#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
LOXL4	84171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	100012144	100012144	+	Silent	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr10:100012144G>A	ENST00000260702.3	-	12	2067	c.1917C>T	c.(1915-1917)gcC>gcT	p.A639A	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	639	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GACAGAAGCTGGCCTTGTGCC	0.532																																																0													175.0	162.0	167.0					10																	100012144		2203	4300	6503	SO:0001819	synonymous_variant	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1917C>T	10.37:g.100012144G>A			Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	ENST00000260702.3	37	CCDS7473.1																																																																																				0.532	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211		28	282	28	282
FNBP4	23360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	47755624	47755624	+	Missense_Mutation	SNP	T	T	C			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr11:47755624T>C	ENST00000263773.5	-	10	1651	c.1639A>G	c.(1639-1641)Aat>Gat	p.N547D	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	547						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GATTGTCTATTAATGCCTAGA	0.328																																																0													123.0	118.0	119.0					11																	47755624		1841	4094	5935	SO:0001583	missense	23360			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1639A>G	11.37:g.47755624T>C	ENSP00000263773:p.Asn547Asp		Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.300784	0.60195	.	.	ENSG00000109920	ENST00000263773	T	0.10860	2.83	6.02	6.02	0.97574	.	0.163418	0.64402	D	0.000003	T	0.07908	0.0198	N	0.12182	0.205	0.51767	D	0.999934	B	0.16166	0.016	B	0.15052	0.012	T	0.35574	-0.9783	10	0.29301	T	0.29	-18.7305	16.542	0.84395	0.0:0.0:0.0:1.0	.	547	Q8N3X1	FNBP4_HUMAN	D	547	ENSP00000263773:N547D	ENSP00000263773:N547D	N	-	1	0	FNBP4	47712200	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	6.015000	0.70791	2.304000	0.77564	0.528000	0.53228	AAT		0.328	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3			27	57	27	57
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	82877743	82877743	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr11:82877743G>A	ENST00000298281.4	+	5	2256	c.1804G>A	c.(1804-1806)Gaa>Aaa	p.E602K		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	602					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						ATCTGGTTGGGAAGAAAATAA	0.318																																																0													74.0	78.0	77.0					11																	82877743		1694	3663	5357	SO:0001583	missense	51585			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1804G>A	11.37:g.82877743G>A	ENSP00000298281:p.Glu602Lys		A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531166	0.85706	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.66460	0.66;-0.21;-0.03	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000009	T	0.75436	0.3849	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.70978	-0.4725	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	602;602	E9PQ01;O94913	.;PCF11_HUMAN	K	602	ENSP00000298281:E602K;ENSP00000434540:E602K;ENSP00000431567:E602K	.	E	+	1	0	PCF11	82555391	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.912000	0.92726	2.885000	0.99019	0.655000	0.94253	GAA		0.318	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885		37	66	37	66
DBX2	440097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	45410365	45410365	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr12:45410365G>A	ENST00000332700.6	-	4	895	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	242					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		TTGGAATTCCGCCATTTCATC	0.403																																																0													113.0	117.0	116.0					12																	45410365		2203	4300	6503	SO:0001583	missense	440097				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.724C>T	12.37:g.45410365G>A	ENSP00000331470:p.Arg242Trp			Missense_Mutation	SNP	ENST00000332700.6	37	CCDS31781.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225572	0.79576	.	.	ENSG00000185610	ENST00000332700	D	0.97665	-4.48	5.63	4.7	0.59300	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.122406	0.37577	N	0.002037	D	0.98820	0.9602	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99000	1.0811	10	0.87932	D	0	-21.1709	13.6389	0.62237	0.0:0.0:0.7215:0.2785	.	242	Q6ZNG2	DBX2_HUMAN	W	242	ENSP00000331470:R242W	ENSP00000331470:R242W	R	-	1	2	DBX2	43696632	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.849000	0.55910	2.645000	0.89757	0.557000	0.71058	CGG		0.403	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329		17	184	17	184
RNF17	56163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	25428134	25428134	+	Silent	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr13:25428134G>A	ENST00000255324.5	+	25	3514	c.3462G>A	c.(3460-3462)caG>caA	p.Q1154Q	RNF17_ENST00000339524.3_Silent_p.Q206Q|RNF17_ENST00000381921.1_Silent_p.Q1154Q	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1154					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCAGTGAACAGAAAGTGTCTG	0.403																																																0													84.0	86.0	86.0					13																	25428134		2203	4300	6503	SO:0001819	synonymous_variant	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3462G>A	13.37:g.25428134G>A			Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	37	CCDS9308.2																																																																																				0.403	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994		34	39	34	39
CCDC70	83446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	52439604	52439604	+	Silent	SNP	G	G	A	rs112168960	byFrequency	TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr13:52439604G>A	ENST00000242819.4	+	2	386	c.90G>A	c.(88-90)gcG>gcA	p.A30A		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	30						extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.A30A(1)		breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		GGTCCCTGGCGGCATCCTCTC	0.507																																																1	Substitution - coding silent(1)	lung(1)											66.0	67.0	67.0					13																	52439604		2203	4300	6503	SO:0001819	synonymous_variant	83446				CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.90G>A	13.37:g.52439604G>A			Q8N7A8|Q9H097	Silent	SNP	ENST00000242819.4	37	CCDS9431.1																																																																																				0.507	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	NM_031290		19	173	19	173
CDKN3	1033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	54884631	54884631	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr14:54884631C>T	ENST00000335183.6	+	7	628	c.514C>T	c.(514-516)Cga>Tga	p.R172*	CDKN3_ENST00000458126.2_Nonsense_Mutation_p.R171*|CDKN3_ENST00000442975.2_Nonsense_Mutation_p.R132*|CDKN3_ENST00000556305.1_3'UTR|CDKN3_ENST00000543789.2_3'UTR|CDKN3_ENST00000395577.2_Nonsense_Mutation_p.R126*|CDKN3_ENST00000556102.2_Nonsense_Mutation_p.R172*	NM_005192.3	NP_005183.2	Q00526	CDK3_HUMAN	cyclin-dependent kinase inhibitor 3	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|stomach(1)	3						AGACAGCCTGCGAGACCTAAG	0.458																																					Pancreas(40;634 1012 9382 49950 52462)											0													91.0	64.0	73.0					14																	54884631		2202	4300	6502	SO:0001587	stop_gained	1033			U02681	CCDS9716.1, CCDS45109.1	14q22	2011-08-25	2008-08-01		ENSG00000100526	ENSG00000100526		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1791	protein-coding gene	gene with protein product	"""kinase associated phosphatase"", ""cyclin-dependent kinase inhibitor"", ""CDK2-associated dual specificity phosphatase"""	123832				8242750, 7698009	Standard	NM_005192		Approved	KAP, CDI1	uc001xap.3	Q16667	OTTHUMG00000140302	ENST00000335183.6:c.514C>T	14.37:g.54884631C>T	ENSP00000335357:p.Arg172*			Nonsense_Mutation	SNP	ENST00000335183.6	37	CCDS9716.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130527	0.37630	.	.	ENSG00000100526	ENST00000335183;ENST00000442975;ENST00000458126;ENST00000556102;ENST00000439312;ENST00000395577	.	.	.	6.17	1.72	0.24424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4228	15.8016	0.78456	0.6734:0.3266:0.0:0.0	.	.	.	.	X	172;132;171;172;167;126	.	ENSP00000216414:R71X	R	+	1	2	CDKN3	53954381	0.995000	0.38212	0.966000	0.40874	0.378000	0.30076	0.382000	0.20635	0.309000	0.22966	-0.169000	0.13324	CGA		0.458	CDKN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276893.2			14	22	14	22
CLMN	79789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	95670323	95670323	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr14:95670323C>T	ENST00000298912.4	-	9	1476	c.1363G>A	c.(1363-1365)Gaa>Aaa	p.E455K		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	455					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CTCAATGATTCCTTTGCCACT	0.468																																																0													77.0	73.0	74.0					14																	95670323		2203	4300	6503	SO:0001583	missense	79789			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1363G>A	14.37:g.95670323C>T	ENSP00000298912:p.Glu455Lys		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017783	0.54576	.	.	ENSG00000165959	ENST00000298912	D	0.94828	-3.53	5.63	4.72	0.59763	.	1.140950	0.06667	N	0.765409	D	0.93096	0.7802	L	0.58101	1.795	0.36334	D	0.859035	P	0.46395	0.877	B	0.40741	0.339	D	0.88348	0.2979	10	0.56958	D	0.05	.	9.7332	0.40374	0.0:0.9012:0.0:0.0988	.	455	Q96JQ2	CLMN_HUMAN	K	455	ENSP00000298912:E455K	ENSP00000298912:E455K	E	-	1	0	CLMN	94740076	0.491000	0.26019	0.062000	0.19696	0.002000	0.02628	2.168000	0.42424	1.316000	0.45131	0.655000	0.94253	GAA		0.468	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2			17	47	17	47
HDC	3067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	50534698	50534698	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr15:50534698C>T	ENST00000267845.3	-	12	2150	c.1748G>A	c.(1747-1749)cGc>cAc	p.R583H	HDC_ENST00000543581.1_Missense_Mutation_p.R550H|RN7SL494P_ENST00000461517.2_RNA	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.R583L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		ACTGAGGGAGCGCACCGTCTT	0.542																																					GBM(95;1627 1936 6910 9570)											1	Substitution - Missense(1)	lung(1)											167.0	176.0	173.0					15																	50534698		2196	4295	6491	SO:0001583	missense	3067				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1748G>A	15.37:g.50534698C>T	ENSP00000267845:p.Arg583His			Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333766	0.60853	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.22945	2.44;1.93	5.68	5.68	0.88126	.	0.645193	0.14441	N	0.319397	T	0.46268	0.1384	L	0.38175	1.15	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.37888	-0.9686	10	0.87932	D	0	-18.4835	19.786	0.96437	0.0:1.0:0.0:0.0	.	550;583	B7ZM01;P19113	.;DCHS_HUMAN	H	583;550	ENSP00000267845:R583H;ENSP00000440252:R550H	ENSP00000267845:R583H	R	-	2	0	HDC	48321990	0.999000	0.42202	0.737000	0.30932	0.033000	0.12548	5.198000	0.65147	2.676000	0.91093	0.563000	0.77884	CGC		0.542	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1			119	236	119	236
GGT6	124975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	4463042	4463042	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr17:4463042C>T	ENST00000574154.1	-	2	450	c.154G>A	c.(154-156)Ggg>Agg	p.G52R	GGT6_ENST00000381550.3_Missense_Mutation_p.G52R|GGT6_ENST00000573591.1_5'UTR|GGT6_ENST00000301395.3_Missense_Mutation_p.G52R			Q6P531	GGT6_HUMAN	gamma-glutamyltransferase 6	52					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.G52W(1)		endometrium(2)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CCGGGCAGCCCGCCAGCCTTG	0.652																																																1	Substitution - Missense(1)	lung(1)											19.0	22.0	21.0					17																	4463042		2183	4267	6450	SO:0001583	missense	124975			AK074646	CCDS11047.1, CCDS45582.1, CCDS73942.1	17p13.2	2014-08-12	2008-03-10		ENSG00000167741	ENSG00000167741		"""Gamma-glutamyltransferases"""	26891	protein-coding gene	gene with protein product		612341	"""gamma-glutamyltransferase 6 homolog (rat)"""			18357469	Standard	NM_001122890		Approved	FLJ90165	uc002fyd.4	Q6P531	OTTHUMG00000177827	ENST00000574154.1:c.154G>A	17.37:g.4463042C>T	ENSP00000458307:p.Gly52Arg		B4DUH4|Q8NCM0	Missense_Mutation	SNP	ENST00000574154.1	37	CCDS45582.1	.	.	.	.	.	.	.	.	.	.	C	9.458	1.092316	0.20471	.	.	ENSG00000167741	ENST00000381550;ENST00000301395	T;T	0.25250	2.57;1.81	5.32	-0.233	0.13078	.	0.471361	0.20167	N	0.097817	T	0.12135	0.0295	N	0.25890	0.77	0.09310	N	0.999999	B;B;B	0.32526	0.111;0.119;0.374	B;B;B	0.22601	0.011;0.012;0.04	T	0.14587	-1.0467	10	0.37606	T	0.19	-14.1518	5.3197	0.15874	0.0:0.5215:0.1424:0.3361	.	52;52;52	B4DKN3;Q6P531;Q6P531-2	.;GGT6_HUMAN;.	R	52	ENSP00000370962:G52R;ENSP00000301395:G52R	ENSP00000301395:G52R	G	-	1	0	GGT6	4409791	0.000000	0.05858	0.001000	0.08648	0.230000	0.25150	-0.043000	0.12043	0.072000	0.16694	0.655000	0.94253	GGG		0.652	GGT6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439122.1	NM_153338		10	58	10	58
KRT35	3886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	39635168	39635168	+	Missense_Mutation	SNP	C	C	T	rs573378713	byFrequency	TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr17:39635168C>T	ENST00000393989.1	-	4	833	c.791G>A	c.(790-792)cGa>cAa	p.R264Q	KRT35_ENST00000246639.2_Missense_Mutation_p.R234Q	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	264	Coil 2.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				CTCCAGAACTCGGTTCAGGTC	0.552													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19486	0.0		0.0	False		,,,				2504	0.0															0																																										SO:0001583	missense	3886			X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.791G>A	17.37:g.39635168C>T	ENSP00000377558:p.Arg264Gln		O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709759	0.48517	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	T;T	0.77620	-1.11;-1.11	4.6	4.6	0.57074	Filament (1);	0.000000	0.53938	D	0.000059	T	0.61800	0.2376	L	0.31294	0.92	0.19945	N	0.999949	B	0.32717	0.381	B	0.28784	0.094	T	0.56177	-0.8022	10	0.48119	T	0.1	.	6.5747	0.22560	0.0:0.804:0.0:0.196	.	264	Q92764	KRT35_HUMAN	Q	234;264	ENSP00000246639:R234Q;ENSP00000377558:R264Q	ENSP00000246639:R234Q	R	-	2	0	KRT35	36888694	0.004000	0.15560	0.998000	0.56505	0.974000	0.67602	1.539000	0.36104	2.534000	0.85438	0.655000	0.94253	CGA		0.552	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280		8	85	8	85
NOL4	8715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	31538334	31538334	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr18:31538334C>T	ENST00000261592.5	-	7	1402	c.1105G>A	c.(1105-1107)Gta>Ata	p.V369I	NOL4_ENST00000538587.1_Missense_Mutation_p.V295I|NOL4_ENST00000269185.4_Missense_Mutation_p.V255I|NOL4_ENST00000535475.1_Missense_Mutation_p.V214I|NOL4_ENST00000535384.1_Missense_Mutation_p.V84I|NOL4_ENST00000589544.1_Missense_Mutation_p.V369I	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	369						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CCTCGGTCTACACTCTCATTT	0.448																																																0													230.0	204.0	213.0					18																	31538334		2203	4300	6503	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1105G>A	18.37:g.31538334C>T	ENSP00000261592:p.Val369Ile		B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	5.662	0.306718	0.10733	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92	5.64	3.86	0.44501	.	0.413247	0.22387	N	0.060739	T	0.80597	0.4653	L	0.34521	1.04	0.26462	N	0.975437	P;B;B;B;B;B;B;B	0.44044	0.825;0.228;0.001;0.073;0.034;0.001;0.0;0.167	P;B;B;B;B;B;B;B	0.46026	0.501;0.085;0.005;0.079;0.053;0.005;0.001;0.079	T	0.71906	-0.4451	10	0.51188	T	0.08	-2.261	9.9792	0.41802	0.0:0.784:0.0:0.216	.	255;118;84;295;369;84;369;214	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	I	369;255;118;84;214;295	ENSP00000261592:V369I;ENSP00000269185:V255I;ENSP00000445733:V84I;ENSP00000438190:V214I;ENSP00000443472:V295I	ENSP00000261592:V369I	V	-	1	0	NOL4	29792332	0.994000	0.37717	0.613000	0.29037	0.081000	0.17604	1.922000	0.40045	0.728000	0.32382	0.557000	0.71058	GTA		0.448	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		69	167	69	167
BIRC8	112401	hgsc.bcm.edu;broad.mit.edu	37	19	53793157	53793157	+	Silent	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr19:53793157C>T	ENST00000426466.1	-	1	1718	c.471G>A	c.(469-471)caG>caA	p.Q157Q		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	157					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		TAGTGTCTTTCTGAGCGCTCA	0.408																																																0													99.0	99.0	99.0					19																	53793157		2203	4300	6503	SO:0001819	synonymous_variant	112401			AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.471G>A	19.37:g.53793157C>T			Q6IPY1|Q96RW5	Silent	SNP	ENST00000426466.1	37	CCDS12863.1																																																																																				0.408	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341		3	62	3	62
AMER3	205147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	131521709	131521709	+	Silent	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr2:131521709C>T	ENST00000423981.1	+	2	2174	c.2064C>T	c.(2062-2064)aaC>aaT	p.N688N	AMER3_ENST00000321420.4_Silent_p.N688N	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	688					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TCAGCTCAAACGAACAGCCCC	0.652																																																0													21.0	23.0	22.0					2																	131521709		2201	4299	6500	SO:0001819	synonymous_variant	205147			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2064C>T	2.37:g.131521709C>T			B7ZLH6	Silent	SNP	ENST00000423981.1	37	CCDS2164.1																																																																																				0.652	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		12	10	12	10
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000446179.1_Missense_Mutation_p.R132H|IDH1_ENST00000345146.2_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			40	99	40	99
SETMAR	6419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	4358185	4358185	+	Missense_Mutation	SNP	A	A	G	rs573824448		TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr3:4358185A>G	ENST00000358065.4	+	3	1377	c.1310A>G	c.(1309-1311)aAt>aGt	p.N437S	SETMAR_ENST00000425863.1_Missense_Mutation_p.N298S|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	437	Mariner transposase Hsmar1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		gaagaactcaatgtcaaccat	0.448								Chromatin Structure					A|||	1	0.000199681	0.0	0.0	5008	,	,		9030	0.0		0.0	False		,,,				2504	0.001															0													16.0	18.0	17.0					3																	4358185		2202	4300	6502	SO:0001583	missense	6419			U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.1310A>G	3.37:g.4358185A>G	ENSP00000373354:p.Asn437Ser		B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	37	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	A	4.130	0.022324	0.08006	.	.	ENSG00000170364	ENST00000358065;ENST00000425863;ENST00000358950	T;T;T	0.31510	1.49;1.49;1.49	0.235	0.235	0.15431	Transposase, Tc1-like (1);	0.423880	0.16690	U	0.203584	T	0.32645	0.0836	L	0.45285	1.41	0.09310	N	1	B;P;P;B	0.38767	0.053;0.623;0.646;0.344	B;B;P;B	0.49752	0.129;0.401;0.621;0.134	T	0.17471	-1.0368	9	0.48119	T	0.1	.	.	.	.	.	181;298;424;182	B4DND2;E7EN68;Q53H47;Q96H41	.;.;SETMR_HUMAN;.	S	437;298;201	ENSP00000373354:N437S;ENSP00000403145:N298S;ENSP00000369673:N201S	ENSP00000373354:N437S	N	+	2	0	SETMAR	4333185	0.121000	0.22262	0.150000	0.22450	0.152000	0.21847	0.349000	0.20055	0.263000	0.21812	0.260000	0.18958	AAT		0.448	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515		7	15	7	15
CLDN16	10686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	190120187	190120187	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr3:190120187G>A	ENST00000264734.2	+	2	634	c.386G>A	c.(385-387)cGc>cAc	p.R129H	CLDN16_ENST00000468220.1_3'UTR|CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	129					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		GATGGGATTCGCACCTGTGAT	0.488																																																0													183.0	166.0	172.0					3																	190120187		2203	4300	6503	SO:0001583	missense	10686			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.386G>A	3.37:g.190120187G>A	ENSP00000264734:p.Arg129His			Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221367	0.58560	.	.	ENSG00000113946	ENST00000264734	D	0.88509	-2.39	5.72	5.72	0.89469	Claudin, conserved site (1);	0.078352	0.53938	D	0.000043	D	0.90075	0.6900	L	0.50919	1.6	0.80722	D	1	D	0.89917	1.0	D	0.66847	0.947	D	0.85879	0.1421	10	0.15499	T	0.54	-30.0013	8.3904	0.32524	0.1647:0.0:0.8353:0.0	.	129	Q9Y5I7	CLD16_HUMAN	H	129	ENSP00000264734:R129H	ENSP00000264734:R129H	R	+	2	0	CLDN16	191602881	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	3.165000	0.50778	2.707000	0.92482	0.650000	0.86243	CGC		0.488	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580		29	216	29	216
GUCY1A3	2982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	156631972	156631972	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr4:156631972A>G	ENST00000296518.7	+	6	864	c.655A>G	c.(655-657)Ata>Gta	p.I219V	GUCY1A3_ENST00000511507.1_Missense_Mutation_p.I219V|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.I219V|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.I219V|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.I219V|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.I219V|GUCY1A3_ENST00000393832.3_5'UTR			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	219					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TCCCGGCATCATAAAGGCAGC	0.458																																																0													100.0	102.0	101.0					4																	156631972		2203	4300	6503	SO:0001583	missense	2982				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.655A>G	4.37:g.156631972A>G	ENSP00000296518:p.Ile219Val		D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.283216	0.59867	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000296518;ENST00000513574	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.74	3.31	0.37934	Heme-NO binding (1);	0.085836	0.49916	N	0.000137	T	0.46328	0.1387	L	0.48174	1.505	0.46279	D	0.998967	P;P;P	0.47191	0.891;0.891;0.891	P;P;P	0.55303	0.773;0.773;0.773	T	0.19289	-1.0310	10	0.21014	T	0.42	.	10.3512	0.43937	0.8669:0.0:0.1331:0.0	.	219;219;219	B3KU69;Q02108;D6RDW3	.;GCYA3_HUMAN;.	V	219	ENSP00000424361:I219V;ENSP00000421493:I219V;ENSP00000426968:I219V;ENSP00000412201:I219V;ENSP00000296518:I219V;ENSP00000426040:I219V	ENSP00000296518:I219V	I	+	1	0	GUCY1A3	156851422	1.000000	0.71417	0.976000	0.42696	0.668000	0.39293	4.763000	0.62257	0.528000	0.28580	0.523000	0.50628	ATA		0.458	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			49	116	49	116
OR2Y1	134083	hgsc.bcm.edu;broad.mit.edu	37	5	180166657	180166657	+	Silent	SNP	G	G	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr5:180166657G>T	ENST00000307832.2	-	1	442	c.402C>A	c.(400-402)gcC>gcA	p.A134A		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGCATGATGGCCATGTAGT	0.587																																																0													66.0	58.0	61.0					5																	180166657		2203	4300	6503	SO:0001819	synonymous_variant	134083			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.402C>A	5.37:g.180166657G>T			B9EIP1|Q6IFB1|Q96R16	Silent	SNP	ENST00000307832.2	37	CCDS34323.1																																																																																				0.587	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682		4	76	4	76
PHF3	23469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	64394227	64394227	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr6:64394227C>T	ENST00000262043.3	+	4	944	c.604C>T	c.(604-606)Cga>Tga	p.R202*	PHF3_ENST00000393387.1_Nonsense_Mutation_p.R202*|PHF3_ENST00000509330.1_Nonsense_Mutation_p.R202*			Q92576	PHF3_HUMAN	PHD finger protein 3	202					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAGGTGCAGCCGAAATAGCGG	0.403																																					GBM(135;136 1820 29512 34071 46235)											0													164.0	136.0	145.0					6																	64394227		2203	4300	6503	SO:0001587	stop_gained	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.604C>T	6.37:g.64394227C>T	ENSP00000262043:p.Arg202*		A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Nonsense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.405805	0.25378	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387	.	.	.	5.72	4.85	0.62838	.	0.000000	0.33419	N	0.004923	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5259	7.801	0.29174	0.2476:0.6735:0.0:0.0789	.	.	.	.	X	16;114;202;155;202;202	.	ENSP00000262043:R202X	R	+	1	2	PHF3	64452186	0.938000	0.31826	0.443000	0.26883	0.145000	0.21501	1.981000	0.40628	1.415000	0.47037	0.650000	0.86243	CGA		0.403	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2			36	82	36	82
DPY19L1	23333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	34977700	34977700	+	Missense_Mutation	SNP	T	T	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr7:34977700T>A	ENST00000310974.4	-	21	1921	c.1777A>T	c.(1777-1779)Agt>Tgt	p.S593C	MIR548N_ENST00000408742.1_RNA	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	593						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GCTTTCCGACTATACATTGAG	0.328																																																0													95.0	83.0	87.0					7																	34977700		1830	4092	5922	SO:0001583	missense	23333			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1777A>T	7.37:g.34977700T>A	ENSP00000308695:p.Ser593Cys		O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.627481	0.87560	.	.	ENSG00000173852	ENST00000389292;ENST00000310974	T	0.66280	-0.2	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.81851	0.4910	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85197	0.1013	10	0.87932	D	0	-17.4685	15.3426	0.74309	0.0:0.0:0.0:1.0	.	593	Q2PZI1	D19L1_HUMAN	C	3;593	ENSP00000308695:S593C	ENSP00000308695:S593C	S	-	1	0	DPY19L1	34944225	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.131000	0.77243	2.229000	0.72834	0.472000	0.43445	AGT		0.328	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			20	19	20	19
TSPAN33	340348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	128804343	128804343	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr7:128804343A>G	ENST00000289407.4	+	5	501	c.392A>G	c.(391-393)aAc>aGc	p.N131S	Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	131					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						GAGATCATCAACAATGCCATT	0.493											OREG0018304	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													204.0	173.0	184.0					7																	128804343		2203	4300	6503	SO:0001583	missense	340348				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.392A>G	7.37:g.128804343A>G	ENSP00000289407:p.Asn131Ser	1567		Missense_Mutation	SNP	ENST00000289407.4	37	CCDS5810.1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.486594	0.44249	.	.	ENSG00000158457	ENST00000289407	D	0.86769	-2.17	5.95	3.61	0.41365	Tetraspanin, EC2 domain (1);	0.138036	0.64402	N	0.000004	T	0.75664	0.3880	L	0.27053	0.805	0.42316	D	0.992239	B	0.15473	0.013	B	0.19148	0.024	T	0.62364	-0.6870	10	0.14656	T	0.56	-4.361	7.3805	0.26854	0.76:0.0:0.24:0.0	.	131	Q86UF1	TSN33_HUMAN	S	131	ENSP00000289407:N131S	ENSP00000289407:N131S	N	+	2	0	TSPAN33	128591579	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.180000	0.50895	0.515000	0.28320	0.533000	0.62120	AAC		0.493	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562		156	227	156	227
TBXAS1	6916	hgsc.bcm.edu;broad.mit.edu	37	7	139529240	139529240	+	Silent	SNP	G	G	A	rs201600575		TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr7:139529240G>A	ENST00000455353.1	+	1	188	c.51G>A	c.(49-51)acG>acA	p.T17T	TBXAS1_ENST00000458722.1_Silent_p.T17T|TBXAS1_ENST00000436047.2_Silent_p.T18T|TBXAS1_ENST00000414508.2_Silent_p.T18T|TBXAS1_ENST00000448866.1_Silent_p.T17T|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000336425.5_Silent_p.T17T|TBXAS1_ENST00000416849.2_Silent_p.T18T|TBXAS1_ENST00000539806.1_Silent_p.T18T|TBXAS1_ENST00000411653.1_Silent_p.T17T|TBXAS1_ENST00000425687.1_Intron|TBXAS1_ENST00000263552.6_Silent_p.T18T			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	17					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	CCATGGTGACGGTGGCCCTGT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17045	0.001		0.0	False		,,,				2504	0.0															0													71.0	63.0	66.0					7																	139529240		2203	4300	6503	SO:0001819	synonymous_variant	6916			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000455353.1:c.51G>A	7.37:g.139529240G>A			B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Silent	SNP	ENST00000455353.1	37																																																																																					0.572	TBXAS1-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000348380.1			4	70	4	70
CCIN	881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	36170121	36170121	+	Missense_Mutation	SNP	C	C	T	rs569235631	byFrequency	TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr9:36170121C>T	ENST00000335119.2	+	1	733	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	208	BACK.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GGTGTACTTCCGGAAGGAGGA	0.488													C|||	36	0.0071885	0.0	0.0	5008	,	,		23339	0.002		0.0	False		,,,				2504	0.0348															0													61.0	59.0	60.0					9																	36170121		2203	4300	6503	SO:0001583	missense	881			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.622C>T	9.37:g.36170121C>T	ENSP00000334996:p.Arg208Trp		Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522260	0.44866	.	.	ENSG00000185972	ENST00000335119	T	0.69306	-0.39	5.55	3.47	0.39725	BTB/Kelch-associated (2);	0.329487	0.21674	N	0.070837	T	0.65333	0.2681	N	0.24115	0.695	0.32381	N	0.554537	D	0.64830	0.994	P	0.57720	0.826	T	0.73464	-0.3974	10	0.87932	D	0	.	11.8134	0.52195	0.324:0.676:0.0:0.0	.	208	Q13939	CALI_HUMAN	W	208	ENSP00000334996:R208W	ENSP00000334996:R208W	R	+	1	2	CCIN	36160121	0.969000	0.33509	1.000000	0.80357	0.925000	0.55904	0.157000	0.16402	1.314000	0.45095	0.563000	0.77884	CGG		0.488	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893		23	44	23	44
ALDH1A1	216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	75520934	75520934	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr9:75520934C>T	ENST00000297785.3	-	12	1427	c.1373G>A	c.(1372-1374)gGc>gAc	p.G458D		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	458					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	ACTTACCACGCCATAGCAATT	0.343																																																0													60.0	59.0	60.0					9																	75520934		2203	4300	6503	SO:0001583	missense	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1373G>A	9.37:g.75520934C>T	ENSP00000297785:p.Gly458Asp		O00768|Q5SYR1	Missense_Mutation	SNP	ENST00000297785.3	37	CCDS6644.1	.	.	.	.	.	.	.	.	.	.	C	1.401	-0.578178	0.03854	.	.	ENSG00000165092	ENST00000297785	T	0.15952	2.38	5.91	4.94	0.65067	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.251773	0.40728	N	0.001027	T	0.13157	0.0319	N	0.19112	0.55	0.80722	D	1	B;B	0.20459	0.045;0.044	B;B	0.29176	0.099;0.077	T	0.08229	-1.0732	10	0.14252	T	0.57	.	15.3781	0.74630	0.1784:0.8215:0.0:0.0	.	379;458	B4DDF8;P00352	.;AL1A1_HUMAN	D	458	ENSP00000297785:G458D	ENSP00000297785:G458D	G	-	2	0	ALDH1A1	74710754	0.993000	0.37304	0.048000	0.18961	0.248000	0.25809	2.818000	0.48041	1.277000	0.44412	0.650000	0.86243	GGC		0.343	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052679.1			17	61	17	61
NOTCH1	4851	hgsc.bcm.edu;broad.mit.edu	37	9	139412245	139412245	+	Missense_Mutation	SNP	C	C	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr9:139412245C>A	ENST00000277541.6	-	8	1475	c.1400G>T	c.(1399-1401)tGc>tTc	p.C467F	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	467	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTGGTCCAGGCAGGTGGCGTC	0.677			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													57.0	64.0	62.0					9																	139412245		2146	4233	6379	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1400G>T	9.37:g.139412245C>A	ENSP00000277541:p.Cys467Phe		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224158	0.79576	.	.	ENSG00000148400	ENST00000277541	D	0.99445	-5.91	4.57	4.57	0.56435	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.99935	4.985	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96191	0.9138	10	0.87932	D	0	.	16.3317	0.83023	0.0:1.0:0.0:0.0	.	467	P46531	NOTC1_HUMAN	F	467	ENSP00000277541:C467F	ENSP00000277541:C467F	C	-	2	0	NOTCH1	138532066	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.258000	0.78371	2.088000	0.63022	0.462000	0.41574	TGC		0.677	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		6	126	6	126
CXorf22	170063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	35966455	35966455	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chrX:35966455G>A	ENST00000297866.5	+	4	608	c.542G>A	c.(541-543)gGc>gAc	p.G181D		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	181										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GAATACCACGGCCAATTACCC	0.413																																																0													195.0	154.0	168.0					X																	35966455		2202	4300	6502	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.542G>A	X.37:g.35966455G>A	ENSP00000297866:p.Gly181Asp		Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759192	0.69763	.	.	ENSG00000165164	ENST00000297866	T	0.39056	1.1	4.91	4.91	0.64330	.	0.106321	0.64402	D	0.000004	T	0.61160	0.2325	M	0.72894	2.215	0.29874	N	0.826554	D	0.71674	0.998	D	0.74023	0.982	T	0.59434	-0.7455	10	0.17832	T	0.49	-24.4319	16.4434	0.83908	0.0:0.0:1.0:0.0	.	181	Q6ZTR5	CX022_HUMAN	D	181	ENSP00000297866:G181D	ENSP00000297866:G181D	G	+	2	0	CXorf22	35876376	1.000000	0.71417	0.038000	0.18304	0.029000	0.11900	6.223000	0.72257	2.169000	0.68431	0.534000	0.68092	GGC		0.413	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		74	152	74	152
CXorf22	170063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	35993797	35993797	+	Missense_Mutation	SNP	C	C	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chrX:35993797C>A	ENST00000297866.5	+	15	2546	c.2480C>A	c.(2479-2481)aCc>aAc	p.T827N		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	827								p.T827N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGGTCTTTCACCTTTACAGTG	0.383																																																1	Substitution - Missense(1)	lung(1)											102.0	88.0	93.0					X																	35993797		2202	4300	6502	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2480C>A	X.37:g.35993797C>A	ENSP00000297866:p.Thr827Asn		Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	C	9.205	1.029382	0.19512	.	.	ENSG00000165164	ENST00000297866	T	0.14640	2.49	5.14	-0.802	0.10889	.	0.327756	0.31847	N	0.006966	T	0.19604	0.0471	M	0.76002	2.32	0.19300	N	0.999971	D	0.56521	0.976	P	0.55455	0.776	T	0.21075	-1.0256	10	0.15952	T	0.53	-2.1102	4.1972	0.10448	0.2243:0.4472:0.2457:0.0827	.	827	Q6ZTR5	CX022_HUMAN	N	827	ENSP00000297866:T827N	ENSP00000297866:T827N	T	+	2	0	CXorf22	35903718	0.089000	0.21612	0.066000	0.19879	0.008000	0.06430	0.190000	0.17057	-0.212000	0.10109	-0.224000	0.12420	ACC		0.383	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		40	67	40	67
GRIA3	2892	hgsc.bcm.edu;broad.mit.edu	37	X	122598965	122598965	+	Splice_Site	SNP	T	T	A			TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chrX:122598965T>A	ENST00000371251.1	+	13	2376		c.e13+2		GRIA3_ENST00000371256.5_Splice_Site|GRIA3_ENST00000264357.5_Splice_Site|AL356213.1_ENST00000577653.1_RNA|GRIA3_ENST00000542149.1_Splice_Site			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	AGCATTAAGGTGGGTGGAATA	0.393																																																0													104.0	97.0	99.0					X																	122598965		2203	4300	6503	SO:0001630	splice_region_variant	2892			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2324+2T>A	X.37:g.122598965T>A			D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Splice_Site	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	t	14.29	2.492670	0.44352	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5028	0.61467	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA3	122426646	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.036000	0.88901	1.784000	0.52394	0.336000	0.21669	.		0.393	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	Intron	9	128	9	128
CATSPERD	257062	broad.mit.edu;ucsc.edu	37	19	5727283	5727283	+	Missense_Mutation	SNP	G	G	A	rs182825334		TCGA-FG-8186-01A-11D-2253-08	TCGA-FG-8186-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	729f5374-cda6-4f84-8843-8d638ede22d1	033c9e3a-1498-4e9d-bbb1-2ab70851c8b8	g.chr19:5727283G>A	ENST00000381624.3	+	3	192	c.131G>A	c.(130-132)cGc>cAc	p.R44H	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	44					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CTCTAGGACCGCCTGTATTTT	0.338													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19125	0.0		0.0	False		,,,				2504	0.0															0								G	HIS/ARG	2,3630		0,2,1814	103.0	95.0	98.0		131	-6.0	0.0	19		98	21,8115		0,21,4047	yes	missense	TMEM146	NM_152784.3	29	0,23,5861	AA,AG,GG		0.2581,0.0551,0.1954	probably-damaging	44/799	5727283	23,11745	1816	4068	5884	SO:0001583	missense	257062			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.131G>A	19.37:g.5727283G>A	ENSP00000371037:p.Arg44His		Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	5.933	0.356130	0.11239	5.51E-4	0.002581	ENSG00000174898	ENST00000381624	T	0.24908	1.83	3.0	-5.99	0.02213	.	.	.	.	.	T	0.19167	0.0460	L	0.44542	1.39	0.09310	N	0.999999	D	0.59357	0.985	P	0.46510	0.519	T	0.18871	-1.0323	9	0.49607	T	0.09	.	2.5935	0.04848	0.3028:0.1651:0.4073:0.1248	.	44	Q86XM0	TM146_HUMAN	H	44	ENSP00000371037:R44H	ENSP00000371037:R44H	R	+	2	0	TMEM146	5678283	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.541000	0.00218	-4.388000	0.00052	-1.613000	0.00800	CGC		0.338	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784		8	95	8	95
