit.edu;ucsc.edu	37	2	102957203	102957203	+	Silent	SNP	C	C	T	rs200131845	byFrequency	TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr2:102957203C>T	ENST00000233954.1	+	5	796	c.525C>T	c.(523-525)gaC>gaT	p.D175D	IL1RL1_ENST00000409584.1_Silent_p.D175D|IL1RL1_ENST00000404917.2_Silent_p.D58D|IL1RL1_ENST00000393393.3_Silent_p.D175D|IL1RL1_ENST00000311734.2_Silent_p.D175D	NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	175	Ig-like C2-type 2.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TGACTGAGGACGCAGGTGATT	0.423													c|||	4	0.000798722	0.0	0.0	5008	,	,		19085	0.0		0.001	False		,,,				2504	0.0031															0								C	,	0,4406		0,0,2203	132.0	125.0	128.0		525,525	-3.6	0.0	2		128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	IL1RL1	NM_003856.2,NM_016232.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	175/329,175/557	102957203	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9173			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.525C>T	2.37:g.102957203C>T			A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Silent	SNP	ENST00000233954.1	37	CCDS2057.1																																																																																				0.423	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232		23	94	23	94
LRFN5	145581	broad.mit.edu;ucsc.edu	37	14	42355895	42355895	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr14:42355895C>T	ENST00000298119.4	+	3	1256	c.67C>T	c.(67-69)Cgt>Tgt	p.R23C	LRFN5_ENST00000554120.1_Missense_Mutation_p.R23C|LRFN5_ENST00000554171.1_Missense_Mutation_p.R23C	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	23	LRRNT.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTGTCCAAAGCGTTGTGTCTG	0.398										HNSCC(30;0.082)																																						0													92.0	83.0	86.0					14																	42355895		2203	4300	6503	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.67C>T	14.37:g.42355895C>T	ENSP00000298119:p.Arg23Cys		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799459	0.50208	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.53640	0.73;0.61;0.61	5.56	5.56	0.83823	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.56097	D	0.000022	T	0.48572	0.1507	M	0.72894	2.215	0.80722	D	1	B;P	0.42010	0.397;0.768	B;B	0.36464	0.17;0.225	T	0.53718	-0.8399	10	0.44086	T	0.13	.	17.0193	0.86429	0.0:1.0:0.0:0.0	.	23;23	G3V364;Q96NI6	.;LRFN5_HUMAN	C	23	ENSP00000298119:R23C;ENSP00000451897:R23C;ENSP00000451067:R23C	ENSP00000298119:R23C	R	+	1	0	LRFN5	41425645	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.595000	0.87683	0.650000	0.86243	CGT		0.398	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		5	38	5	38
KMT2E	55904	broad.mit.edu;ucsc.edu	37	7	104753522	104753522	+	Silent	SNP	G	G	A	rs369015069		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr7:104753522G>A	ENST00000311117.3	+	27	5864	c.5319G>A	c.(5317-5319)ccG>ccA	p.P1773P	KMT2E_ENST00000334877.4_Silent_p.P1731P|SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000257745.4_Silent_p.P1773P	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1773	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CTTTGGGACCGGGACCCCAGC	0.532																																																0								G	,	1,4405	2.1+/-5.4	0,1,2202	211.0	178.0	190.0		5319,5319	0.9	1.0	7		190	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MLL5	NM_018682.3,NM_182931.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	1773/1859,1773/1859	104753522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.5319G>A	7.37:g.104753522G>A			B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	4.128	0.021921	0.08006	2.27E-4	0.0	ENSG00000005483	ENST00000393656	.	.	.	4.1	0.883	0.19177	.	.	.	.	.	T	0.56978	0.2022	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54098	-0.8344	5	0.38643	T	0.18	.	7.847	0.29431	0.0:0.3197:0.3954:0.2849	.	.	.	.	Q	1556	.	ENSP00000377266:R1556Q	R	+	2	0	MLL5	104540758	0.959000	0.32827	1.000000	0.80357	0.950000	0.60333	0.060000	0.14342	0.806000	0.34183	0.557000	0.71058	CGG		0.532	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			43	225	43	225
PCDHA1	56147	broad.mit.edu;ucsc.edu	37	5	140166068	140166068	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr5:140166068C>T	ENST00000504120.2	+	1	193	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	PCDHA1_ENST00000394633.3_Missense_Mutation_p.R65W|PCDHA1_ENST00000378133.3_Missense_Mutation_p.R65W	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGCCTGTTCCGGGTGGCGTC	0.587																																																0													64.0	70.0	68.0					5																	140166068		2203	4300	6503	SO:0001583	missense	56147			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.193C>T	5.37:g.140166068C>T	ENSP00000420840:p.Arg65Trp		O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	16.31	3.087844	0.55968	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.38887	1.11;1.11;1.11	4.31	3.4	0.38934	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.38897	U	0.001524	T	0.77294	0.4109	H	0.99225	4.475	0.38284	D	0.94251	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.997	D	0.85301	0.1073	10	0.87932	D	0	.	11.3419	0.49537	0.3419:0.6581:0.0:0.0	.	65;65;65	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	W	65	ENSP00000420840:R65W;ENSP00000378129:R65W;ENSP00000367373:R65W	ENSP00000367373:R65W	R	+	1	2	PCDHA1	140146252	0.998000	0.40836	1.000000	0.80357	0.546000	0.35178	3.201000	0.51059	0.876000	0.35872	0.650000	0.86243	CGG		0.587	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		30	127	30	127
ANKRD18DP	348840	broad.mit.edu;ucsc.edu	37	3	197803763	197803763	+	RNA	SNP	G	G	A	rs374695729		TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr3:197803763G>A	ENST00000435620.2	-	0	591					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		CAGTGTTGCCGTAGACATCCT	0.458													g|||	1	0.000199681	0.0	0.0014	5008	,	,		17823	0.0		0.0	False		,,,				2504	0.0															0								G		1,1383		0,1,691	343.0	250.0	278.0			-2.0	0.0	3		278	0,3182		0,0,1591	no	intergenic				0,1,2282	AA,AG,GG		0.0,0.0723,0.0219			197803763	1,4565	692	1591	2283			348840			BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197803763G>A				RNA	SNP	ENST00000435620.2	37																																																																																					0.458	ANKRD18DP-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000316910.2	NR_003291		4	27	4	27
UTP20	27340	broad.mit.edu;ucsc.edu	37	12	101750464	101750464	+	Missense_Mutation	SNP	C	C	G			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr12:101750464C>G	ENST00000261637.4	+	42	5701	c.5527C>G	c.(5527-5529)Ctg>Gtg	p.L1843V	snoU13_ENST00000458958.1_RNA	NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1843					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GGAAGCTAATCTGCCAAGGTA	0.363																																																0													63.0	65.0	65.0					12																	101750464		2203	4300	6503	SO:0001583	missense	27340			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5527C>G	12.37:g.101750464C>G	ENSP00000261637:p.Leu1843Val		Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.979956	0.53827	.	.	ENSG00000120800	ENST00000261637	T	0.63417	-0.04	5.9	5.02	0.67125	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79770	0.4503	M	0.88377	2.95	0.58432	D	0.999991	D	0.89917	1.0	D	0.80764	0.994	T	0.81297	-0.0996	10	0.49607	T	0.09	-9.9148	9.4003	0.38428	0.0:0.7879:0.0:0.2121	.	1843	O75691	UTP20_HUMAN	V	1843	ENSP00000261637:L1843V	ENSP00000261637:L1843V	L	+	1	2	UTP20	100274595	1.000000	0.71417	0.985000	0.45067	0.669000	0.39330	2.301000	0.43628	1.515000	0.48885	-0.140000	0.14226	CTG		0.363	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		3	29	3	29
AKIP1	56672	broad.mit.edu;hgsc.bcm.edu	37	11	8940912	8940912	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr11:8940912delT	ENST00000309377.4	+	6	608	c.518delT	c.(517-519)atafs	p.I173fs	AKIP1_ENST00000534147.1_Frame_Shift_Del_p.I173fs|AKIP1_ENST00000299576.5_Frame_Shift_Del_p.I146fs|AKIP1_ENST00000309357.4_Frame_Shift_Del_p.I146fs|AKIP1_ENST00000396648.2_Frame_Shift_Del_p.I146fs	NM_020642.3	NP_065693.2	Q9NQ31	AKIP1_HUMAN	A kinase (PRKA) interacting protein 1	173					substrate adhesion-dependent cell spreading (GO:0034446)	nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(2)	5						GACCTCTACATAGAAGTATAT	0.468																																																0													150.0	147.0	148.0					11																	8940912		2201	4296	6497	SO:0001589	frameshift_variant	56672			AF512007	CCDS7793.1, CCDS55743.1, CCDS55744.1	11p15.3	2011-04-18	2011-04-18	2011-04-18	ENSG00000166452	ENSG00000166452			1170	protein-coding gene	gene with protein product		609191	"""chromosome 11 open reading frame 17"""	C11orf17		20562110, 18178962, 15630084	Standard	NM_020642		Approved	BCA3	uc001mgx.3	Q9NQ31	OTTHUMG00000165653	ENST00000309377.4:c.518delT	11.37:g.8940912delT	ENSP00000310459:p.Ile173fs		Q8NBS2|Q8TAC6|Q8TAD3|Q8TAE0	Frame_Shift_Del	DEL	ENST00000309377.4	37	CCDS7793.1																																																																																				0.468	AKIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385615.1	NM_020642		30	117	30	117
CRYL1	51084	broad.mit.edu;hgsc.bcm.edu	37	13	21013857	21013859	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr13:21013857_21013859delTCT	ENST00000298248.7	-	4	373_375	c.311_313delAGA	c.(310-315)aagatt>att	p.K104del	CRYL1_ENST00000382812.1_In_Frame_Del_p.K82del|CRYL1_ENST00000480748.1_5'UTR	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	104					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)			NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		TGAGCAAAAATCTTCTTCTTCAG	0.419																																																0																																										SO:0001651	inframe_deletion	51084			AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.311_313delAGA	13.37:g.21013863_21013865delTCT	ENSP00000298248:p.Lys104del		A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	In_Frame_Del	DEL	ENST00000298248.7	37	CCDS41871.1																																																																																				0.419	CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044071.1	NM_015974		12	66	12	66
F8	2157	broad.mit.edu;hgsc.bcm.edu	37	X	154159063	154159063	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chrX:154159063delG	ENST00000360256.4	-	14	3202	c.3002delC	c.(3001-3003)gctfs	p.A1001fs		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1001	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AGTCAACAAAGCAGGTCCATG	0.343																																																0													78.0	75.0	76.0					X																	154159063		2203	4299	6502	SO:0001589	frameshift_variant	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3002delC	X.37:g.154159063delG	ENSP00000353393:p.Ala1001fs		Q14286|Q5HY69	Frame_Shift_Del	DEL	ENST00000360256.4	37	CCDS35457.1																																																																																				0.343	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			26	135	26	135
RB1	5925	broad.mit.edu	37	13	48955530	48955533	+	Frame_Shift_Del	DEL	ATTT	ATTT	-			TCGA-FG-6688-01A-11D-1893-08	TCGA-FG-6688-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2f93c396-7e42-4ae7-b954-028d5214671d	3a55f162-2e11-46f9-8c0a-4a1f473997ff	g.chr13:48955530_48955533delATTT	ENST00000267163.4	+	17	1784_1787	c.1646_1649delATTT	c.(1645-1650)catttafs	p.HL549fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	549	Domain A.|Pocket; binds T and E1A.		H -> Y (in RB). {ECO:0000269|PubMed:8605116}.		androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATGATAAAACATTTAGAACGATGT	0.328		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)																																								SO:0001589	frameshift_variant	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1646_1649delATTT	13.37:g.48955530_48955533delATTT	ENSP00000267163:p.His549fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	37	CCDS31973.1																																																																																				0.328	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			9	36	9	36
