#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
GAD2	2572	hgsc.bcm.edu;ucsc.edu	37	10	26513539	26513539	+	Missense_Mutation	SNP	T	T	C	rs143186590	byFrequency	TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr10:26513539T>C	ENST00000376261.3	+	6	1186	c.683T>C	c.(682-684)aTt>aCt	p.I228T	GAD2_ENST00000376248.1_Missense_Mutation_p.I114T|GAD2_ENST00000259271.3_Missense_Mutation_p.I228T	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	228					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AGAGAAATCATTGGCTGGCCA	0.388													T|||	32	0.00638978	0.0023	0.0317	5008	,	,		18696	0.006		0.0	False		,,,				2504	0.001															0								T	THR/ILE,THR/ILE	3,4403	6.2+/-15.9	0,3,2200	108.0	111.0	110.0		683,683	5.2	1.0	10	dbSNP_134	110	2,8598	1.2+/-3.3	0,2,4298	yes	missense,missense	GAD2	NM_000818.2,NM_001134366.1	89,89	0,5,6498	CC,CT,TT		0.0233,0.0681,0.0384	benign,benign	228/586,228/586	26513539	5,13001	2203	4300	6503	SO:0001583	missense	2572			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.683T>C	10.37:g.26513539T>C	ENSP00000365437:p.Ile228Thr		Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	4	0.0018315018315018315	1	0.0020325203252032522	2	0.0055248618784530384	1	0.0017482517482517483	0	0.0	T	19.85	3.902913	0.72754	6.81E-4	2.33E-4	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000376248	T;T;T	0.39592	1.07;1.07;1.07	5.21	5.21	0.72293	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.092939	0.64402	D	0.000001	T	0.59321	0.2185	M	0.92555	3.32	0.80722	D	1	P	0.35328	0.495	P	0.48598	0.583	T	0.71695	-0.4515	10	0.87932	D	0	-8.2904	15.1137	0.72380	0.0:0.0:0.0:1.0	.	228	Q05329	DCE2_HUMAN	T	228;228;114	ENSP00000365437:I228T;ENSP00000259271:I228T;ENSP00000365424:I114T	ENSP00000259271:I228T	I	+	2	0	GAD2	26553545	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	1.981000	0.57761	0.533000	0.62120	ATT		0.388	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818		74	159	74	159
PCNXL3	399909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	65403262	65403262	+	Missense_Mutation	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr11:65403262G>A	ENST00000355703.3	+	32	5986	c.5447G>A	c.(5446-5448)cGc>cAc	p.R1816H	SIPA1_ENST00000534313.1_5'Flank|MIR4690_ENST00000578459.1_RNA	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1816						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						TGGCTCCTGCGCACCTGGGAG	0.687																																																0													12.0	14.0	14.0					11																	65403262		2124	4230	6354	SO:0001583	missense	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.5447G>A	11.37:g.65403262G>A	ENSP00000347931:p.Arg1816His		Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282991	0.59867	.	.	ENSG00000197136	ENST00000355703	T	0.06933	3.24	4.11	0.408	0.16377	.	0.316581	0.33591	N	0.004756	T	0.05502	0.0145	N	0.08118	0	0.25246	N	0.989717	B;D	0.67145	0.021;0.996	B;P	0.51193	0.02;0.662	T	0.32929	-0.9888	10	0.49607	T	0.09	.	5.0279	0.14395	0.2566:0.1594:0.5839:0.0	.	703;1816	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	H	1816	ENSP00000347931:R1816H	ENSP00000347931:R1816H	R	+	2	0	PCNXL3	65159838	0.526000	0.26298	0.997000	0.53966	0.966000	0.64601	0.468000	0.22051	-0.112000	0.11979	0.462000	0.41574	CGC		0.687	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		10	9	10	9
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	19475547	19475547	+	Silent	SNP	T	T	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr12:19475547T>C	ENST00000299275.6	+	15	2091	c.2085T>C	c.(2083-2085)gaT>gaC	p.D695D	PLEKHA5_ENST00000317589.4_Silent_p.D695D|PLEKHA5_ENST00000429027.2_Silent_p.D798D|PLEKHA5_ENST00000538714.1_Silent_p.D753D|PLEKHA5_ENST00000543806.1_Silent_p.D614D|PLEKHA5_ENST00000355397.3_Silent_p.D753D|PLEKHA5_ENST00000539256.1_Silent_p.D453D|PLEKHA5_ENST00000359180.3_Silent_p.D695D|PLEKHA5_ENST00000424268.1_Silent_p.D626D	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	695					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					TACAAAGGGATGATTTACAAA	0.408																																					Pancreas(196;329 2193 11246 14234 19524)											0													87.0	82.0	84.0					12																	19475547		2203	4300	6503	SO:0001819	synonymous_variant	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2085T>C	12.37:g.19475547T>C			A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	37	CCDS8682.1																																																																																				0.408	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012		65	71	65	71
VWA8	23078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	42293731	42293731	+	Missense_Mutation	SNP	T	T	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr13:42293731T>C	ENST00000379310.3	-	26	3180	c.3112A>G	c.(3112-3114)Aag>Gag	p.K1038E	VWA8_ENST00000281496.6_Missense_Mutation_p.K1038E	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1038						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										CCTTACTCCTTTGCCAGCTGC	0.373																																																0													170.0	145.0	153.0					13																	42293731		2203	4300	6503	SO:0001583	missense	23078			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3112A>G	13.37:g.42293731T>C	ENSP00000368612:p.Lys1038Glu		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.908447	0.72868	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496	T;T	0.15372	2.93;2.43	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	M	0.63843	1.955	0.80722	D	1	D	0.67145	0.996	P	0.58013	0.831	T	0.02625	-1.1132	10	0.25106	T	0.35	.	15.9017	0.79384	0.0:0.0:0.0:1.0	.	1038	A3KMH1	K0564_HUMAN	E	942;1038;1038	ENSP00000368612:K1038E;ENSP00000281496:K1038E	ENSP00000251030:K942E	K	-	1	0	KIAA0564	41191731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.940000	0.87693	2.213000	0.71641	0.528000	0.53228	AAG		0.373	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058		84	83	84	83
PYGL	5836	hgsc.bcm.edu;ucsc.edu	37	14	51378586	51378586	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr14:51378586C>T	ENST00000216392.7	-	16	2163	c.1831G>A	c.(1831-1833)Gcc>Acc	p.A611T	PYGL_ENST00000544180.2_Missense_Mutation_p.A577T|RP11-218E20.5_ENST00000557343.1_RNA|PYGL_ENST00000532462.1_Missense_Mutation_p.A611T	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	611					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	TATCCTGGGGCAGCCTTTGGG	0.453																																																0													127.0	116.0	120.0					14																	51378586		2203	4300	6503	SO:0001583	missense	5836				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.1831G>A	14.37:g.51378586C>T	ENSP00000216392:p.Ala611Thr		A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	ENST00000216392.7	37	CCDS32080.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792933	0.90453	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.94184	-3.37;-3.37;-3.37	5.61	5.61	0.85477	.	0.047302	0.85682	D	0.000000	D	0.98131	0.9383	H	0.98802	4.335	0.80722	D	1	D;P;D	0.52996	0.957;0.92;0.957	P;P;P	0.61328	0.819;0.887;0.694	D	0.99421	1.0933	10	0.87932	D	0	-3.6634	18.6272	0.91344	0.0:1.0:0.0:0.0	.	577;577;611	F5H816;B4DUB7;P06737	.;.;PYGL_HUMAN	T	611;577;611	ENSP00000431657:A611T;ENSP00000443787:A577T;ENSP00000216392:A611T	ENSP00000216392:A611T	A	-	1	0	PYGL	50448336	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.792000	0.85828	2.646000	0.89796	0.467000	0.42956	GCC		0.453	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3	NM_002863		90	149	90	149
GGA2	23062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	23491094	23491094	+	Missense_Mutation	SNP	G	G	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr16:23491094G>T	ENST00000309859.4	-	11	1203	c.1121C>A	c.(1120-1122)gCa>gAa	p.A374E	GGA2_ENST00000569182.1_5'UTR|GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	374	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		ACCCAAGGCTGCCAGGTCCTG	0.612																																																0													105.0	74.0	84.0					16																	23491094		2197	4300	6497	SO:0001583	missense	23062			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1121C>A	16.37:g.23491094G>T	ENSP00000311962:p.Ala374Glu		D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774098	0.31411	.	.	ENSG00000103365	ENST00000309859	T	0.14893	2.47	4.56	2.5	0.30297	.	0.603497	0.17831	N	0.160529	T	0.15089	0.0364	L	0.60455	1.87	0.80722	D	1	D	0.54772	0.968	P	0.45310	0.476	T	0.28427	-1.0044	10	0.02654	T	1	-5.2242	7.3814	0.26858	0.0:0.1659:0.4925:0.3416	.	374	Q9UJY4	GGA2_HUMAN	E	374	ENSP00000311962:A374E	ENSP00000311962:A374E	A	-	2	0	GGA2	23398595	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	1.204000	0.32296	0.604000	0.29930	-0.182000	0.12963	GCA		0.612	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1			15	101	15	101
ABCC12	94160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	48145730	48145730	+	Missense_Mutation	SNP	C	C	T	rs566735897		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr16:48145730C>T	ENST00000311303.3	-	14	2426	c.2081G>A	c.(2080-2082)cGc>cAc	p.R694H	ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_Missense_Mutation_p.R694H	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	694	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTTTGCATAGCGCCCTCTCTC	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20518	0.0		0.0	False		,,,				2504	0.0															0													164.0	154.0	157.0					16																	48145730		2201	4300	6501	SO:0001583	missense	94160			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2081G>A	16.37:g.48145730C>T	ENSP00000311030:p.Arg694His		Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	C	6.204	0.405832	0.11754	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	T;T	0.81330	-1.48;-1.48	5.56	-5.46	0.02608	ABC transporter-like (1);	0.728400	0.14511	N	0.315092	T	0.59770	0.2218	N	0.25426	0.745	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.42632	-0.9440	10	0.42905	T	0.14	.	3.7885	0.08710	0.1007:0.3595:0.1001:0.4396	.	694	Q96J65	MRP9_HUMAN	H	694;694;636	ENSP00000311030:R694H;ENSP00000401855:R694H	ENSP00000311030:R694H	R	-	2	0	ABCC12	46703231	0.000000	0.05858	0.003000	0.11579	0.140000	0.21249	-0.288000	0.08377	-0.800000	0.04433	-1.149000	0.01842	CGC		0.463	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226		41	88	41	88
WDR81	124997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	1637326	1637326	+	Silent	SNP	C	C	T	rs143987787		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr17:1637326C>T	ENST00000409644.1	+	7	4995	c.4995C>T	c.(4993-4995)agC>agT	p.S1665S	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Silent_p.S462S|WDR81_ENST00000545662.1_Silent_p.S296S|WDR81_ENST00000419248.1_Silent_p.S438S|WDR81_ENST00000446363.1_Silent_p.S304S|WDR81_ENST00000309182.5_Silent_p.S614S	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1665					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TCTTCCTGAGCGGCAGCAAGG	0.657																																																0								C	,,,	0,4404		0,0,2202	62.0	58.0	59.0		1386,4995,1314,1842	-4.2	1.0	17	dbSNP_134	59	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	WDR81	NM_001163673.1,NM_001163809.1,NM_001163811.1,NM_152348.3	,,,	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	,,,	462/739,1665/1942,438/715,614/891	1637326	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	124997			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.4995C>T	17.37:g.1637326C>T			B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Silent	SNP	ENST00000409644.1	37	CCDS54062.1																																																																																				0.657	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348		57	87	57	87
RABEP1	9135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	5257698	5257698	+	Silent	SNP	A	A	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr17:5257698A>G	ENST00000546142.2	+	8	1195	c.1008A>G	c.(1006-1008)aaA>aaG	p.K336K	RABEP1_ENST00000262477.6_Silent_p.K336K|RABEP1_ENST00000341923.6_Silent_p.K336K|RABEP1_ENST00000408982.2_Silent_p.K336K|RABEP1_ENST00000537505.1_Silent_p.K293K			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	336					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AGGATCACAAAAAAGCAGATG	0.338																																																0													133.0	122.0	125.0					17																	5257698		1824	4086	5910	SO:0001819	synonymous_variant	9135			AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.1008A>G	17.37:g.5257698A>G			B2RAG7|O95369|Q8IVX3	Silent	SNP	ENST00000546142.2	37	CCDS45592.1																																																																																				0.338	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703		26	28	26	28
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		23	5	23	5
CASC3	22794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	38320314	38320314	+	Missense_Mutation	SNP	G	G	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr17:38320314G>T	ENST00000264645.7	+	7	1592	c.1366G>T	c.(1366-1368)Gat>Tat	p.D456Y		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	456	Necessary for localization in cytoplasmic stress granules.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						AGCTCCGGTGGATTCTAGTAC	0.542																																																0													57.0	54.0	55.0					17																	38320314		2203	4300	6503	SO:0001583	missense	22794			X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1366G>T	17.37:g.38320314G>T	ENSP00000264645:p.Asp456Tyr		A8K8R0	Missense_Mutation	SNP	ENST00000264645.7	37	CCDS11362.1	.	.	.	.	.	.	.	.	.	.	G	8.828	0.939219	0.18281	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.08	5.08	0.68730	.	0.229868	0.42964	D	0.000621	T	0.57315	0.2045	N	0.14661	0.345	0.58432	D	0.999995	D;D	0.61697	0.99;0.981	P;P	0.56700	0.804;0.687	T	0.64732	-0.6338	9	0.72032	D	0.01	-11.8211	18.2812	0.90098	0.0:0.0:1.0:0.0	.	456;456	B4DKR6;O15234	.;CASC3_HUMAN	Y	456	.	ENSP00000264645:D456Y	D	+	1	0	CASC3	35573840	1.000000	0.71417	0.973000	0.42090	0.267000	0.26476	7.716000	0.84723	2.648000	0.89879	0.563000	0.77884	GAT		0.542	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359		36	36	36	36
G6PC	2538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	41059590	41059590	+	Missense_Mutation	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr17:41059590G>A	ENST00000253801.2	+	3	470	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	G6PC_ENST00000585489.1_Missense_Mutation_p.V131I|G6PC_ENST00000592383.1_Intron	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	131					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTACGTGATGGTCACATCTAC	0.517																																																0													79.0	68.0	72.0					17																	41059590		2203	4300	6503	SO:0001583	missense	2538			U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.391G>A	17.37:g.41059590G>A	ENSP00000253801:p.Val131Ile		A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	37	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476402	0.84640	.	.	ENSG00000131482	ENST00000253801	T	0.75050	-0.9	5.05	5.05	0.67936	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78566	0.4303	L	0.39898	1.24	0.80722	D	1	D	0.56968	0.978	P	0.57911	0.829	T	0.76471	-0.2947	10	0.34782	T	0.22	.	18.2197	0.89897	0.0:0.0:1.0:0.0	.	131	P35575	G6PC_HUMAN	I	131	ENSP00000253801:V131I	ENSP00000253801:V131I	V	+	1	0	G6PC	38313116	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	7.186000	0.77722	2.617000	0.88574	0.555000	0.69702	GTC		0.517	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151		30	57	30	57
RFX1	5989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	14077272	14077272	+	Missense_Mutation	SNP	T	T	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr19:14077272T>C	ENST00000254325.4	-	14	2156	c.1922A>G	c.(1921-1923)tAc>tGc	p.Y641C		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	641					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GCTGAGGTTGTACCTCCAGAA	0.642																																																0													51.0	45.0	47.0					19																	14077272		2203	4300	6503	SO:0001583	missense	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.1922A>G	19.37:g.14077272T>C	ENSP00000254325:p.Tyr641Cys			Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.584495	0.28268	.	.	ENSG00000132005	ENST00000254325	T	0.07800	3.16	4.41	3.36	0.38483	.	0.186824	0.45606	D	0.000360	T	0.04588	0.0125	N	0.14661	0.345	0.31340	N	0.683779	B	0.10296	0.003	B	0.09377	0.004	T	0.13764	-1.0497	10	0.39692	T	0.17	-9.2043	5.7932	0.18371	0.1677:0.0:0.1743:0.658	.	641	P22670	RFX1_HUMAN	C	641	ENSP00000254325:Y641C	ENSP00000254325:Y641C	Y	-	2	0	RFX1	13938272	1.000000	0.71417	0.993000	0.49108	0.859000	0.49053	1.870000	0.39529	0.694000	0.31654	0.459000	0.35465	TAC		0.642	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918		29	34	29	34
RASIP1	54922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	49227649	49227649	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr19:49227649C>T	ENST00000222145.4	-	10	2693	c.2489G>A	c.(2488-2490)cGg>cAg	p.R830Q		NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	830	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		GGAGAGTTTCCGGAAGAACTC	0.572																																																0													97.0	88.0	91.0					19																	49227649		2203	4300	6503	SO:0001583	missense	54922			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2489G>A	19.37:g.49227649C>T	ENSP00000222145:p.Arg830Gln		Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	c	19.83	3.899765	0.72754	.	.	ENSG00000105538	ENST00000222145	T	0.21031	2.03	5.11	5.11	0.69529	Dilute (1);Dil domain (1);	0.293482	0.28618	N	0.014713	T	0.14141	0.0342	N	0.16743	0.435	0.31952	N	0.609598	P	0.48162	0.906	B	0.40165	0.321	T	0.04664	-1.0935	10	0.24483	T	0.36	-2.2551	16.4672	0.84083	0.0:1.0:0.0:0.0	.	830	Q5U651	RAIN_HUMAN	Q	830	ENSP00000222145:R830Q	ENSP00000222145:R830Q	R	-	2	0	RASIP1	53919461	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.158000	0.50723	2.570000	0.86706	0.550000	0.68814	CGG		0.572	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805		61	81	61	81
NOTCH2	4853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	120468319	120468319	+	Missense_Mutation	SNP	A	A	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:120468319A>T	ENST00000256646.2	-	25	4339	c.4120T>A	c.(4120-4122)Tgc>Agc	p.C1374S	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1374	EGF-like 35. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTGACTCGCAGTCCCGGGGA	0.642			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													25.0	24.0	25.0					1																	120468319		2203	4293	6496	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4120T>A	1.37:g.120468319A>T	ENSP00000256646:p.Cys1374Ser		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.869245	0.32977	.	.	ENSG00000134250	ENST00000256646	D	0.83591	-1.74	5.94	5.94	0.96194	.	0.000000	0.41396	U	0.000894	T	0.71350	0.3329	L	0.54323	1.7	0.80722	D	1	B	0.30824	0.296	B	0.22753	0.041	T	0.74685	-0.3582	10	0.54805	T	0.06	.	15.5759	0.76387	1.0:0.0:0.0:0.0	.	1374	Q04721	NOTC2_HUMAN	S	1374	ENSP00000256646:C1374S	ENSP00000256646:C1374S	C	-	1	0	NOTCH2	120269842	1.000000	0.71417	0.998000	0.56505	0.364000	0.29643	8.919000	0.92770	2.272000	0.75746	0.459000	0.35465	TGC		0.642	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		25	21	25	21
SFT2D2	375035	hgsc.bcm.edu;broad.mit.edu	37	1	168205989	168205989	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:168205989C>T	ENST00000271375.4	+	6	466	c.394C>T	c.(394-396)Cag>Tag	p.Q132*	SFT2D2_ENST00000367829.1_Silent_p.C104C|SFT2D2_ENST00000367825.3_Silent_p.C104C|SFT2D2_ENST00000471981.1_3'UTR	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					CTGCATTTTGCAGTCTTTGGC	0.403																																																0													242.0	235.0	238.0					1																	168205989		2203	4300	6503	SO:0001587	stop_gained	375035			AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.394C>T	1.37:g.168205989C>T	ENSP00000271375:p.Gln132*			Nonsense_Mutation	SNP	ENST00000271375.4	37	CCDS1271.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622529	0.87460	.	.	ENSG00000213064	ENST00000271375	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.8493	15.614	0.76750	0.0:1.0:0.0:0.0	.	.	.	.	X	132	.	ENSP00000271375:Q132X	Q	+	1	0	SFT2D2	166472613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.141000	0.71744	2.414000	0.81942	0.650000	0.86243	CAG		0.403	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083827.2	NM_199344		139	179	139	179
TPR	7175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	186292829	186292829	+	Missense_Mutation	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:186292829G>A	ENST00000367478.4	-	43	6582	c.6286C>T	c.(6286-6288)Cca>Tca	p.P2096S		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2096					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGAACTGGTGGTCCCAACTCC	0.463			T	NTRK1	papillary thyroid																																		Dom	yes		1	1q25	7175	translocated promoter region		E	0													121.0	123.0	122.0					1																	186292829		1887	4126	6013	SO:0001583	missense	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6286C>T	1.37:g.186292829G>A	ENSP00000356448:p.Pro2096Ser		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313159	0.81358	.	.	ENSG00000047410	ENST00000367478	T	0.36157	1.27	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.62011	0.2393	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.64567	-0.6377	10	0.87932	D	0	.	19.4568	0.94895	0.0:0.0:1.0:0.0	.	2096	P12270	TPR_HUMAN	S	2096	ENSP00000356448:P2096S	ENSP00000356448:P2096S	P	-	1	0	TPR	184559452	1.000000	0.71417	0.982000	0.44146	0.985000	0.73830	6.719000	0.74718	2.673000	0.90976	0.650000	0.86243	CCA		0.463	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		96	180	96	180
SPATA17	128153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	217915355	217915355	+	Missense_Mutation	SNP	A	A	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:217915355A>G	ENST00000366933.4	+	6	489	c.434A>G	c.(433-435)gAa>gGa	p.E145G		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	145						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		AAAGAAAGAGAAGAGAAGAAG	0.403																																																0													127.0	118.0	121.0					1																	217915355		2203	4300	6503	SO:0001583	missense	128153			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.434A>G	1.37:g.217915355A>G	ENSP00000355900:p.Glu145Gly		A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.765999	0.90020	.	.	ENSG00000162814	ENST00000366933	T	0.53857	0.6	5.84	5.84	0.93424	.	0.051449	0.85682	D	0.000000	T	0.71409	0.3336	M	0.80847	2.515	0.45899	D	0.998748	D	0.67145	0.996	P	0.60236	0.871	T	0.76033	-0.3107	10	0.72032	D	0.01	-4.5609	15.8903	0.79293	1.0:0.0:0.0:0.0	.	145	Q96L03	SPT17_HUMAN	G	145	ENSP00000355900:E145G	ENSP00000355900:E145G	E	+	2	0	SPATA17	215981978	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.077000	0.64419	2.223000	0.72356	0.533000	0.62120	GAA		0.403	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796		32	29	32	29
TRIM58	25893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	248039522	248039522	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:248039522C>T	ENST00000366481.3	+	6	1240	c.1192C>T	c.(1192-1194)Cca>Tca	p.P398S	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	398	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCTTGCCTCCCCATCAGTGCC	0.512																																																0													140.0	143.0	142.0					1																	248039522		2203	4300	6503	SO:0001583	missense	25893			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1192C>T	1.37:g.248039522C>T	ENSP00000355437:p.Pro398Ser		Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	C	3.676	-0.066469	0.07273	.	.	ENSG00000162722	ENST00000366481	T	0.69435	-0.4	4.05	3.13	0.36017	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.225320	0.31809	N	0.007035	T	0.66538	0.2799	L	0.35487	1.065	0.40730	D	0.982732	D	0.56521	0.976	P	0.59357	0.856	T	0.65146	-0.6239	10	0.45353	T	0.12	.	9.2219	0.37382	0.0:0.8111:0.0:0.1889	.	398	Q8NG06	TRI58_HUMAN	S	398	ENSP00000355437:P398S	ENSP00000355437:P398S	P	+	1	0	TRIM58	246106145	0.348000	0.24861	0.035000	0.18076	0.006000	0.05464	2.089000	0.41672	0.688000	0.31529	-0.813000	0.03139	CCA		0.512	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431		25	202	25	202
JPH2	57158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	42788430	42788430	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr20:42788430C>T	ENST00000372980.3	-	2	1869	c.997G>A	c.(997-999)Gac>Aac	p.D333N		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	333					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CGGTGGCCGTCGGGCAGCGTG	0.662																																																0													43.0	37.0	39.0					20																	42788430		2203	4299	6502	SO:0001583	missense	57158			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.997G>A	20.37:g.42788430C>T	ENSP00000362071:p.Asp333Asn		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	ENST00000372980.3	37	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	c	25.4	4.632685	0.87660	.	.	ENSG00000149596	ENST00000372980	T	0.58797	0.31	3.12	2.16	0.27623	.	0.115168	0.56097	N	0.000022	T	0.49440	0.1557	L	0.46614	1.455	0.80722	D	1	D	0.55172	0.97	B	0.44315	0.446	T	0.44651	-0.9314	10	0.42905	T	0.14	.	9.776	0.40618	0.0:0.8956:0.0:0.1044	.	333	Q9BR39	JPH2_HUMAN	N	333	ENSP00000362071:D333N	ENSP00000362071:D333N	D	-	1	0	JPH2	42221844	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.811000	0.47986	0.492000	0.27815	0.306000	0.20318	GAC		0.662	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1			45	32	45	32
KRTAP20-2	337976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	32007647	32007647	+	Missense_Mutation	SNP	A	A	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr21:32007647A>G	ENST00000330798.2	+	1	93	c.65A>G	c.(64-66)tAt>tGt	p.Y22C		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	22						intermediate filament (GO:0005882)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						GGCGGTGGCTATGGCTGTGGC	0.562																																																0													203.0	161.0	175.0					21																	32007647		2203	4300	6503	SO:0001583	missense	337976			AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.65A>G	21.37:g.32007647A>G	ENSP00000330746:p.Tyr22Cys			Missense_Mutation	SNP	ENST00000330798.2	37	CCDS13604.1	.	.	.	.	.	.	.	.	.	.	A	4.235	0.042582	0.08196	.	.	ENSG00000184032	ENST00000330798	T	0.14391	2.51	4.18	-1.16	0.09678	.	.	.	.	.	T	0.09069	0.0224	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.34976	-0.9807	8	0.87932	D	0	.	3.2727	0.06888	0.472:0.0:0.3452:0.1827	.	22	Q3LI61	KR202_HUMAN	C	22	ENSP00000330746:Y22C	ENSP00000330746:Y22C	Y	+	2	0	KRTAP20-2	30929518	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.318000	0.02705	-0.281000	0.09141	-1.426000	0.01102	TAT		0.562	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128238.3			77	80	77	80
COL5A2	1290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	189933563	189933563	+	Silent	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr2:189933563C>T	ENST00000374866.3	-	19	1480	c.1206G>A	c.(1204-1206)ggG>ggA	p.G402G		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	402					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CACCTCTCTGCCCCTGAGGAC	0.502																																																0													30.0	36.0	34.0					2																	189933563		2203	4300	6503	SO:0001819	synonymous_variant	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1206G>A	2.37:g.189933563C>T			P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	CCDS33350.1																																																																																				0.502	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		20	32	20	32
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His		Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			70	66	70	66
IRS1	3667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	227661149	227661149	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr2:227661149C>T	ENST00000305123.5	-	1	3326	c.2306G>A	c.(2305-2307)aGa>aAa	p.R769K	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	769					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CTTAAAGGATCTTGGCAATGA	0.627																																																0													132.0	151.0	145.0					2																	227661149		2203	4300	6503	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2306G>A	2.37:g.227661149C>T	ENSP00000304895:p.Arg769Lys			Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029283	0.54790	.	.	ENSG00000169047	ENST00000305123	D	0.83250	-1.7	4.85	4.85	0.62838	.	0.119094	0.41396	D	0.000888	D	0.86481	0.5943	L	0.55213	1.73	0.33996	D	0.649703	D	0.67145	0.996	P	0.57620	0.824	D	0.87135	0.2199	10	0.23302	T	0.38	-6.8812	18.1615	0.89709	0.0:1.0:0.0:0.0	.	769	P35568	IRS1_HUMAN	K	769	ENSP00000304895:R769K	ENSP00000304895:R769K	R	-	2	0	IRS1	227369393	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.397000	0.59690	2.526000	0.85167	0.561000	0.74099	AGA		0.627	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		184	228	184	228
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	38768259	38768259	+	Silent	SNP	T	T	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr3:38768259T>C	ENST00000449082.2	-	16	2924	c.2925A>G	c.(2923-2925)caA>caG	p.Q975Q		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	975					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CTCTGGGAGCTTGGAGCCCTC	0.577																																																0													63.0	64.0	64.0					3																	38768259		2203	4300	6503	SO:0001819	synonymous_variant	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2925A>G	3.37:g.38768259T>C			A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																				0.577	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		31	48	31	48
FGFRL1	53834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	1018108	1018108	+	Missense_Mutation	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr4:1018108G>A	ENST00000398484.2	+	7	1308	c.728G>A	c.(727-729)cGt>cAt	p.R243H	FGFRL1_ENST00000264748.6_Missense_Mutation_p.R243H|FGFRL1_ENST00000504138.1_Missense_Mutation_p.R243H|FGFRL1_ENST00000510644.1_Missense_Mutation_p.R243H			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	243					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)	p.R213L(2)|p.R243L(2)		endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GAGCGGACCCGTTCCAAGCCC	0.711																																																4	Substitution - Missense(4)	lung(4)											41.0	39.0	40.0					4																	1018108		2199	4279	6478	SO:0001583	missense	53834				CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.728G>A	4.37:g.1018108G>A	ENSP00000381498:p.Arg243His		B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	g	22.3	4.277289	0.80580	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000264748	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.24	5.24	0.73138	.	0.166361	0.52532	D	0.000071	T	0.70378	0.3217	L	0.39397	1.21	0.52099	D	0.999944	D	0.60575	0.988	P	0.48571	0.582	T	0.74346	-0.3695	10	0.62326	D	0.03	-35.1573	17.8483	0.88737	0.0:0.0:1.0:0.0	.	243	Q8N441	FGRL1_HUMAN	H	243;213;243;243;243	ENSP00000381498:R243H;ENSP00000425025:R243H;ENSP00000423091:R243H;ENSP00000264748:R243H	ENSP00000264748:R243H	R	+	2	0	FGFRL1	1008108	0.991000	0.36638	0.999000	0.59377	0.641000	0.38312	3.172000	0.50832	2.461000	0.83175	0.567000	0.79289	CGT		0.711	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923		45	57	45	57
EVC2	132884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	5586352	5586352	+	Missense_Mutation	SNP	G	G	A	rs139610006		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr4:5586352G>A	ENST00000344408.5	-	17	3108	c.3055C>T	c.(3055-3057)Cgg>Tgg	p.R1019W	EVC2_ENST00000344938.1_Missense_Mutation_p.R1019W|EVC2_ENST00000310917.2_Missense_Mutation_p.R939W	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1019					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GCACTCACCCGGCTGTGCGAC	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17748	0.0		0.0	False		,,,				2504	0.0															0								G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	38.0	40.0	39.0		2815,3055	3.2	1.0	4	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EVC2	NM_001166136.1,NM_147127.4	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	939/1229,1019/1309	5586352	1,13005	2203	4300	6503	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3055C>T	4.37:g.5586352G>A	ENSP00000342144:p.Arg1019Trp		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.49	2.848538	0.51164	0.0	1.16E-4	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74421	-0.84;-0.83;-0.83	4.98	3.22	0.36961	.	0.326796	0.28700	N	0.014427	T	0.59891	0.2227	N	0.08118	0	0.25523	N	0.987349	D	0.67145	0.996	P	0.49637	0.617	T	0.55592	-0.8117	10	0.66056	D	0.02	-21.2531	9.0374	0.36296	0.1837:0.0:0.8163:0.0	.	1019	Q86UK5	LBN_HUMAN	W	1019;939;1019	ENSP00000339954:R1019W;ENSP00000311683:R939W;ENSP00000342144:R1019W	ENSP00000311683:R939W	R	-	1	2	EVC2	5637253	1.000000	0.71417	0.998000	0.56505	0.256000	0.26092	2.348000	0.44045	1.231000	0.43661	0.543000	0.68304	CGG		0.602	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		12	14	12	14
STPG2	285555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	99030425	99030425	+	Missense_Mutation	SNP	C	C	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr4:99030425C>A	ENST00000295268.3	-	4	508	c.419G>T	c.(418-420)gGt>gTt	p.G140V		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	140																	AAAATGTATACCTTTGTATTT	0.313																																																0													62.0	62.0	62.0					4																	99030425		2203	4298	6501	SO:0001583	missense	285555			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.419G>T	4.37:g.99030425C>A	ENSP00000295268:p.Gly140Val			Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954259	0.73902	.	.	ENSG00000163116	ENST00000295268	T	0.37411	1.2	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62709	-0.6797	10	0.87932	D	0	-21.364	18.0778	0.89433	0.0:1.0:0.0:0.0	.	140	Q8N412	CD037_HUMAN	V	140	ENSP00000295268:G140V	ENSP00000295268:G140V	G	-	2	0	C4orf37	99249448	0.998000	0.40836	0.991000	0.47740	0.927000	0.56198	5.125000	0.64715	2.619000	0.88677	0.484000	0.47621	GGT		0.313	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952		31	57	31	57
MROH2B	133558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	41070936	41070936	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr5:41070936C>A	ENST00000399564.4	-	1	469	c.19G>T	c.(19-21)Gaa>Taa	p.E7*		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	7								p.E7*(1)									CCTATGGATTCCTCTGTACTA	0.423																																																1	Substitution - Nonsense(1)	lung(1)											95.0	90.0	92.0					5																	41070936		1920	4120	6040	SO:0001587	stop_gained	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.19G>T	5.37:g.41070936C>A	ENSP00000382476:p.Glu7*		Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	38	7.200541	0.98132	.	.	ENSG00000171495	ENST00000399564	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	14.3311	0.66556	0.0:1.0:0.0:0.0	.	.	.	.	X	7	.	ENSP00000382476:E7X	E	-	1	0	HEATR7B2	41106693	0.786000	0.28738	0.464000	0.27143	0.019000	0.09904	1.975000	0.40569	2.771000	0.95319	0.591000	0.81541	GAA		0.423	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		7	12	7	12
HLA-DOA	3111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	32974943	32974943	+	Silent	SNP	A	A	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr6:32974943A>G	ENST00000229829.5	-	4	738	c.663T>C	c.(661-663)tgT>tgC	p.C221C	HLA-DOA_ENST00000450833.2_Intron|HLA-DOA_ENST00000495532.1_5'Flank	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	221					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						GGCCCAGGGCACAGACCAGGG	0.577																																																0													71.0	75.0	74.0					6																	32974943		2203	4300	6503	SO:0001819	synonymous_variant	3111			M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.663T>C	6.37:g.32974943A>G			Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Silent	SNP	ENST00000229829.5	37	CCDS4763.1																																																																																				0.577	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076426.2	NM_002119		51	83	51	83
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	51892645	51892645	+	Missense_Mutation	SNP	A	A	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr6:51892645A>G	ENST00000371117.3	-	31	3885	c.3610T>C	c.(3610-3612)Tgc>Cgc	p.C1204R	PKHD1_ENST00000340994.4_Missense_Mutation_p.C1204R	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1204	IPT/TIG 7.		C -> Y. {ECO:0000269|PubMed:12079288}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GACCCACAGCAAGGCTCGATG	0.413																																																0													67.0	67.0	67.0					6																	51892645		2203	4300	6503	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3610T>C	6.37:g.51892645A>G	ENSP00000360158:p.Cys1204Arg		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.021923	0.54576	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.75589	-0.95;-0.95	5.71	5.71	0.89125	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63189	0.2490	L	0.47190	1.495	0.58432	D	0.999999	D;P	0.56521	0.976;0.817	P;P	0.50049	0.629;0.524	T	0.63242	-0.6681	10	0.12430	T	0.62	.	15.1592	0.72767	1.0:0.0:0.0:0.0	.	1204;1204	P08F94-2;P08F94	.;PKHD1_HUMAN	R	1204	ENSP00000360158:C1204R;ENSP00000341097:C1204R	ENSP00000341097:C1204R	C	-	1	0	PKHD1	52000604	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	2.700000	0.47085	2.171000	0.68590	0.533000	0.62120	TGC		0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		38	77	38	77
WBSCR17	64409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	71135022	71135022	+	Missense_Mutation	SNP	G	G	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr7:71135022G>C	ENST00000333538.5	+	8	1966	c.1332G>C	c.(1330-1332)aaG>aaC	p.K444N	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	444					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TAAAGTGTAAGAATTTCCAGT	0.438																																																0													154.0	152.0	153.0					7																	71135022		2203	4300	6503	SO:0001583	missense	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1332G>C	7.37:g.71135022G>C	ENSP00000329654:p.Lys444Asn		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817200	0.70912	.	.	ENSG00000185274	ENST00000333538	T	0.55930	0.49	4.85	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.71134	0.3304	M	0.90425	3.115	0.80722	D	1	D	0.63046	0.992	P	0.58660	0.843	T	0.77056	-0.2729	10	0.62326	D	0.03	.	11.1396	0.48394	0.1534:0.0:0.8466:0.0	.	444	Q6IS24	GLTL3_HUMAN	N	444	ENSP00000329654:K444N	ENSP00000329654:K444N	K	+	3	2	WBSCR17	70772958	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.219000	0.32479	2.238000	0.73509	0.591000	0.81541	AAG		0.438	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		73	127	73	127
ADAM28	10863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	24151678	24151678	+	Missense_Mutation	SNP	C	C	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr8:24151678C>G	ENST00000265769.4	+	1	126	c.16C>G	c.(16-18)Ctg>Gtg	p.L6V	ADAM28_ENST00000540823.1_5'UTR|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.L6V|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000397649.3_5'UTR	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	6					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GCAAGGTCTCCTGCCAGTCAG	0.498																																					NSCLC(193;488 2149 22258 34798 40734)											0													229.0	204.0	212.0					8																	24151678		2203	4300	6503	SO:0001583	missense	10863			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.16C>G	8.37:g.24151678C>G	ENSP00000265769:p.Leu6Val		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	CCDS34865.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332309	0.41297	.	.	ENSG00000042980	ENST00000265769;ENST00000437154	T;T	0.02032	4.72;4.49	4.62	0.554	0.17241	.	.	.	.	.	T	0.03871	0.0109	M	0.81802	2.56	0.20307	N	0.999917	B;B	0.17038	0.02;0.008	B;B	0.13407	0.007;0.009	T	0.32745	-0.9895	9	0.48119	T	0.1	.	4.9444	0.13982	0.0:0.4738:0.3346:0.1916	.	6;6	Q9UKQ2;Q9UKQ2-2	ADA28_HUMAN;.	V	6	ENSP00000265769:L6V;ENSP00000393699:L6V	ENSP00000265769:L6V	L	+	1	2	ADAM28	24207623	0.003000	0.15002	0.005000	0.12908	0.071000	0.16799	0.826000	0.27407	-0.006000	0.14370	0.591000	0.81541	CTG		0.498	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778		105	116	105	116
HAUS6	54801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	19093264	19093264	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr9:19093264G>C	ENST00000380502.3	-	4	808	c.341C>G	c.(340-342)tCa>tGa	p.S114*	HAUS6_ENST00000380496.1_5'Flank	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	114					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AAGAAATAGTGAACCAACAAC	0.313																																																0													64.0	58.0	60.0					9																	19093264		2203	4298	6501	SO:0001587	stop_gained	54801			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.341C>G	9.37:g.19093264G>C	ENSP00000369871:p.Ser114*		B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Nonsense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	G	42	9.736719	0.99251	.	.	ENSG00000147874	ENST00000380502	.	.	.	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.3656	15.5084	0.75760	0.0:0.0:1.0:0.0	.	.	.	.	X	114	.	ENSP00000369871:S114X	S	-	2	0	HAUS6	19083264	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.625000	0.74248	2.236000	0.73375	0.563000	0.77884	TCA		0.313	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645		8	39	8	39
CNTNAP3	79937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	39140572	39140572	+	Missense_Mutation	SNP	A	A	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr9:39140572A>C	ENST00000297668.6	-	12	1893	c.1820T>G	c.(1819-1821)aTt>aGt	p.I607S	CNTNAP3_ENST00000323947.7_Missense_Mutation_p.I514S|CNTNAP3_ENST00000377659.1_Missense_Mutation_p.I607S|CNTNAP3_ENST00000377656.2_Missense_Mutation_p.I607S|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.I519S	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	607	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ATCTGCATCAATATAGTAAAG	0.453																																																0													47.0	53.0	51.0					9																	39140572		2203	4300	6503	SO:0001583	missense	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1820T>G	9.37:g.39140572A>C	ENSP00000297668:p.Ile607Ser		B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	37	CCDS6616.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932219	0.52866	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000323947;ENST00000377659	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	2.85	2.85	0.33270	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (5);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	.	.	.	.	T	0.67924	0.2945	H	0.95574	3.69	0.09310	N	1	P;D;D;D;D	0.76494	0.952;0.963;0.999;0.997;0.963	P;P;D;D;P	0.74023	0.521;0.852;0.982;0.91;0.842	T	0.59289	-0.7482	9	0.87932	D	0	.	10.1498	0.42786	1.0:0.0:0.0:0.0	.	514;607;607;607;607	E2QRH2;Q96NU0;Q9BZ76-2;A6NC89;Q9BZ76	.;CNT3B_HUMAN;.;.;CNTP3_HUMAN	S	607;607;519;514;607	ENSP00000297668:I607S;ENSP00000366884:I607S;ENSP00000350863:I519S;ENSP00000320728:I514S;ENSP00000366887:I607S	ENSP00000297668:I607S	I	-	2	0	CNTNAP3	39130572	1.000000	0.71417	0.007000	0.13788	0.729000	0.41735	7.878000	0.87231	1.304000	0.44892	0.361000	0.22055	ATT		0.453	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655		42	46	42	46
OR1N2	138882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	125316257	125316257	+	Missense_Mutation	SNP	G	G	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr9:125316257G>T	ENST00000373688.2	+	1	867	c.809G>T	c.(808-810)gGg>gTg	p.G270V		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CTCTTCTATGGGTCTCTTATG	0.473																																																0													227.0	230.0	229.0					9																	125316257		2203	4300	6503	SO:0001583	missense	138882				CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.809G>T	9.37:g.125316257G>T	ENSP00000362792:p.Gly270Val		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	ENST00000373688.2	37	CCDS35123.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131315	0.37630	.	.	ENSG00000171501	ENST00000373688	T	0.35605	1.3	4.56	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.138036	0.32819	N	0.005604	T	0.49745	0.1575	M	0.76002	2.32	0.21697	N	0.999586	P	0.39862	0.692	P	0.48921	0.595	T	0.48479	-0.9032	10	0.72032	D	0.01	.	13.188	0.59693	0.0:0.0:0.8393:0.1607	.	270	Q8NGR9	OR1N2_HUMAN	V	270	ENSP00000362792:G270V	ENSP00000362792:G270V	G	+	2	0	OR1N2	124356078	0.000000	0.05858	0.212000	0.23672	0.842000	0.47809	-0.121000	0.10643	1.148000	0.42385	0.644000	0.83932	GGG		0.473	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			50	57	50	57
FANCB	2187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	14863149	14863149	+	Missense_Mutation	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chrX:14863149G>A	ENST00000324138.3	-	7	1909	c.1756C>T	c.(1756-1758)Cca>Tca	p.P586S	FANCB_ENST00000398334.1_Missense_Mutation_p.P586S	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	586					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					GTTAAAAGTGGTGAAAGAGAT	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							0													126.0	114.0	118.0					X																	14863149		2203	4300	6503	SO:0001583	missense	2187	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1756C>T	X.37:g.14863149G>A	ENSP00000326819:p.Pro586Ser		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	37	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972201	0.74246	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.5	5.5	0.81552	.	0.120769	0.56097	D	0.000028	T	0.68201	0.2975	L	0.34521	1.04	0.45541	D	0.998498	D	0.89917	1.0	D	0.97110	1.0	T	0.71794	-0.4485	9	0.87932	D	0	-13.8641	17.256	0.87056	0.0:0.0:1.0:0.0	.	586	Q8NB91	FANCB_HUMAN	S	586	.	ENSP00000326819:P586S	P	-	1	0	FANCB	14773070	1.000000	0.71417	0.765000	0.31456	0.962000	0.63368	4.883000	0.63128	2.286000	0.76751	0.594000	0.82650	CCA		0.388	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		87	15	87	15
GRPR	2925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	16170454	16170454	+	Missense_Mutation	SNP	C	C	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chrX:16170454C>A	ENST00000380289.2	+	3	1239	c.841C>A	c.(841-843)Cat>Aat	p.H281N	RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000435789.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	281					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					GCTCCCCAATCATGTCATCTA	0.547																																																0													153.0	129.0	137.0					X																	16170454		2203	4300	6503	SO:0001583	missense	2925				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.841C>A	X.37:g.16170454C>A	ENSP00000369643:p.His281Asn		B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	CCDS14174.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195592	0.78902	.	.	ENSG00000126010	ENST00000380289;ENST00000535371	T	0.38077	1.16	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57902	0.2085	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54111	-0.8342	10	0.33940	T	0.23	-12.9196	17.2579	0.87062	0.0:1.0:0.0:0.0	.	281	P30550	GRPR_HUMAN	N	281;70	ENSP00000369643:H281N	ENSP00000369643:H281N	H	+	1	0	GRPR	16080375	1.000000	0.71417	0.961000	0.40146	0.718000	0.41266	7.487000	0.81328	2.287000	0.76781	0.600000	0.82982	CAT		0.547	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		182	24	182	24
ZNF609	23060	broad.mit.edu;ucsc.edu	37	15	64966267	64966267	+	Missense_Mutation	SNP	C	C	G			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr15:64966267C>G	ENST00000326648.3	+	4	1342	c.1214C>G	c.(1213-1215)gCc>gGc	p.A405G	RNU6-549P_ENST00000384433.1_RNA|ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	405						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGGGCAGGAGCCAATAGCAAA	0.567																																																0													92.0	92.0	92.0					15																	64966267		2203	4299	6502	SO:0001583	missense	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1214C>G	15.37:g.64966267C>G	ENSP00000316527:p.Ala405Gly		Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240206	0.58995	.	.	ENSG00000180357	ENST00000326648	T	0.50813	0.73	5.55	5.55	0.83447	.	0.247478	0.48767	N	0.000174	T	0.45316	0.1336	L	0.38175	1.15	0.58432	D	0.999992	P	0.35033	0.481	B	0.38500	0.275	T	0.27938	-1.0059	10	0.32370	T	0.25	-1.4922	19.5145	0.95157	0.0:1.0:0.0:0.0	.	405	O15014	ZN609_HUMAN	G	405	ENSP00000316527:A405G	ENSP00000316527:A405G	A	+	2	0	ZNF609	62753320	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.802000	0.62539	2.608000	0.88229	0.650000	0.86243	GCC		0.567	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		75	121	75	121
SVEP1	79987	broad.mit.edu;ucsc.edu	37	9	113275228	113275228	+	Silent	SNP	G	G	A			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr9:113275228G>A	ENST00000401783.2	-	5	1617	c.1281C>T	c.(1279-1281)tcC>tcT	p.S427S	SVEP1_ENST00000374461.1_Silent_p.S404S|SVEP1_ENST00000302728.8_Silent_p.S427S|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Silent_p.S404S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	427	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTCTGAACCGGACCACAAAC	0.443																																																0													102.0	96.0	98.0					9																	113275228		1940	4139	6079	SO:0001819	synonymous_variant	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1281C>T	9.37:g.113275228G>A			Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	37	CCDS48004.1																																																																																				0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				36	61	36	61
OR2L2	26246	broad.mit.edu;ucsc.edu	37	1	248202456	248202456	+	Missense_Mutation	SNP	T	T	C			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr1:248202456T>C	ENST00000366479.2	+	1	983	c.887T>C	c.(886-888)gTg>gCg	p.V296A	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AACAAGGAGGTGATGGGGGCC	0.463																																																0													77.0	76.0	76.0					1																	248202456		2203	4300	6503	SO:0001583	missense	26246			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.887T>C	1.37:g.248202456T>C	ENSP00000355435:p.Val296Ala		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	15.20	2.761779	0.49468	.	.	ENSG00000203663	ENST00000366479	T	0.39592	1.07	1.9	1.9	0.25705	.	.	.	.	.	T	0.59101	0.2169	M	0.71296	2.17	0.30453	N	0.775028	D	0.89917	1.0	D	0.74348	0.983	T	0.57763	-0.7755	9	0.87932	D	0	.	9.0367	0.36291	0.0:0.0:0.0:1.0	.	296	Q8NH16	OR2L2_HUMAN	A	296	ENSP00000355435:V296A	ENSP00000355435:V296A	V	+	2	0	OR2L2	246269079	0.357000	0.24938	0.976000	0.42696	0.587000	0.36485	3.797000	0.55514	0.746000	0.32786	0.163000	0.16589	GTG		0.463	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		68	87	68	87
HAUS6	54801	broad.mit.edu;ucsc.edu	37	9	19093229	19093229	+	Missense_Mutation	SNP	G	G	A	rs151253216		TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr9:19093229G>A	ENST00000380502.3	-	4	843	c.376C>T	c.(376-378)Cat>Tat	p.H126Y	HAUS6_ENST00000380496.1_5'Flank	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	126					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.H126Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TACATCAGATGAATAAACTTA	0.294																																																1	Substitution - Missense(1)	lung(1)						G	TYR/HIS	0,4406		0,0,2203	55.0	51.0	53.0		376	3.9	1.0	9	dbSNP_134	53	2,8594	2.2+/-6.3	0,2,4296	no	missense	HAUS6	NM_017645.3	83	0,2,6499	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	126/956	19093229	2,13000	2203	4298	6501	SO:0001583	missense	54801			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.376C>T	9.37:g.19093229G>A	ENSP00000369871:p.His126Tyr		B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.194335	0.58017	0.0	2.33E-4	ENSG00000147874	ENST00000380502	T	0.24538	1.85	4.87	3.91	0.45181	.	0.268624	0.41097	D	0.000955	T	0.48484	0.1502	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	T	0.54669	-0.8259	10	0.72032	D	0.01	-10.9298	14.3044	0.66375	0.0:0.1642:0.8358:0.0	.	126	Q7Z4H7	HAUS6_HUMAN	Y	126	ENSP00000369871:H126Y	ENSP00000369871:H126Y	H	-	1	0	HAUS6	19083229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.473000	0.53122	2.236000	0.73375	0.563000	0.77884	CAT		0.294	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645		4	29	4	29
AFP	174	broad.mit.edu;ucsc.edu	37	4	74316388	74316388	+	Missense_Mutation	SNP	C	C	T			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chr4:74316388C>T	ENST00000395792.2	+	11	1446	c.1346C>T	c.(1345-1347)gCc>gTc	p.A449V	AFP_ENST00000226359.2_Missense_Mutation_p.A449V	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	449	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGCTGATGGCCATCACCAGA	0.507									Alpha-Fetoprotein, Hereditary Persistence of																																							0													93.0	84.0	87.0					4																	74316388		2203	4300	6503	SO:0001583	missense	174	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1346C>T	4.37:g.74316388C>T	ENSP00000379138:p.Ala449Val		B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	C	6.957	0.546439	0.13312	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.72942	-0.7;-0.7	4.85	3.05	0.35203	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.859348	0.10384	N	0.681214	T	0.55689	0.1936	L	0.28274	0.84	0.09310	N	1	B;P	0.35793	0.379;0.521	B;B	0.35182	0.197;0.197	T	0.49899	-0.8890	10	0.66056	D	0.02	.	5.6004	0.17351	0.2037:0.6952:0.0:0.1011	.	291;449	B4DMX4;P02771	.;FETA_HUMAN	V	449	ENSP00000379138:A449V;ENSP00000226359:A449V	ENSP00000226359:A449V	A	+	2	0	AFP	74535252	0.000000	0.05858	0.008000	0.14137	0.282000	0.26991	0.386000	0.20702	0.696000	0.31696	0.655000	0.94253	GCC		0.507	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3			37	40	37	40
ATRX	546	broad.mit.edu;hgsc.bcm.edu	37	X	76937611	76937615	+	Frame_Shift_Del	DEL	CTTTT	CTTTT	-			TCGA-IK-7675-01A-11D-2086-08	TCGA-IK-7675-10A-01D-2086-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a78544d7-65c6-4778-af62-ceec24c14056	110272fc-ed7e-4515-84d7-5e7262cfc9a8	g.chrX:76937611_76937615delCTTTT	ENST00000373344.5	-	9	3347_3351	c.3133_3137delAAAAG	c.(3133-3138)aaaagtfs	p.KS1045fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.KS1007fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1045					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATTTTTTTACTTTTCTTTTCTCCA	0.337			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3133_3137delAAAAG	X.37:g.76937616_76937620delCTTTT	ENSP00000362441:p.Lys1045fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	ENST00000373344.5	37	CCDS14434.1																																																																																				0.337	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		35	19	35	19
