#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AADAC	13	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	151545693	151545693	+	Nonsense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:151545693T>G	ENST00000232892.7	+	5	1059	c.933T>G	c.(931-933)taT>taG	p.Y311*	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	311					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CTAAAAAATATCCAGGGTTCC	0.418																																					p.Y311X	Ovarian(30;839 841 2699 32801 46334)	.											.	AADAC	280	0			c.T933G						.						46.0	46.0	46.0					3																	151545693		2203	4300	6503	SO:0001587	stop_gained	13	exon5			AAAATATCCAGGG	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.933T>G	3.37:g.151545693T>G	ENSP00000232892:p.Tyr311*	65.0	0.0		55.0	17.0	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Nonsense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577070	0.86645	.	.	ENSG00000114771	ENST00000232892	.	.	.	4.81	-4.0	0.04057	.	0.581521	0.18265	N	0.146491	.	.	.	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.2852	14.216	0.65792	0.0:0.6926:0.0:0.3074	.	.	.	.	X	311	.	ENSP00000232892:Y311X	Y	+	3	2	AADAC	153028383	0.709000	0.27886	0.084000	0.20598	0.990000	0.78478	-0.243000	0.08915	-0.723000	0.04915	0.482000	0.46254	TAT	.		0.418	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
AASDH	132949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57204730	57204730	+	Silent	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:57204730C>A	ENST00000205214.6	-	15	3315	c.3135G>T	c.(3133-3135)ggG>ggT	p.G1045G	AASDH_ENST00000451613.1_3'UTR|AASDH_ENST00000434343.2_Silent_p.G560G|AASDH_ENST00000513376.1_Silent_p.G945G	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1045					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TCCACACTTTCCCATCAGTAG	0.433																																					p.G1045G		.											.	AASDH	94	0			c.G3135T						.						83.0	78.0	80.0					4																	57204730		2203	4300	6503	SO:0001819	synonymous_variant	132949	exon15			CACTTTCCCATCA	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.3135G>T	4.37:g.57204730C>A		201.0	0.0		222.0	54.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	ENST00000205214.6	37	CCDS3504.1																																																																																			.		0.433	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48318705	48318705	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:48318705T>A	ENST00000435803.1	+	18	7938	c.7914T>A	c.(7912-7914)atT>atA	p.I2638I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2638					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGAAGAAATTGCTGAATTTT	0.323																																					p.I2638I		.											.	ABCA13	521	0			c.T7914A						.						34.0	33.0	33.0					7																	48318705		1812	4070	5882	SO:0001819	synonymous_variant	154664	exon18			AGAAATTGCTGAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7914T>A	7.37:g.48318705T>A		65.0	0.0		74.0	19.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.323	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCC8	6833	broad.mit.edu;mdanderson.org	37	11	17430046	17430046	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:17430046C>A	ENST00000389817.3	-	23	2781	c.2713G>T	c.(2713-2715)Ggc>Tgc	p.G905C	ABCC8_ENST00000302539.4_Missense_Mutation_p.G906C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	905	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TGGATGGTGCCATCCTTCATG	0.537																																					p.G905C		.											.	ABCC8	91	0			c.G2713T						.						121.0	116.0	118.0					11																	17430046		2200	4293	6493	SO:0001583	missense	6833	exon23			TGGTGCCATCCTT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2713G>T	11.37:g.17430046C>A	ENSP00000374467:p.Gly905Cys	28.0	1.0		47.0	6.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896651	0.91962	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.98987	-5.3;-5.3	6.04	6.04	0.98038	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	H	0.99312	4.51	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.97492	1.0054	10	0.87932	D	0	.	18.7754	0.91910	0.0:1.0:0.0:0.0	.	905	Q09428	ABCC8_HUMAN	C	905;906;909	ENSP00000374467:G905C;ENSP00000303960:G906C	ENSP00000303960:G906C	G	-	1	0	ABCC8	17386622	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.482000	0.81143	2.873000	0.98535	0.563000	0.77884	GGC	.		0.537	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
ACVR1B	91	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52374781	52374782	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:52374781_52374782GG>TT	ENST00000257963.4	+	4	686_687	c.609_610GG>TT	c.(607-612)gtGGcc>gtTTcc	p.A204S	ACVR1B_ENST00000541224.1_Missense_Mutation_p.A204S|ACVR1B_ENST00000542485.1_Missense_Mutation_p.A152S|ACVR1B_ENST00000426655.2_Missense_Mutation_p.A204S|ACVR1B_ENST00000415850.2_Missense_Mutation_p.A204S	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	204	GS. {ECO:0000255|PROSITE- ProRule:PRU00585}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	AGCGCACAGTGGCCCGAACCAT	0.485											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V203V|p.A204S		.											.	ACVR1B	1015	0			c.G609T|c.G610T						.																																			SO:0001583	missense	91	exon4			CACAGTGGCCCGA|ACAGTGGCCCGAA		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	Exception_encountered	12.37:g.52374781_52374782delinsTT	ENSP00000257963:p.Ala204Ser	100.0	1.0|0.0	984	125.0|122.0	36.0|34.0	NM_020328	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Silent|Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1																																																																																			.		0.485	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
AGAP7P	653268	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	51464927	51464927	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:51464927G>A	ENST00000374095.5	-	7	1654	c.1529C>T	c.(1528-1530)tCa>tTa	p.S510L		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		510	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						GCCAATAGATGACATAACCTT	0.552																																					p.S510L		.											.	.	.	0			c.C1529T						.						42.0	52.0	49.0					10																	51464927		2195	4293	6488	SO:0001583	missense	653268	exon7			ATAGATGACATAA																												ENST00000374095.5:c.1529C>T	10.37:g.51464927G>A	ENSP00000363208:p.Ser510Leu	220.0	1.0		251.0	40.0	NM_001077685	A6NGH4	Missense_Mutation	SNP	ENST00000374095.5	37	CCDS41524.1	.	.	.	.	.	.	.	.	.	.	.	0.680	-0.798388	0.02841	.	.	ENSG00000204169	ENST00000374095	T	0.41758	0.99	.	.	.	.	0.128567	0.53938	N	0.000057	T	0.14184	0.0343	N	0.04686	-0.185	0.29206	N	0.874886	B	0.02656	0.0	B	0.06405	0.002	T	0.19257	-1.0311	9	0.13853	T	0.58	.	4.5675	0.12193	0.3181:0.0:0.6819:0.0	.	510	Q5VUJ5	AGAP7_HUMAN	L	510	ENSP00000363208:S510L	ENSP00000363208:S510L	S	-	2	0	AGAP7	51134933	0.974000	0.33945	0.010000	0.14722	0.010000	0.07245	4.848000	0.62874	-1.351000	0.02197	-1.360000	0.01215	TCA	.		0.552	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048033.1		
AKAP1	8165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	55187484	55187484	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:55187484G>T	ENST00000337714.3	+	3	2046	c.1813G>T	c.(1813-1815)Gtc>Ttc	p.V605F	AKAP1_ENST00000572557.1_Missense_Mutation_p.V605F|AKAP1_ENST00000571629.1_Missense_Mutation_p.V605F|AKAP1_ENST00000539273.1_Missense_Mutation_p.V605F	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	605					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					CCCTAAGAAGGTCGACCTCAT	0.567																																					p.V605F		.											.	AKAP1	227	0			c.G1813T						.						94.0	91.0	92.0					17																	55187484		2203	4300	6503	SO:0001583	missense	8165	exon4			AAGAAGGTCGACC	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1813G>T	17.37:g.55187484G>T	ENSP00000337736:p.Val605Phe	59.0	0.0		60.0	17.0	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.498453	0.64298	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	T;T	0.63255	-0.03;-0.03	5.18	5.18	0.71444	.	0.235917	0.34802	N	0.003673	T	0.60353	0.2262	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	P	0.59221	0.854	T	0.63386	-0.6649	10	0.56958	D	0.05	-23.2636	10.6762	0.45787	0.0:0.1414:0.7122:0.1464	.	605	Q92667	AKAP1_HUMAN	F	605;647;605	ENSP00000337736:V605F;ENSP00000443139:V605F	ENSP00000337736:V605F	V	+	1	0	AKAP1	52542483	0.998000	0.40836	1.000000	0.80357	0.970000	0.65996	1.354000	0.34056	2.426000	0.82243	0.655000	0.94253	GTC	.		0.567	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
AKAP4	8852	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49955717	49955717	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:49955717A>T	ENST00000376056.2	-	6	2574	c.2424T>A	c.(2422-2424)agT>agA	p.S808R	AKAP4_ENST00000358526.2_Missense_Mutation_p.S817R|AKAP4_ENST00000376064.3_Missense_Mutation_p.S808R|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.S434R					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GACCTCCTACACTGTACCCCT	0.512																																					p.S817R		.											.	AKAP4	540	0			c.T2451A						.						214.0	176.0	189.0					X																	49955717		2203	4300	6503	SO:0001583	missense	8852	exon6			TCCTACACTGTAC	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2424T>A	X.37:g.49955717A>T	ENSP00000365224:p.Ser808Arg	67.0	1.0		73.0	32.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683309	0.68157	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	4.78	-5.66	0.02451	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.64402	D	0.000008	T	0.28101	0.0693	M	0.77820	2.39	0.27754	N	0.944059	B;D	0.89917	0.01;1.0	B;D	0.91635	0.01;0.999	T	0.02196	-1.1197	9	.	.	.	-4.6632	9.0496	0.36367	0.2724:0.1387:0.5889:0.0	.	817;434	Q5JQC9;A6ND82	AKAP4_HUMAN;.	R	808;434;817;808	ENSP00000365224:S808R;ENSP00000365226:S434R;ENSP00000351327:S817R;ENSP00000365232:S808R	.	S	-	3	2	AKAP4	49842457	0.005000	0.15991	0.964000	0.40570	0.993000	0.82548	-1.865000	0.01649	-1.035000	0.03291	0.425000	0.28330	AGT	.		0.512	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
AKAP6	9472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	33293092	33293092	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:33293092A>G	ENST00000280979.4	+	13	6243	c.6073A>G	c.(6073-6075)Aac>Gac	p.N2025D	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2025					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACTTGAACAAAACGGAACAGA	0.423																																					p.N2025D	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6	733	0			c.A6073G						.						89.0	85.0	86.0					14																	33293092		2203	4300	6503	SO:0001583	missense	9472	exon13			GAACAAAACGGAA	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6073A>G	14.37:g.33293092A>G	ENSP00000280979:p.Asn2025Asp	32.0	0.0		36.0	7.0	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085351	0.55861	.	.	ENSG00000151320	ENST00000280979	T	0.06068	3.35	6.11	6.11	0.99139	.	0.298172	0.35495	N	0.003170	T	0.09158	0.0226	L	0.60455	1.87	0.80722	D	1	P	0.34462	0.454	B	0.27262	0.078	T	0.02294	-1.1181	10	0.72032	D	0.01	-12.7363	15.2732	0.73723	1.0:0.0:0.0:0.0	.	2025	Q13023	AKAP6_HUMAN	D	2025	ENSP00000280979:N2025D	ENSP00000280979:N2025D	N	+	1	0	AKAP6	32362843	0.244000	0.23889	0.920000	0.36463	0.814000	0.46013	2.643000	0.46604	2.343000	0.79666	0.533000	0.62120	AAC	.		0.423	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
ALAS1	211	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52240032	52240032	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:52240032G>A	ENST00000394965.2	+	7	1338	c.978G>A	c.(976-978)atG>atA	p.M326I	ALAS1_ENST00000469224.1_Missense_Mutation_p.M326I|ALAS1_ENST00000310271.2_Missense_Mutation_p.M326I|ALAS1_ENST00000484952.1_Missense_Mutation_p.M326I	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	326					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	TGGCTAAGATGATGCCAGGTA	0.488																																					p.M326I		.											.	ALAS1	93	0			c.G978A						.						131.0	122.0	125.0					3																	52240032		2203	4300	6503	SO:0001583	missense	211	exon7			TAAGATGATGCCA	X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.978G>A	3.37:g.52240032G>A	ENSP00000378416:p.Met326Ile	123.0	2.0		131.0	43.0	NM_000688		Missense_Mutation	SNP	ENST00000394965.2	37	CCDS2847.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778391	0.49786	.	.	ENSG00000023330	ENST00000469224;ENST00000394965;ENST00000310271;ENST00000484952	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	5.83	5.83	0.93111	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.035122	0.85682	D	0.000000	T	0.80571	0.4648	N	0.11000	0.08	0.80722	D	1	B;B	0.24186	0.099;0.099	B;B	0.25140	0.058;0.034	T	0.74934	-0.3495	10	0.15066	T	0.55	-25.8698	20.1005	0.97872	0.0:0.0:1.0:0.0	.	343;326	B4DVA0;P13196	.;HEM1_HUMAN	I	326	ENSP00000417719:M326I;ENSP00000378416:M326I;ENSP00000309259:M326I;ENSP00000418779:M326I	ENSP00000309259:M326I	M	+	3	0	ALAS1	52215072	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.859000	0.86982	2.758000	0.94735	0.467000	0.42956	ATG	.		0.488	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1		
ALB	213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74270094	74270094	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:74270094A>G	ENST00000295897.4	+	1	139	c.50A>G	c.(49-51)tAt>tGt	p.Y17C	ALB_ENST00000503124.1_5'UTR|ALB_ENST00000509063.1_Missense_Mutation_p.Y17C|ALB_ENST00000415165.2_Missense_Mutation_p.Y17C|ALB_ENST00000401494.3_Missense_Mutation_p.Y17C	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGCTCGGCTTATTCCAGGGGT	0.388																																					p.Y17C		.											.	ALB	96	0			c.A50G						.						137.0	128.0	131.0					4																	74270094		2203	4300	6503	SO:0001583	missense	213	exon1			CGGCTTATTCCAG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.50A>G	4.37:g.74270094A>G	ENSP00000295897:p.Tyr17Cys	350.0	1.0		361.0	63.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000295897.4	37	CCDS3555.1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064148	0.55432	.	.	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000415165;ENST00000329326;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.74315	-0.83;0.5;0.18;0.5;0.71	5.55	1.57	0.23409	.	0.682952	0.14352	N	0.325004	T	0.79851	0.4517	M	0.72479	2.2	0.20821	N	0.999849	D;D;D;D	0.71674	0.99;0.998;0.991;0.991	P;P;P;P	0.58077	0.832;0.829;0.706;0.706	T	0.68640	-0.5355	10	0.87932	D	0	-17.068	7.8602	0.29506	0.4971:0.3722:0.0:0.1307	.	17;17;17;17	B7WNR0;C9JKR2;A6NBZ8;P02768	.;.;.;ALBU_HUMAN	C	19;17;17;17;17;17;17	ENSP00000392541:Y19C;ENSP00000295897:Y17C;ENSP00000401820:Y17C;ENSP00000422784:Y17C;ENSP00000384695:Y17C	ENSP00000295897:Y17C	Y	+	2	0	ALB	74488958	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	1.099000	0.31013	0.127000	0.18452	0.533000	0.62120	TAT	.		0.388	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
ALDH3A1	218	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	19645392	19645392	+	Missense_Mutation	SNP	G	G	C	rs376168390		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:19645392G>C	ENST00000457500.2	-	4	943	c.614C>G	c.(613-615)aCc>aGc	p.T205S	ALDH3A1_ENST00000395555.3_Missense_Mutation_p.T205S|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.T132S|ALDH3A1_ENST00000225740.6_Missense_Mutation_p.T205S|ALDH3A1_ENST00000485231.1_5'Flank|ALDH3A1_ENST00000444455.1_Missense_Mutation_p.T205S	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	205					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		CGTGACAGGGGTCAGGTGCTT	0.632																																					p.T205S		.											.	ALDH3A1	228	0			c.C614G						.						152.0	107.0	122.0					17																	19645392		2203	4300	6503	SO:0001583	missense	218	exon4			ACAGGGGTCAGGT	M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.614C>G	17.37:g.19645392G>C	ENSP00000411821:p.Thr205Ser	90.0	1.0		124.0	29.0	NM_001135168	A8K828|Q9BT37	Missense_Mutation	SNP	ENST00000457500.2	37	CCDS11212.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794908	0.90453	.	.	ENSG00000108602	ENST00000225740;ENST00000395555;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844;ENST00000439102;ENST00000426645	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	4.49	4.49	0.54785	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.90559	0.7041	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93175	0.6569	10	0.87932	D	0	.	16.1757	0.81847	0.0:0.0:1.0:0.0	.	205;322;205	A8K828;Q8N9T9;P30838	.;.;AL3A1_HUMAN	S	205;205;263;205;205;132;205;205	ENSP00000225740:T205S;ENSP00000378923:T205S;ENSP00000388469:T205S;ENSP00000411821:T205S;ENSP00000389766:T205S	ENSP00000225740:T205S	T	-	2	0	ALDH3A1	19585984	1.000000	0.71417	0.981000	0.43875	0.974000	0.67602	9.081000	0.94049	2.068000	0.61886	0.462000	0.41574	ACC	.		0.632	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132265.4	NM_000691	
ANKRD30B	374860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	14850260	14850260	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr18:14850260T>C	ENST00000358984.4	+	35	3266	c.3086T>C	c.(3085-3087)tTa>tCa	p.L1029S		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1029										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GTCGATATATTAAAAGAAAAA	0.279																																					p.L1029S		.											.	ANKRD30B	24	0			c.T3086C						.						50.0	44.0	45.0					18																	14850260		692	1577	2269	SO:0001583	missense	374860	exon35			ATATATTAAAAGA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3086T>C	18.37:g.14850260T>C	ENSP00000351875:p.Leu1029Ser	406.0	0.0		348.0	80.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	T	7.085	0.570913	0.13623	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.39406	1.08	1.48	1.48	0.22813	.	.	.	.	.	T	0.52108	0.1714	M	0.79258	2.445	0.46241	D	0.998947	D;D	0.69078	0.997;0.995	P;P	0.54889	0.697;0.763	T	0.56414	-0.7983	9	0.87932	D	0	.	7.0503	0.25069	0.0:0.0:0.0:1.0	.	1114;1029	Q9BXX2;F8WAG3	AN30B_HUMAN;.	S	1029;423;449	ENSP00000351875:L1029S	ENSP00000277669:L449S	L	+	2	0	ANKRD30B	14840260	0.031000	0.19500	0.055000	0.19348	0.066000	0.16364	1.168000	0.31859	0.941000	0.37499	0.145000	0.16022	TTA	.		0.279	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
APOPT1	84334	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	104040498	104040498	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:104040498A>G	ENST00000409074.2	+	3	416	c.415A>G	c.(415-417)Act>Gct	p.T139A	APOPT1_ENST00000556253.2_Missense_Mutation_p.T126A|RP11-73M18.2_ENST00000472726.2_Missense_Mutation_p.T139A|APOPT1_ENST00000477116.1_3'UTR|APOPT1_ENST00000247618.4_Missense_Mutation_p.T126A|AL139300.1_ENST00000583855.1_RNA	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	139					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											GGGCCTGAGAACTGAATCAGG	0.368																																					p.T139A		.											.	.	.	0			c.A415G						.						211.0	213.0	212.0					14																	104040498		2203	4300	6503	SO:0001583	missense	84334	exon3			CTGAGAACTGAAT	BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.415A>G	14.37:g.104040498A>G	ENSP00000386485:p.Thr139Ala	621.0	0.0		587.0	149.0	NM_032374	Q53G28	Missense_Mutation	SNP	ENST00000409074.2	37	CCDS9983.2	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808741	0.31961	.	.	ENSG00000256053;ENSG00000256053;ENSG00000256500;ENSG00000256500	ENST00000409074;ENST00000495778;ENST00000472726;ENST00000247618	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.97	-9.11	0.00711	.	0.408897	0.24889	N	0.034789	T	0.15739	0.0379	L	0.27053	0.805	0.09310	N	0.999995	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.19943	-1.0290	10	0.15066	T	0.55	.	2.2292	0.03992	0.4662:0.0966:0.2414:0.1957	.	139;139	E7EVH7;Q96IL0	.;APOP1_HUMAN	A	139;101;139;126	ENSP00000386485:T139A;ENSP00000451703:T101A;ENSP00000439065:T139A;ENSP00000247618:T126A	ENSP00000247618:T126A	T	+	1	0	C14orf153;RP11-73M18.2	103110251	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-0.557000	0.05985	-2.387000	0.00589	0.533000	0.62120	ACT	.		0.368	APOPT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333060.2	NM_032374	
ASIC4	55515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	220379823	220379823	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:220379823C>A	ENST00000347842.3	+	1	772	c.758C>A	c.(757-759)tCg>tAg	p.S253*	ASIC4_ENST00000358078.4_Nonsense_Mutation_p.S253*|AC053503.11_ENST00000429882.1_RNA	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	253					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										TTCCGGCATTCGGCACTCAGC	0.672																																					p.S253X		.											.	.	.	0			c.C758A						.						42.0	38.0	39.0					2																	220379823		2203	4300	6503	SO:0001587	stop_gained	55515	exon1			GGCATTCGGCACT	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.758C>A	2.37:g.220379823C>A	ENSP00000326627:p.Ser253*	54.0	0.0		77.0	21.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Nonsense_Mutation	SNP	ENST00000347842.3	37	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	C	37	6.271920	0.97431	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	.	.	.	4.69	4.69	0.59074	.	0.376783	0.23750	N	0.044926	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7538	17.4292	0.87534	0.0:1.0:0.0:0.0	.	.	.	.	X	253	.	ENSP00000326627:S253X	S	+	2	0	ACCN4	220088067	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.797000	0.69087	2.431000	0.82371	0.655000	0.94253	TCG	.		0.672	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
ASXL1	171023	broad.mit.edu;bcgsc.ca	37	20	31023639	31023639	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:31023639C>T	ENST00000375687.4	+	13	3548	c.3124C>T	c.(3124-3126)Cca>Tca	p.P1042S	ASXL1_ENST00000306058.5_Missense_Mutation_p.P1037S	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1042					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CCAATCTGCCCCACTGTCCAA	0.537			"""F, N, Mis"""		"""MDS, CMML"""																																p.P1042S		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.C3124T						.						227.0	187.0	201.0					20																	31023639		2203	4300	6503	SO:0001583	missense	171023	exon12			TCTGCCCCACTGT	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3124C>T	20.37:g.31023639C>T	ENSP00000364839:p.Pro1042Ser	64.0	0.0		77.0	6.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.631410	0.00115	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.19669	2.13;2.13	4.32	0.761	0.18448	.	0.413038	0.24291	N	0.039809	T	0.05273	0.0140	N	0.01168	-0.975	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42430	-0.9452	10	0.06625	T	0.88	-0.0226	8.5618	0.33516	0.0:0.3515:0.0:0.6485	.	1037;1042	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	S	1042;1042;1042;963;1037	ENSP00000364839:P1042S;ENSP00000305119:P1037S	ENSP00000305119:P1037S	P	+	1	0	ASXL1	30487300	0.001000	0.12720	0.021000	0.16686	0.073000	0.16967	0.669000	0.25142	0.095000	0.17434	-0.415000	0.06103	CCA	.		0.537	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
BNC2	54796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	16738381	16738381	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:16738381C>A	ENST00000380672.4	-	2	163	c.106G>T	c.(106-108)Ggg>Tgg	p.G36W	BNC2_ENST00000380667.2_Missense_Mutation_p.G36W|BNC2_ENST00000545497.1_Intron|BNC2_ENST00000380666.2_Missense_Mutation_p.G36W	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GTATCAACCCCACAACATGGG	0.423																																					p.G36W		.											.	BNC2	92	0			c.G106T						.						172.0	143.0	153.0					9																	16738381		2203	4300	6503	SO:0001583	missense	54796	exon2			CAACCCCACAACA	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.106G>T	9.37:g.16738381C>A	ENSP00000370047:p.Gly36Trp	168.0	0.0		176.0	59.0	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247602	0.22880	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	T;T;T	0.04156	3.69;3.69;3.69	4.07	-0.347	0.12617	.	1.111260	0.07026	N	0.827613	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	D;B;P	0.54964	0.969;0.336;0.73	P;B;B	0.53224	0.721;0.052;0.058	T	0.44513	-0.9323	10	0.72032	D	0.01	0.2058	6.6548	0.22981	0.0:0.4942:0.0:0.5058	.	36;36;36	Q06HC4;Q6ZN30-2;Q6ZN30	.;.;BNC2_HUMAN	W	36	ENSP00000370047:G36W;ENSP00000370042:G36W;ENSP00000370041:G36W	ENSP00000370041:G36W	G	-	1	0	BNC2	16728381	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	0.016000	0.13377	-0.062000	0.13088	0.579000	0.79373	GGG	.		0.423	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
SMIM24	284422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3474916	3474916	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:3474916T>G	ENST00000215531.4	-	4	396	c.318A>C	c.(316-318)ggA>ggC	p.G106G	C19orf77_ENST00000587847.1_Silent_p.G36G|C19orf77_ENST00000591708.1_Silent_p.G36G	NM_001136503.1	NP_001129975.1	O75264	SIM24_HUMAN		106						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGTTGCtctctccttcctttg	0.498																																					p.G106G		.											.	.	.	0			c.A318C						.						166.0	147.0	153.0					19																	3474916		692	1591	2283	SO:0001819	synonymous_variant	284422	exon4			GCTCTCTCCTTCC																												ENST00000215531.4:c.318A>C	19.37:g.3474916T>G		254.0	0.0		227.0	68.0	NM_001136503	B9EJF4|Q9P059	Silent	SNP	ENST00000215531.4	37	CCDS45915.1																																																																																			.		0.498	C19orf77-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452929.1		
C3P1	388503	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10166314	10166314	+	RNA	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:10166314G>T	ENST00000495140.1	+	0	1672							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CCTACTCTATGATGACGACCC	0.577																																					.		.											.	C3P1	90	0			.						.						182.0	162.0	169.0					19																	10166314		2071	4220	6291			388503	.			CTCTATGATGACG	AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10166314G>T		152.0	0.0		223.0	67.0	.		RNA	SNP	ENST00000495140.1	37																																																																																				.		0.577	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
C7orf72	100130988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50135895	50135895	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:50135895C>T	ENST00000297001.6	+	1	264	c.214C>T	c.(214-216)Cct>Tct	p.P72S		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	72										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						CCCTTATCCCCCTTCAGTTTT	0.408																																					p.P72S		.											.	C7orf72	23	0			c.C214T						.						110.0	99.0	103.0					7																	50135895		692	1591	2283	SO:0001583	missense	100130988	exon1			TATCCCCCTTCAG		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.214C>T	7.37:g.50135895C>T	ENSP00000297001:p.Pro72Ser	267.0	0.0		285.0	61.0	NM_001161834	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	37	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130208	0.56721	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.68	4.69	0.59074	.	.	.	.	.	T	0.34745	0.0908	L	0.33485	1.01	0.26573	N	0.973524	P	0.50943	0.94	P	0.49421	0.61	T	0.08994	-1.0695	7	.	.	.	-9.4796	9.7843	0.40666	0.0:0.8738:0.0:0.1262	.	72	A4D263	CG072_HUMAN	S	72	.	.	P	+	1	0	C7orf72	50106441	0.809000	0.29036	0.993000	0.49108	0.982000	0.71751	2.051000	0.41307	2.678000	0.91216	0.491000	0.48974	CCT	.		0.408	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
CACNG4	27092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65026740	65026740	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:65026740G>T	ENST00000262138.3	+	4	606	c.604G>T	c.(604-606)Gct>Tct	p.A202S	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	202					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GGGCGTCCTGGCTGTAAACAT	0.453																																					p.A202S		.											.	CACNG4	90	0			c.G604T						.						86.0	83.0	84.0					17																	65026740		2203	4300	6503	SO:0001583	missense	27092	exon4			GTCCTGGCTGTAA	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.604G>T	17.37:g.65026740G>T	ENSP00000262138:p.Ala202Ser	73.0	0.0		77.0	28.0	NM_014405	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	37	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383831	0.61845	.	.	ENSG00000075461	ENST00000262138	D	0.89415	-2.51	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.92328	0.7566	L	0.59436	1.845	0.58432	D	0.999998	D	0.63880	0.993	D	0.75484	0.986	D	0.89747	0.3937	10	0.16420	T	0.52	-1.7597	16.3423	0.83085	0.0:0.0:1.0:0.0	.	202	Q9UBN1	CCG4_HUMAN	S	202	ENSP00000262138:A202S	ENSP00000262138:A202S	A	+	1	0	CACNG4	62457202	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.314000	0.96306	2.285000	0.76669	0.556000	0.70494	GCT	.		0.453	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
CBWD5	220869	hgsc.bcm.edu;broad.mit.edu	37	9	70484455	70484455	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:70484455delT	ENST00000382405.3	-	3	435	c.258delA	c.(256-258)aaafs	p.K86fs	CBWD5_ENST00000429800.2_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000430059.2_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000377384.1_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000377392.5_Frame_Shift_Del_p.K50fs|CBWD5_ENST00000377395.4_Frame_Shift_Del_p.K86fs			Q5RIA9	CBWD5_HUMAN	COBW domain containing 5	86							ATP binding (GO:0005524)								all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CAGCTAAGGATTTCTCCAGCG	0.418																																					p.K86fs		.											.	CBWD5	22	0			c.258delA						.						14.0	13.0	13.0					9																	70484455		2119	4176	6295	SO:0001589	frameshift_variant	220869	exon3			TAAGGATTTCTCC	BC067803, BC082271	CCDS75841.1, CCDS75843.1, CCDS75844.1	9q13	2005-08-23			ENSG00000147996	ENSG00000147996			24584	protein-coding gene	gene with protein product	"""dopamine responsive protein"""						Standard	XM_005272748		Approved		uc004ack.3	Q5RIA9	OTTHUMG00000013336	ENST00000382405.3:c.258delA	9.37:g.70484455delT	ENSP00000371842:p.Lys86fs	3269.0	0.0		3148.0	257.0	NM_001024916	Q8N7U8	Frame_Shift_Del	DEL	ENST00000382405.3	37																																																																																				.		0.418	CBWD5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000037131.2		
CCDC6	8030	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	61592392	61592392	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:61592392T>A	ENST00000263102.6	-	3	704	c.473A>T	c.(472-474)gAa>gTa	p.E158V		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	158	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		CTGTTCTAGTTCGGCTTTCTC	0.398			T	RET	NSCLC																																p.E158V		.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	686	0			c.A473T						.						145.0	128.0	134.0					10																	61592392		2203	4300	6503	SO:0001583	missense	8030	exon3			TCTAGTTCGGCTT	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.473A>T	10.37:g.61592392T>A	ENSP00000263102:p.Glu158Val	266.0	2.0		308.0	77.0	NM_005436	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632371	0.87660	.	.	ENSG00000108091	ENST00000263102	D	0.82167	-1.58	5.95	5.95	0.96441	.	0.043855	0.85682	D	0.000000	D	0.87083	0.6089	L	0.57536	1.79	0.80722	D	1	D	0.53462	0.96	P	0.54815	0.761	D	0.87940	0.2716	10	0.62326	D	0.03	-15.0074	16.0971	0.81132	0.0:0.0:0.0:1.0	.	158	Q16204	CCDC6_HUMAN	V	158	ENSP00000263102:E158V	ENSP00000263102:E158V	E	-	2	0	CCDC6	61262398	1.000000	0.71417	0.977000	0.42913	0.994000	0.84299	7.645000	0.83430	2.279000	0.76181	0.533000	0.62120	GAA	.		0.398	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
CDC14B	8555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	99285642	99285642	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:99285642C>G	ENST00000375241.1	-	11	1597	c.1146G>C	c.(1144-1146)gaG>gaC	p.E382D	CDC14B_ENST00000375236.1_Missense_Mutation_p.E382D|CDC14B_ENST00000375240.3_Missense_Mutation_p.E382D|CDC14B_ENST00000265659.2_Missense_Mutation_p.E382D|CDC14B_ENST00000375242.3_Missense_Mutation_p.E345D|CDC14B_ENST00000481149.1_5'Flank|CDC14B_ENST00000463569.1_Missense_Mutation_p.E382D	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	382					activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				GTTGTCCATTCTCCTGCCCCT	0.453																																					p.E382D		.											.	CDC14B	228	0			c.G1146C						.						110.0	115.0	113.0					9																	99285642		2203	4298	6501	SO:0001583	missense	8555	exon11			TCCATTCTCCTGC	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1146G>C	9.37:g.99285642C>G	ENSP00000364389:p.Glu382Asp	230.0	0.0		222.0	57.0	NM_033331	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	37	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245333	0.39697	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236	D;D;D;D;D;D	0.92199	-2.98;-2.99;-2.99;-2.98;-2.99;-2.99	5.29	4.32	0.51571	.	0.438058	0.24633	N	0.036867	D	0.88894	0.6561	L	0.54323	1.7	0.31311	N	0.687097	B;B;B	0.17465	0.022;0.013;0.013	B;B;B	0.23852	0.049;0.028;0.013	D	0.84695	0.0725	10	0.35671	T	0.21	0.0118	10.6986	0.45913	0.0:0.9011:0.0:0.0989	.	382;382;345	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	D	382;382;382;345;382;382	ENSP00000265659:E382D;ENSP00000364389:E382D;ENSP00000364388:E382D;ENSP00000364390:E345D;ENSP00000420572:E382D;ENSP00000364384:E382D	ENSP00000265659:E382D	E	-	3	2	CDC14B	98325463	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.439000	0.35013	2.759000	0.94783	0.555000	0.69702	GAG	.		0.453	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331	
CDC42BPA	8476	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	227316906	227316908	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	GCA	GCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:227316906_227316908delGCA	ENST00000366769.3	-	11	2706_2708	c.1415_1417delTGC	c.(1414-1419)ctgcag>cag	p.L472del	CDC42BPA_ENST00000366767.3_In_Frame_Del_p.L472del|CDC42BPA_ENST00000334218.5_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366765.3_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366764.2_In_Frame_Del_p.L472del|CDC42BPA_ENST00000535525.1_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366766.2_In_Frame_Del_p.L472del	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GTTGAATACTGCAGAGCTTGGAC	0.271																																					p.472_473del		.											.	CDC42BPA	549	0			c.1415_1417del						.																																			SO:0001651	inframe_deletion	8476	exon11			AATACTGCAGAGC	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.1415_1417delTGC	1.37:g.227316906_227316908delGCA	ENSP00000355731:p.Leu472del	584.0	0.0		426.0	107.0	NM_003607		In_Frame_Del	DEL	ENST00000366769.3	37	CCDS1558.1																																																																																			.		0.271	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
CDH11	1009	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	65038672	65038672	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr16:65038672G>A	ENST00000268603.4	-	3	716	c.101C>T	c.(100-102)tCc>tTc	p.S34F	CDH11_ENST00000394156.3_Missense_Mutation_p.S34F|CDH11_ENST00000569624.1_5'UTR|CDH11_ENST00000566827.1_Intron	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	34					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCCATGGAAGGAGGGCCGCAG	0.617			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.S34F		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	852	0			c.C101T						.						29.0	27.0	28.0					16																	65038672		2202	4300	6502	SO:0001583	missense	1009	exon3			TGGAAGGAGGGCC	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.101C>T	16.37:g.65038672G>A	ENSP00000268603:p.Ser34Phe	37.0	1.0		54.0	12.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739199	0.49045	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000536902	T;T	0.56941	0.43;0.43	5.01	5.01	0.66863	.	0.405917	0.26404	N	0.024571	T	0.64327	0.2588	L	0.43152	1.355	0.80722	D	1	D;B	0.63880	0.993;0.213	D;B	0.63192	0.912;0.11	T	0.63386	-0.6649	10	0.48119	T	0.1	.	18.1881	0.89798	0.0:0.0:1.0:0.0	.	34;34	P55287-2;P55287	.;CAD11_HUMAN	F	34	ENSP00000268603:S34F;ENSP00000377711:S34F	ENSP00000268603:S34F	S	-	2	0	CDH11	63596173	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.431000	0.73395	2.722000	0.93159	0.591000	0.81541	TCC	.		0.617	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46829366	46829366	+	Missense_Mutation	SNP	G	G	A	rs573686247		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:46829366G>A	ENST00000262738.3	-	5	4534	c.4535C>T	c.(4534-4536)aCg>aTg	p.T1512M		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1512	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCCACGGTCGTTGTTGTCTC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		16571	0.0		0.001	False		,,,				2504	0.0				p.T1512M		.											.	CELSR1	525	0			c.C4535T						.						61.0	50.0	54.0					22																	46829366		2203	4300	6503	SO:0001583	missense	9620	exon5			ACGGTCGTTGTTG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4535C>T	22.37:g.46829366G>A	ENSP00000262738:p.Thr1512Met	33.0	0.0		33.0	9.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819755	0.50633	.	.	ENSG00000075275	ENST00000262738	T	0.79845	-1.31	4.62	4.62	0.57501	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000001	D	0.89643	0.6774	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90785	0.4682	10	0.59425	D	0.04	.	17.4417	0.87566	0.0:0.0:1.0:0.0	.	1512	Q9NYQ6	CELR1_HUMAN	M	1512	ENSP00000262738:T1512M	ENSP00000262738:T1512M	T	-	2	0	CELSR1	45208030	1.000000	0.71417	0.032000	0.17829	0.018000	0.09664	9.015000	0.93640	2.290000	0.77057	0.655000	0.94253	ACG	.		0.622	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CEP152	22995	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49048388	49048388	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr15:49048388A>G	ENST00000380950.2	-	20	3244	c.3057T>C	c.(3055-3057)tgT>tgC	p.C1019C	CEP152_ENST00000399334.3_Silent_p.C1019C|CEP152_ENST00000325747.5_Silent_p.C926C	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1019					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TCTGGTCTAGACAAGTTTGTA	0.413																																					p.C1019C		.											.	CEP152	70	0			c.T3057C						.						136.0	123.0	127.0					15																	49048388		1874	4108	5982	SO:0001819	synonymous_variant	22995	exon20			GTCTAGACAAGTT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3057T>C	15.37:g.49048388A>G		174.0	1.0		201.0	54.0	NM_014985	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	37	CCDS58361.1																																																																																			.		0.413	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
CHRNA9	55584	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	40351066	40351066	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:40351066A>G	ENST00000310169.2	+	4	672	c.533A>G	c.(532-534)tAc>tGc	p.Y178C		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	178					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TCCTGGACCTACAATGGCAAT	0.522																																					p.Y178C	Esophageal Squamous(115;1297 1602 22235 25158 43327)	.											.	CHRNA9	96	0			c.A533G						.						221.0	192.0	202.0					4																	40351066		2203	4300	6503	SO:0001583	missense	55584	exon4			GGACCTACAATGG	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.533A>G	4.37:g.40351066A>G	ENSP00000312663:p.Tyr178Cys	197.0	1.0		197.0	50.0	NM_017581	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	CCDS3459.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.148738	0.78001	.	.	ENSG00000174343	ENST00000310169	D	0.83591	-1.74	5.31	5.31	0.75309	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94324	0.8176	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96265	0.9194	10	0.87932	D	0	.	15.271	0.73702	1.0:0.0:0.0:0.0	.	178	Q9UGM1	ACHA9_HUMAN	C	178	ENSP00000312663:Y178C	ENSP00000312663:Y178C	Y	+	2	0	CHRNA9	40045823	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.031000	0.59945	0.459000	0.35465	TAC	.		0.522	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1		
CLCA2	9635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	86916353	86916353	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:86916353A>T	ENST00000370565.4	+	12	2254	c.2092A>T	c.(2092-2094)Agc>Tgc	p.S698C	CLCA2_ENST00000498802.1_3'UTR	NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	698					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TCCCAGCATAAGCACCCCAGC	0.398																																					p.S698C	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	.											.	CLCA2	155	0			c.A2092T						.						157.0	147.0	150.0					1																	86916353		2203	4300	6503	SO:0001583	missense	9635	exon12			AGCATAAGCACCC		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.2092A>T	1.37:g.86916353A>T	ENSP00000359596:p.Ser698Cys	165.0	0.0		129.0	14.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	.	.	.	.	.	.	.	.	.	.	A	8.310	0.821970	0.16678	.	.	ENSG00000137975	ENST00000370565	T	0.03242	4.0	5.36	4.23	0.50019	.	0.737030	0.13753	N	0.365105	T	0.02342	0.0072	M	0.71581	2.175	0.09310	N	1	B	0.33739	0.422	B	0.36186	0.219	T	0.42275	-0.9461	10	0.72032	D	0.01	-1.2264	6.6844	0.23136	0.75:0.1709:0.0791:0.0	.	698	Q9UQC9	CLCA2_HUMAN	C	698	ENSP00000359596:S698C	ENSP00000359596:S698C	S	+	1	0	CLCA2	86688941	0.001000	0.12720	0.091000	0.20842	0.016000	0.09150	1.240000	0.32731	0.879000	0.35944	0.528000	0.53228	AGC	.		0.398	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
CNKSR2	22866	ucsc.edu;bcgsc.ca	37	X	21624911	21624911	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:21624911A>G	ENST00000379510.3	+	19	2095	c.2059A>G	c.(2059-2061)Agt>Ggt	p.S687G	CNKSR2_ENST00000425654.2_Missense_Mutation_p.S657G|CNKSR2_ENST00000543067.1_Missense_Mutation_p.S638G|CNKSR2_ENST00000279451.4_Missense_Mutation_p.S687G	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	687					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CTGGAGTGAGAGTGACAAGGA	0.393																																					p.S687G		.											.	CNKSR2	625	0			c.A2059G						.						234.0	156.0	182.0					X																	21624911		2203	4300	6503	SO:0001583	missense	22866	exon19			AGTGAGAGTGACA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2059A>G	X.37:g.21624911A>G	ENSP00000368824:p.Ser687Gly	33.0	0.0		48.0	5.0	NM_014927	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.290733	0.80914	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.24151	2.12;1.87;1.9;2.19	5.8	5.8	0.92144	.	0.077579	0.85682	D	0.000000	T	0.52306	0.1726	M	0.76328	2.33	0.58432	D	0.999996	B;D;D;D	0.89917	0.047;1.0;1.0;1.0	B;D;D;D	0.85130	0.189;0.997;0.997;0.997	T	0.56751	-0.7927	10	0.87932	D	0	-16.9343	15.0492	0.71854	1.0:0.0:0.0:0.0	.	657;638;279;687	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	G	657;638;687;687	ENSP00000397906:S657G;ENSP00000444633:S638G;ENSP00000279451:S687G;ENSP00000368824:S687G	ENSP00000279451:S687G	S	+	1	0	CNKSR2	21534832	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	1.937000	0.56155	0.481000	0.45027	AGT	.		0.393	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
COL16A1	1307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32151294	32151294	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:32151294T>G	ENST00000373672.3	-	29	2478	c.1962A>C	c.(1960-1962)ccA>ccC	p.P654P	COL16A1_ENST00000271069.6_Silent_p.P653P|COL16A1_ENST00000373668.3_Silent_p.P654P	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	654	Triple-helical region 6 (COL6) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCTCTCCGGATGGGCCAGGCA	0.637																																					p.P654P	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.A1962C						.						102.0	110.0	108.0					1																	32151294		1911	4125	6036	SO:0001819	synonymous_variant	1307	exon29			TCCGGATGGGCCA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1962A>C	1.37:g.32151294T>G		107.0	0.0		162.0	36.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1																																																																																			.		0.637	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
COL4A1	1282	ucsc.edu;bcgsc.ca	37	13	110828996	110828996	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:110828996T>C	ENST00000375820.4	-	35	3066	c.2945A>G	c.(2944-2946)cAg>cGg	p.Q982R		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	982	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CTGTCCTGCCTGCCCGTCCTT	0.577																																					p.Q982R		.											.	COL4A1	654	0			c.A2945G						.						55.0	54.0	54.0					13																	110828996		2203	4300	6503	SO:0001583	missense	1282	exon35			CCTGCCTGCCCGT	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2945A>G	13.37:g.110828996T>C	ENSP00000364979:p.Gln982Arg	55.0	0.0		39.0	4.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.435095	0.43224	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.93189	-3.18	6.06	6.06	0.98353	.	0.120358	0.56097	D	0.000029	D	0.92668	0.7670	N	0.16903	0.455	0.80722	D	1	D	0.63046	0.992	D	0.67548	0.952	D	0.90812	0.4702	10	0.17369	T	0.5	.	16.6127	0.84892	0.0:0.0:0.0:1.0	.	982	P02462	CO4A1_HUMAN	R	625;982;631	ENSP00000364979:Q982R	ENSP00000364973:Q625R	Q	-	2	0	COL4A1	109626997	1.000000	0.71417	0.824000	0.32777	0.116000	0.19942	4.322000	0.59215	2.322000	0.78497	0.528000	0.53228	CAG	.		0.577	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
CRY1	1407	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	107386611	107386611	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:107386611T>G	ENST00000008527.5	-	12	2582	c.1715A>C	c.(1714-1716)gAc>gCc	p.D572A		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	572					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						ACTCTGTGTGTCCTCTTCCTG	0.373																																					p.D572A		.											.	CRY1	93	0			c.A1715C						.						113.0	112.0	112.0					12																	107386611		2203	4300	6503	SO:0001583	missense	1407	exon12			TGTGTGTCCTCTT	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1715A>C	12.37:g.107386611T>G	ENSP00000008527:p.Asp572Ala	132.0	1.0		102.0	38.0	NM_004075		Missense_Mutation	SNP	ENST00000008527.5	37	CCDS9112.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.316443	0.60524	.	.	ENSG00000008405	ENST00000008527;ENST00000319645;ENST00000549356	.	.	.	5.95	5.95	0.96441	.	0.422486	0.28647	N	0.014611	T	0.38026	0.1025	N	0.08118	0	0.43814	D	0.996373	B	0.09022	0.002	B	0.06405	0.002	T	0.26883	-1.0090	9	0.15952	T	0.53	-9.4604	16.4069	0.83677	0.0:0.0:0.0:1.0	.	572	Q16526	CRY1_HUMAN	A	572;179;92	.	ENSP00000008527:D572A	D	-	2	0	CRY1	105910741	1.000000	0.71417	0.944000	0.38274	0.989000	0.77384	5.002000	0.63952	2.272000	0.75746	0.460000	0.39030	GAC	.		0.373	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075	
DFNB59	494513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179325171	179325171	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:179325171G>C	ENST00000409117.3	+	6	1120	c.764G>C	c.(763-765)aGa>aCa	p.R255T	DFNB59_ENST00000375129.4_Missense_Mutation_p.R255T	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	255					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CTATTTGAAAGAAGTATGTTT	0.353																																					p.R255T		.											.	DFNB59	22	0			c.G764C						.						85.0	81.0	82.0					2																	179325171		1833	4085	5918	SO:0001583	missense	494513	exon6			TTGAAAGAAGTAT	BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.764G>C	2.37:g.179325171G>C	ENSP00000386647:p.Arg255Thr	126.0	0.0		105.0	20.0	NM_001042702	A0PK14|B9EJE2	Missense_Mutation	SNP	ENST00000409117.3	37	CCDS42787.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803735	0.50315	.	.	ENSG00000204311	ENST00000409117;ENST00000375129	T;T	0.58506	0.33;0.33	5.4	5.4	0.78164	.	0.000000	0.49305	U	0.000141	T	0.44329	0.1288	N	0.22421	0.69	0.49299	D	0.999774	B	0.25441	0.126	B	0.26094	0.066	T	0.32134	-0.9918	10	0.14252	T	0.57	-21.5255	16.9645	0.86282	0.0:0.0:1.0:0.0	.	255	Q0ZLH3	PJVK_HUMAN	T	255	ENSP00000386647:R255T;ENSP00000364271:R255T	ENSP00000364271:R255T	R	+	2	0	DFNB59	179033417	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.095000	0.57728	2.538000	0.85594	0.462000	0.41574	AGA	.		0.353	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335160.1		
DGKG	1608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	185993350	185993350	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:185993350C>T	ENST00000265022.3	-	10	1435	c.896G>A	c.(895-897)gGc>gAc	p.G299D	DGKG_ENST00000344484.4_Missense_Mutation_p.G299D|DGKG_ENST00000544847.1_Missense_Mutation_p.G299D|DGKG_ENST00000382164.4_Missense_Mutation_p.G299D	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	299					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GCAGCACAGGCCTTGCTTGCG	0.522																																					p.G299D		.											.	DGKG	714	0			c.G896A						.						124.0	106.0	112.0					3																	185993350		2203	4300	6503	SO:0001583	missense	1608	exon10			CACAGGCCTTGCT	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.896G>A	3.37:g.185993350C>T	ENSP00000265022:p.Gly299Asp	46.0	0.0		54.0	17.0	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581617	0.86748	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691;ENST00000437018	D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49	5.55	4.63	0.57726	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.058330	0.64402	D	0.000002	D	0.98541	0.9513	H	0.99130	4.44	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.98959	1.0797	10	0.87932	D	0	.	16.0206	0.80486	0.0:0.8655:0.1345:0.0	.	299;299;299;299	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	D	299;299;299;299;302;50	ENSP00000265022:G299D;ENSP00000339777:G299D;ENSP00000371599:G299D;ENSP00000440507:G299D;ENSP00000395526:G50D	ENSP00000265022:G299D	G	-	2	0	DGKG	187476044	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.699000	0.68310	2.761000	0.94854	0.655000	0.94253	GGC	.		0.522	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
DROSHA	29102	ucsc.edu;bcgsc.ca	37	5	31448654	31448654	+	Splice_Site	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:31448654C>T	ENST00000511367.2	-	22	3126	c.2882G>A	c.(2881-2883)aGg>aAg	p.R961K	DROSHA_ENST00000513349.1_Splice_Site_p.R924K|DROSHA_ENST00000344624.3_Splice_Site_p.R961K|DROSHA_ENST00000442743.1_Splice_Site_p.R924K	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	961	Necessary for interaction with DGCR8 and pri-miRNA processing activity.|RNase III 1.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TCAACTTTACCTCGAGGGAGT	0.313																																					p.R961K		.											.	DROSHA	227	0			c.G2882A						.						84.0	85.0	84.0					5																	31448654		1833	4087	5920	SO:0001630	splice_region_variant	29102	exon22			CTTTACCTCGAGG	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2882+1G>A	5.37:g.31448654C>T		40.0	0.0		45.0	4.0	NM_013235	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100177	0.56183	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	5.63	5.63	0.86233	Ribonuclease III (4);	0.088391	0.85682	N	0.000000	T	0.72028	0.3410	N	0.04880	-0.145	0.80722	D	1	P;B	0.38048	0.616;0.291	B;B	0.35312	0.159;0.2	T	0.71965	-0.4433	9	.	.	.	-19.0119	19.7587	0.96304	0.0:1.0:0.0:0.0	.	924;961	E7EMP9;Q9NRR4	.;RNC_HUMAN	K	961;961;924;924;886;917	ENSP00000425979:R961K;ENSP00000339845:R961K;ENSP00000409335:R924K;ENSP00000424161:R924K	.	R	-	2	0	DROSHA	31484411	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.131000	0.77243	2.663000	0.90544	0.556000	0.70494	AGG	.		0.313	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	Missense_Mutation
EIF2B4	8890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27590024	27590024	+	Silent	SNP	C	C	T	rs373520608		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:27590024C>T	ENST00000347454.4	-	10	1101	c.930G>A	c.(928-930)gaG>gaA	p.E310E	EIF2B4_ENST00000451130.2_Silent_p.E330E|EIF2B4_ENST00000445933.2_Silent_p.E309E|EIF2B4_ENST00000493344.2_Silent_p.E331E|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	310					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACAATCTTCTCTTGCACAT	0.438																																					p.E330E		.											.	EIF2B4	90	0			c.G990A						.	C	,,	0,4406		0,0,2203	209.0	177.0	188.0		930,927,990	5.1	1.0	2		188	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	EIF2B4	NM_001034116.1,NM_015636.3,NM_172195.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	310/524,309/523,330/544	27590024	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8890	exon9			AATCTTCTCTTGC	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.930G>A	2.37:g.27590024C>T		79.0	0.0		81.0	22.0	NM_172195	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Silent	SNP	ENST00000347454.4	37	CCDS33164.1																																																																																			.		0.438	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1		
ELAVL1	1994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8038704	8038704	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:8038704C>A	ENST00000407627.2	-	4	464	c.335G>T	c.(334-336)gGg>gTg	p.G112V	ELAVL1_ENST00000351593.5_Missense_Mutation_p.G139V|ELAVL1_ENST00000596459.1_Missense_Mutation_p.G112V|ELAVL1_ENST00000593807.1_Missense_Mutation_p.G112V	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	112	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CCGCGGGAGCCCGCTGATGTA	0.557																																					p.G112V		.											.	ELAVL1	90	0			c.G335T						.						152.0	117.0	129.0					19																	8038704		2203	4300	6503	SO:0001583	missense	1994	exon4			GGGAGCCCGCTGA	U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.335G>T	19.37:g.8038704C>A	ENSP00000385269:p.Gly112Val	120.0	0.0		125.0	38.0	NM_001419	B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	ENST00000407627.2	37	CCDS12193.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782162	0.90282	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.08896	3.04;3.04	5.0	5.0	0.66597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60058	-0.7337	10	0.87932	D	0	.	15.8573	0.78989	0.0:1.0:0.0:0.0	.	112	Q15717	ELAV1_HUMAN	V	112;139	ENSP00000385269:G112V;ENSP00000264073:G139V	ENSP00000264073:G139V	G	-	2	0	ELAVL1	7944704	1.000000	0.71417	0.965000	0.40720	0.925000	0.55904	7.517000	0.81783	2.595000	0.87683	0.655000	0.94253	GGG	.		0.557	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461494.3	NM_001419	
ELMSAN1	91748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74189521	74189521	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:74189521C>T	ENST00000286523.5	-	10	3386	c.2604G>A	c.(2602-2604)gtG>gtA	p.V868V	ELMSAN1_ENST00000394071.2_Silent_p.V868V	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	868	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										AGTAGAACTCCACGCACTGGG	0.527																																					p.V868V		.											.	.	.	0			c.G2604A						.						225.0	204.0	212.0					14																	74189521		2203	4300	6503	SO:0001819	synonymous_variant	91748	exon10			GAACTCCACGCAC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.2604G>A	14.37:g.74189521C>T		87.0	0.0		116.0	36.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Silent	SNP	ENST00000286523.5	37	CCDS9819.1																																																																																			.		0.527	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
EPHB1	2047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	134920367	134920367	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:134920367A>T	ENST00000398015.3	+	12	2552	c.2182A>T	c.(2182-2184)Atc>Ttc	p.I728F	EPHB1_ENST00000493838.1_Missense_Mutation_p.I289F	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	728	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GCTCAGGGGCATCGCTGCTGG	0.512																																					p.I728F		.											.	EPHB1	1492	0			c.A2182T						.						237.0	236.0	236.0					3																	134920367		2203	4300	6503	SO:0001583	missense	2047	exon12			AGGGGCATCGCTG	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2182A>T	3.37:g.134920367A>T	ENSP00000381097:p.Ile728Phe	133.0	0.0		153.0	32.0	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	A	31	5.063828	0.93898	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.69435	-0.4;-0.4	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.150822	0.52532	D	0.000078	D	0.87505	0.6194	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91447	0.5178	10	0.87932	D	0	.	15.6001	0.76616	1.0:0.0:0.0:0.0	.	728	P54762	EPHB1_HUMAN	F	728;289	ENSP00000381097:I728F;ENSP00000419574:I289F	ENSP00000381097:I728F	I	+	1	0	EPHB1	136403057	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	9.263000	0.95617	2.224000	0.72417	0.460000	0.39030	ATC	.		0.512	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
EXOC1	55763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56759928	56759928	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:56759928G>A	ENST00000381295.2	+	15	2283	c.1935G>A	c.(1933-1935)agG>agA	p.R645R	EXOC1_ENST00000346134.7_Silent_p.R645R|EXOC1_ENST00000349598.6_Silent_p.R630R	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	645					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					CTGTCAAAAGGAACTTTGACA	0.333																																					p.R645R		.											.	EXOC1	950	0			c.G1935A						.						68.0	64.0	65.0					4																	56759928		2203	4300	6503	SO:0001819	synonymous_variant	55763	exon15			CAAAAGGAACTTT	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1935G>A	4.37:g.56759928G>A		78.0	0.0		76.0	23.0	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Silent	SNP	ENST00000381295.2	37	CCDS3502.1																																																																																			.		0.333	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
FAM98A	25940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	33810097	33810097	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:33810097T>C	ENST00000238823.8	-	8	1443	c.1303A>G	c.(1303-1305)Agt>Ggt	p.S435G	FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Missense_Mutation_p.S240G|FAM98A_ENST00000403368.1_3'UTR			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	436	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TGGTATCCACTTCCTGTATAT	0.557																																					p.S435G		.											.	FAM98A	91	0			c.A1303G						.						152.0	138.0	143.0					2																	33810097		2203	4300	6503	SO:0001583	missense	25940	exon8			ATCCACTTCCTGT		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1303A>G	2.37:g.33810097T>C	ENSP00000238823:p.Ser435Gly	108.0	0.0		116.0	32.0	NM_015475	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	ENST00000238823.8	37	CCDS33179.1	.	.	.	.	.	.	.	.	.	.	T	9.404	1.078689	0.20227	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000441530	T;T	0.51071	0.84;0.72	5.64	5.64	0.86602	.	0.103522	0.64402	D	0.000002	T	0.25082	0.0609	N	0.08118	0	0.46317	D	0.998989	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.14117	-1.0484	10	0.08837	T	0.75	-12.9086	11.7336	0.51752	0.0:0.0705:0.0:0.9295	.	436;266;435;273	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	G	435;436;240	ENSP00000238823:S435G;ENSP00000408716:S240G	ENSP00000238823:S435G	S	-	1	0	FAM98A	33663601	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.501000	0.45389	2.147000	0.66899	0.533000	0.62120	AGT	.		0.557	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
FBF1	85302	broad.mit.edu;bcgsc.ca	37	17	73919636	73919636	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:73919636G>C	ENST00000586717.1	-	13	1286	c.1013C>G	c.(1012-1014)cCc>cGc	p.P338R	FBF1_ENST00000389570.4_Missense_Mutation_p.P338R|FBF1_ENST00000319129.5_Missense_Mutation_p.P337R			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	338					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TCCCTTCCTGGGCTGGATGGG	0.592																																					p.P337R		.											.	FBF1	205	0			c.C1010G						.						19.0	21.0	20.0					17																	73919636		1977	4160	6137	SO:0001583	missense	85302	exon13			TTCCTGGGCTGGA	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1013C>G	17.37:g.73919636G>C	ENSP00000465132:p.Pro338Arg	106.0	0.0		103.0	22.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	G	15.36	2.810036	0.50421	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.17213	2.29;2.29	4.03	3.04	0.35103	.	.	.	.	.	T	0.22781	0.0550	L	0.44542	1.39	0.09310	N	1	D;B;D	0.53462	0.96;0.242;0.96	P;B;P	0.53006	0.668;0.101;0.715	T	0.09574	-1.0668	9	0.21540	T	0.41	-3.4059	11.7786	0.51999	0.0:0.5476:0.4524:0.0	.	352;338;337	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	R	338;338;337;351	ENSP00000374221:P338R;ENSP00000324292:P337R	ENSP00000324292:P337R	P	-	2	0	FBF1	71431231	0.153000	0.22777	0.894000	0.35097	0.990000	0.78478	1.070000	0.30653	0.884000	0.36064	0.561000	0.74099	CCC	.		0.592	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127727761	127727761	+	Missense_Mutation	SNP	C	C	G	rs35095480		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:127727761C>G	ENST00000508053.1	-	17	2527	c.1553G>C	c.(1552-1554)cGa>cCa	p.R518P	FBN2_ENST00000508989.1_Missense_Mutation_p.R485P|FBN2_ENST00000262464.4_Missense_Mutation_p.R518P			P35556	FBN2_HUMAN	fibrillin 2	518	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCATTCACATCGGTAGCTTGA	0.348																																					p.R518P		.											.	FBN2	146	0			c.G1553C						.						142.0	133.0	136.0					5																	127727761		2203	4300	6503	SO:0001583	missense	2201	exon11			TCACATCGGTAGC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1553G>C	5.37:g.127727761C>G	ENSP00000424571:p.Arg518Pro	171.0	0.0		136.0	24.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253938	0.80135	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87650	-2.28;-2.28;-2.28	4.14	4.14	0.48551	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.51477	D	0.000087	D	0.94830	0.8330	M	0.92923	3.36	0.58432	D	0.99999	D;D	0.89917	1.0;0.996	D;D	0.72982	0.958;0.979	D	0.95717	0.8763	10	0.62326	D	0.03	.	17.7235	0.88359	0.0:1.0:0.0:0.0	.	485;518	D6RJI3;P35556	.;FBN2_HUMAN	P	518;518;485	ENSP00000262464:R518P;ENSP00000424571:R518P;ENSP00000425596:R485P	ENSP00000262464:R518P	R	-	2	0	FBN2	127755660	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.303000	0.65738	2.592000	0.87571	0.585000	0.79938	CGA	.		0.348	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FKBP15	23307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	115948581	115948581	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:115948581C>T	ENST00000238256.3	-	15	1563	c.1446G>A	c.(1444-1446)caG>caA	p.Q482Q		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	482					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GCCGAACGGGCTGCAGCTGGG	0.537																																					p.Q482Q		.											.	FKBP15	25	0			c.G1446A						.						66.0	78.0	74.0					9																	115948581		2078	4207	6285	SO:0001819	synonymous_variant	23307	exon15			AACGGGCTGCAGC	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.1446G>A	9.37:g.115948581C>T		76.0	0.0		89.0	26.0	NM_015258	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	CCDS48007.1																																																																																			.		0.537	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
FMN1	342184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33359250	33359250	+	Intron	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr15:33359250C>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000558197.1_Missense_Mutation_p.G279V|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.G279V|FMN1_ENST00000559150.1_Intron			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CACACGAAGCCCACTGAAAAA	0.468																																					p.G279V		.											.	FMN1	23	0			c.G836T						.						59.0	60.0	60.0					15																	33359250		1889	4125	6014	SO:0001627	intron_variant	342184	exon1			CGAAGCCCACTGA	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-1975G>T	15.37:g.33359250C>A		109.0	0.0		125.0	25.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	C	16.00	2.999301	0.54147	.	.	ENSG00000248905	ENST00000334528	T	0.61158	0.13	5.59	4.66	0.58398	.	.	.	.	.	T	0.76884	0.4050	.	.	.	.	.	.	D;D	0.69078	0.997;0.997	D;D	0.71184	0.972;0.963	T	0.82032	-0.0658	7	0.87932	D	0	.	16.3782	0.83418	0.0:0.8679:0.1321:0.0	.	279;279	Q68DA7-3;Q68DA7-5	.;.	V	279	ENSP00000333950:G279V	ENSP00000333950:G279V	G	-	2	0	FMN1	31146542	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.983000	0.76180	1.340000	0.45581	0.655000	0.94253	GGG	.		0.468	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
FOXS1	2307	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	30432921	30432921	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:30432921C>G	ENST00000375978.3	-	1	499	c.425G>C	c.(424-426)gGa>gCa	p.G142A		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	142					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						GTTGGGGACTCCTGGGTCCTG	0.721																																					p.G142A		.											.	FOXS1	69	0			c.G425C						.						15.0	16.0	15.0					20																	30432921		2201	4297	6498	SO:0001583	missense	2307	exon1			GGGACTCCTGGGT	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.425G>C	20.37:g.30432921C>G	ENSP00000365145:p.Gly142Ala	19.0	0.0		33.0	12.0	NM_004118	Q96D28	Missense_Mutation	SNP	ENST00000375978.3	37	CCDS13192.1	.	.	.	.	.	.	.	.	.	.	C	9.029	0.986809	0.18889	.	.	ENSG00000179772	ENST00000375978	D	0.93604	-3.25	4.47	3.53	0.40419	.	0.000000	0.45126	D	0.000391	D	0.87935	0.6303	L	0.32530	0.975	0.43622	D	0.996006	P	0.45348	0.856	B	0.43754	0.43	D	0.84160	0.0428	10	0.08837	T	0.75	.	11.241	0.48968	0.0:0.9091:0.0:0.0909	.	142	O43638	FOXS1_HUMAN	A	142	ENSP00000365145:G142A	ENSP00000365145:G142A	G	-	2	0	FOXS1	29896582	0.609000	0.26975	0.062000	0.19696	0.057000	0.15508	1.382000	0.34374	1.107000	0.41642	0.455000	0.32223	GGA	.		0.721	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118	
FPR3	2359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	52327451	52327451	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:52327451G>C	ENST00000339223.4	+	2	629	c.450G>C	c.(448-450)tgG>tgC	p.W150C	FPR3_ENST00000595991.1_Missense_Mutation_p.W150C	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	150					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						CGGGACTCTGGATTTTCACCA	0.478																																					p.W150C		.											.	FPR3	501	0			c.G450C						.						103.0	91.0	95.0					19																	52327451		2203	4300	6503	SO:0001583	missense	2359	exon2			ACTCTGGATTTTC		CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.450G>C	19.37:g.52327451G>C	ENSP00000341821:p.Trp150Cys	141.0	0.0		162.0	11.0	NM_002030		Missense_Mutation	SNP	ENST00000339223.4	37	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	13.33	2.206216	0.39003	.	.	ENSG00000187474	ENST00000339223	D	0.88818	-2.43	2.34	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.96269	0.8783	H	0.98901	4.365	0.48236	D	0.999612	D	0.89917	1.0	D	0.97110	1.0	D	0.95907	0.8920	10	0.87932	D	0	.	10.3497	0.43927	0.0:0.0:1.0:0.0	.	150	P25089	FPR3_HUMAN	C	150	ENSP00000341821:W150C	ENSP00000341821:W150C	W	+	3	0	FPR3	57019263	1.000000	0.71417	0.027000	0.17364	0.052000	0.14988	6.278000	0.72614	1.323000	0.45263	0.467000	0.42956	TGG	.		0.478	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
FRG1	2483	broad.mit.edu;bcgsc.ca	37	4	190876266	190876266	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:190876266C>A	ENST00000226798.4	+	5	614	c.392C>A	c.(391-393)gCa>gAa	p.A131E	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	131					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CGTTCAGATGCAATTGGACCA	0.358																																					p.A131E		.											.	FRG1	90	0			c.C392A						.						91.0	91.0	91.0					4																	190876266		2203	4300	6503	SO:0001583	missense	2483	exon5			CAGATGCAATTGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.392C>A	4.37:g.190876266C>A	ENSP00000226798:p.Ala131Glu	711.0	1.0		651.0	27.0	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	27.2	4.806760	0.90623	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.54479	1.85;0.57	4.04	4.04	0.47022	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.74023	0.3662	M	0.90082	3.085	0.80722	D	1	D	0.62365	0.991	P	0.61800	0.894	T	0.81360	-0.0968	10	0.87932	D	0	-6.8733	14.1451	0.65347	0.0:1.0:0.0:0.0	.	131	Q14331	FRG1_HUMAN	E	131;68	ENSP00000226798:A131E;ENSP00000435943:A68E	ENSP00000226798:A131E	A	+	2	0	FRG1	191113260	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.292000	0.78731	1.964000	0.57103	0.567000	0.79289	GCA	.		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
GFOD1	54438	broad.mit.edu;ucsc.edu	37	6	13470848	13470848	+	Intron	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:13470848T>C	ENST00000379287.3	-	1	918				AL583828.1_ENST00000558378.1_5'UTR|GFOD1_ENST00000379278.3_5'UTR|GFOD1_ENST00000603223.1_Missense_Mutation_p.R90G	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			ATTTTCTTCCTCTGATGTCCT	0.453																																					p.R90G		.											.	GFOD1	92	0			c.A268G						.																																			SO:0001627	intron_variant	54438	exon2			TCTTCCTCTGATG	AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.253+16021A>G	6.37:g.13470848T>C		47.0	0.0		42.0	5.0	NM_001242629	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	37	CCDS4524.1																																																																																			.		0.453	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988	
GKAP1	80318	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86403523	86403523	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:86403523T>C	ENST00000376371.2	-	5	831	c.431A>G	c.(430-432)cAc>cGc	p.H144R	GKAP1_ENST00000376365.3_Missense_Mutation_p.H144R	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	144					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						TACCTTTTTGTGCTCTTCATA	0.284																																					p.H144R		.											.	GKAP1	90	0			c.A431G						.						132.0	132.0	132.0					9																	86403523		2201	4299	6500	SO:0001583	missense	80318	exon5			TTTTTGTGCTCTT	BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.431A>G	9.37:g.86403523T>C	ENSP00000365550:p.His144Arg	70.0	0.0		52.0	14.0	NM_025211	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Missense_Mutation	SNP	ENST00000376371.2	37	CCDS35049.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.323040	0.41096	.	.	ENSG00000165113	ENST00000376371;ENST00000376365	.	.	.	5.42	4.28	0.50868	.	0.318671	0.38959	N	0.001511	T	0.48804	0.1520	L	0.57536	1.79	0.38161	D	0.939027	P;B	0.41848	0.763;0.004	P;B	0.44897	0.463;0.006	T	0.47100	-0.9143	9	0.19590	T	0.45	-12.2822	7.3735	0.26815	0.0:0.0742:0.1434:0.7825	.	144;144	Q5VSY0-2;Q5VSY0	.;GKAP1_HUMAN	R	144	.	ENSP00000365544:H144R	H	-	2	0	GKAP1	85593343	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.714000	0.47202	0.991000	0.38814	-0.386000	0.06593	CAC	.		0.284	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211	
GLYAT	10249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58477428	58477428	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:58477428C>G	ENST00000344743.3	-	6	843	c.702G>C	c.(700-702)ttG>ttC	p.L234F	GLYAT_ENST00000529732.1_Missense_Mutation_p.L234F	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	234					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	GGTATTCCGGCAAGGTGCCTG	0.537																																					p.L234F		.											.	GLYAT	90	0			c.G702C						.						63.0	61.0	61.0					11																	58477428		2201	4295	6496	SO:0001583	missense	10249	exon6			TTCCGGCAAGGTG	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.702G>C	11.37:g.58477428C>G	ENSP00000340200:p.Leu234Phe	79.0	0.0		101.0	20.0	NM_201648	O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	37	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939572	0.34189	.	.	ENSG00000149124	ENST00000344743;ENST00000529732	T;T	0.20463	2.07;2.07	6.06	1.9	0.25705	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	1.421900	0.04581	N	0.394958	T	0.43077	0.1231	M	0.81802	2.56	0.29804	N	0.832157	D	0.52996	0.957	P	0.59221	0.854	T	0.08827	-1.0703	10	0.54805	T	0.06	0.095	5.1614	0.15064	0.0:0.5944:0.1469:0.2587	.	234	Q6IB77	GLYAT_HUMAN	F	234	ENSP00000340200:L234F;ENSP00000431688:L234F	ENSP00000340200:L234F	L	-	3	2	GLYAT	58234004	0.245000	0.23899	0.234000	0.24042	0.060000	0.15804	-0.077000	0.11394	0.407000	0.25591	0.650000	0.86243	TTG	.		0.537	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1		
GPR124	25960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	37693203	37693203	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:37693203C>G	ENST00000412232.2	+	13	1978	c.1965C>G	c.(1963-1965)caC>caG	p.H655Q	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	655					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCCTCTTCCACAGCCACAGCA	0.647																																					p.H655Q		.											.	GPR124	157	0			c.C1965G						.						57.0	63.0	61.0					8																	37693203		2203	4299	6502	SO:0001583	missense	25960	exon13			CTTCCACAGCCAC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1965C>G	8.37:g.37693203C>G	ENSP00000406367:p.His655Gln	21.0	0.0		53.0	13.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621557	0.46736	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.54279	0.58	5.29	2.02	0.26589	.	0.278824	0.33772	N	0.004561	T	0.25680	0.0625	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.09907	-1.0653	10	0.24483	T	0.36	-27.3241	5.9515	0.19248	0.2893:0.5672:0.0:0.1435	.	655	Q96PE1	GP124_HUMAN	Q	648;655	ENSP00000406367:H655Q	ENSP00000406367:H655Q	H	+	3	2	GPR124	37812361	0.996000	0.38824	1.000000	0.80357	0.901000	0.52897	0.430000	0.21428	1.206000	0.43276	0.655000	0.94253	CAC	.		0.647	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
GRIK4	2900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	120831700	120831700	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:120831700A>T	ENST00000527524.2	+	17	2244	c.1957A>T	c.(1957-1959)Att>Ttt	p.I653F	GRIK4_ENST00000438375.2_Missense_Mutation_p.I653F	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	653					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GGATGTGCCCATTGAGTCAGT	0.527																																					p.I653F		.											.	GRIK4	92	0			c.A1957T						.						139.0	110.0	120.0					11																	120831700		2203	4299	6502	SO:0001583	missense	2900	exon15			GTGCCCATTGAGT	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1957A>T	11.37:g.120831700A>T	ENSP00000435648:p.Ile653Phe	81.0	0.0		76.0	22.0	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	A	33	5.202808	0.94997	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.64085	-0.08;-0.08	5.51	5.51	0.81932	Ionotropic glutamate receptor (2);	0.047918	0.85682	D	0.000000	T	0.77130	0.4085	M	0.73598	2.24	0.80722	D	1	P;D	0.62365	0.949;0.991	P;D	0.63033	0.722;0.91	T	0.80061	-0.1540	10	0.66056	D	0.02	.	15.3185	0.74102	1.0:0.0:0.0:0.0	.	653;653	A6H8K8;Q16099	.;GRIK4_HUMAN	F	653	ENSP00000435648:I653F;ENSP00000404063:I653F	ENSP00000404063:I653F	I	+	1	0	GRIK4	120336910	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.097000	0.63578	0.533000	0.62120	ATT	.		0.527	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
GSTA4	2941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	52858985	52858985	+	Silent	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:52858985C>A	ENST00000370959.1	-	2	174	c.57G>T	c.(55-57)gtG>gtT	p.V19V	GSTA4_ENST00000370960.1_5'UTR|GSTA4_ENST00000541324.1_5'UTR|RN7SK_ENST00000365328.1_RNA			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	19	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	AAACCCATCTCACGGACTCCA	0.478																																					p.V19V		.											.	GSTA4	90	0			c.G57T						.						85.0	87.0	86.0					6																	52858985		2203	4300	6503	SO:0001819	synonymous_variant	2941	exon2			CCATCTCACGGAC	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.57G>T	6.37:g.52858985C>A		42.0	0.0		55.0	15.0	NM_001512	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Silent	SNP	ENST00000370959.1	37	CCDS4948.1																																																																																			.		0.478	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1	NM_001512	
GTF3C2	2976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27552031	27552031	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:27552031G>C	ENST00000359541.2	-	14	2425	c.1996C>G	c.(1996-1998)Ccc>Gcc	p.P666A	GTF3C2_ENST00000264720.3_Missense_Mutation_p.P666A			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	666					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATTGTAGGGAAGCAGCCAG	0.517																																					p.C666G		.											.	GTF3C2	92	0			c.T1996G						.						178.0	181.0	180.0					2																	27552031		2203	4300	6503	SO:0001583	missense	2976	exon15			TGTAGGGAAGCAG	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1996C>G	2.37:g.27552031G>C	ENSP00000352536:p.Pro666Ala	65.0	0.0		97.0	25.0	NM_001521	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.68|10.68	1.417812|1.417812	0.25552|0.25552	.|.	.|.	ENSG00000115207|ENSG00000115207	ENST00000454704;ENST00000415683|ENST00000359541;ENST00000264720	.|T;T	.|0.71934	.|-0.61;-0.61	6.03|6.03	6.03|6.03	0.97812|0.97812	.|WD40 repeat-like-containing domain (1);	.|0.277859	.|0.37393	.|N	.|0.002111	T|T	0.55768|0.55768	0.1941|0.1941	N|N	0.24115|0.24115	0.695|0.695	0.40827|0.40827	D|D	0.983556|0.983556	.|P	.|0.38020	.|0.615	.|B	.|0.33196	.|0.159	T|T	0.55438|0.55438	-0.8141|-0.8141	5|10	.|0.13853	.|T	.|0.58	-15.2787|-15.2787	18.0604|18.0604	0.89375|0.89375	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|666	.|Q8WUA4	.|TF3C2_HUMAN	L|A	174;67|666	.|ENSP00000352536:P666A;ENSP00000264720:P666A	.|ENSP00000264720:P666A	F|P	-|-	3|1	2|0	GTF3C2|GTF3C2	27405535|27405535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	3.796000|3.796000	0.55507|0.55507	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	TTC|CCC	.		0.517	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
GUCY2C	2984	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14774139	14774139	+	Silent	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:14774139G>T	ENST00000261170.3	-	23	2749	c.2613C>A	c.(2611-2613)atC>atA	p.I871I	RP11-695J4.2_ENST00000542401.1_RNA|RP11-695J4.2_ENST00000545424.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	871	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACGCATCACCGATGGTTTCCA	0.443																																					p.I871I		.											.	GUCY2C	338	0			c.C2613A						.						184.0	166.0	172.0					12																	14774139		2203	4300	6503	SO:0001819	synonymous_variant	2984	exon23			ATCACCGATGGTT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2613C>A	12.37:g.14774139G>T		127.0	1.0		153.0	46.0	NM_004963	B2RMY6	Silent	SNP	ENST00000261170.3	37	CCDS8664.1																																																																																			.		0.443	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
HCCS	3052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	11139892	11139892	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:11139892G>C	ENST00000321143.4	+	7	971	c.769G>C	c.(769-771)Gac>Cac	p.D257H	HCCS_ENST00000380763.3_Missense_Mutation_p.D257H|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380762.4_Missense_Mutation_p.D257H	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	257					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						GGCAGTATGGGACAGAATGAA	0.403																																					p.D257H	Ovarian(86;1338 1347 1462 10340 37882)	.											.	HCCS	226	0			c.G769C						.						127.0	99.0	109.0					X																	11139892		2203	4300	6503	SO:0001583	missense	3052	exon7			GTATGGGACAGAA		CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.769G>C	X.37:g.11139892G>C	ENSP00000326579:p.Asp257His	33.0	0.0		32.0	15.0	NM_001122608	B3KUS1|Q502X8	Missense_Mutation	SNP	ENST00000321143.4	37	CCDS14139.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243512	0.79912	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.83506	-1.73;-1.73;-1.73	5.84	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.93327	0.7873	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94344	0.7573	10	0.66056	D	0.02	-36.3632	12.9185	0.58218	0.0:0.0:0.8366:0.1634	.	257	P53701	CCHL_HUMAN	H	257	ENSP00000326579:D257H;ENSP00000370140:D257H;ENSP00000370139:D257H	ENSP00000326579:D257H	D	+	1	0	HCCS	11049813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.239000	0.95389	1.197000	0.43143	0.600000	0.82982	GAC	.		0.403	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
HHIP	64399	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	145579960	145579960	+	Missense_Mutation	SNP	C	C	T	rs149715142		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:145579960C>T	ENST00000296575.3	+	3	1146	c.491C>T	c.(490-492)gCg>gTg	p.A164V	HHIP-AS1_ENST00000512359.1_RNA|HHIP_ENST00000511314.1_3'UTR|HHIP_ENST00000434550.2_Missense_Mutation_p.A164V	NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	164					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		CAAACAACTGCGGATGAGTTT	0.353																																					p.A164V		.											.	HHIP	283	0			c.C491T						.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	98.0	104.0	102.0		491	5.1	1.0	4	dbSNP_134	102	0,8600		0,0,4300	no	missense	HHIP	NM_022475.2	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	164/701	145579960	1,13005	2203	4300	6503	SO:0001583	missense	64399	exon3			CAACTGCGGATGA	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.491C>T	4.37:g.145579960C>T	ENSP00000296575:p.Ala164Val	126.0	1.0		99.0	16.0	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	ENST00000296575.3	37	CCDS3762.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727352	0.30593	2.27E-4	0.0	ENSG00000164161	ENST00000296575;ENST00000434550	T;T	0.77750	-1.12;-1.12	5.91	5.07	0.68467	Folate receptor-like (1);	0.289408	0.38605	N	0.001632	T	0.63010	0.2475	N	0.25144	0.715	0.49915	D	0.999838	B;B	0.25235	0.001;0.121	B;B	0.14023	0.005;0.01	T	0.57957	-0.7721	10	0.15952	T	0.53	-17.0762	14.5095	0.67774	0.0:0.9305:0.0:0.0695	.	164;164	Q96QV1;Q96QV1-2	HHIP_HUMAN;.	V	164	ENSP00000296575:A164V;ENSP00000408587:A164V	ENSP00000296575:A164V	A	+	2	0	HHIP	145799410	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	4.397000	0.59690	2.817000	0.96982	0.643000	0.83706	GCG	C|1.000;T|0.000		0.353	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
HIST1H3B	8358	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	26032209	26032209	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:26032209C>T	ENST00000244661.2	-	1	79	c.80G>A	c.(79-81)cGc>cAc	p.R27H		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	27					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CGCGCTCTTGCGAGCAGCCTT	0.612																																					p.R27H		.											.	HIST1H3B	92	0			c.G80A						.						67.0	82.0	77.0					6																	26032209		2161	4211	6372	SO:0001583	missense	8358	exon1			CTCTTGCGAGCAG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.80G>A	6.37:g.26032209C>T	ENSP00000244661:p.Arg27His	22.0	0.0		29.0	10.0	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	12.66	2.005280	0.35415	.	.	ENSG00000124693	ENST00000244661	T	0.46063	0.88	5.19	5.19	0.71726	.	.	.	.	.	T	0.53029	0.1771	.	.	.	0.43598	D	0.995951	.	.	.	.	.	.	T	0.53208	-0.8471	6	0.51188	T	0.08	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	H	27	ENSP00000244661:R27H	ENSP00000244661:R27H	R	-	2	0	HIST1H3B	26140188	1.000000	0.71417	0.994000	0.49952	0.013000	0.08279	7.633000	0.83260	2.577000	0.86979	0.561000	0.74099	CGC	.		0.612	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
IGSF3	3321	broad.mit.edu;bcgsc.ca	37	1	117158700	117158700	+	Splice_Site	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:117158700A>T	ENST00000369486.3	-	3	1187		c.e3+1		IGSF3_ENST00000318837.6_Splice_Site|IGSF3_ENST00000369483.1_Splice_Site	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3						lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GCTTCTCCTTACCCACTAGGT	0.468																																					.		.											.	IGSF3	92	0			c.421+2T>A						.						37.0	35.0	36.0					1																	117158700		2199	4291	6490	SO:0001630	splice_region_variant	3321	exon4			CTCCTTACCCACT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.421+1T>A	1.37:g.117158700A>T		295.0	1.0		342.0	75.0	NM_001542	A6NJZ6|A6NMC7	Splice_Site	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.864503	0.71949	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3061	0.54902	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF3	116960223	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	8.705000	0.91357	2.075000	0.62263	0.454000	0.30748	.	.		0.468	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	Intron
IL12A	3592	broad.mit.edu;bcgsc.ca	37	3	159713218	159713218	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:159713218C>T	ENST00000305579.2	+	7	941	c.634C>T	c.(634-636)Cca>Tca	p.P212S	IL12A-AS1_ENST00000497452.1_RNA|IL12A-AS1_ENST00000462431.1_RNA|IL12A_ENST00000466512.1_Missense_Mutation_p.P198S|IL12A_ENST00000480787.1_Missense_Mutation_p.P174S	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	178					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGAGACTGTGCCACAAAAATC	0.363																																					p.P212S		.											.	IL12A	90	0			c.C634T						.						94.0	94.0	94.0					3																	159713218		2203	4300	6503	SO:0001583	missense	3592	exon7			ACTGTGCCACAAA	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.634C>T	3.37:g.159713218C>T	ENSP00000303231:p.Pro212Ser	176.0	1.0		148.0	6.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	37	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812074	0.50527	.	.	ENSG00000168811	ENST00000305579;ENST00000480787;ENST00000466512	.	.	.	5.48	1.7	0.24286	.	1.234140	0.05295	N	0.521908	T	0.63094	0.2482	M	0.77103	2.36	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.26467	-1.0102	9	0.72032	D	0.01	0.5004	4.3917	0.11343	0.1559:0.5932:0.0:0.251	.	212	O60595	.	S	212;174;198	.	ENSP00000303231:P212S	P	+	1	0	IL12A	161195912	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.370000	0.07523	0.032000	0.15435	-0.182000	0.12963	CCA	.		0.363	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76715138	76715138	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:76715138T>A	ENST00000369950.3	-	10	1190	c.1001A>T	c.(1000-1002)gAa>gTa	p.E334V	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ATGATAGACTTCCTCACTTTC	0.443																																					p.E334V	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1	93	0			c.A1001T						.						181.0	163.0	169.0					6																	76715138		2203	4300	6503	SO:0001583	missense	3617	exon10			TAGACTTCCTCAC	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1001A>T	6.37:g.76715138T>A	ENSP00000358966:p.Glu334Val	344.0	0.0		358.0	79.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	T	2.784	-0.252760	0.05829	.	.	ENSG00000112706	ENST00000369950	T	0.37752	1.18	5.01	1.07	0.20283	SEA (2);	1.053100	0.07418	N	0.893510	T	0.05547	0.0146	N	0.08118	0	0.20764	N	0.999854	B	0.13145	0.007	B	0.13407	0.009	T	0.38520	-0.9657	10	0.30078	T	0.28	.	3.9146	0.09217	0.1611:0.4147:0.0:0.4242	.	334	Q17R60	IMPG1_HUMAN	V	334	ENSP00000358966:E334V	ENSP00000358966:E334V	E	-	2	0	IMPG1	76771858	0.280000	0.24249	0.040000	0.18447	0.273000	0.26683	0.498000	0.22530	-0.088000	0.12506	-0.472000	0.04984	GAA	.		0.443	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
INPPL1	3636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	71948271	71948271	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:71948271C>T	ENST00000298229.2	+	26	3187	c.2983C>T	c.(2983-2985)Cag>Tag	p.Q995*	INPPL1_ENST00000541756.1_Nonsense_Mutation_p.Q753*|PHOX2A_ENST00000544057.1_5'Flank|INPPL1_ENST00000538751.1_Nonsense_Mutation_p.Q753*	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	995	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GGTCCCGCACCAGCTGCTGCC	0.637																																					p.Q995X		.											.	INPPL1	660	0			c.C2983T						.						79.0	95.0	90.0					11																	71948271		2200	4293	6493	SO:0001587	stop_gained	3636	exon26			CCGCACCAGCTGC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2983C>T	11.37:g.71948271C>T	ENSP00000298229:p.Gln995*	30.0	0.0		35.0	10.0	NM_001567	B2RTX5|Q13577|Q13578	Nonsense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	c	36	5.719986	0.96839	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751;ENST00000541752	.	.	.	5.19	5.19	0.71726	.	0.075721	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	16.1928	0.82004	0.0:1.0:0.0:0.0	.	.	.	.	X	995;753;753;8	.	ENSP00000298229:Q995X	Q	+	1	0	INPPL1	71625919	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.125000	0.77193	2.414000	0.81942	0.462000	0.41574	CAG	.		0.637	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
IQGAP1	8826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91017734	91017734	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr15:91017734C>T	ENST00000268182.5	+	23	2717	c.2593C>T	c.(2593-2595)Cct>Tct	p.P865S	IQGAP1_ENST00000560020.1_3'UTR|IQGAP1_ENST00000560738.1_Missense_Mutation_p.P293S	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	865					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGAGGATCCTCCTATGGTTGT	0.433																																					p.P865S		.											.	IQGAP1	950	0			c.C2593T						.						98.0	98.0	98.0					15																	91017734		2198	4298	6496	SO:0001583	missense	8826	exon23			GATCCTCCTATGG	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.2593C>T	15.37:g.91017734C>T	ENSP00000268182:p.Pro865Ser	92.0	0.0		101.0	28.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601469	0.87055	.	.	ENSG00000140575	ENST00000268182	T	0.02974	4.09	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	M	0.63169	1.94	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.04041	-1.0982	10	0.32370	T	0.25	-15.6881	17.2199	0.86954	0.0:1.0:0.0:0.0	.	865	P46940	IQGA1_HUMAN	S	865	ENSP00000268182:P865S	ENSP00000268182:P865S	P	+	1	0	IQGAP1	88818738	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	5.781000	0.68964	2.606000	0.88127	0.591000	0.81541	CCT	.		0.433	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
ITSN1	6453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	35172168	35172168	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr21:35172168G>A	ENST00000381318.3	+	19	2527	c.2239G>A	c.(2239-2241)Gca>Aca	p.A747T	ITSN1_ENST00000399352.1_Missense_Mutation_p.A747T|ITSN1_ENST00000399338.4_Missense_Mutation_p.A747T|ITSN1_ENST00000399367.3_Missense_Mutation_p.A747T|ITSN1_ENST00000379960.5_Missense_Mutation_p.A747T|ITSN1_ENST00000381291.4_Missense_Mutation_p.A747T|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399353.1_Missense_Mutation_p.A710T|ITSN1_ENST00000399349.1_Missense_Mutation_p.A747T|ITSN1_ENST00000437442.2_Missense_Mutation_p.A747T|ITSN1_ENST00000399355.2_Missense_Mutation_p.A747T|ITSN1_ENST00000381285.4_Missense_Mutation_p.A747T|ITSN1_ENST00000399326.3_Missense_Mutation_p.A747T	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	747	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GTATTACCGGGCACTGTACCC	0.408																																					p.A747T		.											.	ITSN1	94	0			c.G2239A						.						97.0	96.0	97.0					21																	35172168		2203	4300	6503	SO:0001583	missense	6453	exon19			TACCGGGCACTGT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2239G>A	21.37:g.35172168G>A	ENSP00000370719:p.Ala747Thr	44.0	0.0		31.0	8.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692345	0.88735	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	5.65	5.65	0.86999	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.84229	0.5426	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.999;1.0;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;0.996;0.999;0.999;0.997;0.999;0.999;0.999;1.0	D	0.85856	0.1407	10	0.87932	D	0	.	19.7272	0.96168	0.0:0.0:1.0:0.0	.	710;710;710;747;747;747;747;747;747;710	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	T	710;747;747;747;747;747;747;747;747;747;747;747;747;747	ENSP00000382290:A710T;ENSP00000370719:A747T;ENSP00000370691:A747T;ENSP00000370685:A747T;ENSP00000382301:A747T;ENSP00000382289:A747T;ENSP00000382292:A747T;ENSP00000382286:A747T;ENSP00000382275:A747T;ENSP00000387377:A747T;ENSP00000382265:A747T;ENSP00000369294:A747T	ENSP00000369294:A747T	A	+	1	0	ITSN1	34094038	1.000000	0.71417	0.854000	0.33618	0.680000	0.39746	8.502000	0.90505	2.673000	0.90976	0.557000	0.71058	GCA	.		0.408	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
KDM7A	80853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139819020	139819020	+	Splice_Site	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:139819020C>A	ENST00000397560.2	-	9	1237		c.e9-1		JHDM1D_ENST00000006967.5_Splice_Site	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN							histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					CTCATAACACCTAAATGAGTT	0.308																																					.		.											.	JHDM1D	91	0			c.1140-1G>T						.						76.0	73.0	74.0					7																	139819020		1783	4055	5838	SO:0001630	splice_region_variant	80853	exon10			TAACACCTAAATG																												ENST00000397560.2:c.1140-1G>T	7.37:g.139819020C>A		110.0	0.0		81.0	23.0	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Splice_Site	SNP	ENST00000397560.2	37	CCDS43658.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164077	0.78339	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3681	0.98887	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JHDM1D	139465489	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.776000	0.85560	2.890000	0.99128	0.655000	0.94253	.	.		0.308	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		Intron
JKAMP	51528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	59965466	59965466	+	Nonsense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:59965466T>G	ENST00000261247.9	+	5	627	c.480T>G	c.(478-480)taT>taG	p.Y160*	RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000425728.2_Nonsense_Mutation_p.Y154*|JKAMP_ENST00000554271.1_Nonsense_Mutation_p.Y174*|JKAMP_ENST00000356057.5_Nonsense_Mutation_p.Y168*	NM_001098625.1|NM_001284203.1|NM_016475.3	NP_001092095.1|NP_001271132.1|NP_057559.2	Q9P055	JKAMP_HUMAN	JNK1/MAPK8-associated membrane protein	175					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						TATTTATCTATTACGCATTCT	0.284																																					p.Y160X		.											.	JKAMP	67	0			c.T480G						.						68.0	60.0	63.0					14																	59965466		1810	4074	5884	SO:0001587	stop_gained	51528	exon5			TATCTATTACGCA	AF212245	CCDS45116.1, CCDS45117.1, CCDS61462.1, CCDS61463.1	14q22.3	2014-02-14	2009-08-13	2009-08-13	ENSG00000050130	ENSG00000050130			20184	protein-coding gene	gene with protein product	"""Jun N-terminal kinase 1-associated membrane protein"""	611176	"""chromosome 14 open reading frame 100"""	C14orf100		16166642, 19269966	Standard	NM_001284202		Approved	HSPC213, JAMP, HSPC327, CDA06	uc001xef.4	Q9P055	OTTHUMG00000171054	ENST00000261247.9:c.480T>G	14.37:g.59965466T>G	ENSP00000261247:p.Tyr160*	140.0	0.0		108.0	29.0	NM_016475	B4DP67|Q6FIB6|Q6IAJ2|Q7Z5D4|Q86SY6|Q9H0Q6|Q9H2W0|Q9HAH5|Q9P0R3	Nonsense_Mutation	SNP	ENST00000261247.9	37	CCDS45116.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552834	0.65425	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000554271;ENST00000554795;ENST00000356057	.	.	.	5.5	-1.27	0.09347	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-52.5972	10.7707	0.46321	0.0:0.4043:0.0:0.5957	.	.	.	.	X	160;154;174;168;168	.	ENSP00000261247:Y160X	Y	+	3	2	JKAMP	59035219	0.995000	0.38212	0.995000	0.50966	0.988000	0.76386	0.369000	0.20416	-0.137000	0.11455	0.533000	0.62120	TAT	.		0.284	JKAMP-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411430.1	NM_001098625	
KCNJ4	3761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38823337	38823337	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:38823337C>A	ENST00000303592.3	-	2	1059	c.801G>T	c.(799-801)gaG>gaT	p.E267D	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	267					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GCGGGCTGTCCTCGTCGATCT	0.612																																					p.E267D		.											.	KCNJ4	90	0			c.G801T						.						92.0	76.0	82.0					22																	38823337		2203	4300	6503	SO:0001583	missense	3761	exon2			GCTGTCCTCGTCG	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.801G>T	22.37:g.38823337C>A	ENSP00000306497:p.Glu267Asp	39.0	0.0		62.0	24.0	NM_004981	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	37	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067975	0.36470	.	.	ENSG00000168135	ENST00000303592	D	0.92595	-3.07	4.94	3.79	0.43588	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.112974	0.64402	D	0.000017	D	0.90256	0.6953	M	0.69523	2.12	0.40481	D	0.980449	B	0.06786	0.001	B	0.12837	0.008	D	0.87653	0.2529	10	0.62326	D	0.03	.	10.6862	0.45843	0.0:0.8325:0.0:0.1675	.	267	P48050	IRK4_HUMAN	D	267	ENSP00000306497:E267D	ENSP00000306497:E267D	E	-	3	2	KCNJ4	37153283	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.255000	0.32909	1.066000	0.40716	0.555000	0.69702	GAG	.		0.612	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
KCTD16	57528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	143586733	143586733	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:143586733C>T	ENST00000507359.3	+	2	1547	c.456C>T	c.(454-456)ccC>ccT	p.P152P	KCTD16_ENST00000512467.1_Silent_p.P152P	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	152					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GAATCTGCCCCCCTTCCTCCC	0.547																																					p.P152P		.											.	KCTD16	137	0			c.C456T						.						81.0	87.0	85.0					5																	143586733		2203	4300	6503	SO:0001819	synonymous_variant	57528	exon3			CTGCCCCCCTTCC	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.456C>T	5.37:g.143586733C>T		72.0	0.0		77.0	21.0	NM_020768	Q9P2M9	Silent	SNP	ENST00000507359.3	37	CCDS34260.1																																																																																			.		0.547	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
KDR	3791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55955862	55955862	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:55955862G>A	ENST00000263923.4	-	24	3595	c.3300C>T	c.(3298-3300)tcC>tcT	p.S1100S	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACTTACCTAAGGAAAATATTT	0.408			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.S1100S		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	2298	0			c.C3300T						.						123.0	133.0	130.0					4																	55955862		2203	4300	6503	SO:0001819	synonymous_variant	3791	exon24			ACCTAAGGAAAAT	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3300C>T	4.37:g.55955862G>A		139.0	0.0		120.0	28.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																			.		0.408	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
SPIDR	23514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	48508456	48508456	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:48508456C>G	ENST00000297423.4	+	9	1565	c.1181C>G	c.(1180-1182)tCa>tGa	p.S394*	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Nonsense_Mutation_p.S324*|SPIDR_ENST00000518074.1_Nonsense_Mutation_p.S334*	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	394	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AAAGAAGATTCAGAAAAAACT	0.378																																					p.S394X		.											.	KIAA0146	68	0			c.C1181G						.						101.0	94.0	96.0					8																	48508456		1824	4088	5912	SO:0001587	stop_gained	23514	exon9			AAGATTCAGAAAA	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1181C>G	8.37:g.48508456C>G	ENSP00000297423:p.Ser394*	156.0	0.0		119.0	31.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Nonsense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.080166|5.080166	0.94050|0.94050	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.|.	.|.	.|.	5.3|5.3	4.43|4.43	0.53597|0.53597	.|.	.|0.513015	.|0.18585	.|N	.|0.136900	T|.	0.52741|.	0.1753|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.61168|.	-0.7117|.	3|.	.|0.27082	.|T	.|0.32	.|.	11.43|11.43	0.50034|0.50034	0.0:0.9141:0.0:0.0859|0.0:0.9141:0.0:0.0859	.|.	.|.	.|.	.|.	E|X	76|394;334;324;83	.|.	.|ENSP00000297423:S394X	Q|S	+|+	1|2	0|0	KIAA0146|KIAA0146	48671009|48671009	0.915000|0.915000	0.31059|0.31059	0.020000|0.020000	0.16555|0.16555	0.257000|0.257000	0.26127|0.26127	1.656000|1.656000	0.37355|0.37355	1.376000|1.376000	0.46267|0.46267	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.		0.378	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
KIAA1033	23325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	105509006	105509006	+	Splice_Site	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:105509006A>T	ENST00000332180.5	+	5	453	c.366A>T	c.(364-366)ggA>ggT	p.G122G		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ATGGAGAAGGAGGTAAGTTTA	0.259																																					p.G122G		.											.	KIAA1033	91	0			c.A366T						.						64.0	59.0	61.0					12																	105509006		1781	4040	5821	SO:0001630	splice_region_variant	23325	exon5			AGAAGGAGGTAAG	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.367+1A>T	12.37:g.105509006A>T		562.0	1.0		404.0	80.0	NM_015275		Silent	SNP	ENST00000332180.5	37	CCDS41826.1																																																																																			.		0.259	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	Silent
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200973575	200973575	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:200973575C>A	ENST00000422435.2	-	7	1225	c.909G>T	c.(907-909)ttG>ttT	p.L303F	KIF21B_ENST00000332129.2_Missense_Mutation_p.L303F|KIF21B_ENST00000360529.5_Missense_Mutation_p.L303F|KIF21B_ENST00000461742.2_Missense_Mutation_p.L303F	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	303	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TCACATTGCCCAAGGCCAGCT	0.602																																					p.L303F		.											.	KIF21B	96	0			c.G909T						.						67.0	53.0	58.0					1																	200973575		2203	4298	6501	SO:0001583	missense	23046	exon7			ATTGCCCAAGGCC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.909G>T	1.37:g.200973575C>A	ENSP00000411831:p.Leu303Phe	59.0	0.0		95.0	23.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	c	25.6	4.652874	0.88056	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.59	5.59	0.84812	Kinesin, motor domain (3);	0.000000	0.64402	D	0.000004	D	0.95258	0.8462	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	D	0.95779	0.8815	10	0.87932	D	0	.	14.4547	0.67409	0.1472:0.8528:0.0:0.0	.	303;303;303;303	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	F	303	ENSP00000328494:L303F;ENSP00000353724:L303F;ENSP00000433808:L303F;ENSP00000411831:L303F	ENSP00000328494:L303F	L	-	3	2	KIF21B	199240198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.129000	0.50500	2.632000	0.89209	0.580000	0.79431	TTG	.		0.602	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KLF6	1316	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	3824157	3824157	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:3824157C>A	ENST00000497571.1	-	2	612	c.352G>T	c.(352-354)Gaa>Taa	p.E118*	KLF6_ENST00000469435.1_Nonsense_Mutation_p.E118*|KLF6_ENST00000173785.4_5'UTR|KLF6_ENST00000542957.1_Nonsense_Mutation_p.E118*	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	118					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GGAGAAAGTTCCTCGGAGCTG	0.532											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E118X		.											.	KLF6	1134	0			c.G352T						.						143.0	152.0	149.0					10																	3824157		2203	4300	6503	SO:0001587	stop_gained	1316	exon2			AAAGTTCCTCGGA	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.352G>T	10.37:g.3824157C>A	ENSP00000419923:p.Glu118*	149.0	1.0	614	181.0	54.0	NM_001160125	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Nonsense_Mutation	SNP	ENST00000497571.1	37	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	C	37	6.141043	0.97320	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	17.2727	0.87106	0.0:1.0:0.0:0.0	.	.	.	.	X	118	.	ENSP00000419079:E118X	E	-	1	0	KLF6	3814157	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	7.371000	0.79600	2.309000	0.77851	0.561000	0.74099	GAA	.		0.532	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
KRT72	140807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52979897	52979897	+	Missense_Mutation	SNP	C	C	A	rs34119325	byFrequency	TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:52979897C>A	ENST00000537672.2	-	9	1415	c.1405G>T	c.(1405-1407)Gcc>Tcc	p.A469S	KRT72_ENST00000354310.4_Missense_Mutation_p.A427S|KRT72_ENST00000398066.3_Missense_Mutation_p.A281S|KRT72_ENST00000293745.2_Missense_Mutation_p.A469S	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	469	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CTGCTTGAGGCGCCAAAGCCC	0.577																																					p.A469S		.											.	KRT72	96	0			c.G1405T						.						69.0	63.0	65.0					12																	52979897		2203	4300	6503	SO:0001583	missense	140807	exon9			TTGAGGCGCCAAA	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1405G>T	12.37:g.52979897C>A	ENSP00000441160:p.Ala469Ser	48.0	0.0		71.0	10.0	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	C	0.986	-0.695433	0.03303	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	T;T;D;T	0.81908	-1.48;-1.48;-1.55;-1.21	4.18	-3.48	0.04739	.	0.883800	0.09298	N	0.821369	T	0.68769	0.3037	N	0.24115	0.695	0.09310	N	1	B;B	0.16166	0.013;0.016	B;B	0.12837	0.004;0.008	T	0.51260	-0.8728	10	0.28530	T	0.3	.	10.3711	0.44055	0.0:0.3612:0.0:0.6388	.	427;469	B4DEI8;Q14CN4	.;K2C72_HUMAN	S	469;469;427;281	ENSP00000441160:A469S;ENSP00000293745:A469S;ENSP00000346269:A427S;ENSP00000446151:A281S	ENSP00000293745:A469S	A	-	1	0	KRT72	51266164	0.000000	0.05858	0.005000	0.12908	0.029000	0.11900	-1.188000	0.03064	-0.683000	0.05190	-1.538000	0.00913	GCC	C|0.996;T|0.004		0.577	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
KRTAP7-1	337878	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	32201797	32201797	+	RNA	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr21:32201797T>G	ENST00000452750.1	-	0	281							Q8IUC3	KRA71_HUMAN	keratin associated protein 7-1 (gene/pseudogene)							intermediate filament (GO:0005882)											CCCCATGGCCTATAGAAGCTA	0.522																																					p.R74R		.											.	.	.	0			c.A220C						.						50.0	55.0	53.0					21																	32201797		692	1591	2283			337878	exon2			ATGGCCTATAGAA	AJ457063	CCDS74780.1	21q22.1	2014-04-10	2010-03-12		ENSG00000184586	ENSG00000274749		"""Keratin associated proteins"""	18934	protein-coding gene	gene with protein product			"""keratin associated protein 7-1"""			12359730	Standard	NM_181606		Approved	KAP7.1	uc011adj.2	Q8IUC3	OTTHUMG00000188305		21.37:g.32201797T>G		69.0	0.0		98.0	25.0	NM_181606	Q3LI56	Silent	SNP	ENST00000452750.1	37																																																																																				.		0.522	KRTAP7-1-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000128248.3	NM_181606	
LGALS9B	284194	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	20354888	20354888	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:20354888G>C	ENST00000423676.3	-	10	893	c.830C>G	c.(829-831)gCt>gGt	p.A277G	LGALS9B_ENST00000324290.5_Missense_Mutation_p.A276G			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	277	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						ACGGACCACAGCATTCTCATC	0.572																																					p.A276G		.											.	LGALS9B	23	0			c.C827G						.						19.0	20.0	20.0					17																	20354888		2124	4180	6304	SO:0001583	missense	284194	exon10			ACCACAGCATTCT		CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.830C>G	17.37:g.20354888G>C	ENSP00000388841:p.Ala277Gly	234.0	0.0		297.0	83.0	NM_001042685	A6NLF8|A8K2J8	Missense_Mutation	SNP	ENST00000423676.3	37		.	.	.	.	.	.	.	.	.	.	G	6.907	0.536891	0.13188	.	.	ENSG00000170298	ENST00000423676;ENST00000324290	.	.	.	1.97	0.917	0.19380	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.653418	0.14891	N	0.292415	T	0.59142	0.2172	M	0.80982	2.52	0.09310	N	1	P;B	0.43885	0.82;0.05	P;B	0.53954	0.738;0.095	T	0.50600	-0.8809	9	0.62326	D	0.03	.	7.0179	0.24899	0.1605:0.0:0.8395:0.0	.	277;276	Q3B8N2;Q3B8N2-2	LEG9B_HUMAN;.	G	276;277	.	ENSP00000315564:A277G	A	-	2	0	LGALS9B	20295480	0.000000	0.05858	0.047000	0.18901	0.422000	0.31414	0.246000	0.18160	0.369000	0.24510	0.194000	0.17425	GCT	.		0.572	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2	NM_001042685	
LRRIQ1	84125	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85450424	85450424	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:85450424C>T	ENST00000393217.2	+	8	1914	c.1853C>T	c.(1852-1854)tCa>tTa	p.S618L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	618										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TCACTAACATCAGAAAATTCC	0.284																																					p.S618L		.											.	LRRIQ1	95	0			c.C1853T						.						24.0	25.0	24.0					12																	85450424		2187	4287	6474	SO:0001583	missense	84125	exon8			TAACATCAGAAAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1853C>T	12.37:g.85450424C>T	ENSP00000376910:p.Ser618Leu	218.0	1.0		169.0	32.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	8.551	0.875470	0.17395	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.48522	0.81	5.32	-1.03	0.10102	.	1.570580	0.04054	N	0.305207	T	0.28830	0.0715	N	0.22421	0.69	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09574	-1.0668	10	0.26408	T	0.33	.	1.1532	0.01790	0.1916:0.336:0.1473:0.3251	.	618;593	Q96JM4;C9JI57	LRIQ1_HUMAN;.	L	618;593;618	ENSP00000376910:S618L	ENSP00000256007:S618L	S	+	2	0	LRRIQ1	83974555	0.917000	0.31117	0.047000	0.18901	0.025000	0.11179	0.490000	0.22403	-0.015000	0.14150	0.591000	0.81541	TCA	.		0.284	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
LRRTM4	80059	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	77745674	77745674	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:77745674A>G	ENST00000409093.1	-	3	1657	c.1321T>C	c.(1321-1323)Ttg>Ctg	p.L441L	LRRTM4_ENST00000409884.1_Silent_p.L441L|LRRTM4_ENST00000409282.1_Silent_p.L442L|LRRTM4_ENST00000409911.1_Silent_p.L442L|LRRTM4_ENST00000409088.3_Silent_p.L441L			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	441					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TAGATCACCAAGAGGATCATG	0.483																																					p.L441L		.											.	LRRTM4	94	0			c.T1321C						.						66.0	67.0	67.0					2																	77745674		1987	4174	6161	SO:0001819	synonymous_variant	80059	exon3			TCACCAAGAGGAT	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1321T>C	2.37:g.77745674A>G		141.0	1.0		158.0	55.0	NM_024993	Q4FZ98|Q6UXJ7	Silent	SNP	ENST00000409093.1	37	CCDS46346.1																																																																																			.		0.483	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
LY75	4065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160665051	160665051	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:160665051A>T	ENST00000263636.4	-	33	4758	c.4731T>A	c.(4729-4731)gaT>gaA	p.D1577E	LY75_ENST00000553424.1_Missense_Mutation_p.D1577E|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.D1577E|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.D1577E|LY75_ENST00000554112.1_Missense_Mutation_p.D1577E	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1577	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TCTCATCTTCATCTTTTATGG	0.343																																					p.D1577E		.											.	LY75	90	0			c.T4731A						.						170.0	167.0	168.0					2																	160665051		2202	4299	6501	SO:0001583	missense	4065	exon33			ATCTTCATCTTTT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4731T>A	2.37:g.160665051A>T	ENSP00000263636:p.Asp1577Glu	163.0	0.0		140.0	40.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495988	0.64186	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0	5.55	4.35	0.52113	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.462627	0.16025	U	0.233157	T	0.25865	0.0630	M	0.87971	2.92	0.42835	D	0.994038	P;P;B	0.44946	0.846;0.84;0.433	P;P;B	0.48334	0.557;0.574;0.164	T	0.05971	-1.0853	10	0.56958	D	0.05	-13.1038	11.6348	0.51198	0.8671:0.0:0.0:0.1329	.	1577;1577;1577	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	E	1577	ENSP00000451511:D1577E;ENSP00000451446:D1577E;ENSP00000263636:D1577E;ENSP00000423463:D1577E;ENSP00000421035:D1577E	ENSP00000423463:D1577E	D	-	3	2	LY75;LY75-CD302	160373297	1.000000	0.71417	0.996000	0.52242	0.882000	0.50991	2.724000	0.47285	2.105000	0.64084	0.402000	0.26972	GAT	.		0.343	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
MAN2B1	4125	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12776599	12776599	+	Silent	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:12776599C>G	ENST00000456935.2	-	2	220	c.180G>C	c.(178-180)ccG>ccC	p.P60P	WDR83_ENST00000418543.3_5'Flank|CTD-2192J16.24_ENST00000597961.1_Silent_p.P57P|MAN2B1_ENST00000221363.4_Silent_p.P60P	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	60					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAGCATGTTCGGCTGCACTG	0.547																																					p.P60P		.											.	MAN2B1	94	0			c.G180C						.						119.0	91.0	100.0					19																	12776599		2203	4300	6503	SO:0001819	synonymous_variant	4125	exon2			CATGTTCGGCTGC		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.180G>C	19.37:g.12776599C>G		67.0	1.0		100.0	33.0	NM_001173498	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	CCDS32919.1																																																																																			.		0.547	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
MBD1	4152	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	47800056	47800056	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr18:47800056C>A	ENST00000591416.1	-	12	1755	c.1324G>T	c.(1324-1326)Gaa>Taa	p.E442*	MBD1_ENST00000382948.5_Nonsense_Mutation_p.E442*|MBD1_ENST00000585672.1_Nonsense_Mutation_p.E392*|MBD1_ENST00000339998.6_Nonsense_Mutation_p.E442*|MBD1_ENST00000349085.2_Nonsense_Mutation_p.E386*|MBD1_ENST00000353909.3_Nonsense_Mutation_p.E393*|MBD1_ENST00000269471.5_Nonsense_Mutation_p.E419*|MBD1_ENST00000585595.1_Nonsense_Mutation_p.E467*|MBD1_ENST00000587605.1_Nonsense_Mutation_p.E386*|MBD1_ENST00000347968.3_Nonsense_Mutation_p.E386*|MBD1_ENST00000398488.1_Nonsense_Mutation_p.E386*|MBD1_ENST00000591535.1_Nonsense_Mutation_p.E419*|MBD1_ENST00000398495.2_Nonsense_Mutation_p.E411*|MBD1_ENST00000269468.5_Nonsense_Mutation_p.E442*|MBD1_ENST00000424334.2_Nonsense_Mutation_p.E493*|MBD1_ENST00000436910.1_Nonsense_Mutation_p.E419*|MBD1_ENST00000457839.2_Nonsense_Mutation_p.E467*|MBD1_ENST00000398493.1_Nonsense_Mutation_p.E386*|MBD1_ENST00000588937.1_Nonsense_Mutation_p.E419*|MBD1_ENST00000590208.1_Nonsense_Mutation_p.E442*			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	442					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CCACCTGCTTCCTGCTTCGTT	0.632																																					p.E467X		.											.	MBD1	228	0			c.G1399T						.						95.0	82.0	86.0					18																	47800056		2203	4300	6503	SO:0001587	stop_gained	4152	exon13			CTGCTTCCTGCTT	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1324G>T	18.37:g.47800056C>A	ENSP00000467017:p.Glu442*	83.0	1.0		95.0	26.0	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Nonsense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727589	0.89390	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	.	.	.	4.06	3.16	0.36331	.	0.227351	0.30695	N	0.009071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-11.5838	9.5813	0.39490	0.0:0.7744:0.2256:0.0	.	.	.	.	X	442;393;386;442;386;419;419;493;442;442;467;386;386	.	ENSP00000269468:E442X	E	-	1	0	MBD1	46054054	0.998000	0.40836	0.997000	0.53966	0.669000	0.39330	1.152000	0.31663	1.249000	0.43950	0.555000	0.69702	GAA	.		0.632	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
MCCC2	64087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	70936898	70936898	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:70936898T>A	ENST00000340941.6	+	11	1197	c.1068T>A	c.(1066-1068)gtT>gtA	p.V356V	MCCC2_ENST00000509358.2_Silent_p.V356V|MCCC2_ENST00000323375.8_Silent_p.V318V	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	356	Acyl-CoA binding. {ECO:0000255}.|Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ACACATTAGTTACAGGTATAA	0.373																																					p.V356V		.											.	MCCC2	23	0			c.T1068A						.						106.0	100.0	102.0					5																	70936898		2203	4300	6503	SO:0001819	synonymous_variant	64087	exon11			ATTAGTTACAGGT	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.1068T>A	5.37:g.70936898T>A		88.0	0.0		93.0	19.0	NM_022132	A6NIY9|Q96C27|Q9Y4L7	Silent	SNP	ENST00000340941.6	37	CCDS34184.1																																																																																			.		0.373	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		
MED24	9862	ucsc.edu;bcgsc.ca	37	17	38185195	38185195	+	Silent	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:38185195T>C	ENST00000394128.2	-	14	1374	c.1293A>G	c.(1291-1293)tcA>tcG	p.S431S	MED24_ENST00000356271.3_Silent_p.S418S|MED24_ENST00000394127.2_Silent_p.S418S|MED24_ENST00000501516.3_Silent_p.S450S|MED24_ENST00000394126.1_Silent_p.S456S|SNORD124_ENST00000459577.1_RNA	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	431					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GTCCCTCCGGTGACTTAGAGT	0.582																																					p.S431S		.											.	MED24	187	0			c.A1293G						.						58.0	59.0	59.0					17																	38185195		2203	4300	6503	SO:0001819	synonymous_variant	9862	exon14			CTCCGGTGACTTA	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1293A>G	17.37:g.38185195T>C		53.0	1.0		43.0	5.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	37	CCDS11359.1																																																																																			.		0.582	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
MIR450A1	554214	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	133674546	133674546	+	RNA	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:133674546T>C	ENST00000362262.1	-	0	0				MIR450B_ENST00000401182.1_RNA|MIR542_ENST00000385050.1_RNA|MIR450A2_ENST00000385022.1_RNA	NR_029962.1				microRNA 450a-1																		CCCCATATTATTGATACAAAA	0.343																																					.		.											.	.	.	0			.						.						170.0	132.0	143.0					X																	133674546		1567	3581	5148			574505	.			ATATTATTGATAC			Xq26.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000199132	ENSG00000199132		"""ncRNAs / Micro RNAs"""	28008	non-coding RNA	RNA, micro			"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1			Standard	NR_029962		Approved	hsa-mir-450, hsa-mir-450-1, hsa-mir-450a-1	uc011mvl.2				X.37:g.133674546T>C		319.0	0.0		219.0	117.0	.		RNA	SNP	ENST00000362262.1	37																																																																																				.		0.343	MIR450A1-201	KNOWN	basic	miRNA	miRNA		NR_029962	
MME	4311	broad.mit.edu;bcgsc.ca	37	3	154832794	154832794	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:154832794A>G	ENST00000460393.1	+	4	328	c.208A>G	c.(208-210)Atc>Gtc	p.I70V	MME_ENST00000477669.1_3'UTR|MME_ENST00000462745.1_Missense_Mutation_p.I70V|MME_ENST00000493237.1_Missense_Mutation_p.I70V|MME_ENST00000360490.2_Missense_Mutation_p.I70V|MME_ENST00000492661.1_Missense_Mutation_p.I70V	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	70					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TGCTCGACTGATCCAAAACAT	0.438																																					p.I70V		.											.	MME	516	0			c.A208G						.						110.0	107.0	108.0					3																	154832794		2203	4300	6503	SO:0001583	missense	4311	exon4			CGACTGATCCAAA		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.208A>G	3.37:g.154832794A>G	ENSP00000418525:p.Ile70Val	95.0	1.0		93.0	5.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.315585	0.40996	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000481828;ENST00000462745;ENST00000493237;ENST00000360490;ENST00000491026;ENST00000473730;ENST00000462837	D;D;D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.46	5.46	0.80206	.	0.154476	0.56097	D	0.000039	T	0.75649	0.3878	L	0.50333	1.59	0.46061	D	0.998844	B	0.09022	0.002	B	0.08055	0.003	T	0.72017	-0.4417	10	0.48119	T	0.1	-16.2573	12.6433	0.56721	0.8624:0.1376:0.0:0.0	.	70	P08473	NEP_HUMAN	V	70	ENSP00000420389:I70V;ENSP00000418525:I70V;ENSP00000420101:I70V;ENSP00000419653:I70V;ENSP00000417079:I70V;ENSP00000353679:I70V;ENSP00000418791:I70V;ENSP00000420542:I70V;ENSP00000417595:I70V	ENSP00000353679:I70V	I	+	1	0	MME	156315488	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.085000	0.50151	2.085000	0.62840	0.459000	0.35465	ATC	.		0.438	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
NFATC2	4773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50092056	50092056	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:50092056T>G	ENST00000396009.3	-	4	1693	c.1474A>C	c.(1474-1476)Ata>Cta	p.I492L	NFATC2_ENST00000610033.1_Missense_Mutation_p.I273L|NFATC2_ENST00000371564.3_Missense_Mutation_p.I492L|NFATC2_ENST00000414705.1_Missense_Mutation_p.I472L|NFATC2_ENST00000609507.1_Missense_Mutation_p.I273L|NFATC2_ENST00000609943.1_Missense_Mutation_p.I472L	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	492	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					TTGCCCACTATCTTCTCATAG	0.557																																					p.I492L		.											.	NFATC2	92	0			c.A1474C						.						225.0	223.0	224.0					20																	50092056		2203	4300	6503	SO:0001583	missense	4773	exon4			CCACTATCTTCTC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1474A>C	20.37:g.50092056T>G	ENSP00000379330:p.Ile492Leu	308.0	0.0		329.0	83.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858656	0.71834	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.41400	1.0;1.0;1.0	5.26	5.26	0.73747	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.195954	0.47093	D	0.000247	T	0.52709	0.1751	N	0.25647	0.755	0.44000	D	0.996704	P;P;B;B	0.42908	0.476;0.793;0.338;0.338	P;D;P;P	0.66497	0.531;0.944;0.531;0.531	T	0.55724	-0.8096	10	0.59425	D	0.04	-8.1108	15.1874	0.73016	0.0:0.0:0.0:1.0	.	472;472;492;492	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	L	492;492;273;472	ENSP00000360619:I492L;ENSP00000379330:I492L;ENSP00000396471:I472L	ENSP00000360619:I492L	I	-	1	0	NFATC2	49525463	1.000000	0.71417	0.979000	0.43373	0.907000	0.53573	1.659000	0.37387	1.983000	0.57843	0.528000	0.53228	ATA	.		0.557	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
NOS1AP	9722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162337003	162337003	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:162337003G>T	ENST00000361897.5	+	10	1669	c.1267G>T	c.(1267-1269)Gac>Tac	p.D423Y	NOS1AP_ENST00000493151.1_Missense_Mutation_p.D128Y|NOS1AP_ENST00000530878.1_Missense_Mutation_p.D418Y|RP11-565P22.6_ENST00000431696.1_Intron|NOS1AP_ENST00000454693.1_3'UTR	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	423					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			AGGTAGGCGCGACTGCTTGGT	0.682																																					p.D423Y		.											.	NOS1AP	228	0			c.G1267T						.						51.0	57.0	55.0					1																	162337003		2203	4300	6503	SO:0001583	missense	9722	exon10			AGGCGCGACTGCT	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.1267G>T	1.37:g.162337003G>T	ENSP00000355133:p.Asp423Tyr	41.0	0.0		43.0	12.0	NM_014697	B7ZLF5|O43564|Q3T551|Q5VU95	Missense_Mutation	SNP	ENST00000361897.5	37	CCDS1237.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.136167	0.77662	.	.	ENSG00000198929	ENST00000530878;ENST00000361897;ENST00000464284;ENST00000493151	T;T	0.78246	-1.16;-1.16	4.96	4.96	0.65561	.	0.741680	0.14378	N	0.323360	T	0.69602	0.3129	N	0.14661	0.345	.	.	.	D;D;P	0.62365	0.986;0.991;0.947	P;P;P	0.55824	0.785;0.615;0.511	T	0.76332	-0.2998	9	0.66056	D	0.02	.	17.1256	0.86713	0.0:0.0:1.0:0.0	.	128;418;423	Q3T551;B7ZLF5;O75052	.;.;CAPON_HUMAN	Y	418;423;79;128	ENSP00000431586:D418Y;ENSP00000355133:D423Y	ENSP00000355133:D423Y	D	+	1	0	NOS1AP	160603627	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.219000	0.51200	2.419000	0.82065	0.655000	0.94253	GAC	.		0.682	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	247582364	247582364	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:247582364G>T	ENST00000336119.3	+	1	1014	c.268G>T	c.(268-270)Gat>Tat	p.D90Y	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000366497.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000391827.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000391828.3_Missense_Mutation_p.D90Y|NLRP3_ENST00000348069.2_Missense_Mutation_p.D90Y	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	90	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCAAAAAGAGATGAGCCGAA	0.423																																					p.D90Y		.											.	NLRP3	674	0			c.G268T						.						56.0	54.0	55.0					1																	247582364		2203	4300	6503	SO:0001583	missense	114548	exon1			AAAAGAGATGAGC	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.268G>T	1.37:g.247582364G>T	ENSP00000337383:p.Asp90Tyr	16.0	0.0		19.0	10.0	NM_183395	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209887	0.39003	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32	4.49	4.49	0.54785	Pyrin (1);DEATH-like (2);	0.631279	0.15000	N	0.286179	T	0.62684	0.2448	L	0.36672	1.1	0.09310	N	0.999999	P;D;D;P;P	0.65815	0.953;0.972;0.995;0.95;0.916	P;P;P;P;B	0.58520	0.507;0.702;0.84;0.492;0.406	T	0.55623	-0.8112	10	0.87932	D	0	.	12.8787	0.58003	0.0:0.0:1.0:0.0	.	90;90;90;90;90	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	Y	90	ENSP00000375704:D90Y;ENSP00000355453:D90Y;ENSP00000337383:D90Y;ENSP00000294752:D90Y;ENSP00000355452:D90Y;ENSP00000375703:D90Y	ENSP00000337383:D90Y	D	+	1	0	NLRP3	245648987	0.363000	0.24989	0.082000	0.20525	0.423000	0.31445	1.668000	0.37481	2.498000	0.84270	0.561000	0.74099	GAT	.		0.423	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
NRDE2	55051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	90764607	90764607	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:90764607G>T	ENST00000354366.3	-	8	1895	c.1663C>A	c.(1663-1665)Cca>Aca	p.P555T	NRDE2_ENST00000357904.3_Missense_Mutation_p.P324T	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	555																	GACTTACCTGGGTTGATGACC	0.498																																					p.P555T		.											.	.	.	0			c.C1663A						.						94.0	89.0	91.0					14																	90764607		2203	4300	6503	SO:0001583	missense	55051	exon8			TACCTGGGTTGAT	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1663C>A	14.37:g.90764607G>T	ENSP00000346335:p.Pro555Thr	29.0	0.0		52.0	10.0	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	37	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765351	0.31228	.	.	ENSG00000119720	ENST00000354366;ENST00000357904;ENST00000554464	T;T	0.34667	1.35;1.35	5.58	4.68	0.58851	.	0.478879	0.22197	N	0.063287	T	0.30792	0.0776	L	0.45581	1.43	0.35821	D	0.824573	B	0.19445	0.036	B	0.24006	0.05	T	0.29058	-1.0024	10	0.25106	T	0.35	.	9.927	0.41498	0.0722:0.14:0.7878:0.0	.	555	Q9H7Z3	CN102_HUMAN	T	555;324;134	ENSP00000346335:P555T;ENSP00000350579:P324T	ENSP00000346335:P555T	P	-	1	0	C14orf102	89834360	1.000000	0.71417	0.878000	0.34440	0.848000	0.48234	4.195000	0.58400	1.341000	0.45600	0.455000	0.32223	CCA	.		0.498	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
NRG2	9542	ucsc.edu;bcgsc.ca	37	5	139235271	139235271	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:139235271A>G	ENST00000361474.1	-	6	1506	c.1282T>C	c.(1282-1284)Tgc>Cgc	p.C428R	NRG2_ENST00000358522.3_Missense_Mutation_p.C430R|NRG2_ENST00000289409.4_Missense_Mutation_p.C422R|NRG2_ENST00000340391.3_Missense_Mutation_p.C225R|NRG2_ENST00000394770.1_3'UTR|CTB-35F21.4_ENST00000504413.1_RNA|NRG2_ENST00000545385.1_Missense_Mutation_p.C430R|NRG2_ENST00000541337.1_Missense_Mutation_p.C362R|NRG2_ENST00000289422.7_Missense_Mutation_p.C436R	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	428					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGTCTTGCAGTAGGCCACC	0.592																																					p.C436R		.											.	NRG2	526	0			c.T1306C						.						155.0	134.0	141.0					5																	139235271		2203	4300	6503	SO:0001583	missense	9542	exon7			TCTTGCAGTAGGC		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1282T>C	5.37:g.139235271A>G	ENSP00000354910:p.Cys428Arg	50.0	0.0		57.0	5.0	NM_013982		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360523	0.82353	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000340391;ENST00000289409;ENST00000358522	T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;3.72;-0.03	5.02	5.02	0.67125	Neuregulin 1-related, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	M	0.75777	2.31	0.80722	D	1	P;P;P;P	0.46277	0.849;0.875;0.754;0.849	B;P;B;B	0.49502	0.382;0.613;0.382;0.382	T	0.75091	-0.3440	10	0.59425	D	0.04	-18.6323	14.7328	0.69393	1.0:0.0:0.0:0.0	.	422;428;430;436	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	R	362;436;428;436;430;225;422;430	ENSP00000444235:C362R;ENSP00000289422:C436R;ENSP00000354910:C428R;ENSP00000438753:C430R;ENSP00000342660:C225R;ENSP00000289409:C422R;ENSP00000351323:C430R	ENSP00000289409:C422R	C	-	1	0	NRG2	139215455	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.240000	0.95396	1.897000	0.54924	0.379000	0.24179	TGC	.		0.592	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
OR51G1	79324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4944842	4944842	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:4944842C>A	ENST00000321961.2	-	1	795	c.728G>T	c.(727-729)tGt>tTt	p.C243F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGAGAGACACAGGTGTTGAG	0.552																																					p.C243F		.											.	OR51G1	70	0			c.G728T						.						164.0	126.0	139.0					11																	4944842		2201	4298	6499	SO:0001583	missense	79324	exon1			GAGACACAGGTGT	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.728G>T	11.37:g.4944842C>A	ENSP00000322546:p.Cys243Phe	118.0	0.0		119.0	22.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	37	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699620	0.48307	.	.	ENSG00000176879	ENST00000321961	T	0.00368	7.75	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	U	0.000656	T	0.01765	0.0056	H	0.96208	3.785	0.50313	D	0.99986	D	0.89917	1.0	D	0.97110	1.0	T	0.31971	-0.9924	10	0.87932	D	0	.	15.9949	0.80232	0.0:1.0:0.0:0.0	.	243	Q8NGK1	O51G1_HUMAN	F	243	ENSP00000322546:C243F	ENSP00000322546:C243F	C	-	2	0	OR51G1	4901418	1.000000	0.71417	0.970000	0.41538	0.156000	0.22039	5.593000	0.67550	2.359000	0.80004	0.557000	0.71058	TGT	.		0.552	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OR1S2	219958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57970715	57970715	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:57970715G>A	ENST00000302592.6	-	1	938	c.939C>T	c.(937-939)gcC>gcT	p.A313A		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				GCTTTCTCAGGGCACCTTTCA	0.423																																					p.A313A		.											.	OR1S2	69	0			c.C939T						.						136.0	138.0	137.0					11																	57970715		2201	4294	6495	SO:0001819	synonymous_variant	219958	exon1			TCTCAGGGCACCT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.939C>T	11.37:g.57970715G>A		115.0	0.0		101.0	27.0	NM_001004459	Q6IFG5|Q96R85	Silent	SNP	ENST00000302592.6	37	CCDS31545.1																																																																																			.		0.423	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
OSGEPL1	64172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190617632	190617632	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:190617632C>T	ENST00000264151.5	-	6	1139	c.1037G>A	c.(1036-1038)tGc>tAc	p.C346Y	OSGEPL1_ENST00000519810.1_Missense_Mutation_p.C346Y|Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000522700.1_Missense_Mutation_p.C346Y	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			CAACAAAGTGCACTGTGTTGC	0.403																																					p.C346Y		.											.	.	.	0			c.G1037A						.						83.0	80.0	81.0					2																	190617632		1895	4127	6022	SO:0001583	missense	64172	exon6			AAAGTGCACTGTG	AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.1037G>A	2.37:g.190617632C>T	ENSP00000264151:p.Cys346Tyr	312.0	0.0		271.0	60.0	NM_022353		Missense_Mutation	SNP	ENST00000264151.5	37	CCDS46472.1	.	.	.	.	.	.	.	.	.	.	C	2.943	-0.218548	0.06101	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700	T;T;T	0.41400	1.0;1.0;1.0	5.27	5.27	0.74061	Peptidase M22, glycoprotease (1);	0.179938	0.52532	D	0.000076	T	0.19565	0.0470	N	0.12637	0.245	0.29823	N	0.830666	B	0.18461	0.028	B	0.14578	0.011	T	0.21690	-1.0238	10	0.02654	T	1	-4.9742	8.7283	0.34483	0.2661:0.6021:0.1318:0.0	.	346	Q9H4B0	OSGP2_HUMAN	Y	346	ENSP00000264151:C346Y;ENSP00000428859:C346Y;ENSP00000429697:C346Y	ENSP00000264151:C346Y	C	-	2	0	OSGEPL1	190325877	1.000000	0.71417	0.994000	0.49952	0.917000	0.54804	5.380000	0.66202	2.737000	0.93849	0.563000	0.77884	TGC	.		0.403	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353	
P2RY1	5028	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	152553878	152553878	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:152553878A>C	ENST00000305097.3	+	1	1143	c.307A>C	c.(307-309)Act>Cct	p.T103P		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	103					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GTACGTGCTGACTCTGCCAGC	0.498																																					p.T103P		.											.	P2RY1	500	0			c.A307C						.						89.0	82.0	84.0					3																	152553878		2203	4300	6503	SO:0001583	missense	5028	exon1			GTGCTGACTCTGC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.307A>C	3.37:g.152553878A>C	ENSP00000304767:p.Thr103Pro	110.0	1.0		156.0	39.0	NM_002563		Missense_Mutation	SNP	ENST00000305097.3	37	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.931851	0.73442	.	.	ENSG00000169860	ENST00000305097	T	0.73789	-0.78	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.063411	0.64402	D	0.000006	T	0.81113	0.4755	M	0.83012	2.62	0.51233	D	0.999913	P	0.49783	0.928	P	0.51170	0.661	D	0.83597	0.0126	10	0.62326	D	0.03	.	10.3523	0.43943	0.8537:0.0:0.0:0.1463	.	103	P47900	P2RY1_HUMAN	P	103	ENSP00000304767:T103P	ENSP00000304767:T103P	T	+	1	0	P2RY1	154036568	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.428000	0.66489	2.148000	0.66965	0.533000	0.62120	ACT	.		0.498	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
PADI2	11240	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	17402191	17402191	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:17402191G>A	ENST00000375486.4	-	12	1501	c.1438C>T	c.(1438-1440)Ccc>Tcc	p.P480S	PADI2_ENST00000444885.2_Missense_Mutation_p.P364S|PADI2_ENST00000466151.1_5'UTR	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	480					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CCGGGGATGGGGACAAAGGAC	0.602											OREG0013145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P480S		.											.	PADI2	208	0			c.C1438T						.						86.0	86.0	86.0					1																	17402191		2203	4300	6503	SO:0001583	missense	11240	exon12			GGATGGGGACAAA	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1438C>T	1.37:g.17402191G>A	ENSP00000364635:p.Pro480Ser	28.0	1.0	717	46.0	15.0	NM_007365	Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	37	CCDS177.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793231	0.70452	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.39406	1.08;1.08	4.47	4.47	0.54385	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.84683	2.71	0.80722	D	1	D;P	0.71674	0.998;0.674	D;B	0.68621	0.959;0.407	T	0.73594	-0.3933	10	0.66056	D	0.02	-25.1718	16.2177	0.82239	0.0:0.0:1.0:0.0	.	364;480	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	S	480;364	ENSP00000364635:P480S;ENSP00000405894:P364S	ENSP00000364635:P480S	P	-	1	0	PADI2	17274778	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.986000	0.93492	2.492000	0.84095	0.655000	0.94253	CCC	.		0.602	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		
PCDH9	5101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	66878891	66878891	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:66878891G>A	ENST00000377865.2	-	4	3744	c.3610C>T	c.(3610-3612)Cat>Tat	p.H1204Y	PCDH9_ENST00000328454.5_Missense_Mutation_p.H1170Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.H1204Y|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000456367.1_Missense_Mutation_p.H1170Y			Q9HC56	PCDH9_HUMAN	protocadherin 9	1204					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TTGTTGAAATGGCCTTCATTG	0.493																																					p.H1204Y		.											.	PCDH9	96	0			c.C3610T						.						164.0	131.0	142.0					13																	66878891		2203	4300	6503	SO:0001583	missense	5101	exon5			TGAAATGGCCTTC	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3610C>T	13.37:g.66878891G>A	ENSP00000367096:p.His1204Tyr	345.0	0.0		365.0	82.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181698	0.57800	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.56275	0.53;0.53;0.47;0.47	6.05	6.05	0.98169	.	0.000000	0.48767	D	0.000168	T	0.61949	0.2388	N	0.19112	0.55	0.49687	D	0.999814	P;P;P	0.42039	0.659;0.769;0.659	P;P;P	0.61397	0.775;0.888;0.775	T	0.62272	-0.6889	10	0.59425	D	0.04	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	1162;1170;1204	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	Y	1204;1204;1170;1170	ENSP00000442186:H1204Y;ENSP00000367096:H1204Y;ENSP00000401699:H1170Y;ENSP00000332060:H1170Y	ENSP00000332060:H1170Y	H	-	1	0	PCDH9	65776892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	CAT	.		0.493	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCDH9	5101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	67800949	67800949	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:67800949C>T	ENST00000377865.2	-	1	1758	c.1624G>A	c.(1624-1626)Gta>Ata	p.V542I	PCDH9_ENST00000328454.5_Missense_Mutation_p.V542I|PCDH9_ENST00000544246.1_Missense_Mutation_p.V542I|PCDH9_ENST00000456367.1_Missense_Mutation_p.V542I|PCDH9_ENST00000377861.3_Missense_Mutation_p.V542I			Q9HC56	PCDH9_HUMAN	protocadherin 9	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CTGGCAGTTACTGTAAAAATG	0.458																																					p.V542I		.											.	PCDH9	96	0			c.G1624A						.						86.0	88.0	87.0					13																	67800949		2203	4300	6503	SO:0001583	missense	5101	exon2			CAGTTACTGTAAA	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1624G>A	13.37:g.67800949C>T	ENSP00000367096:p.Val542Ile	164.0	0.0		141.0	39.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536080	0.27475	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	6.08	6.08	0.98989	Cadherin (5);Cadherin-like (1);	0.058936	0.64402	D	0.000002	T	0.30854	0.0778	L	0.35341	1.055	0.58432	D	0.999999	B;B;B;B	0.31581	0.329;0.01;0.058;0.071	B;B;B;B	0.39738	0.308;0.075;0.065;0.173	T	0.02713	-1.1120	10	0.48119	T	0.1	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	542;542;542;542	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	I	542	ENSP00000442186:V542I;ENSP00000367096:V542I;ENSP00000401699:V542I;ENSP00000332060:V542I;ENSP00000367092:V542I	ENSP00000332060:V542I	V	-	1	0	PCDH9	66698950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.970000	0.63742	2.894000	0.99253	0.655000	0.94253	GTA	.		0.458	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCDHA2	56146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140176834	140176834	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:140176834A>T	ENST00000526136.1	+	1	2285	c.2285A>T	c.(2284-2286)gAg>gTg	p.E762V	PCDHA2_ENST00000520672.2_Missense_Mutation_p.E762V|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.E762V|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	762	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCTGGGGAGGACCCCCCC	0.622																																					p.E762V		.											.	PCDHA2	94	0			c.A2285T						.						46.0	50.0	49.0					5																	140176834		2203	4300	6503	SO:0001583	missense	56146	exon1			CTGGGGAGGACCC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2285A>T	5.37:g.140176834A>T	ENSP00000431748:p.Glu762Val	201.0	0.0		225.0	59.0	NM_031495	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	a	16.47	3.132858	0.56828	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.17213	2.29;2.29;2.29	4.0	4.0	0.46444	.	0.371940	0.19003	U	0.125274	T	0.46658	0.1404	M	0.92880	3.355	0.23341	N	0.997877	D;B;D	0.76494	0.985;0.377;0.999	P;B;D	0.76575	0.891;0.206;0.988	T	0.42699	-0.9436	10	0.62326	D	0.03	.	7.8235	0.29300	0.9027:0.0:0.0973:0.0	.	762;762;762	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	762	ENSP00000430584:E762V;ENSP00000367372:E762V;ENSP00000431748:E762V	ENSP00000367372:E762V	E	+	2	0	PCDHA2	140157018	0.999000	0.42202	0.998000	0.56505	0.755000	0.42902	3.253000	0.51469	1.584000	0.49913	0.477000	0.44152	GAG	.		0.622	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140208267	140208267	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:140208267G>A	ENST00000529310.1	+	1	705	c.591G>A	c.(589-591)aaG>aaA	p.K197K	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Silent_p.K197K|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	197	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.K197N(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTATTAAAGAAATCCTTGG	0.433																																					p.K197K		.											.	PCDHA6	92	2	Substitution - Missense(2)	large_intestine(2)	c.G591A						.						67.0	72.0	70.0					5																	140208267		2203	4300	6503	SO:0001819	synonymous_variant	56142	exon1			ATTAAAGAAATCC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.591G>A	5.37:g.140208267G>A		82.0	0.0		74.0	20.0	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																			.		0.433	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PDE4DIP	9659	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	144946701	144946701	+	Missense_Mutation	SNP	C	C	T	rs77741848	byFrequency	TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:144946701C>T	ENST00000369354.3	-	5	749	c.560G>A	c.(559-561)aGg>aAg	p.R187K	PDE4DIP_ENST00000369351.3_Missense_Mutation_p.R187K|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R324K|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.R253K|RNU2-38P_ENST00000410856.1_RNA|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R324K|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.R187K|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R187K			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	187					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTCTACAAGCCTCTCCTGGGC	0.433			T	PDGFRB	MPD																																p.R253K		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.G758A						.	A	LYS/ARG,LYS/ARG,LYS/ARG,LYS/ARG	212,4194	112.9+/-151.0	0,212,1991	138.0	125.0	129.0		560,560,758,560	-0.9	0.9	1	dbSNP_131	129	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense	PDE4DIP	NM_014644.4,NM_001198834.2,NM_001198832.1,NM_001002812.1	26,26,26,26	0,214,6289	TT,TC,CC		0.0233,4.8116,1.6454	benign,benign,benign,benign	187/2347,187/2363,253/2241,187/970	144946701	214,12792	2203	4300	6503	SO:0001583	missense	9659	exon8			ACAAGCCTCTCCT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.560G>A	1.37:g.144946701C>T	ENSP00000358360:p.Arg187Lys	257.0	0.0		211.0	27.0	NM_001198832	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	39	0.017857142857142856	38	0.07723577235772358	1	0.0027624309392265192	0	0.0	0	0.0	c	4.608	0.113083	0.08831	0.048116	2.33E-4	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000530078	T;T;T;T;T;T;T	0.03358	4.8;4.95;4.95;4.9;4.9;3.96;3.97	5.16	-0.895	0.10560	.	.	.	.	.	T	0.00271	0.0008	N	0.00538	-1.39	0.58432	D	0.999992	B;B;B	0.12630	0.0;0.006;0.0	B;B;B	0.10450	0.0;0.005;0.0	T	0.40021	-0.9585	9	0.02654	T	1	.	4.3487	0.11144	0.1805:0.2077:0.0:0.6118	.	187;253;187	Q5VU43-7;Q5VU43-3;Q5VU43	.;.;MYOME_HUMAN	K	253;187;187;324;324;187;187;253	ENSP00000327209:R253K;ENSP00000358360:R187K;ENSP00000358363:R187K;ENSP00000435654:R324K;ENSP00000358366:R324K;ENSP00000358357:R187K;ENSP00000358355:R187K	ENSP00000327209:R253K	R	-	2	0	PDE4DIP	143658058	0.992000	0.36948	0.858000	0.33744	0.743000	0.42351	0.213000	0.17521	-0.030000	0.13804	-0.739000	0.03532	AGG	C|0.976;T|0.024		0.433	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31983740	31983740	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:31983740A>T	ENST00000438447.1	+	3	1344	c.956A>T	c.(955-957)cAa>cTa	p.Q319L	PDZD2_ENST00000282493.3_Missense_Mutation_p.Q319L			O15018	PDZD2_HUMAN	PDZ domain containing 2	319					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						ACGGACTTCCAATCGAGTGAC	0.478																																					p.Q319L		.											.	PDZD2	563	0			c.A956T						.						92.0	97.0	95.0					5																	31983740		2202	4300	6502	SO:0001583	missense	23037	exon2			ACTTCCAATCGAG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.956A>T	5.37:g.31983740A>T	ENSP00000402033:p.Gln319Leu	164.0	0.0		156.0	45.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680327	0.68042	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06687	3.27;3.27	5.68	5.68	0.88126	PDZ/DHR/GLGF (1);	0.000000	0.44902	D	0.000407	T	0.18130	0.0435	L	0.32530	0.975	0.38661	D	0.952077	D;D	0.63880	0.979;0.993	P;D	0.72338	0.747;0.977	T	0.02202	-1.1196	10	0.52906	T	0.07	.	12.3301	0.55035	1.0:0.0:0.0:0.0	.	145;319	B4E3P2;O15018	.;PDZD2_HUMAN	L	319	ENSP00000402033:Q319L;ENSP00000282493:Q319L	ENSP00000282493:Q319L	Q	+	2	0	PDZD2	32019497	0.985000	0.35326	0.899000	0.35326	0.506000	0.33950	3.118000	0.50414	2.167000	0.68274	0.528000	0.53228	CAA	.		0.478	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
PDZRN3	23024	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	73453362	73453362	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:73453362A>G	ENST00000263666.4	-	4	1217	c.1103T>C	c.(1102-1104)aTg>aCg	p.M368T	PDZRN3_ENST00000466780.1_Missense_Mutation_p.M25T|PDZRN3_ENST00000462146.2_Missense_Mutation_p.M25T|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.M90T|PDZRN3_ENST00000479530.1_Missense_Mutation_p.M85T	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	368					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AGTGAGGGCCATGATATGTTC	0.498																																					p.M368T		.											.	PDZRN3	232	0			c.T1103C						.						194.0	156.0	169.0					3																	73453362		2203	4300	6503	SO:0001583	missense	23024	exon4			AGGGCCATGATAT	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1103T>C	3.37:g.73453362A>G	ENSP00000263666:p.Met368Thr	178.0	2.0		170.0	50.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206678	0.39003	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.10477	2.87;3.57;3.44;3.44;3.57;3.55	6.07	6.07	0.98685	.	0.175149	0.64402	D	0.000009	T	0.13114	0.0318	L	0.60845	1.875	0.44373	D	0.997276	B;B;B;B	0.25955	0.138;0.013;0.017;0.013	B;B;B;B	0.29663	0.105;0.01;0.009;0.01	T	0.07712	-1.0758	10	0.27082	T	0.32	.	10.6136	0.45436	0.9283:0.0:0.0717:0.0	.	90;85;85;368	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	T	368;90;25;25;85;368;66	ENSP00000263666:M368T;ENSP00000442026:M90T;ENSP00000418168:M25T;ENSP00000418484:M25T;ENSP00000418624:M85T;ENSP00000419250:M66T	ENSP00000263666:M368T	M	-	2	0	PDZRN3	73536052	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.254000	0.65457	2.326000	0.78906	0.533000	0.62120	ATG	.		0.498	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PFKP	5214	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	3150974	3150974	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:3150974G>A	ENST00000381125.4	+	9	1028	c.952G>A	c.(952-954)Gac>Aac	p.D318N	PFKP_ENST00000381075.2_Missense_Mutation_p.D310N	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	318	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		TTCGGCATTCGACAGGATCTT	0.587																																					p.D318N		.											.	PFKP	253	0			c.G952A						.						138.0	126.0	130.0					10																	3150974		2203	4300	6503	SO:0001583	missense	5214	exon9			GCATTCGACAGGA	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.952G>A	10.37:g.3150974G>A	ENSP00000370517:p.Asp318Asn	91.0	1.0		123.0	31.0	NM_002627	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323097	0.81580	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000415005	D;D;D	0.95238	-3.65;-3.65;-3.65	5.2	5.2	0.72013	Phosphofructokinase domain (2);Phosphofructokinase, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98890	0.9624	H	0.99900	4.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.994	D	0.99063	1.0831	10	0.87932	D	0	.	19.0968	0.93255	0.0:0.0:1.0:0.0	.	310;310;318	B3KS15;Q5VSR7;Q01813	.;.;K6PP_HUMAN	N	318;307;310;102	ENSP00000370517:D318N;ENSP00000370465:D310N;ENSP00000408858:D102N	ENSP00000370465:D310N	D	+	1	0	PFKP	3140974	1.000000	0.71417	0.980000	0.43619	0.259000	0.26198	9.577000	0.98196	2.596000	0.87737	0.561000	0.74099	GAC	.		0.587	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
PGLYRP3	114771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153279733	153279733	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:153279733G>A	ENST00000290722.1	-	2	118	c.66C>T	c.(64-66)acC>acT	p.T22T		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	22					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGAGACGATGGTGGGAGTAT	0.622																																					p.T22T		.											.	PGLYRP3	94	0			c.C66T						.						32.0	31.0	32.0					1																	153279733		2202	4300	6502	SO:0001819	synonymous_variant	114771	exon2			GACGATGGTGGGA	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.66C>T	1.37:g.153279733G>A		39.0	0.0		45.0	18.0	NM_052891	A1A4U8|Q5SY65	Silent	SNP	ENST00000290722.1	37	CCDS1035.1																																																																																			.		0.622	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891	
PMS1	5378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190718971	190718971	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:190718971G>A	ENST00000441310.2	+	9	1206	c.973G>A	c.(973-975)Gtt>Att	p.V325I	PMS1_ENST00000418224.3_Missense_Mutation_p.V149I|PMS1_ENST00000409823.3_Missense_Mutation_p.V286I|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000432292.3_Missense_Mutation_p.V149I|PMS1_ENST00000447232.2_Missense_Mutation_p.V325I	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	325					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TTAGGAATCTGTTTTAATTGC	0.249			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.V325I		.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	.	PMS1	1396	0			c.G973A						.						26.0	27.0	27.0					2																	190718971		1982	4190	6172	SO:0001583	missense	5378	exon9			GAATCTGTTTTAA		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.973G>A	2.37:g.190718971G>A	ENSP00000406490:p.Val325Ile	159.0	0.0		133.0	28.0	NM_001128144	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	37	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924570	0.34002	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000424307;ENST00000409593	D;D;T;D;D;D;D	0.84944	-1.92;-1.92;-1.42;-1.92;-1.92;-1.92;-1.92	5.29	2.3	0.28687	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	0.163445	0.53938	N	0.000050	T	0.79353	0.4431	L	0.46614	1.455	0.47778	D	0.999516	B;B;B;B;B;B;B	0.28378	0.06;0.058;0.058;0.209;0.033;0.06;0.06	B;B;B;B;B;B;B	0.34385	0.116;0.181;0.181;0.181;0.181;0.116;0.116	T	0.72459	-0.4287	10	0.37606	T	0.19	-13.062	7.6931	0.28579	0.1397:0.253:0.6073:0.0	.	325;286;286;110;286;325;325	Q4VAL4;B4DMF4;Q5FBZ9;Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	I	149;325;149;286;325;149;264;110	ENSP00000406490:V325I;ENSP00000404492:V149I;ENSP00000387125:V286I;ENSP00000401064:V325I;ENSP00000398378:V149I;ENSP00000389938:V264I;ENSP00000387169:V110I	ENSP00000376149:V149I	V	+	1	0	PMS1	190427216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.746000	0.38288	0.762000	0.33152	0.557000	0.71058	GTT	.		0.249	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
POLRMT	5442	ucsc.edu;bcgsc.ca	37	19	621784	621784	+	Silent	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:621784C>A	ENST00000588649.2	-	10	1998	c.1914G>T	c.(1912-1914)acG>acT	p.T638T	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	638					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGAAGGTCAGCGTGGGCTCCG	0.682																																					p.T638T		.											.	POLRMT	92	0			c.G1914T						.						30.0	33.0	32.0					19																	621784		2200	4299	6499	SO:0001819	synonymous_variant	5442	exon10			GGTCAGCGTGGGC		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1914G>T	19.37:g.621784C>A		28.0	0.0		31.0	9.0	NM_005035	O60370	Silent	SNP	ENST00000588649.2	37	CCDS12036.1																																																																																			.		0.682	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
POTEA	340441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	43152221	43152221	+	RNA	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:43152221G>A	ENST00000522175.2	+	0	360							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCTTCTGCTGGACAGACAATG	0.403																																					p.D120N		.											.	POTEA	91	0			c.G358A						.						107.0	105.0	106.0					8																	43152221		2160	4290	6450			340441	exon2			CTGCTGGACAGAC	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152221G>A		182.0	0.0		145.0	24.0	NM_001005365	A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	ENST00000522175.2	37																																																																																				.		0.403	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920	
PPP2R5B	5526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64695804	64695804	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:64695804G>A	ENST00000164133.2	+	6	1251	c.629G>A	c.(628-630)cGt>cAt	p.R210H		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	210					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CCCCGGGAGCGTGAGTACCTC	0.587																																					p.R210H		.											.	PPP2R5B	660	0			c.G629A						.						82.0	71.0	74.0					11																	64695804		2201	4297	6498	SO:0001583	missense	5526	exon6			GGGAGCGTGAGTA	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.629G>A	11.37:g.64695804G>A	ENSP00000164133:p.Arg210His	75.0	0.0		89.0	19.0	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871173	0.91587	.	.	ENSG00000068971	ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.56	3.56	0.40772	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87168	0.6110	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91159	0.4959	9	0.87932	D	0	-9.5765	13.5415	0.61676	0.0:0.0:1.0:0.0	.	210	Q15173	2A5B_HUMAN	H	210;237;210	.	ENSP00000164133:R210H	R	+	2	0	PPP2R5B	64452380	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.137000	0.94496	2.322000	0.78497	0.549000	0.68633	CGT	.		0.587	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	
RAB34	83871	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	27038628	27038628	+	IGR	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:27038628G>T	ENST00000395245.3	-	0	1736				PROCA1_ENST00000439862.3_5'Flank|PROCA1_ENST00000581289.1_Silent_p.T17T|PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000301039.2_Silent_p.T17T	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family						antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CCTTGGGCTCGGTCTTTTCCT	0.642																																					p.T17T	Pancreas(175;216 2049 29940 32498 41589)	.											.	PROCA1	91	0			c.C51A						.						117.0	99.0	105.0					17																	27038628		2203	4300	6503	SO:0001628	intergenic_variant	147011	exon1			GGGCTCGGTCTTT	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680		17.37:g.27038628G>T		64.0	0.0		82.0	18.0	NM_152465	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Silent	SNP	ENST00000395245.3	37	CCDS11240.1																																																																																			.		0.642	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
PRPS2	5634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12838904	12838904	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:12838904A>G	ENST00000380668.5	+	6	974	c.846A>G	c.(844-846)aaA>aaG	p.K282K	PRPS2_ENST00000398491.2_Silent_p.K285K	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	282					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						ACAAAATGAAACACTGCACCA	0.448																																					p.K285K		.											.	PRPS2	130	0			c.A855G						.						94.0	76.0	82.0					X																	12838904		2203	4300	6503	SO:0001819	synonymous_variant	5634	exon6			AATGAAACACTGC	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.846A>G	X.37:g.12838904A>G		35.0	0.0		42.0	23.0	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Silent	SNP	ENST00000380668.5	37	CCDS14150.1																																																																																			.		0.448	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
PTCHD3	374308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27702131	27702131	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:27702131A>G	ENST00000438700.3	-	1	1166	c.1049T>C	c.(1048-1050)tTt>tCt	p.F350S		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	350					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AATGTTGGTAAATTGATCGAG	0.522																																					p.F350S		.											.	PTCHD3	94	0			c.T1049C						.						176.0	187.0	184.0					10																	27702131		2203	4300	6503	SO:0001583	missense	374308	exon1			TTGGTAAATTGAT	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1049T>C	10.37:g.27702131A>G	ENSP00000417658:p.Phe350Ser	109.0	0.0		129.0	37.0	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.261729	0.23051	.	.	ENSG00000182077	ENST00000438700	D	0.85258	-1.96	3.98	1.57	0.23409	.	0.331006	0.35151	N	0.003408	T	0.78426	0.4281	L	0.51422	1.61	0.09310	N	1	B	0.16396	0.017	B	0.23150	0.044	T	0.68800	-0.5313	10	0.66056	D	0.02	-3.53	6.1272	0.20186	0.6764:0.0:0.3236:0.0	.	350	Q3KNS1	PTHD3_HUMAN	S	350	ENSP00000417658:F350S	ENSP00000417658:F350S	F	-	2	0	PTCHD3	27742137	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	1.357000	0.34090	0.206000	0.20587	0.459000	0.35465	TTT	.		0.522	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
PXMP4	11264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	32298387	32298387	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:32298387C>A	ENST00000409299.3	-	3	441	c.349G>T	c.(349-351)Gga>Tga	p.G117*	PXMP4_ENST00000217398.3_Missense_Mutation_p.L123F|PXMP4_ENST00000344022.3_Intron	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	117						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						TTGTTTTCTCCAAACACCAGG	0.577																																					p.G117X		.											.	PXMP4	90	0			c.G349T						.						128.0	116.0	120.0					20																	32298387		2203	4300	6503	SO:0001587	stop_gained	11264	exon3			TTTCTCCAAACAC	AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.349G>T	20.37:g.32298387C>A	ENSP00000386385:p.Gly117*	161.0	0.0		163.0	40.0	NM_007238	A2A2I7|Q9H0T4	Nonsense_Mutation	SNP	ENST00000409299.3	37	CCDS13225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.5|29.5	5.009587|5.009587	0.93346|0.93346	.|.	.|.	ENSG00000101417|ENSG00000101417	ENST00000409299|ENST00000217398	.|.	.|.	.|.	5.15|5.15	1.96|1.96	0.26148|0.26148	.|.	0.217610|.	0.47852|.	D|.	0.000215|.	.|T	.|0.62841	.|0.2461	.|.	.|.	.|.	0.26785|0.26785	N|N	0.969518|0.969518	.|D	.|0.76494	.|0.999	.|D	.|0.66979	.|0.948	.|T	.|0.53436	.|-0.8439	.|7	0.62326|0.66056	D|D	0.03|0.02	0.4395|0.4395	9.2112|9.2112	0.37320|0.37320	0.0:0.7447:0.0:0.2553|0.0:0.7447:0.0:0.2553	.|.	.|123	.|B4DWH1	.|.	X|F	117|123	.|.	ENSP00000386385:G117X|ENSP00000217398:L123F	G|L	-|-	1|3	0|2	PXMP4|PXMP4	31762048|31762048	0.998000|0.998000	0.40836|0.40836	0.785000|0.785000	0.31869|0.31869	0.928000|0.928000	0.56348|0.56348	0.734000|0.734000	0.26101|0.26101	0.127000|0.127000	0.18452|0.18452	0.609000|0.609000	0.83330|0.83330	GGA|TTG	.		0.577	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078739.2	NM_007238	
RAD9B	144715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110959986	110959986	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:110959986G>A	ENST00000409778.3	+	8	712	c.688G>A	c.(688-690)Gat>Aat	p.D230N	RAD9B_ENST00000409300.1_Missense_Mutation_p.D299N|RAD9B_ENST00000409246.1_Missense_Mutation_p.D227N|RAD9B_ENST00000392672.4_Missense_Mutation_p.D299N|RAD9B_ENST00000409425.1_Missense_Mutation_p.D227N			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	296					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						CCTCAGGTCAGATCTGATTGA	0.358																																					p.D299N		.											.	RAD9B	228	0			c.G895A						.						23.0	23.0	23.0					12																	110959986		2203	4297	6500	SO:0001583	missense	144715	exon10			AGGTCAGATCTGA		CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.688G>A	12.37:g.110959986G>A	ENSP00000386697:p.Asp230Asn	126.0	0.0		141.0	33.0	NM_152442	Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Missense_Mutation	SNP	ENST00000409778.3	37		.	.	.	.	.	.	.	.	.	.	G	11.40	1.626729	0.28978	.	.	ENSG00000151164	ENST00000409246;ENST00000392672;ENST00000409300;ENST00000409425;ENST00000409778	T;T;T;T;T	0.22336	1.96;2.25;2.28;1.96;2.19	5.33	2.22	0.28083	.	0.542931	0.16309	N	0.220078	T	0.16214	0.0390	L	0.29908	0.895	0.24084	N	0.995938	P;B;B	0.40970	0.734;0.006;0.001	B;B;B	0.40329	0.326;0.002;0.0	T	0.11397	-1.0589	10	0.23302	T	0.38	-1.093	12.7805	0.57474	0.0:0.4768:0.5232:0.0	.	230;299;296	B4DYM6;B4DX60;Q6WBX8	.;.;RAD9B_HUMAN	N	227;299;299;227;230	ENSP00000387329:D227N;ENSP00000376440:D299N;ENSP00000386434:D299N;ENSP00000386629:D227N;ENSP00000386697:D230N	ENSP00000376440:D299N	D	+	1	0	RAD9B	109444369	0.995000	0.38212	0.938000	0.37757	0.706000	0.40770	0.801000	0.27055	0.578000	0.29487	0.561000	0.74099	GAT	.		0.358	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404634.1	NM_152442	
RALGAPA2	57186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20571891	20571891	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:20571891C>T	ENST00000202677.7	-	17	2278	c.2271G>A	c.(2269-2271)caG>caA	p.Q757Q		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	757	Poly-Gln.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						CCTGCTGCTGCTGTCCCACTG	0.512																																					p.Q757Q		.											.	RALGAPA2	24	0			c.G2271A						.						69.0	75.0	73.0					20																	20571891		2062	4196	6258	SO:0001819	synonymous_variant	57186	exon17			CTGCTGCTGTCCC	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2271G>A	20.37:g.20571891C>T		74.0	1.0		74.0	19.0	NM_020343	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	37	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788097	0.31593	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.85	3.93	0.45458	.	.	.	.	.	T	0.59169	0.2174	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54754	-0.8246	4	.	.	.	.	8.9712	0.35908	0.0:0.7671:0.0:0.2329	.	.	.	.	N	574	.	.	S	-	2	0	RALGAPA2	20519891	0.929000	0.31497	0.689000	0.30133	0.638000	0.38207	0.343000	0.19944	0.818000	0.34468	0.655000	0.94253	AGC	.		0.512	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
RASSF6	166824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74451010	74451010	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:74451010T>G	ENST00000342081.3	-	6	680	c.550A>C	c.(550-552)Aga>Cga	p.R184R	RASSF6_ENST00000395777.2_Silent_p.R152R|RASSF6_ENST00000307439.5_Silent_p.R152R|RASSF6_ENST00000335049.5_Silent_p.R140R	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6	184					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)					breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CTCATGGTTCTATAGAGCACT	0.413																																					p.R184R		.											.	RASSF6	319	0			c.A550C						.						153.0	146.0	148.0					4																	74451010		2203	4300	6503	SO:0001819	synonymous_variant	166824	exon6			TGGTTCTATAGAG	AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.550A>C	4.37:g.74451010T>G		259.0	0.0		249.0	77.0	NM_201431	Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Silent	SNP	ENST00000342081.3	37	CCDS3558.1																																																																																			.		0.413	RASSF6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252279.1	NM_177532	
RBM34	23029	ucsc.edu;bcgsc.ca	37	1	235324541	235324541	+	Start_Codon_SNP	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:235324541T>C	ENST00000408888.3	-	1	231	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RBM34_ENST00000366606.3_5'UTR			P42696	RBM34_HUMAN	RNA binding motif protein 34	1						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			TCCAAGGCCATTCTTACTCCA	0.627																																					p.M1V		.											.	RBM34	46	0			c.A1G						.						124.0	136.0	132.0					1																	235324541		2014	4174	6188	SO:0001582	initiator_codon_variant	23029	exon1			AGGCCATTCTTAC		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.1A>G	1.37:g.235324541T>C	ENSP00000386226:p.Met1Val	42.0	0.0		46.0	4.0	NM_001161533	A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097802	0.56075	.	.	ENSG00000188739	ENST00000408888;ENST00000400947;ENST00000429912	T	0.16597	2.33	4.84	4.84	0.62591	.	0.100134	0.64402	D	0.000009	T	0.39489	0.1080	.	.	.	0.80722	D	1	D;P	0.67145	0.996;0.817	D;B	0.73380	0.98;0.23	T	0.27088	-1.0084	9	0.87932	D	0	-23.5923	10.966	0.47412	0.0:0.0:0.0:1.0	.	1;1	P42696-2;P42696	.;RBM34_HUMAN	V	1	ENSP00000386226:M1V	ENSP00000383731:M1V	M	-	1	0	RBM34	233391164	0.965000	0.33210	0.801000	0.32222	0.006000	0.05464	3.070000	0.50033	2.137000	0.66172	0.533000	0.62120	ATG	.		0.627	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014	Missense_Mutation
RBM46	166863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155719022	155719022	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:155719022G>C	ENST00000281722.3	+	3	446	c.211G>C	c.(211-213)Gat>Cat	p.D71H	RBM46_ENST00000510397.1_Missense_Mutation_p.D71H|RBM46_ENST00000514866.1_Missense_Mutation_p.D71H	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	71	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AATACCTCGTGATATGTATGA	0.373																																					p.D71H		.											.	RBM46	69	0			c.G211C						.						122.0	125.0	124.0					4																	155719022		2203	4300	6503	SO:0001583	missense	166863	exon3			CCTCGTGATATGT	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.211G>C	4.37:g.155719022G>C	ENSP00000281722:p.Asp71His	161.0	0.0		135.0	36.0	NM_144979	B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	37	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540670	0.65085	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	T;T;T;T	0.20200	3.16;2.09;3.16;2.09	5.9	5.9	0.94986	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.045934	0.85682	D	0.000000	T	0.47340	0.1440	M	0.76170	2.325	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.994	D;D;D	0.72075	0.951;0.976;0.964	T	0.42582	-0.9443	10	0.87932	D	0	-29.8799	15.4131	0.74943	0.0681:0.0:0.9319:0.0	.	71;71;71	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	H	71	ENSP00000424500:D71H;ENSP00000281722:D71H;ENSP00000422813:D71H;ENSP00000426672:D71H	ENSP00000281722:D71H	D	+	1	0	RBM46	155938472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.804000	0.85993	2.793000	0.96121	0.563000	0.77884	GAT	.		0.373	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979	
RBMS3	27303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	29781252	29781252	+	Silent	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:29781252C>G	ENST00000383767.2	+	5	777	c.441C>G	c.(439-441)ctC>ctG	p.L147L	RBMS3_ENST00000273139.9_Silent_p.L147L|RBMS3_ENST00000396583.3_Silent_p.L147L|RBMS3_ENST00000445033.1_Silent_p.L147L|RBMS3_ENST00000434693.2_Silent_p.L146L|RBMS3_ENST00000383766.2_Silent_p.L146L|RBMS3_ENST00000456853.1_Silent_p.L147L|RBMS3_ENST00000452462.1_Silent_p.L147L			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	147	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				TCTCAAATCTCCCCATTTCTA	0.398																																					p.L147L		.											.	RBMS3	90	0			c.C441G						.						172.0	166.0	168.0					3																	29781252		2203	4300	6503	SO:0001819	synonymous_variant	27303	exon5			AAATCTCCCCATT	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.441C>G	3.37:g.29781252C>G		124.0	0.0		98.0	19.0	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Silent	SNP	ENST00000383767.2	37	CCDS33724.1																																																																																			.		0.398	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
RELL2	285613	broad.mit.edu;mdanderson.org	37	5	141019591	141019591	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:141019591G>T	ENST00000297164.3	+	5	1808	c.608G>T	c.(607-609)gGt>gTt	p.G203V	FCHSD1_ENST00000523856.1_5'UTR|RELL2_ENST00000444782.1_Missense_Mutation_p.G203V|RELL2_ENST00000521367.1_Missense_Mutation_p.G137V|RELL2_ENST00000518856.1_Missense_Mutation_p.G137V|RELL2_ENST00000518025.1_3'UTR|FCHSD1_ENST00000435817.2_3'UTR	NM_173828.4	NP_776189.3	Q8NC24	RELL2_HUMAN	RELT-like 2	203					positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCCAGGGGGTGGTCAGGGG	0.677																																					p.G203V		.											.	RELL2	90	0			c.G608T						.						28.0	33.0	31.0					5																	141019591		2203	4298	6501	SO:0001583	missense	285613	exon5			CAGGGGGTGGTCA	AK054889	CCDS4265.1	5q31.3	2011-10-11	2007-06-15	2007-06-15	ENSG00000164620	ENSG00000164620			26902	protein-coding gene	gene with protein product		611213	"""chromosome 5 open reading frame 16"""	C5orf16		12975309, 16389068	Standard	NM_173828		Approved	FLJ90583	uc003lli.3	Q8NC24	OTTHUMG00000129612	ENST00000297164.3:c.608G>T	5.37:g.141019591G>T	ENSP00000297164:p.Gly203Val	31.0	0.0		44.0	13.0	NM_173828	D3DQE2|Q6P4E7|Q6UXY2	Missense_Mutation	SNP	ENST00000297164.3	37	CCDS4265.1	.	.	.	.	.	.	.	.	.	.	G	7.655	0.683782	0.14907	.	.	ENSG00000164620	ENST00000444782;ENST00000521367;ENST00000297164;ENST00000518856	T;T;T;T	0.17213	2.37;2.29;2.37;2.31	4.91	1.96	0.26148	.	0.395845	0.24691	N	0.036388	T	0.10637	0.0260	N	0.16478	0.41	0.23920	N	0.996463	B;B	0.19073	0.033;0.006	B;B	0.17433	0.018;0.008	T	0.23476	-1.0187	10	0.40728	T	0.16	0.0195	11.5513	0.50723	0.0:0.0:0.5326:0.4674	.	137;203	E5RHA7;Q8NC24	.;RELL2_HUMAN	V	203;137;203;137	ENSP00000409443:G203V;ENSP00000430948:G137V;ENSP00000297164:G203V;ENSP00000427992:G137V	ENSP00000297164:G203V	G	+	2	0	RELL2	140999775	0.027000	0.19231	0.179000	0.23059	0.987000	0.75469	1.443000	0.35057	0.074000	0.16767	0.561000	0.74099	GGT	.		0.677	RELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251807.2	NM_173828	
RILPL1	353116	ucsc.edu;bcgsc.ca	37	12	123970231	123970231	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:123970231T>C	ENST00000376874.4	-	5	1158	c.923A>G	c.(922-924)gAg>gGg	p.E308G	RILPL1_ENST00000544468.1_5'Flank|RILPL1_ENST00000340724.6_Missense_Mutation_p.E156G	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	308	RILP-like.				epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GGACTTGAGCTCGTTCCTCTC	0.607																																					p.E308G		.											.	.	.	0			c.A923G						.						57.0	60.0	59.0					12																	123970231		2109	4224	6333	SO:0001583	missense	353116	exon5			TTGAGCTCGTTCC	AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.923A>G	12.37:g.123970231T>C	ENSP00000366070:p.Glu308Gly	43.0	0.0		36.0	4.0	NM_178314	Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	37	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.928035	0.92389	.	.	ENSG00000188026	ENST00000376874;ENST00000340724	T;T	0.53206	0.63;0.63	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.69842	0.3156	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.74348	0.961;0.983;0.974	T	0.75741	-0.3211	10	0.87932	D	0	-12.5202	13.9414	0.64057	0.0:0.0:0.0:1.0	.	284;308;157	Q5EBL4-2;Q5EBL4;Q5EBL4-3	.;RIPL1_HUMAN;.	G	308;156	ENSP00000366070:E308G;ENSP00000345874:E156G	ENSP00000345874:E156G	E	-	2	0	RILPL1	122536184	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.048000	0.71046	1.777000	0.52277	0.402000	0.26972	GAG	.		0.607	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
RNF133	168433	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	122338762	122338763	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:122338762_122338763delCT	ENST00000340112.2	-	1	447_448	c.210_211delAG	c.(208-213)agagtgfs	p.RV70fs	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	70	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						ACTCCTGCCACTCTCTTCAAAG	0.431																																					p.70_71del	Colon(198;1778 2057 7449 19869 45985)	.											.	RNF133	227	0			c.210_211del						.																																			SO:0001589	frameshift_variant	168433	exon1			CTGCCACTCTCTT	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.210_211delAG	7.37:g.122338766_122338767delCT	ENSP00000344489:p.Arg70fs	90.0	0.0		85.0	28.0	NM_139175	A4D0W2|Q8N7G7	Frame_Shift_Del	DEL	ENST00000340112.2	37	CCDS5784.1																																																																																			.		0.431	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
ROBO3	64221	ucsc.edu;bcgsc.ca	37	11	124749788	124749788	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:124749788A>G	ENST00000397801.1	+	26	4094	c.3902A>G	c.(3901-3903)gAg>gGg	p.E1301G	ROBO3_ENST00000543966.1_Missense_Mutation_p.E64G|ROBO3_ENST00000538940.1_Missense_Mutation_p.E1279G|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1301					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CGCAGTGGGGAGAGGAAAGCG	0.701																																					p.E1301G		.											.	ROBO3	113	0			c.A3902G						.						16.0	21.0	20.0					11																	124749788		2040	4184	6224	SO:0001583	missense	64221	exon26			GTGGGGAGAGGAA	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3902A>G	11.37:g.124749788A>G	ENSP00000380903:p.Glu1301Gly	42.0	1.0		33.0	4.0	NM_022370		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.386962	0.61956	.	.	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.66460	-0.21;-0.2;0.71	5.5	5.5	0.81552	.	0.169764	0.27725	N	0.018102	T	0.65080	0.2657	L	0.54323	1.7	0.36039	D	0.83993	P	0.40970	0.734	B	0.42798	0.398	T	0.72340	-0.4323	10	0.37606	T	0.19	.	13.1249	0.59349	1.0:0.0:0.0:0.0	.	1301	Q96MS0	ROBO3_HUMAN	G	1301;1279;64	ENSP00000380903:E1301G;ENSP00000441797:E1279G;ENSP00000438799:E64G	ENSP00000380903:E1301G	E	+	2	0	ROBO3	124254998	1.000000	0.71417	0.331000	0.25455	0.288000	0.27193	4.080000	0.57620	2.076000	0.62316	0.533000	0.62120	GAG	.		0.701	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
RPP30	10556	ucsc.edu;bcgsc.ca	37	10	92660343	92660343	+	Silent	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:92660343T>C	ENST00000371703.3	+	11	985	c.714T>C	c.(712-714)gcT>gcC	p.A238A	RPP30_ENST00000489806.1_3'UTR|RPP30_ENST00000413330.1_Silent_p.A238A	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	238					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						GAAAAACTGCTTTTGGAATTA	0.378																																					p.A238A		.											.	RPP30	226	0			c.T714C						.						176.0	192.0	186.0					10																	92660343		2203	4300	6503	SO:0001819	synonymous_variant	10556	exon11			AACTGCTTTTGGA	BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.714T>C	10.37:g.92660343T>C		77.0	0.0		42.0	4.0	NM_006413	B2R799|E9PB02	Silent	SNP	ENST00000371703.3	37	CCDS7411.1																																																																																			.		0.378	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049347.1	NM_006413	
RUNX3	864	ucsc.edu;bcgsc.ca	37	1	25228849	25228849	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:25228849A>G	ENST00000308873.6	-	5	1020	c.1012T>C	c.(1012-1014)Tct>Cct	p.S338P	RUNX3_ENST00000540420.1_Missense_Mutation_p.S245P|RUNX3_ENST00000496967.1_5'Flank|RUNX3_ENST00000399916.1_Missense_Mutation_p.S352P|RUNX3_ENST00000338888.3_Missense_Mutation_p.S352P	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	338	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		TAGGAGCCAGAGGATGTCCCG	0.677																																					p.S352P		.											.	RUNX3	414	0			c.T1054C						.						20.0	24.0	23.0					1																	25228849		2198	4295	6493	SO:0001583	missense	864	exon6			AGCCAGAGGATGT	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.1012T>C	1.37:g.25228849A>G	ENSP00000308051:p.Ser338Pro	41.0	0.0		46.0	4.0	NM_001031680	B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000308873.6	37	CCDS257.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.023347	0.75390	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000540420;ENST00000428150	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	3.93	3.93	0.45458	Runx inhibition (1);	0.000000	0.85682	D	0.000000	T	0.53158	0.1779	L	0.55990	1.75	0.53688	D	0.999971	D;D;D	0.76494	0.994;0.999;0.994	D;D;D	0.83275	0.962;0.996;0.989	T	0.54193	-0.8330	10	0.49607	T	0.09	-22.0821	13.2451	0.60018	1.0:0.0:0.0:0.0	.	285;352;338	E9PH34;B1AJV5;Q13761	.;.;RUNX3_HUMAN	P	352;338;352;245;285	ENSP00000382800:S352P;ENSP00000308051:S338P;ENSP00000343477:S352P;ENSP00000444872:S245P	ENSP00000308051:S338P	S	-	1	0	RUNX3	25101436	1.000000	0.71417	0.988000	0.46212	0.776000	0.43924	6.808000	0.75206	1.788000	0.52465	0.379000	0.24179	TCT	.		0.677	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237923107	237923107	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:237923107A>C	ENST00000366574.2	+	83	11674	c.11357A>C	c.(11356-11358)gAt>gCt	p.D3786A	RYR2_ENST00000542537.1_Missense_Mutation_p.D3770A|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.D3792A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3786					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGAAAAAGGATGTGGGCTTC	0.413																																					p.D3786A		.											.	RYR2	158	0			c.A11357C						.						116.0	113.0	114.0					1																	237923107		1854	4090	5944	SO:0001583	missense	6262	exon83			AAAAGGATGTGGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11357A>C	1.37:g.237923107A>C	ENSP00000355533:p.Asp3786Ala	144.0	0.0		166.0	43.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.020179	0.75275	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.89343	-2.5;-2.5;-2.5	5.81	5.81	0.92471	.	0.000000	0.64402	U	0.000006	D	0.90164	0.6926	M	0.79258	2.445	0.80722	D	1	B;B	0.30146	0.27;0.27	B;B	0.34138	0.176;0.092	D	0.89443	0.3725	10	0.66056	D	0.02	-21.7762	16.1616	0.81721	1.0:0.0:0.0:0.0	.	760;3786	B4DGV4;Q92736	.;RYR2_HUMAN	A	3786;3792;3770;760	ENSP00000355533:D3786A;ENSP00000353174:D3792A;ENSP00000443798:D3770A	ENSP00000353174:D3792A	D	+	2	0	RYR2	235989730	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	9.279000	0.95777	2.218000	0.71995	0.377000	0.23210	GAT	.		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SACM1L	22908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45748365	45748365	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:45748365A>G	ENST00000389061.5	+	4	503	c.299A>G	c.(298-300)tAt>tGt	p.Y100C	SACM1L_ENST00000418611.1_5'UTR|SACM1L_ENST00000464524.1_3'UTR|SACM1L_ENST00000541314.1_Intron	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	100					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GTCCTTTCTTATAAGAAGACA	0.373																																					p.Y100C		.											.	SACM1L	91	0			c.A299G						.						90.0	88.0	89.0					3																	45748365		2203	4300	6503	SO:0001583	missense	22908	exon4			TTTCTTATAAGAA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.299A>G	3.37:g.45748365A>G	ENSP00000373713:p.Tyr100Cys	240.0	0.0		188.0	52.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	37	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424864	0.83667	.	.	ENSG00000211456	ENST00000389061	T	0.56776	0.44	5.52	5.52	0.82312	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.55872	-0.8072	10	0.21540	T	0.41	-17.1008	15.6379	0.76970	1.0:0.0:0.0:0.0	.	100	Q9NTJ5	SAC1_HUMAN	C	100	ENSP00000373713:Y100C	ENSP00000373713:Y100C	Y	+	2	0	SACM1L	45723369	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.847000	0.92166	2.094000	0.63399	0.482000	0.46254	TAT	.		0.373	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
SAFB	6294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5653399	5653399	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:5653399C>T	ENST00000292123.5	+	11	1601	c.1494C>T	c.(1492-1494)gaC>gaT	p.D498D	SAFB_ENST00000592224.1_Silent_p.D498D|SAFB_ENST00000454510.1_Silent_p.D429D|SAFB_ENST00000538656.1_Silent_p.D341D|SAFB_ENST00000433404.1_Silent_p.D328D|SAFB_ENST00000588852.1_Silent_p.D498D	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	498					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GAGACAGTGACGGGAAAAAGG	0.423																																					p.D498D	Colon(88;338 1345 6184 8214 20897)	.											.	SAFB	228	0			c.C1494T						.						57.0	54.0	55.0					19																	5653399		2203	4300	6503	SO:0001819	synonymous_variant	6294	exon11			CAGTGACGGGAAA	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1494C>T	19.37:g.5653399C>T		142.0	0.0		189.0	53.0	NM_002967	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Silent	SNP	ENST00000292123.5	37	CCDS12142.1																																																																																			.		0.423	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2		
SCN5A	6331	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38645329	38645329	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:38645329A>G	ENST00000333535.4	-	12	1913	c.1764T>C	c.(1762-1764)caT>caC	p.H588H	SCN5A_ENST00000423572.2_Silent_p.H588H|SCN5A_ENST00000455624.2_Silent_p.H588H|SCN5A_ENST00000449557.2_Silent_p.H588H|SCN5A_ENST00000414099.2_Silent_p.H588H|SCN5A_ENST00000443581.1_Silent_p.H588H|SCN5A_ENST00000425664.1_Silent_p.H588H|SCN5A_ENST00000450102.2_Silent_p.H588H|SCN5A_ENST00000451551.2_Silent_p.H588H|SCN5A_ENST00000413689.1_Silent_p.H588H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	588					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TCTTTTTGCCATGGAGGGCGT	0.662																																					p.H588H		.											.	SCN5A	98	0			c.T1764C						.						79.0	84.0	83.0					3																	38645329		1997	4180	6177	SO:0001819	synonymous_variant	6331	exon12			TTTGCCATGGAGG	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1764T>C	3.37:g.38645329A>G		83.0	1.0		92.0	31.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	CCDS46796.1																																																																																			.		0.662	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SF3A1	10291	ucsc.edu;bcgsc.ca	37	22	30742471	30742471	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:30742471C>T	ENST00000215793.8	-	3	377	c.223G>A	c.(223-225)Gag>Aag	p.E75K	SF3A1_ENST00000439242.1_Missense_Mutation_p.E75K	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	75					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TTGTTGATCTCGTTCTGTCGG	0.483																																					p.E75K		.											.	SF3A1	157	0			c.G223A						.						190.0	187.0	188.0					22																	30742471		2203	4300	6503	SO:0001583	missense	10291	exon3			TGATCTCGTTCTG	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.223G>A	22.37:g.30742471C>T	ENSP00000215793:p.Glu75Lys	209.0	2.0		251.0	64.0	NM_001005409	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513539	0.85389	.	.	ENSG00000099995	ENST00000439242;ENST00000215793	T;T	0.50277	0.75;0.75	5.49	5.49	0.81192	SWAP/Surp (3);	0.000000	0.85682	D	0.000000	T	0.73753	0.3627	M	0.87038	2.855	0.80722	D	1	D	0.67145	0.996	D	0.71656	0.974	T	0.76105	-0.3081	10	0.54805	T	0.06	-32.6658	19.5755	0.95441	0.0:1.0:0.0:0.0	.	75	Q15459	SF3A1_HUMAN	K	75	ENSP00000390336:E75K;ENSP00000215793:E75K	ENSP00000215793:E75K	E	-	1	0	SF3A1	29072471	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	7.517000	0.81783	2.865000	0.98341	0.655000	0.94253	GAG	.		0.483	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
TUBGCP6	85378	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50655246	50655246	+	IGR	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:50655246T>G	ENST00000248846.5	-	0	5612				SELO_ENST00000380903.2_Missense_Mutation_p.S543R|SELO_ENST00000492092.1_3'UTR|TUBGCP6_ENST00000491449.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6						G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGCAGCTGAGTGCGGCAGAGC	0.682																																					.		.											.	.	.	0			.						.						21.0	30.0	27.0					22																	50655246		2184	4285	6469	SO:0001628	intergenic_variant	0	.			GCTGAGTGCGGCA	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150		22.37:g.50655246T>G		26.0	2.0		43.0	17.0	.	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934399	0.52866	.	.	ENSG00000073169	ENST00000380903	T	0.18016	2.24	4.88	-1.43	0.08884	.	0.349702	0.31301	N	0.007882	T	0.25975	0.0633	M	0.83953	2.67	0.09310	N	1	B;P	0.44690	0.131;0.841	B;P	0.52554	0.063;0.702	T	0.12967	-1.0527	10	0.66056	D	0.02	.	1.4202	0.02311	0.1681:0.3004:0.1143:0.4172	.	543;386	Q9BVL4;Q6ICA4	SELO_HUMAN;.	R	543	ENSP00000370288:S543R	ENSP00000370288:S543R	S	+	3	2	RP3-402G11.5	48997373	0.000000	0.05858	0.013000	0.15412	0.005000	0.04900	-0.158000	0.10070	-0.022000	0.13986	-0.344000	0.07964	AGT	.		0.682	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
SFMBT2	57713	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	7423775	7423775	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:7423775C>T	ENST00000361972.4	-	2	176	c.86G>A	c.(85-87)gGa>gAa	p.G29E	SFMBT2_ENST00000397160.3_Missense_Mutation_p.G29E|SFMBT2_ENST00000379711.2_Missense_Mutation_p.G29E|SFMBT2_ENST00000379713.3_Missense_Mutation_p.G29E|SFMBT2_ENST00000397167.1_Missense_Mutation_p.G29E	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	29					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						ATCAAGGTCTCCATTTCCATT	0.418																																					p.G29E		.											.	SFMBT2	141	0			c.G86A						.						127.0	119.0	122.0					10																	7423775		2203	4300	6503	SO:0001583	missense	57713	exon2			AGGTCTCCATTTC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.86G>A	10.37:g.7423775C>T	ENSP00000355109:p.Gly29Glu	86.0	0.0		92.0	24.0	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.617098	0.28801	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.31510	2.55;2.55;1.89;1.49;1.49	5.41	4.31	0.51392	.	0.351137	0.21051	N	0.080994	T	0.18923	0.0454	L	0.43152	1.355	0.09310	N	1	B;B	0.33694	0.421;0.22	B;B	0.27715	0.082;0.074	T	0.23226	-1.0194	10	0.02654	T	1	.	9.9855	0.41839	0.0:0.8935:0.0:0.1065	.	29;29	Q5T981;Q5VUG0	.;SMBT2_HUMAN	E	29	ENSP00000355109:G29E;ENSP00000380353:G29E;ENSP00000369035:G29E;ENSP00000369033:G29E;ENSP00000380346:G29E	ENSP00000355109:G29E	G	-	2	0	SFMBT2	7463781	0.471000	0.25862	0.305000	0.25099	0.233000	0.25261	2.278000	0.43426	2.553000	0.86117	0.650000	0.86243	GGA	.		0.418	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SLC10A2	6555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103701772	103701772	+	Silent	SNP	C	C	T	rs201412654		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:103701772C>T	ENST00000245312.3	-	5	1382	c.786G>A	c.(784-786)acG>acA	p.T262T		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	262			T -> M (in PBAM; abolishes taurocholate transport; dbSNP:rs72547505). {ECO:0000269|PubMed:9109432}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TCTGCATCCCCGTTTCAAAAG	0.418																																					p.T262T		.											.	SLC10A2	94	0			c.G786A						.						124.0	94.0	104.0					13																	103701772		2203	4300	6503	SO:0001819	synonymous_variant	6555	exon5			CATCCCCGTTTCA	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.786G>A	13.37:g.103701772C>T		90.0	0.0		106.0	28.0	NM_000452	A1L4F4|Q13839	Silent	SNP	ENST00000245312.3	37	CCDS9506.1																																																																																			.		0.418	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
SLC17A1	6568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	25811931	25811931	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:25811931G>A	ENST00000244527.4	-	9	1080	c.965C>T	c.(964-966)tCa>tTa	p.S322L	SLC17A1_ENST00000476801.1_Missense_Mutation_p.S322L|SLC17A1_ENST00000468082.1_Missense_Mutation_p.S268L|SLC17A1_ENST00000427328.1_Missense_Mutation_p.S268L	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	322					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.S322*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GAAGAAGTCTGATAACTGACC	0.448																																					p.S322L		.											.	SLC17A1	94	1	Substitution - Nonsense(1)	lung(1)	c.C965T						.						103.0	93.0	96.0					6																	25811931		2203	4300	6503	SO:0001583	missense	6568	exon9			AAGTCTGATAACT		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.965C>T	6.37:g.25811931G>A	ENSP00000244527:p.Ser322Leu	79.0	0.0		76.0	17.0	NM_005074	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351871	0.24512	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.59502	0.26;0.72;0.26;0.72	3.38	3.38	0.38709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.211340	0.06268	N	0.695074	T	0.43277	0.1240	L	0.50333	1.59	0.09310	N	1	B;B	0.32467	0.321;0.372	B;B	0.39771	0.205;0.309	T	0.48269	-0.9050	10	0.54805	T	0.06	.	10.5584	0.45131	0.0:0.0:1.0:0.0	.	268;322	Q14916-2;Q14916	.;NPT1_HUMAN	L	322;268;322;268	ENSP00000244527:S322L;ENSP00000410549:S268L;ENSP00000420614:S322L;ENSP00000420546:S268L	ENSP00000244527:S322L	S	-	2	0	SLC17A1	25919910	0.981000	0.34729	0.010000	0.14722	0.350000	0.29205	3.678000	0.54627	2.191000	0.70037	0.650000	0.86243	TCA	.		0.448	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
SLC22A16	85413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	110763664	110763664	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:110763664C>T	ENST00000368919.3	-	4	1032	c.966G>A	c.(964-966)ctG>ctA	p.L322L	RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000330550.4_Silent_p.L288L|SLC22A16_ENST00000439654.1_Silent_p.L322L|SLC22A16_ENST00000456137.2_3'UTR	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	322					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AAAGTTCTGACAGTTTACAGG	0.423																																					p.L322L		.											.	SLC22A16	91	0			c.G966A						.						104.0	98.0	100.0					6																	110763664		2203	4300	6503	SO:0001819	synonymous_variant	85413	exon4			TTCTGACAGTTTA		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.966G>A	6.37:g.110763664C>T		66.0	0.0		76.0	17.0	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	37	CCDS5084.1																																																																																			.		0.423	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
SLC22A17	51310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23816360	23816360	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:23816360G>A	ENST00000206544.8	-	8	1614	c.1278C>T	c.(1276-1278)gcC>gcT	p.A426A	SLC22A17_ENST00000354772.3_Silent_p.A408A|SLC22A17_ENST00000397267.1_Silent_p.A426A|SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000397260.3_Silent_p.A297A	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	426					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGAGGATGGCGGCAGCTTGGG	0.632																																					p.A426A		.											.	SLC22A17	226	0			c.C1278T						.						71.0	55.0	60.0					14																	23816360		2203	4300	6503	SO:0001819	synonymous_variant	51310	exon8			GATGGCGGCAGCT	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1278C>T	14.37:g.23816360G>A		70.0	0.0		71.0	24.0	NM_020372	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Silent	SNP	ENST00000206544.8	37	CCDS9593.1																																																																																			.		0.632	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
SLC36A1	206358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150843185	150843185	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:150843185T>A	ENST00000243389.3	+	3	438	c.215T>A	c.(214-216)gTg>gAg	p.V72E	SLC36A1_ENST00000520701.1_Missense_Mutation_p.V72E|SLC36A1_ENST00000521351.1_3'UTR|SLC36A1_ENST00000429484.2_Missense_Mutation_p.V72E|SLC36A1_ENST00000521925.1_Missense_Mutation_p.V72E	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	72				V -> A (in Ref. 7; BAB71435). {ECO:0000305}.	amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CCTCTGGCGGTGAAAAATGCA	0.463																																					p.V72E	Melanoma(151;1534 1860 12947 32979 37872)	.											.	SLC36A1	91	0			c.T215A						.						107.0	97.0	101.0					5																	150843185		2203	4300	6503	SO:0001583	missense	206358	exon3			TGGCGGTGAAAAA	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.215T>A	5.37:g.150843185T>A	ENSP00000243389:p.Val72Glu	113.0	0.0		109.0	24.0	NM_078483	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Missense_Mutation	SNP	ENST00000243389.3	37	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924335	0.92319	.	.	ENSG00000123643	ENST00000520111;ENST00000520701;ENST00000429484;ENST00000243389;ENST00000456739;ENST00000521925	T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27	6.08	6.08	0.98989	.	0.057095	0.64402	D	0.000002	T	0.17152	0.0412	M	0.84683	2.71	0.58432	D	0.999994	P;D	0.53151	0.956;0.958	D;P	0.63283	0.913;0.826	T	0.00083	-1.2103	10	0.72032	D	0.01	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	72;72	E7EW39;Q7Z2H8	.;S36A1_HUMAN	E	72	ENSP00000429796:V72E;ENSP00000428140:V72E;ENSP00000395640:V72E;ENSP00000243389:V72E;ENSP00000430305:V72E	ENSP00000243389:V72E	V	+	2	0	SLC36A1	150823378	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	7.859000	0.86982	2.333000	0.79357	0.533000	0.62120	GTG	.		0.463	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1	NM_078483	
SLC39A8	64116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103228652	103228652	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:103228652A>C	ENST00000394833.2	-	3	969	c.493T>G	c.(493-495)Ttt>Gtt	p.F165V	SLC39A8_ENST00000510255.1_5'UTR|SLC39A8_ENST00000424970.2_Missense_Mutation_p.F165V|SLC39A8_ENST00000356736.4_Missense_Mutation_p.F165V	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	165					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AGCCCCACAAAAAAGGTCAAA	0.368																																					p.F165V		.											.	SLC39A8	90	0			c.T493G						.						118.0	134.0	129.0					4																	103228652		2203	4300	6503	SO:0001583	missense	64116	exon3			CCACAAAAAAGGT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.493T>G	4.37:g.103228652A>C	ENSP00000378310:p.Phe165Val	364.0	0.0		294.0	80.0	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	37	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	A	31	5.062340	0.93898	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.45276	0.9;0.9;0.9	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	M	0.75884	2.315	0.80722	D	1	D;D;D	0.76494	0.987;0.999;0.991	D;D;D	0.75484	0.964;0.986;0.915	T	0.68796	-0.5314	10	0.72032	D	0.01	-11.2509	14.8503	0.70292	1.0:0.0:0.0:0.0	.	165;165;98	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	V	165	ENSP00000394548:F165V;ENSP00000349174:F165V;ENSP00000378310:F165V	ENSP00000349174:F165V	F	-	1	0	SLC39A8	103447675	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.097000	0.94193	2.108000	0.64289	0.533000	0.62120	TTT	.		0.368	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
SLC8A1	6546	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	40656603	40656603	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:40656603C>A	ENST00000403092.1	-	2	851	c.818G>T	c.(817-819)gGg>gTg	p.G273V	SLC8A1_ENST00000406391.2_Missense_Mutation_p.G273V|SLC8A1_ENST00000332839.4_Missense_Mutation_p.G273V|SLC8A1_ENST00000405269.1_Missense_Mutation_p.G273V|SLC8A1_ENST00000542756.1_Missense_Mutation_p.G273V|SLC8A1_ENST00000406785.2_Missense_Mutation_p.G273V|SLC8A1_ENST00000408028.2_Missense_Mutation_p.G273V|SLC8A1_ENST00000402441.1_Missense_Mutation_p.G273V|SLC8A1_ENST00000542024.1_Missense_Mutation_p.G273V|SLC8A1_ENST00000405901.3_Missense_Mutation_p.G273V			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	273	Calmodulin-binding. {ECO:0000255}.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AATAATCATCCCCCTCTGCTT	0.423																																					p.G273V		.											.	SLC8A1	93	0			c.G818T						.						178.0	177.0	178.0					2																	40656603		2203	4300	6503	SO:0001583	missense	6546	exon1			ATCATCCCCCTCT		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.818G>T	2.37:g.40656603C>A	ENSP00000384763:p.Gly273Val	111.0	2.0		107.0	32.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565593	0.65651	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.31769	1.5;1.53;1.53;1.53;1.5;1.5;1.53;1.48;1.5;1.5	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	M	0.82630	2.6	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.989;1.0;0.998;0.992;0.995	T	0.64390	-0.6419	10	0.87932	D	0	.	17.9158	0.88950	0.0:1.0:0.0:0.0	.	273;273;273;273;273	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	V	273	ENSP00000383886:G273V;ENSP00000440727:G273V;ENSP00000384763:G273V;ENSP00000385678:G273V;ENSP00000385188:G273V;ENSP00000385535:G273V;ENSP00000332931:G273V;ENSP00000384908:G273V;ENSP00000385811:G273V;ENSP00000443515:G273V	ENSP00000332931:G273V	G	-	2	0	SLC8A1	40510107	1.000000	0.71417	0.983000	0.44433	0.881000	0.50899	7.663000	0.83820	2.832000	0.97577	0.655000	0.94253	GGG	.		0.423	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SLC9A7	84679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	46541903	46541903	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:46541903G>A	ENST00000328306.4	-	2	418	c.393C>T	c.(391-393)agC>agT	p.S131S		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	131					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CCTGAGTGCAGCTGAGTGATT	0.488																																					p.S131S	Pancreas(118;454 1696 1930 13865 39976)	.											.	SLC9A7	132	0			c.C393T						.						74.0	56.0	62.0					X																	46541903		2203	4300	6503	SO:0001819	synonymous_variant	84679	exon2			AGTGCAGCTGAGT	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.393C>T	X.37:g.46541903G>A		51.0	0.0		49.0	26.0	NM_001257291	O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	37	CCDS14269.1																																																																																			.		0.488	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
SLIT3	6586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	168244433	168244433	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:168244433T>A	ENST00000519560.1	-	8	1084	c.665A>T	c.(664-666)cAc>cTc	p.H222L	SLIT3_ENST00000332966.8_Missense_Mutation_p.H222L|SLIT3_ENST00000404867.3_Missense_Mutation_p.H222L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	222	LRRCT 1.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGGCCAGGTGGCAGTCGCA	0.617																																					p.H222L	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.A665T						.						60.0	56.0	57.0					5																	168244433		2203	4300	6503	SO:0001583	missense	6586	exon8			GCCAGGTGGCAGT	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.665A>T	5.37:g.168244433T>A	ENSP00000430333:p.His222Leu	39.0	0.0		70.0	22.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497282	0.85069	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.75938	-0.98;-0.98;-0.97	5.53	4.4	0.53042	Cysteine-rich flanking region, C-terminal (1);	0.180128	0.64402	D	0.000013	D	0.84070	0.5391	M	0.93763	3.455	0.80722	D	1	P;P;B	0.45283	0.688;0.855;0.451	B;P;B	0.49953	0.218;0.627;0.341	D	0.87315	0.2314	10	0.87932	D	0	.	10.0534	0.42230	0.0:0.1081:0.0:0.8919	.	222;222;222	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	L	222	ENSP00000430333:H222L;ENSP00000332164:H222L;ENSP00000384890:H222L	ENSP00000332164:H222L	H	-	2	0	SLIT3	168177011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.520000	0.53465	2.099000	0.63709	0.459000	0.35465	CAC	.		0.617	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SPAM1	6677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123594252	123594252	+	Missense_Mutation	SNP	C	C	T	rs376151172		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:123594252C>T	ENST00000439500.1	+	4	1241	c.628C>T	c.(628-630)Ctt>Ttt	p.L210F	SPAM1_ENST00000223028.7_Missense_Mutation_p.L210F|SPAM1_ENST00000340011.5_Missense_Mutation_p.L210F|SPAM1_ENST00000460182.1_Missense_Mutation_p.L210F|SPAM1_ENST00000402183.2_Missense_Mutation_p.L210F	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	210					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGGAAAATTACTTCGGCCAAA	0.383																																					p.L210F		.											.	SPAM1	94	0			c.C628T						.						78.0	83.0	81.0					7																	123594252		2203	4299	6502	SO:0001583	missense	6677	exon3			AAATTACTTCGGC	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.628C>T	7.37:g.123594252C>T	ENSP00000402123:p.Leu210Phe	142.0	0.0		115.0	31.0	NM_153189	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990654	0.35131	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	6.17	3.34	0.38264	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.495783	0.20231	N	0.096470	T	0.36799	0.0980	M	0.88842	2.985	0.09310	N	0.999999	P;P	0.40970	0.734;0.734	B;B	0.38378	0.272;0.272	T	0.42068	-0.9473	9	.	.	.	-26.5249	6.3721	0.21487	0.3469:0.5138:0.0:0.1392	.	210;210	Q8TC30;P38567	.;HYALP_HUMAN	F	210	ENSP00000386028:L210F;ENSP00000417934:L210F;ENSP00000345849:L210F;ENSP00000402123:L210F;ENSP00000223028:L210F	.	L	+	1	0	SPAM1	123381488	0.000000	0.05858	0.023000	0.16930	0.770000	0.43624	-0.053000	0.11846	0.901000	0.36495	0.655000	0.94253	CTT	.		0.383	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
SREBF1	6720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	17719659	17719659	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:17719659G>A	ENST00000261646.5	-	11	2260	c.2076C>T	c.(2074-2076)gcC>gcT	p.A692A	SREBF1_ENST00000355815.4_Silent_p.A722A|SREBF1_ENST00000395757.1_Silent_p.A438A|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000338854.5_Silent_p.A692A|SREBF1_ENST00000583732.1_5'Flank	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	692					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCAGGTTGGTGGCAGTGAGGT	0.662																																					p.A722A		.											.	SREBF1	91	0			c.C2166T						.						29.0	18.0	22.0					17																	17719659		2192	4297	6489	SO:0001819	synonymous_variant	6720	exon12			GTTGGTGGCAGTG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2076C>T	17.37:g.17719659G>A		15.0	0.0		20.0	11.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Silent	SNP	ENST00000261646.5	37	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658616	0.29515	.	.	ENSG00000072310	ENST00000395751	.	.	.	5.4	1.54	0.23209	.	.	.	.	.	T	0.55481	0.1923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44605	-0.9317	4	.	.	.	-10.3203	7.9803	0.30179	0.4089:0.0:0.5911:0.0	.	.	.	.	Y	700	.	.	H	-	1	0	SREBF1	17660384	0.748000	0.28294	0.979000	0.43373	0.926000	0.56050	0.563000	0.23547	0.040000	0.15660	0.561000	0.74099	CAC	.		0.662	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
SUV39H2	79723	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	10	14938885	14938885	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:14938885A>C	ENST00000354919.6	+	3	218	c.218A>C	c.(217-219)gAt>gCt	p.D73A	SUV39H2_ENST00000313519.5_Missense_Mutation_p.D13A|SUV39H2_ENST00000378325.3_Missense_Mutation_p.D73A	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	73	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						GGATGGCCAGATTCTACAAAT	0.328																																					p.D73A		.											.	SUV39H2	290	0			c.A218C						.						69.0	77.0	74.0					10																	14938885		2203	4300	6503	SO:0001583	missense	79723	exon3			GGCCAGATTCTAC	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.218A>C	10.37:g.14938885A>C	ENSP00000346997:p.Asp73Ala	68.0	0.0		61.0	12.0	NM_001193426	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	37	CCDS53494.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.069540	0.55539	.	.	ENSG00000152455	ENST00000433779;ENST00000378325;ENST00000354919;ENST00000313519;ENST00000420416;ENST00000412254	T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.86	5.86	0.93980	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);Chromo domain, conserved site (1);	0.063070	0.64402	D	0.000005	T	0.64681	0.2620	L	0.45470	1.425	0.58432	D	0.999998	B;B	0.25904	0.04;0.137	B;B	0.26969	0.043;0.075	T	0.59958	-0.7356	10	0.20519	T	0.43	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	73;73	Q9H5I1;Q9H5I1-3	SUV92_HUMAN;.	A	13;73;73;13;13;13	ENSP00000388968:D13A;ENSP00000367576:D73A;ENSP00000346997:D73A;ENSP00000319208:D13A;ENSP00000392201:D13A;ENSP00000388218:D13A	ENSP00000319208:D13A	D	+	2	0	SUV39H2	14978891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.162000	0.94745	2.367000	0.80283	0.528000	0.53228	GAT	.		0.328	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
TAS2R40	259286	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142919945	142919945	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:142919945C>T	ENST00000408947.3	+	1	816	c.774C>T	c.(772-774)ttC>ttT	p.F258F	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	258					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					TCTACATTTTCAATGCAATTG	0.488																																					p.F258F		.											.	TAS2R40	23	0			c.C774T						.						117.0	116.0	117.0					7																	142919945		1930	4142	6072	SO:0001819	synonymous_variant	259286	exon1			CATTTTCAATGCA	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.774C>T	7.37:g.142919945C>T		157.0	2.0		162.0	29.0	NM_176882	A4D2I2|Q645W6	Silent	SNP	ENST00000408947.3	37	CCDS43662.1																																																																																			.		0.488	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327097.1		
TAT	6898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	71606499	71606499	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr16:71606499A>G	ENST00000355962.4	-	5	634	c.501T>C	c.(499-501)ccT>ccC	p.P167P	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	167					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	GAGAGAAACCAGGTCTTGGAA	0.443																																					p.P167P	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	.											.	TAT	92	0			c.T501C						.						85.0	82.0	83.0					16																	71606499		2198	4300	6498	SO:0001819	synonymous_variant	6898	exon5			GAAACCAGGTCTT		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.501T>C	16.37:g.71606499A>G		122.0	0.0		109.0	24.0	NM_000353	B2R8I1|D3DWS2	Silent	SNP	ENST00000355962.4	37	CCDS10903.1																																																																																			.		0.443	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133941375	133941375	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:133941375C>T	ENST00000220616.4	+	23	4794	c.4754C>T	c.(4753-4755)gCt>gTt	p.A1585V	TG_ENST00000542445.1_Missense_Mutation_p.A19V|TG_ENST00000377869.1_Missense_Mutation_p.A1528V	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1585					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACGCCAATGCTCCTGTGGCT	0.463																																					p.A1585V		.											.	TG	145	0			c.C4754T						.						142.0	121.0	128.0					8																	133941375		2203	4300	6503	SO:0001583	missense	7038	exon23			CCAATGCTCCTGT	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4754C>T	8.37:g.133941375C>T	ENSP00000220616:p.Ala1585Val	144.0	0.0		177.0	52.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	8.043	0.764313	0.15914	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445	T;T;T	0.62788	0.0;0.0;0.0	5.5	-1.08	0.09936	.	1.845860	0.02581	N	0.098887	T	0.29321	0.0730	N	0.00926	-1.1	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.15093	-1.0449	10	0.24483	T	0.36	.	3.7294	0.08487	0.2064:0.3661:0.0:0.4275	.	19;1585	F5GWW5;P01266	.;THYG_HUMAN	V	1528;391;1585;19	ENSP00000367100:A1528V;ENSP00000220616:A1585V;ENSP00000441693:A19V	ENSP00000220616:A1585V	A	+	2	0	TG	134010557	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.064000	0.14437	0.015000	0.14971	-0.150000	0.13652	GCT	.		0.463	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TLL1	7092	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	166999180	166999180	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:166999180T>A	ENST00000061240.2	+	18	3087	c.2440T>A	c.(2440-2442)Tta>Ata	p.L814I	TLL1_ENST00000507499.1_Missense_Mutation_p.L837I	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	814	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CCGAATCAAATTAGTAAGTGA	0.453																																					p.L814I		.											.	TLL1	158	0			c.T2440A						.						107.0	94.0	98.0					4																	166999180		2203	4300	6503	SO:0001583	missense	7092	exon18			ATCAAATTAGTAA	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2440T>A	4.37:g.166999180T>A	ENSP00000061240:p.Leu814Ile	64.0	1.0		91.0	25.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	T	9.695	1.152919	0.21371	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.30182	1.54;1.54	5.78	2.01	0.26516	CUB (5);	0.075916	0.51477	U	0.000100	T	0.26376	0.0644	L	0.61387	1.9	0.80722	D	1	B;B	0.19817	0.039;0.014	B;B	0.25140	0.058;0.017	T	0.07888	-1.0749	10	0.42905	T	0.14	.	3.6157	0.08077	0.1921:0.4296:0.0:0.3783	.	837;814	E9PD25;O43897	.;TLL1_HUMAN	I	814;837	ENSP00000061240:L814I;ENSP00000426082:L837I	ENSP00000061240:L814I	L	+	1	2	TLL1	167218630	1.000000	0.71417	0.999000	0.59377	0.026000	0.11368	0.677000	0.25262	0.430000	0.26230	-0.297000	0.09499	TTA	.		0.453	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
TMEM184B	25829	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38643832	38643832	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:38643832C>A	ENST00000361906.3	-	2	344	c.136G>T	c.(136-138)Gct>Tct	p.A46S	TMEM184B_ENST00000361684.4_Missense_Mutation_p.A46S	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	46						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					ATGGCCTGAGCGGCAGTTGTC	0.637																																					p.A46S		.											.	TMEM184B	68	0			c.G136T						.						59.0	51.0	54.0					22																	38643832		2203	4300	6503	SO:0001583	missense	25829	exon2			CCTGAGCGGCAGT	AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.136G>T	22.37:g.38643832C>A	ENSP00000355210:p.Ala46Ser	32.0	1.0		43.0	10.0	NM_001195071	A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Missense_Mutation	SNP	ENST00000361906.3	37	CCDS13969.2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671681	0.88348	.	.	ENSG00000198792	ENST00000361906;ENST00000361684	T;T	0.45276	0.9;0.9	4.66	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.88310	2.945	0.80722	D	1	P	0.51449	0.945	P	0.59221	0.854	T	0.69435	-0.5146	10	0.48119	T	0.1	.	12.9039	0.58141	0.0:0.9207:0.0:0.0793	.	46	Q9Y519	T184B_HUMAN	S	46	ENSP00000355210:A46S;ENSP00000354441:A46S	ENSP00000354441:A46S	A	-	1	0	TMEM184B	36973778	1.000000	0.71417	0.141000	0.22245	0.966000	0.64601	5.569000	0.67391	0.960000	0.38005	0.491000	0.48974	GCT	.		0.637	TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075445.4	NM_012264	
TMPRSS11F	389208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	68934361	68934361	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:68934361G>T	ENST00000356291.2	-	7	789	c.730C>A	c.(730-732)Ctc>Atc	p.L244I	UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000499180.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	244	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						GCTGCTGTGAGCAGCCATGTG	0.527																																					p.L244I		.											.	TMPRSS11F	91	0			c.C730A						.						81.0	71.0	75.0					4																	68934361		2203	4300	6503	SO:0001583	missense	389208	exon7			CTGTGAGCAGCCA	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.730C>A	4.37:g.68934361G>T	ENSP00000348639:p.Leu244Ile	93.0	0.0		148.0	44.0	NM_207407	A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366887	0.41902	.	.	ENSG00000198092	ENST00000356291	D	0.97553	-4.43	5.73	3.91	0.45181	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.133529	0.33631	N	0.004709	D	0.93966	0.8068	L	0.45422	1.42	0.33054	D	0.533191	P	0.38617	0.64	B	0.36567	0.228	D	0.94886	0.8043	10	0.38643	T	0.18	.	11.8022	0.52133	0.0:0.4296:0.5704:0.0	.	244	Q6ZWK6	TM11F_HUMAN	I	244	ENSP00000348639:L244I	ENSP00000348639:L244I	L	-	1	0	TMPRSS11F	68616956	0.998000	0.40836	1.000000	0.80357	0.619000	0.37552	0.779000	0.26746	1.370000	0.46153	0.655000	0.94253	CTC	.		0.527	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
TNFSF14	8740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6670048	6670048	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:6670048A>G	ENST00000599359.1	-	2	414	c.33T>C	c.(31-33)ttT>ttC	p.F11F	TNFSF14_ENST00000326176.9_Silent_p.F11F|TNFSF14_ENST00000245912.3_Silent_p.F11F			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	11					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CATCCACCACAAACACTGAGG	0.602																																					p.F11F		.											.	TNFSF14	228	0			c.T33C						.						117.0	90.0	99.0					19																	6670048		2203	4300	6503	SO:0001819	synonymous_variant	8740	exon2			CACCACAAACACT	AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.33T>C	19.37:g.6670048A>G		93.0	0.0		86.0	25.0	NM_003807	A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Silent	SNP	ENST00000599359.1	37	CCDS12171.1																																																																																			.		0.602	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1		
TRAPPC8	22878	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29470774	29470774	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr18:29470774T>C	ENST00000283351.4	-	12	1987	c.1652A>G	c.(1651-1653)aAc>aGc	p.N551S	TRAPPC8_ENST00000582513.1_Missense_Mutation_p.N551S|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.N497S	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	551					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACTTTTCATGTTTATAAAGCA	0.368																																					p.N551S		.											.	TRAPPC8	159	0			c.A1652G						.						132.0	133.0	133.0					18																	29470774		2203	4300	6503	SO:0001583	missense	22878	exon12			TTCATGTTTATAA	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1652A>G	18.37:g.29470774T>C	ENSP00000283351:p.Asn551Ser	151.0	0.0		109.0	28.0	NM_014939	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.782815	0.49891	.	.	ENSG00000153339	ENST00000283351	T	0.75050	-0.9	5.81	5.81	0.92471	.	0.043658	0.85682	D	0.000000	T	0.50888	0.1642	N	0.03154	-0.405	0.58432	D	0.999995	B;B	0.29232	0.027;0.238	B;B	0.24006	0.038;0.05	T	0.54234	-0.8324	10	0.13108	T	0.6	.	16.1647	0.81745	0.0:0.0:0.0:1.0	.	551;551	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	S	551	ENSP00000283351:N551S	ENSP00000283351:N551S	N	-	2	0	TRAPPC8	27724772	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.433000	0.80362	2.226000	0.72624	0.377000	0.23210	AAC	.		0.368	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72975034	72975034	+	Splice_Site	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:72975034C>A	ENST00000262209.4	-	6	1014	c.807G>T	c.(805-807)gaG>gaT	p.E269D		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	269					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GAAGAGTTACCTCCACTGGGT	0.358																																					p.E269D		.											.	TRPA1	230	0			c.G807T						.						117.0	109.0	112.0					8																	72975034		2203	4300	6503	SO:0001630	splice_region_variant	8989	exon6			AGTTACCTCCACT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.807+1G>T	8.37:g.72975034C>A		260.0	0.0		243.0	61.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999723	0.35320	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.38887	1.11;2.63	5.62	4.72	0.59763	Ankyrin repeat-containing domain (4);	0.097447	0.64402	D	0.000001	T	0.23846	0.0577	N	0.00468	-1.46	0.49051	D	0.999748	D	0.58268	0.982	P	0.57244	0.816	T	0.46484	-0.9188	9	.	.	.	-25.8627	13.7095	0.62659	0.0:0.9231:0.0:0.0769	.	269	O75762	TRPA1_HUMAN	D	121;269	ENSP00000428151:E121D;ENSP00000262209:E269D	.	E	-	3	2	TRPA1	73137588	1.000000	0.71417	0.989000	0.46669	0.074000	0.17049	5.070000	0.64376	1.301000	0.44836	0.650000	0.86243	GAG	.		0.358	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Missense_Mutation
TRPT1	83707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63992051	63992051	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:63992051C>A	ENST00000317459.6	-	5	634	c.466G>T	c.(466-468)Gcc>Tcc	p.A156S	TRPT1_ENST00000541278.1_Missense_Mutation_p.A156S|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000394547.3_Missense_Mutation_p.A107S|TRPT1_ENST00000546089.1_Missense_Mutation_p.A107S|TRPT1_ENST00000546133.1_Missense_Mutation_p.A30S|NUDT22_ENST00000441250.2_5'Flank|TRPT1_ENST00000394546.2_Missense_Mutation_p.A158S|NUDT22_ENST00000279206.3_5'Flank			Q86TN4	TRPT1_HUMAN	tRNA phosphotransferase 1	156					regulation of protein kinase activity (GO:0045859)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)		tRNA 2'-phosphotransferase activity (GO:0000215)			lung(2)|skin(1)	3						AGTCCTGGGGCCAGGTGAATG	0.612																																					p.A158S		.											.	TRPT1	90	0			c.G472T						.						93.0	85.0	88.0					11																	63992051		2201	4297	6498	SO:0001583	missense	83707	exon5			CTGGGGCCAGGTG		CCDS31595.1, CCDS44639.1, CCDS53652.1, CCDS53653.1	11q13	2012-05-03			ENSG00000149743	ENSG00000149743			20316	protein-coding gene	gene with protein product	"""tRNA splicing 2' phosphotransferase 1"""	610470				14504659	Standard	NM_001160389		Approved	MGC11134	uc010rnc.2	Q86TN4	OTTHUMG00000167844	ENST00000317459.6:c.466G>T	11.37:g.63992051C>A	ENSP00000314073:p.Ala156Ser	39.0	0.0		69.0	12.0	NM_001160389	A8MU17|A8MYC9|F5H2B2|Q9BSB9	Missense_Mutation	SNP	ENST00000317459.6	37	CCDS31595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.58|17.58	3.426213|3.426213	0.62733|0.62733	.|.	.|.	ENSG00000149743|ENSG00000149743	ENST00000394547;ENST00000394546;ENST00000541278;ENST00000546133;ENST00000317459;ENST00000546089;ENST00000545812|ENST00000544286	T;T;T;T;T;T;T|.	0.40756|.	1.02;1.02;1.02;1.02;1.02;1.02;1.02|.	4.75|4.75	3.78|3.78	0.43462|0.43462	.|.	0.188584|.	0.44688|.	D|.	0.000432|.	T|T	0.50292|0.50292	0.1607|0.1607	N|N	0.25890|0.25890	0.77|0.77	0.41567|0.41567	D|D	0.988664|0.988664	B;P;P;B|.	0.45986|.	0.059;0.488;0.87;0.335|.	B;B;P;B|.	0.46796|.	0.182;0.305;0.527;0.206|.	T|T	0.43845|0.43845	-0.9366|-0.9366	10|5	0.33940|.	T|.	0.23|.	-12.5052|-12.5052	12.1479|12.1479	0.54034|0.54034	0.2735:0.7265:0.0:0.0|0.2735:0.7265:0.0:0.0	.|.	156;158;107;156|.	F5H2B2;A8MU17;Q86TN4-2;Q86TN4|.	.;.;.;TRPT1_HUMAN|.	S|V	107;158;156;30;156;107;158|19	ENSP00000378051:A107S;ENSP00000378050:A158S;ENSP00000438683:A156S;ENSP00000439586:A30S;ENSP00000314073:A156S;ENSP00000437741:A107S;ENSP00000442066:A158S|.	ENSP00000314073:A156S|.	A|G	-|-	1|2	0|0	TRPT1|TRPT1	63748627|63748627	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.951000|0.951000	0.60555|0.60555	1.936000|1.936000	0.40183|0.40183	2.380000|2.380000	0.81148|0.81148	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.		0.612	TRPT1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396579.1	NM_031472	
TSEN2	80746	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	12544973	12544973	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:12544973A>T	ENST00000284995.6	+	5	908	c.521A>T	c.(520-522)aAc>aTc	p.N174I	TSEN2_ENST00000454502.2_Intron|TSEN2_ENST00000314571.7_Missense_Mutation_p.N174I|TSEN2_ENST00000383797.5_Missense_Mutation_p.N174I|TSEN2_ENST00000444864.1_Missense_Mutation_p.N174I|TSEN2_ENST00000402228.3_Missense_Mutation_p.N174I|TSEN2_ENST00000415684.1_Missense_Mutation_p.N174I|RNU6-404P_ENST00000515968.1_RNA	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	174					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						TCTGTGGTAAACGGGGACTCT	0.542																																					p.N174I		.											.	TSEN2	90	0			c.A521T						.						84.0	95.0	92.0					3																	12544973		2203	4300	6503	SO:0001583	missense	80746	exon5			TGGTAAACGGGGA	BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.521A>T	3.37:g.12544973A>T	ENSP00000284995:p.Asn174Ile	129.0	1.0		139.0	43.0	NM_001145395	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	ENST00000284995.6	37	CCDS2611.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.914595	0.33815	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T	0.56611	0.49;0.46;0.49;0.5;0.5;0.45;0.46	4.61	2.17	0.27698	.	1.630570	0.02930	N	0.139055	T	0.56247	0.1972	M	0.63428	1.95	0.09310	N	1	P;P;P	0.47841	0.797;0.901;0.797	P;B;P	0.46253	0.509;0.312;0.509	T	0.33420	-0.9869	10	0.59425	D	0.04	-15.2336	4.6835	0.12747	0.6907:0.2042:0.1051:0.0	.	174;174;174	G5E9Q3;Q8NCE0;Q8NCE0-3	.;SEN2_HUMAN;.	I	174;174;174;174;174;174;147;174	ENSP00000406238:N174I;ENSP00000323188:N174I;ENSP00000373307:N174I;ENSP00000385976:N174I;ENSP00000284995:N174I;ENSP00000407974:N174I;ENSP00000416510:N174I	ENSP00000284995:N174I	N	+	2	0	TSEN2	12519973	0.003000	0.15002	0.001000	0.08648	0.127000	0.20565	1.315000	0.33608	0.231000	0.21079	0.496000	0.49642	AAC	.		0.542	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251981.1	NM_025265	
TUBD1	51174	broad.mit.edu;bcgsc.ca	37	17	57937714	57937714	+	Missense_Mutation	SNP	T	T	C	rs373012328		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:57937714T>C	ENST00000592426.1	-	8	1331	c.1331A>G	c.(1330-1332)gAg>gGg	p.E444G	TUBD1_ENST00000394239.3_Missense_Mutation_p.E387G|TUBD1_ENST00000376094.4_Missense_Mutation_p.E342G|TUBD1_ENST00000346141.6_Missense_Mutation_p.E190G|TUBD1_ENST00000325752.3_Missense_Mutation_p.E444G|TUBD1_ENST00000539018.1_Missense_Mutation_p.E228G|TUBD1_ENST00000340993.6_Missense_Mutation_p.E389G			Q9UJT1	TBD_HUMAN	tubulin, delta 1	444					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	AACAACCTGCTCTAATGACGT	0.328																																					p.E444G		.											.	TUBD1	227	0			c.A1331G						.	T	GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU	1,4405	2.1+/-5.4	0,1,2202	116.0	116.0	116.0		1166,1160,1025,809,683,1331	5.8	1.0	17		116	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	TUBD1	NM_001193609.1,NM_001193610.1,NM_001193611.1,NM_001193612.1,NM_001193613.1,NM_016261.3	98,98,98,98,98,98	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	389/399,387/397,342/352,270/280,228/238,444/454	57937714	1,13005	2203	4300	6503	SO:0001583	missense	51174	exon9			ACCTGCTCTAATG	AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.1331A>G	17.37:g.57937714T>C	ENSP00000468518:p.Glu444Gly	174.0	2.0		198.0	9.0	NM_016261	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	37	CCDS11620.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.697520	0.88830	2.27E-4	0.0	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094;ENST00000539018	T;T;D;T;T	0.81996	-1.26;-0.99;-1.56;-1.03;-1.05	5.82	5.82	0.92795	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92443	0.7601	M	0.89414	3.03	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;0.999;0.994;0.989	D;D;P;D;D;P	0.91635	0.989;0.999;0.882;0.99;0.945;0.762	D	0.93564	0.6898	10	0.66056	D	0.02	-20.3195	16.1777	0.81874	0.0:0.0:0.0:1.0	.	387;190;389;342;389;444	E9PCA7;Q9UJT1-3;Q5KU37;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;.;TBD_HUMAN	G	444;389;190;387;342;228	ENSP00000320797:E444G;ENSP00000342399:E389G;ENSP00000342561:E190G;ENSP00000377785:E387G;ENSP00000365262:E342G	ENSP00000320797:E444G	E	-	2	0	TUBD1	55292496	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.502000	0.81614	2.222000	0.72286	0.383000	0.25322	GAG	.		0.328	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261	
UBE2J2	118424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1190842	1190842	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:1190842T>A	ENST00000349431.6	-	7	740	c.521A>T	c.(520-522)cAa>cTa	p.Q174L	UBE2J2_ENST00000347370.2_Missense_Mutation_p.Q122L|UBE2J2_ENST00000491779.1_5'Flank|UBE2J2_ENST00000400930.4_Missense_Mutation_p.Q190L|UBE2J2_ENST00000339385.6_Missense_Mutation_p.Q139L|UBE2J2_ENST00000348298.7_Missense_Mutation_p.Q122L|UBE2J2_ENST00000360466.2_Missense_Mutation_p.Q174L|UBE2J2_ENST00000400929.2_Missense_Mutation_p.Q122L	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	174					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		GAGTTCGTCTTGTGCTTTCTG	0.542																																					p.Q190L		.											.	UBE2J2	90	0			c.A569T						.						108.0	122.0	117.0					1																	1190842		2203	4300	6503	SO:0001583	missense	118424	exon8			TCGTCTTGTGCTT	AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.521A>T	1.37:g.1190842T>A	ENSP00000305826:p.Gln174Leu	243.0	0.0		258.0	68.0	NM_194315	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	ENST00000349431.6	37	CCDS14.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.775239	0.49786	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930;ENST00000435198	T;T;T;T;T;T;T;T	0.72725	0.91;-0.09;0.91;0.91;0.91;-0.09;-0.68;-0.08	5.87	4.75	0.60458	Ubiquitin-conjugating enzyme/RWD-like (1);	0.049900	0.85682	D	0.000000	T	0.59088	0.2168	L	0.40543	1.245	0.80722	D	1	B;B;B;B	0.29253	0.049;0.001;0.0;0.239	B;B;B;B	0.26517	0.014;0.002;0.001;0.07	T	0.53408	-0.8443	10	0.26408	T	0.33	-18.426	10.9167	0.47139	0.0:0.0731:0.0:0.9269	.	122;190;174;207	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	L	122;174;139;122;122;174;190;174	ENSP00000344857:Q122L;ENSP00000305826:Q174L;ENSP00000340197:Q139L;ENSP00000342541:Q122L;ENSP00000383718:Q122L;ENSP00000353653:Q174L;ENSP00000383719:Q190L;ENSP00000393301:Q174L	ENSP00000340197:Q139L	Q	-	2	0	UBE2J2	1180705	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	5.912000	0.69948	1.059000	0.40554	0.482000	0.46254	CAA	.		0.542	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1	NM_058167	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	215916665	215916665	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:215916665G>A	ENST00000307340.3	-	59	11788	c.11402C>T	c.(11401-11403)cCc>cTc	p.P3801L	USH2A_ENST00000366943.2_Missense_Mutation_p.P3801L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3801	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGAATTTCGGGGATGAGGAT	0.393										HNSCC(13;0.011)																											p.P3801L		.											.	USH2A	115	0			c.C11402T						.						91.0	86.0	88.0					1																	215916665		2203	4300	6503	SO:0001583	missense	7399	exon59			ATTTCGGGGATGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11402C>T	1.37:g.215916665G>A	ENSP00000305941:p.Pro3801Leu	25.0	0.0		37.0	8.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893444	0.33442	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	4.94	4.94	0.65067	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.346744	0.21118	N	0.079863	T	0.47377	0.1442	L	0.50919	1.6	0.09310	N	1	P	0.34462	0.454	B	0.38156	0.266	T	0.37384	-0.9708	10	0.25106	T	0.35	.	10.6735	0.45772	0.0952:0.0:0.9048:0.0	.	3801	O75445	USH2A_HUMAN	L	3801	ENSP00000305941:P3801L;ENSP00000355910:P3801L	ENSP00000305941:P3801L	P	-	2	0	USH2A	213983288	0.025000	0.19082	0.025000	0.17156	0.608000	0.37181	1.812000	0.38952	2.706000	0.92434	0.655000	0.94253	CCC	.		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216062251	216062251	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:216062251T>A	ENST00000307340.3	-	41	8126	c.7740A>T	c.(7738-7740)ggA>ggT	p.G2580G	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.G2580G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2580	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAGTGACATTTCCAGGAGTTC	0.418										HNSCC(13;0.011)																											p.G2580G		.											.	USH2A	115	0			c.A7740T						.						149.0	145.0	146.0					1																	216062251		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon41			GACATTTCCAGGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7740A>T	1.37:g.216062251T>A		91.0	0.0		108.0	29.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VIPR1	7433	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	42577594	42577594	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:42577594C>T	ENST00000325123.4	+	13	1308	c.1195C>T	c.(1195-1197)Ctg>Ttg	p.L399L	VIPR1-AS1_ENST00000452639.3_RNA|VIPR1-AS1_ENST00000610022.1_RNA|VIPR1_ENST00000433647.1_Silent_p.L358L|VIPR1_ENST00000438259.2_Silent_p.L189L|VIPR1_ENST00000543411.1_Silent_p.L351L|VIPR1-AS1_ENST00000608869.1_RNA	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	399					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		GCAGGCGGAGCTGAGGCGGAA	0.662																																					p.L399L		.											.	VIPR1	91	0			c.C1195T						.						11.0	14.0	13.0					3																	42577594		2187	4277	6464	SO:0001819	synonymous_variant	7433	exon13			GCGGAGCTGAGGC	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.1195C>T	3.37:g.42577594C>T		55.0	0.0		56.0	12.0	NM_004624	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Silent	SNP	ENST00000325123.4	37	CCDS2698.1																																																																																			.		0.662	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254728.4	NM_004624	
VTCN1	79679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	117699311	117699311	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:117699311A>G	ENST00000369458.3	-	3	408	c.330T>C	c.(328-330)gtT>gtC	p.V110V	VTCN1_ENST00000359008.4_Silent_p.V113V|VTCN1_ENST00000539893.1_Silent_p.V15V|VTCN1_ENST00000463461.1_5'UTR|VTCN1_ENST00000328189.3_Intron	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		AGGCATTGCCAACTATCACTT	0.468																																					p.V110V		.											.	VTCN1	90	0			c.T330C						.						105.0	99.0	101.0					1																	117699311		2203	4300	6503	SO:0001819	synonymous_variant	79679	exon3			ATTGCCAACTATC	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.330T>C	1.37:g.117699311A>G		115.0	0.0		132.0	38.0	NM_024626		Silent	SNP	ENST00000369458.3	37	CCDS894.1																																																																																			.		0.468	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000033500.2	NM_024626	
VWA3A	146177	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	22149760	22149760	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr16:22149760A>G	ENST00000389398.5	+	22	2315	c.2219A>G	c.(2218-2220)aAg>aGg	p.K740R	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	740						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GAAAAACCAAAGACACTTCAG	0.552																																					p.K740R		.											.	VWA3A	1	0			c.A2219G						.						52.0	56.0	55.0					16																	22149760		1924	4137	6061	SO:0001583	missense	146177	exon22			AACCAAAGACACT	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2219A>G	16.37:g.22149760A>G	ENSP00000374049:p.Lys740Arg	17.0	1.0		32.0	15.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	A	9.124	1.009783	0.19277	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.13196	2.61	5.31	4.22	0.49857	.	0.191938	0.42172	N	0.000757	T	0.09730	0.0239	L	0.31664	0.95	0.80722	D	1	B;B	0.26318	0.038;0.146	B;B	0.26693	0.025;0.072	T	0.21449	-1.0245	10	0.23891	T	0.37	.	8.8005	0.34905	0.9079:0.0:0.0921:0.0	.	740;364	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	R	740;363	ENSP00000374049:K740R	ENSP00000299840:K363R	K	+	2	0	VWA3A	22057261	0.129000	0.22400	0.184000	0.23157	0.192000	0.23643	0.929000	0.28844	0.976000	0.38417	0.533000	0.62120	AAG	.		0.552	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
WAPAL	23063	broad.mit.edu;bcgsc.ca	37	10	88259809	88259809	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:88259809A>G	ENST00000298767.5	-	3	1663	c.1191T>C	c.(1189-1191)cgT>cgC	p.R397R		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	397	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TTTTTCTGAGACGACCAGCTT	0.388																																					p.R397R		.											.	WAPAL	91	0			c.T1191C						.						55.0	58.0	57.0					10																	88259809		2203	4300	6503	SO:0001819	synonymous_variant	23063	exon3			TCTGAGACGACCA	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1191T>C	10.37:g.88259809A>G		96.0	1.0		79.0	6.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Silent	SNP	ENST00000298767.5	37	CCDS7375.1																																																																																			.		0.388	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
YBEY	54059	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	21	47711386	47711386	+	Intron	SNP	G	G	C	rs553720951		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr21:47711386G>C	ENST00000329319.3	+	3	737				YBEY_ENST00000397692.1_Intron|YBEY_ENST00000397691.1_Intron|YBEY_ENST00000339195.6_Intron|YBEY_ENST00000397701.4_Intron|YBEY_ENST00000397694.1_Intron	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)						rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						TGTAAGCGGGGATGCTGAAAT	0.458																																					p.D117H		.											.	YBEY	92	0			c.G349C						.						80.0	78.0	79.0					21																	47711386		2203	4300	6503	SO:0001627	intron_variant	54059	exon3			AGCGGGGATGCTG	AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.339+10G>C	21.37:g.47711386G>C		164.0	0.0		147.0	50.0	NM_001006114	B7WPA9|B7WPF7|D3DSN2	Missense_Mutation	SNP	ENST00000329319.3	37	CCDS33591.1																																																																																			.		0.458	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207265.1	NM_058181	
ZC3H11A	9877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203816541	203816541	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:203816541A>C	ENST00000545588.1	+	12	5099	c.1272A>C	c.(1270-1272)aaA>aaC	p.K424N	ZC3H11A_ENST00000367212.3_Missense_Mutation_p.K424N|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.K424N|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.K424N|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.K424N	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	424					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGAGACAAAAAAGCAAAAAGG	0.423																																					p.K424N		.											.	ZC3H11A	515	0			c.A1272C						.						64.0	68.0	67.0					1																	203816541		2203	4300	6503	SO:0001583	missense	9877	exon15			ACAAAAAAGCAAA		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.1272A>C	1.37:g.203816541A>C	ENSP00000438527:p.Lys424Asn	167.0	0.0		172.0	37.0	NM_014827	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326908	0.41197	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.82	2.25	0.28309	.	0.272209	0.40728	N	0.001034	T	0.34890	0.0913	L	0.43701	1.375	0.33207	D	0.552924	B	0.17667	0.023	B	0.23419	0.046	T	0.30208	-0.9986	10	0.30078	T	0.28	-19.5068	5.597	0.17333	0.6504:0.135:0.2146:0.0	.	424	O75152	ZC11A_HUMAN	N	424;424;370;424;424;424;424	ENSP00000356183:K424N;ENSP00000356181:K424N;ENSP00000333253:K424N;ENSP00000438527:K424N;ENSP00000356179:K424N	ENSP00000333253:K424N	K	+	3	2	ZC3H11A	202083164	0.994000	0.37717	0.977000	0.42913	0.971000	0.66376	3.299000	0.51826	0.137000	0.18759	-0.262000	0.10625	AAA	.		0.423	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
ZMIZ2	83637	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44795852	44795852	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:44795852A>T	ENST00000309315.4	+	2	127	c.4A>T	c.(4-6)Aac>Tac	p.N2Y	ZMIZ2_ENST00000433667.1_Missense_Mutation_p.N2Y|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.N2Y|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.N2Y|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.N2Y	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	2					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATTGCCAATGAACTCCATGAA	0.607																																					p.N2Y	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2	137	0			c.A4T						.						63.0	69.0	67.0					7																	44795852		1943	4129	6072	SO:0001583	missense	83637	exon1			CCAATGAACTCCA	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.4A>T	7.37:g.44795852A>T	ENSP00000311778:p.Asn2Tyr	77.0	0.0		99.0	17.0	NM_174929	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.778438	0.70107	.	.	ENSG00000122515	ENST00000413916;ENST00000457123;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.41758	1.08;1.06;1.06;1.1;0.99	4.48	4.48	0.54585	.	0.000000	0.51477	D	0.000097	T	0.55800	0.1943	L	0.45581	1.43	0.53688	D	0.999974	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.74023	0.972;0.982;0.972	T	0.59467	-0.7449	10	0.87932	D	0	-16.4222	12.8951	0.58095	1.0:0.0:0.0:0.0	.	2;2;2	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	Y	2	ENSP00000409648:N2Y;ENSP00000311778:N2Y;ENSP00000414723:N2Y;ENSP00000396601:N2Y;ENSP00000265346:N2Y	ENSP00000265346:N2Y	N	+	1	0	ZMIZ2	44762377	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.670000	0.83925	1.890000	0.54733	0.383000	0.25322	AAC	.		0.607	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ZNF28	7576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53304147	53304147	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:53304147A>T	ENST00000457749.2	-	4	1070	c.951T>A	c.(949-951)caT>caA	p.H317Q	ZNF28_ENST00000438150.2_Missense_Mutation_p.H264Q|ZNF28_ENST00000360272.4_Missense_Mutation_p.H264Q|ZNF28_ENST00000414252.2_Missense_Mutation_p.H264Q	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		AAATTATCTTATGTGTTTCAA	0.368																																					p.H317Q		.											.	ZNF28	91	0			c.T951A						.						118.0	120.0	120.0					19																	53304147		2203	4300	6503	SO:0001583	missense	7576	exon4			TATCTTATGTGTT	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.951T>A	19.37:g.53304147A>T	ENSP00000397693:p.His317Gln	112.0	0.0		116.0	27.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	12.71	2.020112	0.35606	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2	1.47	0.341	0.15991	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99972	0.9991	H	0.95504	3.68	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	D	0.97983	1.0350	9	0.87932	D	0	.	5.3348	0.15951	0.828:0.0:0.172:0.0	.	317	P17035	ZNF28_HUMAN	Q	264;317;264;264;264	ENSP00000412143:H264Q;ENSP00000397693:H317Q;ENSP00000353410:H264Q;ENSP00000444965:H264Q;ENSP00000375661:H264Q	ENSP00000353410:H264Q	H	-	3	2	ZNF28	57995959	0.002000	0.14202	0.001000	0.08648	0.022000	0.10575	-0.269000	0.08596	-0.119000	0.11830	0.156000	0.16432	CAT	.		0.368	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF408	79797	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	46726585	46726585	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:46726585C>T	ENST00000311764.2	+	5	1565	c.1335C>T	c.(1333-1335)gcC>gcT	p.A445A		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGGCAAGGCCTTTGCCCGCC	0.662																																					p.A445A	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	.											.	ZNF408	90	0			c.C1335T						.						47.0	46.0	46.0					11																	46726585		2201	4299	6500	SO:0001819	synonymous_variant	79797	exon5			CAAGGCCTTTGCC	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1335C>T	11.37:g.46726585C>T		22.0	1.0		25.0	7.0	NM_024741		Silent	SNP	ENST00000311764.2	37	CCDS7923.1																																																																																			.		0.662	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	64967201	64967202	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:64967201_64967202TG>CT	ENST00000399262.2	-	10	4445_4446	c.4227_4228CA>AG	c.(4225-4230)tcCAgc>tcAGgc	p.S1410G	JMJD1C_ENST00000402544.1_Missense_Mutation_p.S1191G|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S1191G|JMJD1C_ENST00000542921.1_Missense_Mutation_p.S1228G	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1410					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCACCCCAGCTGGAAACACTGG	0.436																																					p.S1410G		.											.	.	.	0			.						.																																			SO:0001583	missense	221037	.			CCCAGCTGGAAAC	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.4227_4228delinsCT	10.37:g.64967201_64967202delinsCT	ENSP00000382204:p.Ser1410Gly	87.0	0.0		84.0	21.0	.	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	DNP	ENST00000399262.2	37	CCDS41532.1																																																																																			.		0.436	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
ZNF518A	9849	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	97917556	97917556	+	RNA	SNP	G	G	A	rs41291602	byFrequency	TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:97917556G>A	ENST00000534948.1	+	0	2334							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GGACACTAATGGATTTTTAAC	0.403																																					.		.											.	ZNF518A	23	0			.						.						122.0	121.0	122.0					10																	97917556		1845	4097	5942			9849	.			ACTAATGGATTTT	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97917556G>A		95.0	0.0		78.0	27.0	.	A0PJI5|O15044|Q32MP4	RNA	SNP	ENST00000534948.1	37																																																																																				G|0.999;C|0.001		0.403	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1078363	1078364	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:1078363_1078364CC>AT	ENST00000441003.2	+	5	677_678	c.650_651CC>AT	c.(649-651)tCC>tAT	p.S217Y	MUC2_ENST00000359061.5_Missense_Mutation_p.S217Y	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	217	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCCCCCGCATCCTGCTCCGAGC	0.653																																					p.S217Y		.											.	.	.	0			.						.																																			SO:0001583	missense	4583	.			CCGCATCCTGCTC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	Exception_encountered	11.37:g.1078363_1078364delinsAT	ENSP00000415183:p.Ser217Tyr	52.0	0.0		83.0	29.0	.	Q14878	Missense_Mutation	DNP	ENST00000441003.2	37																																																																																				.		0.653	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	137928399	137928400	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	GG	GG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:137928399_137928400GG>TT	ENST00000409968.1	+	7	1792_1793	c.1614_1615GG>TT	c.(1612-1617)gaGGat>gaTTat	p.538_539ED>DY	THSD7B_ENST00000413152.2_Missense_Mutation_p.507_508ED>DY|THSD7B_ENST00000272643.3_Missense_Mutation_p.538_539ED>DY|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000485379.1_3'UTR			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	538	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TTCCTTGTGAGGATCCAATGTG	0.515																																					p.ED538DY		.											.	.	.	0			.						.																																			SO:0001583	missense	80731	.			TTGTGAGGATCCA			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	Exception_encountered	2.37:g.137928399_137928400delinsTT	ENSP00000387145:p.E538_D539delinsDY	100.0	1.0		137.0	42.0	.		Missense_Mutation	DNP	ENST00000409968.1	37																																																																																				.		0.515	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137759953	137759954	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:137759953_137759954GG>TT	ENST00000314358.5	+	16	4362_4363	c.4162_4163GG>TT	c.(4162-4164)GGg>TTg	p.G1388L	KDM3B_ENST00000542866.1_Missense_Mutation_p.G420L|KDM3B_ENST00000394866.1_Missense_Mutation_p.G1044L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1388					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCTTTGTGATGGGAGGCTTCTG	0.49																																					p.G1388L		.											.	.	.	0			.						.																																			SO:0001583	missense	51780	.			TGTGATGGGAGGC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	Exception_encountered	5.37:g.137759953_137759954delinsTT	ENSP00000326563:p.Gly1388Leu	243.0	0.0		260.0	74.0	.	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	DNP	ENST00000314358.5	37	CCDS34242.1																																																																																			.		0.490	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
