#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB1	5243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87179344	87179344	+	Silent	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:87179344C>T	ENST00000265724.3	-	14	1794	c.1377G>A	c.(1375-1377)agG>agA	p.R459R	ABCB1_ENST00000543898.1_Silent_p.R395R	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	459	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CATTTATGGTCCTAATATCCT	0.408																																					p.R459R		.											.	ABCB1	582	0			c.G1377A						.						121.0	110.0	113.0					7																	87179344		2203	4300	6503	SO:0001819	synonymous_variant	5243	exon14			TATGGTCCTAATA	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1377G>A	7.37:g.87179344C>T		46.0	0.0		193.0	44.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	ENST00000265724.3	37	CCDS5608.1																																																																																			.		0.408	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
ADAMTS19	171019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	128977592	128977592	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr5:128977592A>T	ENST00000274487.4	+	11	1938	c.1793A>T	c.(1792-1794)gAg>gTg	p.E598V	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	598	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GTAGAAGGTGAGAAAGAATGC	0.393																																					p.E598V		.											.	ADAMTS19	295	0			c.A1793T						.						233.0	193.0	206.0					5																	128977592		2203	4300	6503	SO:0001583	missense	171019	exon11			AAGGTGAGAAAGA	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1793A>T	5.37:g.128977592A>T	ENSP00000274487:p.Glu598Val	110.0	0.0		324.0	94.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671827	0.47781	.	.	ENSG00000145808	ENST00000274487	T	0.63417	-0.04	4.02	4.02	0.46733	.	0.175049	0.35838	N	0.002951	T	0.53254	0.1785	L	0.48877	1.53	0.58432	D	0.99999	B	0.24368	0.102	B	0.20767	0.031	T	0.51036	-0.8756	9	.	.	.	.	14.01	0.64490	1.0:0.0:0.0:0.0	.	598	Q8TE59	ATS19_HUMAN	V	598	ENSP00000274487:E598V	.	E	+	2	0	ADAMTS19	129005491	1.000000	0.71417	0.924000	0.36721	0.976000	0.68499	6.834000	0.75339	2.039000	0.60335	0.482000	0.46254	GAG	.		0.393	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150532349	150532349	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:150532349C>T	ENST00000369038.2	+	16	3257	c.3056C>T	c.(3055-3057)cCc>cTc	p.P1019L	ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.P1019L|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.P1042L			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	1019	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AGGAAGCGCCCCTGTAACAGC	0.612											OREG0013787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1019L		.											.	ADAMTSL4	92	0			c.C3056T						.						84.0	89.0	87.0					1																	150532349		2203	4300	6503	SO:0001583	missense	54507	exon18			AGCGCCCCTGTAA	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.3056C>T	1.37:g.150532349C>T	ENSP00000358034:p.Pro1019Leu	22.0	0.0	1733	50.0	22.0	NM_019032	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199905	0.38905	.	.	ENSG00000143382	ENST00000271643;ENST00000369039;ENST00000369038	T;T;T	0.52526	0.66;0.66;0.66	5.5	4.57	0.56435	.	.	.	.	.	T	0.17323	0.0416	L	0.31371	0.925	0.09310	N	0.99999	B;B;B	0.24823	0.112;0.032;0.053	B;B;B	0.31442	0.13;0.062;0.075	T	0.18398	-1.0338	9	0.30078	T	0.28	.	6.9597	0.24590	0.1748:0.7381:0.0:0.0871	.	980;1042;1019	B7ZMJ3;F8WAD0;Q6UY14	.;.;ATL4_HUMAN	L	1019;1042;1019	ENSP00000271643:P1019L;ENSP00000358035:P1042L;ENSP00000358034:P1019L	ENSP00000271643:P1019L	P	+	2	0	ADAMTSL4	148798973	0.000000	0.05858	0.687000	0.30102	0.978000	0.69477	0.775000	0.26689	1.269000	0.44280	0.561000	0.74099	CCC	.		0.612	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
ADD2	119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70923474	70923474	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:70923474A>T	ENST00000264436.4	-	5	821	c.377T>A	c.(376-378)cTg>cAg	p.L126Q	ADD2_ENST00000407644.2_Missense_Mutation_p.L126Q|ADD2_ENST00000355733.3_Missense_Mutation_p.L126Q|ADD2_ENST00000430656.1_Missense_Mutation_p.L142Q|ADD2_ENST00000413157.2_Missense_Mutation_p.L126Q	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	126					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCCTTTGGCCAGGTTCAGGGA	0.592																																					p.L142Q		.											.	ADD2	93	0			c.T425A						.						109.0	85.0	93.0					2																	70923474		2203	4300	6503	SO:0001583	missense	119	exon4			TTGGCCAGGTTCA	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.377T>A	2.37:g.70923474A>T	ENSP00000264436:p.Leu126Gln	56.0	0.0		412.0	111.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.850231	0.91277	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976	T;T;T;T;T;T;T;T	0.33438	3.32;3.32;3.16;1.84;3.03;3.02;1.43;1.41	4.98	4.98	0.66077	.	0.062767	0.64402	D	0.000005	T	0.43678	0.1258	L	0.36672	1.1	0.45035	D	0.998053	D;P;D;D;D;D	0.76494	0.982;0.884;0.998;0.994;0.965;0.999	P;P;D;P;P;D	0.68621	0.776;0.615;0.938;0.885;0.658;0.959	T	0.39014	-0.9634	10	0.87932	D	0	-16.043	12.9279	0.58270	1.0:0.0:0.0:0.0	.	142;126;126;126;126;126	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	Q	126;126;126;126;126;126;126;126;142;126;126	ENSP00000264436:L126Q;ENSP00000384677:L126Q;ENSP00000347972:L126Q;ENSP00000430243:L126Q;ENSP00000388072:L126Q;ENSP00000398112:L142Q;ENSP00000412357:L126Q;ENSP00000412681:L126Q	ENSP00000264436:L126Q	L	-	2	0	ADD2	70776982	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.981000	0.76166	2.213000	0.71641	0.528000	0.53228	CTG	.		0.592	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146977910	146977910	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr6:146977910A>C	ENST00000397944.3	+	5	482	c.406A>C	c.(406-408)Atg>Ctg	p.M136L	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	136	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TCTCTAGCTGATGAGATGGAT	0.343																																					p.M136L		.											.	.	.	0			c.A406C						.						46.0	42.0	43.0					6																	146977910		692	1591	2283	SO:0001583	missense	79747	exon5			TAGCTGATGAGAT	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.406A>C	6.37:g.146977910A>C	ENSP00000381036:p.Met136Leu	130.0	0.0		231.0	78.0	NM_024694	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	A	22.0	4.227268	0.79576	.	.	ENSG00000118492	ENST00000397944;ENST00000522242	T;T	0.41400	1.0;1.0	5.31	5.31	0.75309	Peptidase C2, calpain, catalytic domain (2);	0.128332	0.64402	D	0.000001	T	0.47655	0.1457	L	0.48362	1.52	0.42668	D	0.993504	D	0.64830	0.994	D	0.70716	0.97	T	0.43605	-0.9381	10	0.41790	T	0.15	-31.7081	15.5619	0.76256	1.0:0.0:0.0:0.0	.	136	Q8N7X0	CAN7L_HUMAN	L	136;130	ENSP00000381036:M136L;ENSP00000428035:M130L	ENSP00000381036:M136L	M	+	1	0	C6orf103	147019603	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.626000	0.90969	2.136000	0.66102	0.528000	0.53228	ATG	.		0.343	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
APPBP2	10513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58539193	58539193	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr17:58539193C>A	ENST00000083182.3	-	8	1201	c.914G>T	c.(913-915)tGt>tTt	p.C305F	APPBP2_ENST00000592995.1_5'UTR	NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	305					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			AACAGACTGACAGATATTATC	0.338																																					p.C305F		.											.	APPBP2	226	0			c.G914T						.						100.0	109.0	106.0					17																	58539193		2203	4299	6502	SO:0001583	missense	10513	exon8			GACTGACAGATAT	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.914G>T	17.37:g.58539193C>A	ENSP00000083182:p.Cys305Phe	162.0	0.0		312.0	124.0	NM_006380	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.270510	0.23221	.	.	ENSG00000062725	ENST00000083182	T	0.75260	-0.92	5.3	5.3	0.74995	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	N	0.05078	-0.115	0.80722	D	1	P	0.45531	0.86	P	0.52309	0.695	T	0.67696	-0.5604	10	0.23891	T	0.37	-15.6009	18.9711	0.92715	0.0:1.0:0.0:0.0	.	305	Q92624	APBP2_HUMAN	F	305	ENSP00000083182:C305F	ENSP00000083182:C305F	C	-	2	0	APPBP2	55893975	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.456000	0.80751	2.502000	0.84385	0.460000	0.39030	TGT	.		0.338	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380	
ARMCX6	54470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100871412	100871412	+	Silent	SNP	G	G	T	rs138992392		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chrX:100871412G>T	ENST00000361910.4	-	3	543	c.199C>A	c.(199-201)Cgg>Agg	p.R67R	ARMCX6_ENST00000497931.1_Intron|ARMCX6_ENST00000539247.1_Silent_p.R67R|ARMCX6_ENST00000538627.1_Silent_p.R67R	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	67						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						GTCCAGGGCCGAGCCATAGTT	0.592																																					p.R67R		.											.	ARMCX6	130	0			c.C199A						.						76.0	70.0	72.0					X																	100871412		2203	4300	6503	SO:0001819	synonymous_variant	54470	exon4			AGGGCCGAGCCAT	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.199C>A	X.37:g.100871412G>T		61.0	0.0		124.0	102.0	NM_001184768	Q9NWJ3	Silent	SNP	ENST00000361910.4	37	CCDS14488.1																																																																																			G|1.000;A|0.000		0.592	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007	
BPTF	2186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65889635	65889635	+	Silent	SNP	T	T	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr17:65889635T>G	ENST00000321892.4	+	8	2644	c.2583T>G	c.(2581-2583)gcT>gcG	p.A861A	BPTF_ENST00000424123.3_Silent_p.A722A|BPTF_ENST00000306378.6_Silent_p.A735A|BPTF_ENST00000335221.5_Silent_p.A861A			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	861	Interaction with MAZ.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATTCATTTGCTTTGAATAAGC	0.403																																					p.A861A		.											.	BPTF	94	0			c.T2583G						.						108.0	98.0	101.0					17																	65889635		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon8			ATTTGCTTTGAAT	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.2583T>G	17.37:g.65889635T>G		454.0	0.0		852.0	331.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.		0.403	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
BRAT1	221927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2579479	2579479	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:2579479C>T	ENST00000340611.4	-	11	1695	c.1439G>A	c.(1438-1440)aGc>aAc	p.S480N	BRAT1_ENST00000473879.1_5'UTR	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	480					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CTTGGGTGAGCTCAGGAGCCA	0.657																																					p.S480N		.											.	BRAT1	229	0			c.G1439A						.						28.0	31.0	30.0					7																	2579479		2199	4299	6498	SO:0001583	missense	221927	exon11			GGTGAGCTCAGGA	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1439G>A	7.37:g.2579479C>T	ENSP00000339637:p.Ser480Asn	17.0	0.0		90.0	33.0	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	C	6.015	0.371237	0.11409	.	.	ENSG00000106009	ENST00000340611	T	0.31510	1.49	5.2	3.37	0.38596	Armadillo-like helical (1);Armadillo-type fold (1);	0.513015	0.22022	N	0.065704	T	0.18718	0.0449	L	0.38838	1.175	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.28332	-1.0047	10	0.12430	T	0.62	-5.923	5.3229	0.15891	0.1353:0.5819:0.0:0.2828	.	480	Q6PJG6	BRAT1_HUMAN	N	480	ENSP00000339637:S480N	ENSP00000339637:S480N	S	-	2	0	BRAT1	2546005	0.000000	0.05858	0.002000	0.10522	0.091000	0.18340	-0.084000	0.11268	0.567000	0.29293	0.462000	0.41574	AGC	.		0.657	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
C12orf50	160419	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	88420359	88420359	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:88420359C>A	ENST00000298699.2	-	3	219	c.39G>T	c.(37-39)tgG>tgT	p.W13C	C12orf50_ENST00000546547.1_5'Flank|C12orf50_ENST00000550553.1_Missense_Mutation_p.W13C	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	13										NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						GCTGAGTTTCCCAGAAGCATG	0.378																																					p.W13C		.											.	C12orf50	93	0			c.G39T						.						95.0	92.0	93.0					12																	88420359		2203	4300	6503	SO:0001583	missense	160419	exon3			AGTTTCCCAGAAG	AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.39G>T	12.37:g.88420359C>A	ENSP00000298699:p.Trp13Cys	51.0	0.0		178.0	10.0	NM_152589	Q6P674	Missense_Mutation	SNP	ENST00000298699.2	37	CCDS9031.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329690	0.60743	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944;ENST00000551163	T;T	0.74632	-0.86;-0.76	5.83	4.95	0.65309	.	0.000000	0.64402	D	0.000008	D	0.84768	0.5545	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86499	0.1802	10	0.87932	D	0	.	13.7749	0.63048	0.1541:0.8459:0.0:0.0	.	67;13	G3V208;Q8NA57	.;CL050_HUMAN	C	13;13;67;13	ENSP00000298699:W13C;ENSP00000448344:W13C	ENSP00000298699:W13C	W	-	3	0	C12orf50	86944490	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	3.675000	0.54605	1.481000	0.48307	-0.224000	0.12420	TGG	.		0.378	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1	NM_152589	
CFAP69	79846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	89938655	89938655	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:89938655A>G	ENST00000389297.4	+	22	2880	c.2629A>G	c.(2629-2631)Aca>Gca	p.T877A	C7orf63_ENST00000497910.1_Missense_Mutation_p.T859A|C7orf63_ENST00000316089.8_Missense_Mutation_p.T831A	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		877										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						ATTTCACCAAACACATATTAA	0.313																																					p.T877A		.											.	C7orf63	91	0			c.A2629G						.						120.0	113.0	115.0					7																	89938655		1810	4073	5883	SO:0001583	missense	79846	exon22			CACCAAACACATA																												ENST00000389297.4:c.2629A>G	7.37:g.89938655A>G	ENSP00000373948:p.Thr877Ala	290.0	0.0		440.0	167.0	NM_001039706	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	ENST00000389297.4	37	CCDS43613.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.47|15.47	2.842236|2.842236	0.51057|0.51057	.|.	.|.	ENSG00000105792|ENSG00000105792	ENST00000412839|ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577	.|T;T;T;T	.|0.27720	.|2.18;2.19;2.2;1.65	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.128766	.|0.52532	.|D	.|0.000061	T|T	0.54111|0.54111	0.1838|0.1838	M|M	0.77103|0.77103	2.36|2.36	0.43982|0.43982	D|D	0.996675|0.996675	.|D;D	.|0.69078	.|0.984;0.997	.|P;P	.|0.61800	.|0.785;0.894	T|T	0.58470|0.58470	-0.7631|-0.7631	5|10	.|0.54805	.|T	.|0.06	-19.0344|-19.0344	15.627|15.627	0.76867|0.76867	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|859;877	.|A5D8W1-5;A5D8W1	.|.;CG063_HUMAN	S|A	105|877;831;859;414	.|ENSP00000373948:T877A;ENSP00000321753:T831A;ENSP00000419549:T859A;ENSP00000391571:T414A	.|ENSP00000321753:T831A	N|T	+|+	2|1	0|0	C7orf63|C7orf63	89776591|89776591	1.000000|1.000000	0.71417|0.71417	0.786000|0.786000	0.31890|0.31890	0.132000|0.132000	0.20833|0.20833	7.075000|7.075000	0.76798|0.76798	2.102000|2.102000	0.63906|0.63906	0.477000|0.477000	0.44152|0.44152	AAC|ACA	.		0.313	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4		
CABP4	57010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67223230	67223230	+	Silent	SNP	C	C	T	rs369080675		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:67223230C>T	ENST00000325656.5	+	1	413	c.336C>T	c.(334-336)taC>taT	p.Y112Y	CABP4_ENST00000542025.2_3'UTR|CABP4_ENST00000438189.2_5'UTR	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	112					photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			AGAGGACATACGGGCCCCTGC	0.682													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16360	0.0		0.0	False		,,,				2504	0.0				p.Y112Y		.											.	CABP4	90	0			c.C336T						.	C		1,4327		0,1,2163	7.0	9.0	8.0		336	-3.0	0.3	11		8	0,8510		0,0,4255	no	coding-synonymous	CABP4	NM_145200.3		0,1,6418	TT,TC,CC		0.0,0.0231,0.0078		112/276	67223230	1,12837	2164	4255	6419	SO:0001819	synonymous_variant	57010	exon1			GACATACGGGCCC	AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.336C>T	11.37:g.67223230C>T		38.0	0.0		75.0	33.0	NM_145200	Q8N4Z2|Q8WWY5	Silent	SNP	ENST00000325656.5	37	CCDS8166.1																																																																																			.		0.682	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397624.2		
CAMSAP2	23271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	200817808	200817808	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:200817808delC	ENST00000236925.4	+	12	1993	c.1944delC	c.(1942-1944)gacfs	p.D648fs	CAMSAP2_ENST00000413307.2_Frame_Shift_Del_p.D621fs|CAMSAP2_ENST00000358823.2_Frame_Shift_Del_p.D637fs			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	648					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TAAGCTTGGACTCTGACATGG	0.398																																					p.D637fs		.											.	.	.	0			c.1911delC						.						136.0	135.0	135.0					1																	200817808		2203	4300	6503	SO:0001589	frameshift_variant	23271	exon11			CTTGGACTCTGAC	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1944delC	1.37:g.200817808delC	ENSP00000236925:p.Asp648fs	76.0	0.0		256.0	91.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Frame_Shift_Del	DEL	ENST00000236925.4	37																																																																																				.		0.398	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
CEP83	51134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94706794	94706794	+	Splice_Site	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:94706794C>T	ENST00000397809.5	-	15	2257		c.e15-1		CCDC41_ENST00000339839.5_Splice_Site	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN							cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						GAGATTTTCTCTAAAAAGAGA	0.274																																					.		.											.	CCDC41	90	0			c.1708-1G>A						.						73.0	64.0	67.0					12																	94706794		1781	4053	5834	SO:0001630	splice_region_variant	51134	exon16			TTTTCTCTAAAAA																												ENST00000397809.5:c.1708-1G>A	12.37:g.94706794C>T		104.0	0.0		289.0	150.0	NM_016122	A4FVB1|Q08AP1	Splice_Site	SNP	ENST00000397809.5	37	CCDS41820.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109054	0.56398	.	.	ENSG00000173588	ENST00000552632;ENST00000339839;ENST00000397809	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4499	0.90700	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC41	93230925	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	5.743000	0.68655	2.359000	0.80004	0.557000	0.71058	.	.		0.274	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3		Intron
CCNJL	79616	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159682609	159682609	+	Silent	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr5:159682609C>T	ENST00000393977.3	-	6	1119	c.834G>A	c.(832-834)agG>agA	p.R278R	CCNJL_ENST00000541762.1_Silent_p.R229R|CCNJL_ENST00000377503.2_5'UTR|CCNJL_ENST00000519673.1_Silent_p.R230R|CCNJL_ENST00000257536.7_Silent_p.R230R	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	278						nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTTGAGATCCTCTGCAGGT	0.512																																					p.R278R		.											.	CCNJL	90	0			c.G834A						.						138.0	141.0	140.0					5																	159682609		1906	4130	6036	SO:0001819	synonymous_variant	79616	exon6			TGAGATCCTCTGC	BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.834G>A	5.37:g.159682609C>T		90.0	1.0		334.0	90.0	NM_024565	Q6ZN43|Q9H7W8	Silent	SNP	ENST00000393977.3	37	CCDS4350.2																																																																																			.		0.512	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565	
CDC7	8317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	91977431	91977431	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:91977431C>A	ENST00000428239.1	+	6	782	c.523C>A	c.(523-525)Cac>Aac	p.H175N	CDC7_ENST00000430031.2_Missense_Mutation_p.H147N|CDC7_ENST00000234626.6_Missense_Mutation_p.H175N	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		TGGTATTGTTCACCGTGATGT	0.318																																					p.H175N		.											.	CDC7	1125	0			c.C523A						.						84.0	83.0	83.0					1																	91977431		2203	4300	6503	SO:0001583	missense	8317	exon6			ATTGTTCACCGTG	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.523C>A	1.37:g.91977431C>A	ENSP00000393139:p.His175Asn	228.0	0.0		465.0	156.0	NM_001134419	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	C	32	5.115646	0.94339	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.50813	0.73;0.73;0.73	5.88	5.88	0.94601	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83124	0.5186	H	0.99689	4.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90283	0.4316	10	0.87932	D	0	-17.6315	20.2314	0.98350	0.0:1.0:0.0:0.0	.	147;175	B7Z5H7;O00311	.;CDC7_HUMAN	N	147;175;175	ENSP00000407477:H147N;ENSP00000234626:H175N;ENSP00000393139:H175N	ENSP00000234626:H175N	H	+	1	0	CDC7	91750019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.789000	0.95967	0.591000	0.81541	CAC	.		0.318	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	63511096	63511096	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr18:63511096G>T	ENST00000397968.2	+	7	1456	c.1030G>T	c.(1030-1032)Gca>Tca	p.A344S	CDH7_ENST00000323011.3_Missense_Mutation_p.A344S|CDH7_ENST00000536984.2_Missense_Mutation_p.A344S	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	344	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GATAGAAGCTGCAAATAAAGA	0.433																																					p.A344S		.											.	CDH7	94	0			c.G1030T						.						120.0	111.0	114.0					18																	63511096		2203	4300	6503	SO:0001583	missense	1005	exon7			GAAGCTGCAAATA	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1030G>T	18.37:g.63511096G>T	ENSP00000381058:p.Ala344Ser	99.0	0.0		249.0	97.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	8.737	0.918083	0.17982	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.48836	0.8;0.8;0.8	5.04	4.15	0.48705	Cadherin (5);Cadherin-like (1);	0.312090	0.35291	N	0.003305	T	0.16300	0.0392	N	0.00801	-1.175	0.36919	D	0.891312	B;B	0.06786	0.001;0.0	B;B	0.11329	0.004;0.006	T	0.24621	-1.0155	10	0.05833	T	0.94	.	12.948	0.58384	0.0:0.0:0.7051:0.2949	.	344;344	F5H5X9;Q9ULB5	.;CADH7_HUMAN	S	344	ENSP00000319166:A344S;ENSP00000443030:A344S;ENSP00000381058:A344S	ENSP00000319166:A344S	A	+	1	0	CDH7	61662076	1.000000	0.71417	0.993000	0.49108	0.967000	0.64934	3.093000	0.50217	1.437000	0.47472	0.655000	0.94253	GCA	.		0.433	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46931320	46931320	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr22:46931320G>T	ENST00000262738.3	-	1	1747	c.1748C>A	c.(1747-1749)cCc>cAc	p.P583H	CELSR1_ENST00000497509.1_5'Flank|CELSR1_ENST00000395964.1_Missense_Mutation_p.P583H	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	583	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GTGCACCACGGGGTAGCCCAG	0.642																																					p.P583H		.											.	CELSR1	525	0			c.C1748A						.						40.0	40.0	40.0					22																	46931320		2203	4300	6503	SO:0001583	missense	9620	exon1			ACCACGGGGTAGC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1748C>A	22.37:g.46931320G>T	ENSP00000262738:p.Pro583His	35.0	0.0		21.0	14.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884833	0.51908	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.52526	0.66;0.66	4.92	4.92	0.64577	Cadherin (3);Cadherin-like (1);	0.088018	0.47455	U	0.000228	T	0.34658	0.0905	N	0.16790	0.44	0.29125	N	0.879973	B	0.30146	0.27	B	0.26202	0.067	T	0.36625	-0.9740	10	0.52906	T	0.07	.	17.747	0.88423	0.0:0.0:1.0:0.0	.	583	Q9NYQ6	CELR1_HUMAN	H	583	ENSP00000262738:P583H;ENSP00000379293:P583H	ENSP00000262738:P583H	P	-	2	0	CELSR1	45309984	1.000000	0.71417	0.970000	0.41538	0.362000	0.29581	7.492000	0.81482	2.281000	0.76405	0.462000	0.41574	CCC	.		0.642	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CHRNB3	1142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42587132	42587132	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr8:42587132G>A	ENST00000289957.2	+	5	810	c.682G>A	c.(682-684)Gtc>Atc	p.V228I		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	228					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	GTATTCCTTCGTCCTGAGACG	0.478																																					p.V228I		.											.	CHRNB3	91	0			c.G682A						.						89.0	92.0	91.0					8																	42587132		2203	4300	6503	SO:0001583	missense	1142	exon5			TCCTTCGTCCTGA	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.682G>A	8.37:g.42587132G>A	ENSP00000289957:p.Val228Ile	131.0	0.0		211.0	73.0	NM_000749	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	g	2.895	-0.228696	0.06022	.	.	ENSG00000147432	ENST00000289957	T	0.79033	-1.23	5.46	5.46	0.80206	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052626	0.85682	D	0.000000	T	0.58452	0.2123	N	0.05414	-0.055	0.41498	D	0.988266	B	0.26512	0.151	B	0.28305	0.088	T	0.57323	-0.7831	10	0.10377	T	0.69	.	14.127	0.65228	0.0:0.0:0.8128:0.1872	.	228	Q05901	ACHB3_HUMAN	I	228	ENSP00000289957:V228I	ENSP00000289957:V228I	V	+	1	0	CHRNB3	42706289	0.929000	0.31497	0.109000	0.21407	0.265000	0.26407	2.384000	0.44362	2.568000	0.86640	0.558000	0.71614	GTC	.		0.478	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238263564	238263564	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:238263564C>T	ENST00000295550.4	-	24	7057	c.6605G>A	c.(6604-6606)cGa>cAa	p.R2202Q	COL6A3_ENST00000409809.1_Missense_Mutation_p.R1996Q|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1996Q|COL6A3_ENST00000346358.4_Missense_Mutation_p.R2002Q|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1595Q|COL6A3_ENST00000347401.3_Missense_Mutation_p.R2001Q	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2202	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2202Q(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGGTCCCCTTCGGCCAAAGCC	0.592																																					p.R2202Q		.											.	COL6A3	526	1	Substitution - Missense(1)	skin(1)	c.G6605A						.						25.0	26.0	26.0					2																	238263564		2203	4300	6503	SO:0001583	missense	1293	exon24			CCCCTTCGGCCAA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6605G>A	2.37:g.238263564C>T	ENSP00000295550:p.Arg2202Gln	15.0	0.0		66.0	23.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927242	0.52759	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37;-3.37	5.51	5.51	0.81932	.	0.000000	0.45126	D	0.000383	D	0.94640	0.8272	L	0.47190	1.495	0.51767	D	0.999937	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.988;0.988;0.995;0.988	D	0.92021	0.5626	10	0.14252	T	0.57	.	16.1839	0.81934	0.0:1.0:0.0:0.0	.	1595;1595;1996;2202	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	Q	2202;2001;1996;1595;1996;2002	ENSP00000295550:R2202Q;ENSP00000315609:R2001Q;ENSP00000315873:R1996Q;ENSP00000418285:R1595Q;ENSP00000386844:R1996Q;ENSP00000295546:R2002Q	ENSP00000295550:R2202Q	R	-	2	0	COL6A3	237928303	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.871000	0.48459	2.593000	0.87608	0.655000	0.94253	CGA	.		0.592	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34174693	34174693	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:34174693A>T	ENST00000373380.1	-	1	411	c.191T>A	c.(190-192)cTc>cAc	p.L64H	CSMD2_ENST00000373381.4_Missense_Mutation_p.L1191H|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1151	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTTTACCTTGAGGACATCTCC	0.418																																					p.L1151H		.											.	CSMD2	103	0			c.T3452A						.						109.0	106.0	107.0					1																	34174693		2203	4300	6503	SO:0001583	missense	114784	exon22			ACCTTGAGGACAT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.191T>A	1.37:g.34174693A>T	ENSP00000362478:p.Leu64His	61.0	0.0		190.0	60.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	A	24.5	4.535717	0.85812	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.47869	0.83;0.83	5.49	5.49	0.81192	CUB (5);	0.000000	0.85682	D	0.000000	T	0.80834	0.4699	H	0.98612	4.28	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.995;0.995	D	0.88196	0.2880	10	0.72032	D	0.01	.	14.7747	0.69724	1.0:0.0:0.0:0.0	.	64;1151;1191	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	H	1191;64	ENSP00000362479:L1191H;ENSP00000362478:L64H	ENSP00000241312:L1151H	L	-	2	0	CSMD2	33947280	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.108000	0.94275	2.097000	0.63578	0.459000	0.35465	CTC	.		0.418	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
CYP4A22	284541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47603268	47603268	+	Silent	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:47603268C>A	ENST00000371891.3	+	1	142	c.111C>A	c.(109-111)ctC>ctA	p.L37L	CYP4A22_ENST00000371890.3_Silent_p.L37L|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000294337.3_Silent_p.L37L|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	37						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CAGCTCAGCTCTACCTGCATA	0.617																																					p.L37L	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22	139	0			c.C111A						.						91.0	77.0	82.0					1																	47603268		2203	4300	6503	SO:0001819	synonymous_variant	284541	exon1			TCAGCTCTACCTG		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.111C>A	1.37:g.47603268C>A		66.0	0.0		200.0	54.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Silent	SNP	ENST00000371891.3	37	CCDS30707.1																																																																																			.		0.617	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
DEPDC5	9681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	32188763	32188763	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr22:32188763C>T	ENST00000382112.3	+	11	797	c.727C>T	c.(727-729)Cga>Tga	p.R243*	DEPDC5_ENST00000535622.1_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000382111.2_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000400246.1_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000536766.1_Nonsense_Mutation_p.R215*|DEPDC5_ENST00000400248.2_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000382105.2_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000400242.3_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000266091.3_Nonsense_Mutation_p.R243*|DEPDC5_ENST00000400249.2_Nonsense_Mutation_p.R243*	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	243					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.R243*(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGCCTCAATTCGACAGGATCA	0.353																																					p.R243X		.											.	DEPDC5	519	1	Substitution - Nonsense(1)	large_intestine(1)	c.C727T						.						130.0	122.0	124.0					22																	32188763		1804	4082	5886	SO:0001587	stop_gained	9681	exon12			TCAATTCGACAGG	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.727C>T	22.37:g.32188763C>T	ENSP00000371546:p.Arg243*	81.0	0.0		125.0	64.0	NM_001242897	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Nonsense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	-	38	6.701398	0.97772	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.	.	.	5.29	1.87	0.25490	.	0.117813	0.53938	D	0.000050	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	13.4713	0.61283	0.6194:0.3806:0.0:0.0	.	.	.	.	X	243;215;243;243;243;243;243;243;243;243;243	.	ENSP00000266091:R243X	R	+	1	2	DEPDC5	30518763	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	1.746000	0.38288	0.154000	0.19237	0.567000	0.79289	CGA	.		0.353	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
DGKA	1606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56332338	56332338	+	Silent	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:56332338C>T	ENST00000331886.5	+	6	847	c.393C>T	c.(391-393)gaC>gaT	p.D131D	DGKA_ENST00000394147.1_Silent_p.D131D|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Silent_p.D131D	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	131	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	GGATCCTGGACAGCTCAGTGA	0.507																																					p.D131D		.											.	DGKA	255	0			c.C393T						.						181.0	166.0	171.0					12																	56332338		2203	4300	6503	SO:0001819	synonymous_variant	1606	exon6			CCTGGACAGCTCA	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.393C>T	12.37:g.56332338C>T		133.0	0.0		413.0	105.0	NM_201554	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Silent	SNP	ENST00000331886.5	37	CCDS8896.1																																																																																			.		0.507	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
ELMO2	63916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44997586	44997586	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr20:44997586A>T	ENST00000290246.6	-	21	2100	c.1906T>A	c.(1906-1908)Tcc>Acc	p.S636T	ELMO2_ENST00000352077.2_Missense_Mutation_p.S634T|ELMO2_ENST00000454865.2_Missense_Mutation_p.S368T|ELMO2_ENST00000439931.2_Missense_Mutation_p.S648T|ELMO2_ENST00000396391.1_Missense_Mutation_p.S636T|ELMO2_ENST00000445496.2_Missense_Mutation_p.S453T|ELMO2_ENST00000372176.1_Missense_Mutation_p.S548T	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	636	PH.				apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				TACAGGATGGAGAAGGCCAAT	0.468																																					p.S636T		.											.	ELMO2	91	0			c.T1906A						.						167.0	156.0	160.0					20																	44997586		2203	4300	6503	SO:0001583	missense	63916	exon20			GGATGGAGAAGGC	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.1906T>A	20.37:g.44997586A>T	ENSP00000290246:p.Ser636Thr	63.0	0.0		149.0	49.0	NM_182764	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.843744	0.91197	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000452857;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077	T;T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38	5.26	5.26	0.73747	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.75737	0.3890	M	0.86420	2.815	0.80722	D	1	P;D;D	0.89917	0.865;1.0;0.982	B;D;P	0.83275	0.418;0.996;0.835	T	0.80739	-0.1248	10	0.87932	D	0	-22.6458	14.5233	0.67870	1.0:0.0:0.0:0.0	.	648;368;636	B4DRL5;B4DZ20;Q96JJ3	.;.;ELMO2_HUMAN	T	636;548;199;636;648;453;368;634	ENSP00000290246:S636T;ENSP00000361249:S548T;ENSP00000414329:S199T;ENSP00000379673:S636T;ENSP00000396519:S648T;ENSP00000409920:S453T;ENSP00000415641:S368T;ENSP00000326172:S634T	ENSP00000290246:S636T	S	-	1	0	ELMO2	44430993	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.139000	0.94554	2.207000	0.71202	0.533000	0.62120	TCC	.		0.468	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	79385992	79385992	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:79385992A>G	ENST00000370742.3	-	10	1400	c.1337T>C	c.(1336-1338)aTt>aCt	p.I446T		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	446					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAAGGTAAAAATGCATATGGC	0.308																																					p.I446T		.											.	ELTD1	24	0			c.T1337C						.						104.0	99.0	101.0					1																	79385992		1816	4081	5897	SO:0001583	missense	64123	exon10			GTAAAAATGCATA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1337T>C	1.37:g.79385992A>G	ENSP00000359778:p.Ile446Thr	40.0	0.0		125.0	50.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811657	0.70797	.	.	ENSG00000162618	ENST00000370742	T	0.51574	0.7	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.67163	0.2864	M	0.91196	3.185	0.80722	D	1	P	0.50943	0.94	P	0.61940	0.896	T	0.75637	-0.3249	9	.	.	.	.	15.0016	0.71476	1.0:0.0:0.0:0.0	.	446	Q9HBW9	ELTD1_HUMAN	T	446	ENSP00000359778:I446T	.	I	-	2	0	ELTD1	79158580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.255000	0.95524	1.998000	0.58463	0.528000	0.53228	ATT	.		0.308	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	96706230	96706230	+	Silent	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr3:96706230A>T	ENST00000389672.5	+	3	545	c.507A>T	c.(505-507)gtA>gtT	p.V169V	EPHA6_ENST00000542517.1_Silent_p.V75V|EPHA6_ENST00000470610.2_Silent_p.V169V	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	75	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CATACCAGGTATGTAATGTAA	0.378																																					p.V169V		.											.	EPHA6	1561	0			c.A507T						.						105.0	103.0	104.0					3																	96706230		1875	4106	5981	SO:0001819	synonymous_variant	285220	exon3			CCAGGTATGTAAT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.507A>T	3.37:g.96706230A>T		60.0	0.0		170.0	59.0	NM_001080448	D6RAL5	Silent	SNP	ENST00000389672.5	37	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	A	9.136	1.012630	0.19277	.	.	ENSG00000080224	ENST00000506569	.	.	.	5.74	1.85	0.25348	.	.	.	.	.	T	0.43255	0.1239	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21965	-1.0230	4	.	.	.	.	1.8811	0.03228	0.4894:0.2493:0.141:0.1202	.	.	.	.	L	114	.	.	M	+	1	0	EPHA6	98188920	0.071000	0.21146	0.999000	0.59377	0.996000	0.88848	-0.601000	0.05687	0.060000	0.16281	0.533000	0.62120	ATG	.		0.378	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
EXOC6B	23233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	72727062	72727062	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:72727062T>A	ENST00000272427.6	-	12	1337	c.1207A>T	c.(1207-1209)Aac>Tac	p.N403Y	EXOC6B_ENST00000410104.1_Missense_Mutation_p.N403Y	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	403					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						ACAATGAGGTTCTTCAAATCT	0.308																																					p.N403Y		.											.	EXOC6B	68	0			c.A1207T						.						63.0	56.0	59.0					2																	72727062		1833	4035	5868	SO:0001583	missense	23233	exon12			TGAGGTTCTTCAA	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1207A>T	2.37:g.72727062T>A	ENSP00000272427:p.Asn403Tyr	223.0	0.0		435.0	128.0	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160540	0.78226	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.34072	1.38;1.38	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.64811	0.2632	M	0.89287	3.02	0.80722	D	1	P;D	0.89917	0.718;1.0	B;D	0.79784	0.168;0.993	T	0.72134	-0.4382	10	0.87932	D	0	.	12.9966	0.58650	0.0:0.0:0.0:1.0	.	403;403	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	Y	403	ENSP00000272427:N403Y;ENSP00000386698:N403Y	ENSP00000272427:N403Y	N	-	1	0	EXOC6B	72580570	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.812000	0.69194	2.177000	0.69029	0.533000	0.62120	AAC	.		0.308	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
FANCD2	2177	ucsc.edu;bcgsc.ca	37	3	10108898	10108898	+	Silent	SNP	A	A	G	rs77246387		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr3:10108898A>G	ENST00000419585.1	+	26	2552	c.2391A>G	c.(2389-2391)gtA>gtG	p.V797V	FANCD2_ENST00000287647.3_Silent_p.V797V|FANCD2_ENST00000383807.1_Silent_p.V797V|FANCD2_ENST00000383806.1_Silent_p.V797V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	797					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.V797V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V797V		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	229	1	Substitution - coding silent(1)	prostate(1)	c.A2391G						.						72.0	63.0	66.0					3																	10108898		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GATTGTAAATGCC	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2391A>G	3.37:g.10108898A>G		38.0	0.0		99.0	11.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			A|0.909;G|0.091		0.368	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FGGY	55277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	60223658	60223658	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:60223658A>G	ENST00000303721.7	+	15	1742	c.1568A>G	c.(1567-1569)gAt>gGt	p.D523G	FGGY_ENST00000371210.1_Missense_Mutation_p.D224G|RP4-782L23.2_ENST00000443012.1_RNA|FGGY_ENST00000371218.4_Missense_Mutation_p.D547G|FGGY_ENST00000371212.1_Missense_Mutation_p.D435G	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	523					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					AGACTACAGGATAAAAAGTAA	0.378																																					p.D547G		.											.	FGGY	69	0			c.A1640G						.						99.0	95.0	96.0					1																	60223658		2203	4300	6503	SO:0001583	missense	55277	exon16			TACAGGATAAAAA		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1568A>G	1.37:g.60223658A>G	ENSP00000305922:p.Asp523Gly	45.0	0.0		97.0	39.0	NM_001113411	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	A	6.236	0.411731	0.11812	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.09	5.09	0.68999	.	0.342239	0.29034	N	0.013350	D	0.89332	0.6685	M	0.68593	2.085	0.38510	D	0.94844	B;B;B	0.25904	0.137;0.046;0.088	B;B;B	0.31869	0.137;0.045;0.063	D	0.87173	0.2222	9	.	.	.	-14.3042	12.3551	0.55171	1.0:0.0:0.0:0.0	.	547;435;523	Q96C11-3;B1AK94;Q96C11	.;.;FGGY_HUMAN	G	547;523;435;224	ENSP00000360262:D547G;ENSP00000305922:D523G;ENSP00000360256:D435G;ENSP00000360254:D224G	.	D	+	2	0	FGGY	59996246	1.000000	0.71417	0.987000	0.45799	0.128000	0.20619	4.822000	0.62686	2.138000	0.66242	0.460000	0.39030	GAT	.		0.378	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	
HPS6	79803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103825804	103825804	+	Silent	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:103825804C>T	ENST00000299238.5	+	1	658	c.573C>T	c.(571-573)ttC>ttT	p.F191F		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	191					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		GCCCTGCCTTCGGGCTGCTGG	0.662									Hermansky-Pudlak syndrome																												p.F191F		.											.	HPS6	90	0			c.C573T						.						25.0	27.0	26.0					10																	103825804		2203	4298	6501	SO:0001819	synonymous_variant	79803	exon1	Familial Cancer Database	HPS, HPS1-8	TGCCTTCGGGCTG	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.573C>T	10.37:g.103825804C>T		18.0	0.0		28.0	9.0	NM_024747	Q5VV69|Q9H685	Silent	SNP	ENST00000299238.5	37	CCDS7527.1																																																																																			.		0.662	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050018.2	NM_024747	
HUNK	30811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33340695	33340695	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr21:33340695C>A	ENST00000270112.2	+	6	1368	c.1008C>A	c.(1006-1008)aaC>aaA	p.N336K		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	336					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CCTATCCCAACAGGTAATTTC	0.532																																					p.N336K		.											.	HUNK	334	0			c.C1008A						.						79.0	76.0	77.0					21																	33340695		2203	4300	6503	SO:0001583	missense	30811	exon6			TCCCAACAGGTAA	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1008C>A	21.37:g.33340695C>A	ENSP00000270112:p.Asn336Lys	56.0	0.0		90.0	28.0	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812700	0.90707	.	.	ENSG00000142149	ENST00000270112	T	0.69175	-0.38	5.37	5.37	0.77165	Protein kinase-like domain (1);	0.114105	0.56097	D	0.000026	T	0.68137	0.2968	L	0.36672	1.1	0.80722	D	1	P	0.51057	0.941	P	0.52823	0.71	T	0.60984	-0.7154	10	0.18276	T	0.48	-29.8074	19.3056	0.94161	0.0:1.0:0.0:0.0	.	336	P57058	HUNK_HUMAN	K	336	ENSP00000270112:N336K	ENSP00000270112:N336K	N	+	3	2	HUNK	32262566	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	6.525000	0.73795	2.783000	0.95769	0.637000	0.83480	AAC	.		0.532	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55247872	55247872	+	Silent	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr5:55247872T>C	ENST00000381298.2	-	13	1896	c.1584A>G	c.(1582-1584)aaA>aaG	p.K528K	IL6ST_ENST00000522633.2_3'UTR|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000336909.5_Silent_p.K528K|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381294.3_Silent_p.K467K|IL6ST_ENST00000502326.3_Silent_p.K528K	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	528	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TCCCTACTTTTTTTGTCCGAA	0.343			O		hepatocellular ca																																p.K528K		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	290	0			c.A1584G						.						73.0	64.0	67.0					5																	55247872		2203	4300	6503	SO:0001819	synonymous_variant	3572	exon13			TACTTTTTTTGTC	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1584A>G	5.37:g.55247872T>C		123.0	0.0		389.0	122.0	NM_002184	A0N0L4|Q5FC04|Q9UQ41	Silent	SNP	ENST00000381298.2	37	CCDS3971.1																																																																																			.		0.343	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
LAG3	3902	broad.mit.edu;bcgsc.ca	37	12	6884573	6884573	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:6884573G>A	ENST00000203629.2	+	5	1249	c.916G>A	c.(916-918)Gac>Aac	p.D306N	LAG3_ENST00000441671.2_Missense_Mutation_p.D306N	NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	306	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GGGAGGCCCTGACCTCCTGGT	0.632																																					p.D306N		.											.	LAG3	90	0			c.G916A						.						93.0	87.0	89.0					12																	6884573		2203	4300	6503	SO:0001583	missense	3902	exon5			GGCCCTGACCTCC		CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.916G>A	12.37:g.6884573G>A	ENSP00000203629:p.Asp306Asn	92.0	0.0		157.0	10.0	NM_002286	A8K7T9|Q7Z643	Missense_Mutation	SNP	ENST00000203629.2	37	CCDS8561.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801210	0.70567	.	.	ENSG00000089692	ENST00000441671;ENST00000203629	T;T	0.12147	2.71;2.71	5.55	4.47	0.54385	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.409722	0.23565	N	0.046818	T	0.26557	0.0649	M	0.76328	2.33	0.19300	N	0.999976	P;P	0.49307	0.922;0.896	P;P	0.54100	0.742;0.596	T	0.06023	-1.0850	10	0.32370	T	0.25	-18.231	10.1839	0.42986	0.1053:0.0:0.8947:0.0	.	306;306	P18627;Q7Z643	LAG3_HUMAN;.	N	306	ENSP00000413825:D306N;ENSP00000203629:D306N	ENSP00000203629:D306N	D	+	1	0	LAG3	6754834	0.174000	0.23070	0.999000	0.59377	0.841000	0.47740	1.987000	0.40687	2.623000	0.88846	0.462000	0.41574	GAC	.		0.632	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402846.1		
ITGA7	3679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56087102	56087102	+	Splice_Site	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:56087102C>T	ENST00000555728.1	-	21	2696		c.e21-1		ITGA7_ENST00000394230.2_Splice_Site|ITGA7_ENST00000394229.2_Splice_Site|ITGA7_ENST00000347027.6_Splice_Site|ITGA7_ENST00000257879.6_Splice_Site|ITGA7_ENST00000257880.7_Splice_Site|ITGA7_ENST00000553804.1_Splice_Site|ITGA7_ENST00000452168.2_Splice_Site			Q13683	ITA7_HUMAN	integrin, alpha 7						blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GGTTGGAAACCTGTGGGAAAA	0.453																																					.		.											.	ITGA7	229	0			c.2548-1G>A						.						52.0	53.0	52.0					12																	56087102		2203	4300	6503	SO:0001630	splice_region_variant	3679	exon21			GGAAACCTGTGGG		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2668-1G>A	12.37:g.56087102C>T		29.0	0.0		101.0	24.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Splice_Site	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	C	17.50	3.404770	0.62288	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8526	0.78943	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA7	54373369	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.253000	0.78320	2.400000	0.81607	0.485000	0.47835	.	.		0.453	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	Intron
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141260598	141260598	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:141260598C>T	ENST00000389484.3	-	54	9567	c.8596G>A	c.(8596-8598)Gat>Aat	p.D2866N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2866	LDL-receptor class A 19. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAGTCTCCATCACACTGCCAT	0.403										TSP Lung(27;0.18)																											p.D2866N	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G8596A						.						162.0	147.0	152.0					2																	141260598		2203	4300	6503	SO:0001583	missense	53353	exon54			CTCCATCACACTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8596G>A	2.37:g.141260598C>T	ENSP00000374135:p.Asp2866Asn	111.0	0.0		289.0	96.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	35	5.479916	0.96307	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.98362	-4.89	5.91	5.91	0.95273	.	0.000000	0.85682	U	0.000000	D	0.98779	0.9589	M	0.68728	2.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99023	1.0818	10	0.45353	T	0.12	.	20.3132	0.98646	0.0:1.0:0.0:0.0	.	2866	Q9NZR2	LRP1B_HUMAN	N	2866;2804	ENSP00000374135:D2866N	ENSP00000374135:D2866N	D	-	1	0	LRP1B	140977068	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.729000	0.84864	2.817000	0.96982	0.643000	0.83706	GAT	.		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MAPK6	5597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	52357196	52357196	+	Silent	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:52357196A>G	ENST00000261845.5	+	6	2972	c.2165A>G	c.(2164-2166)tAa>tGa	p.*722*	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	0					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CATCTGAACTAAAACACTCAG	0.338																																					p.X722X		.											.	MAPK6	1403	0			c.A2165G						.						36.0	38.0	38.0					15																	52357196		2135	4102	6237	SO:0001819	synonymous_variant	5597	exon6			TGAACTAAAACAC	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.2165A>G	15.37:g.52357196A>G		170.0	0.0		279.0	110.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Silent	SNP	ENST00000261845.5	37	CCDS10147.1																																																																																			.		0.338	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
LRRK1	79705	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	101592005	101592005	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:101592005G>A	ENST00000388948.3	+	24	3888	c.3529G>A	c.(3529-3531)Gac>Aac	p.D1177N	RP11-505E24.3_ENST00000558979.1_RNA|RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Missense_Mutation_p.D1174N	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCAGCACACGGACCCCAGTGA	0.607																																					p.D1177N		.											.	LRRK1	602	0			c.G3529A						.						63.0	74.0	71.0					15																	101592005		2142	4237	6379	SO:0001583	missense	79705	exon24			CACACGGACCCCA	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3529G>A	15.37:g.101592005G>A	ENSP00000373600:p.Asp1177Asn	74.0	0.0		200.0	12.0	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926329	0.18056	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.72835	-0.67;-0.69	5.41	4.5	0.54988	.	0.538297	0.19751	N	0.106883	T	0.49830	0.1580	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	10	0.21014	T	0.42	.	8.7802	0.34787	0.2268:0.0:0.7732:0.0	.	1177	Q38SD2	LRRK1_HUMAN	N	1177;1174	ENSP00000373600:D1177N;ENSP00000284395:D1174N	ENSP00000284395:D1174N	D	+	1	0	LRRK1	99409528	0.059000	0.20769	0.011000	0.14972	0.051000	0.14879	0.870000	0.28010	1.289000	0.44618	0.655000	0.94253	GAC	.		0.607	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
MELK	9833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	36630338	36630338	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr9:36630338A>G	ENST00000298048.2	+	9	893	c.709A>G	c.(709-711)Att>Gtt	p.I237V	MELK_ENST00000536987.1_Missense_Mutation_p.I106V|MELK_ENST00000543751.1_Missense_Mutation_p.I205V|MELK_ENST00000536860.1_Missense_Mutation_p.I189V|MELK_ENST00000545008.1_Missense_Mutation_p.I166V|MELK_ENST00000541717.1_Missense_Mutation_p.I237V|MELK_ENST00000538311.1_Missense_Mutation_p.I43V|MELK_ENST00000487398.1_3'UTR|MELK_ENST00000536329.1_Missense_Mutation_p.I166V	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TCCCAGTAGCATTCTGCTTCT	0.348																																					p.I237V	Ovarian(82;980 1317 7225 14391 18624)	.											.	MELK	760	0			c.A709G						.						196.0	206.0	203.0					9																	36630338		2203	4300	6503	SO:0001583	missense	9833	exon9			AGTAGCATTCTGC	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.709A>G	9.37:g.36630338A>G	ENSP00000298048:p.Ile237Val	56.0	0.0		118.0	41.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	37	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	A	6.913	0.538062	0.13188	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.41	-1.06	0.10002	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.423208	0.29451	N	0.012116	T	0.34337	0.0894	N	0.11789	0.175	0.09310	N	0.999999	B;B;B;B;B;B;B	0.10296	0.001;0.003;0.0;0.0;0.001;0.003;0.0	B;B;B;B;B;B;B	0.20577	0.03;0.003;0.001;0.001;0.004;0.006;0.004	T	0.31752	-0.9932	10	0.02654	T	1	-1.4603	10.5173	0.44898	0.5641:0.0:0.4359:0.0	.	157;166;189;237;166;205;237	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	V	237;43;106;166;189;166;237;205	ENSP00000298048:I237V;ENSP00000438226:I43V;ENSP00000439184:I106V;ENSP00000445452:I166V;ENSP00000439792:I189V;ENSP00000443550:I166V;ENSP00000437804:I237V;ENSP00000441596:I205V	ENSP00000298048:I237V	I	+	1	0	MELK	36620338	0.005000	0.15991	0.383000	0.26132	0.985000	0.73830	0.932000	0.28884	-0.456000	0.07043	-0.250000	0.11733	ATT	.		0.348	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
MFGE8	4240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89450543	89450543	+	Silent	SNP	A	A	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:89450543A>C	ENST00000566497.1	-	3	331	c.270T>G	c.(268-270)tcT>tcG	p.S90S	MFGE8_ENST00000268151.7_Silent_p.S90S|MFGE8_ENST00000539437.1_Silent_p.S82S|MFGE8_ENST00000268150.8_Silent_p.S90S|MFGE8_ENST00000559997.1_5'UTR|MFGE8_ENST00000542878.1_Silent_p.S46S			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	90	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					TCACACGCACAGACGAGGCGG	0.617																																					p.S90S		.											.	MFGE8	91	0			c.T270G						.						133.0	92.0	106.0					15																	89450543		2200	4299	6499	SO:0001819	synonymous_variant	4240	exon3			ACGCACAGACGAG	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.270T>G	15.37:g.89450543A>C		93.0	0.0		186.0	56.0	NM_001114614	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Silent	SNP	ENST00000566497.1	37	CCDS10347.1																																																																																			.		0.617	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
MFSD2B	388931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24240356	24240356	+	Silent	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:24240356G>A	ENST00000406420.3	+	6	595	c.579G>A	c.(577-579)ctG>ctA	p.L193L	MFSD2B_ENST00000338315.4_Silent_p.L193L	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	193					transport (GO:0006810)	integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CGGGAACACTGATGGGGGCCA	0.657																																					p.L193L		.											.	MFSD2B	24	0			c.G579A						.						23.0	27.0	25.0					2																	24240356		2049	4184	6233	SO:0001819	synonymous_variant	388931	exon6			AACACTGATGGGG		CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.579G>A	2.37:g.24240356G>A		59.0	0.0		127.0	26.0	NM_001080473	B5MC32	Silent	SNP	ENST00000406420.3	37	CCDS46228.1																																																																																			.		0.657	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000324307.1	NM_001080473	
MID2	11043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107169328	107169328	+	Silent	SNP	A	A	G	rs150570766	byFrequency	TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chrX:107169328A>G	ENST00000262843.6	+	9	2150	c.1602A>G	c.(1600-1602)caA>caG	p.Q534Q	MID2_ENST00000443968.2_Silent_p.Q504Q|RP6-191P20.4_ENST00000430140.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	534	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						TTTCAGGCCAACCCTTTAAAT	0.378													A|||	15	0.00397351	0.0098	0.0029	3775	,	,		13199	0.0		0.0	False		,,,				2504	0.0				p.Q534Q		.											.	MID2	227	0			c.A1602G						.	A	,	65,3768		1,49,14,1581,557	55.0	57.0	57.0		1602,1512	-3.1	1.0	X	dbSNP_134	57	1,6726		0,1,0,2427,1871	no	coding-synonymous,coding-synonymous	MID2	NM_012216.3,NM_052817.2	,	1,50,14,4008,2428	GG,GA,G,AA,A		0.0149,1.6958,0.625	,	534/736,504/706	107169328	66,10494	2202	4299	6501	SO:0001819	synonymous_variant	11043	exon9			AGGCCAACCCTTT		CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1602A>G	X.37:g.107169328A>G		72.0	0.0		134.0	92.0	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Silent	SNP	ENST00000262843.6	37	CCDS14532.2																																																																																			A|0.995;G|0.005		0.378	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
MIR516A2	574499	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	54261513	54261513	+	RNA	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr19:54261513C>T	ENST00000384888.1	+	0	0				RNU6-1041P_ENST00000516254.1_RNA|MIR1283-2_ENST00000408621.1_RNA|MIR516A1_ENST00000385033.1_RNA|AC011453.1_ENST00000583623.1_RNA	NR_030221.1				microRNA 516a-2																		CAAAGGAAAGCGCTTTCTGTT	0.403																																					.		.											.	.	.	0			.						.						147.0	136.0	139.0					19																	54261513		1568	3582	5150			100302205	.			GGAAAGCGCTTTC			19q13.42	2011-09-12	2007-10-23	2008-12-18	ENSG00000207620	ENSG00000207620		"""ncRNAs / Micro RNAs"""	32131	non-coding RNA	RNA, micro			"""microRNA 516-2"""	MIRN516-2, MIRN516A2			Standard	NR_030221		Approved	hsa-mir-516-2, hsa-mir-516a-2	uc021vay.1				19.37:g.54261513C>T		88.0	0.0		268.0	98.0	.		RNA	SNP	ENST00000384888.1	37																																																																																				.		0.403	MIR516A2-201	KNOWN	basic	miRNA	miRNA		NR_030221	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	151833918	151833918	+	Nonstop_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:151833918C>A	ENST00000262189.6	-	59	14953	c.14735G>T	c.(14734-14736)tGa>tTa	p.*4912L	KMT2C_ENST00000355193.2_Nonstop_Mutation_p.*4969L|KMT2C_ENST00000485655.2_Nonstop_Mutation_p.*117L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	0					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GAATGCATTTCAGTTCATCCA	0.473																																					p.X4912L		.											.	MLL3	1398	0			c.G14735T						.						92.0	79.0	84.0					7																	151833918		2203	4300	6503	SO:0001578	stop_lost	58508	exon59			GCATTTCAGTTCA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14735G>T	7.37:g.151833918C>A		13.0	0.0		55.0	15.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244925	0.59103	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000485655;ENST00000424877	.	.	.	5.19	2.98	0.34508	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.247	0.10675	0.0:0.5256:0.0:0.4744	.	.	.	.	L	4912;4969;117;1525	.	.	X	-	2	2	MLL3	151464851	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	3.187000	0.50950	1.308000	0.44962	0.655000	0.94253	TGA	.		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MMP19	4327	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56230959	56230959	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:56230959C>A	ENST00000322569.4	-	9	1479	c.1388G>T	c.(1387-1389)aGa>aTa	p.R463I	MMP19_ENST00000409200.3_3'UTR|MMP19_ENST00000548629.1_Missense_Mutation_p.R440I|MMP19_ENST00000394182.1_Missense_Mutation_p.R177I|TMEM198B_ENST00000478241.1_RNA	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	463					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	GGAAATATTTCTGGGATAGCC	0.522																																					p.R463I		.											.	MMP19	227	0			c.G1388T						.						203.0	215.0	211.0					12																	56230959		2203	4300	6503	SO:0001583	missense	4327	exon9			ATATTTCTGGGAT	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1388G>T	12.37:g.56230959C>A	ENSP00000313437:p.Arg463Ile	160.0	1.0		554.0	291.0	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491257	0.44249	.	.	ENSG00000123342	ENST00000394182;ENST00000322569;ENST00000548629	T;T;T	0.03094	4.05;4.05;4.05	5.71	2.43	0.29744	Hemopexin/matrixin (2);	0.308479	0.34959	N	0.003549	T	0.08044	0.0201	M	0.90705	3.14	0.20703	N	0.999864	P;P	0.50943	0.58;0.94	B;B	0.42386	0.254;0.386	T	0.24835	-1.0149	10	0.66056	D	0.02	.	5.132	0.14915	0.1496:0.5857:0.0:0.2647	.	463;177	Q99542;Q99542-3	MMP19_HUMAN;.	I	177;463;440	ENSP00000377736:R177I;ENSP00000313437:R463I;ENSP00000446979:R440I	ENSP00000313437:R463I	R	-	2	0	MMP19	54517226	0.027000	0.19231	0.762000	0.31397	0.699000	0.40488	0.214000	0.17541	0.757000	0.33036	0.561000	0.74099	AGA	.		0.522	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
MPP7	143098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	28420525	28420525	+	Silent	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:28420525T>C	ENST00000375732.1	-	6	670	c.411A>G	c.(409-411)gtA>gtG	p.V137V	MPP7_ENST00000375719.3_Silent_p.V137V|MPP7_ENST00000481244.1_5'UTR|MPP7_ENST00000540098.1_Silent_p.V137V|MPP7_ENST00000445954.2_Silent_p.V12V|MPP7_ENST00000337532.5_Silent_p.V137V			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	137					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						GGATTATTTTTACTGAGTCTT	0.433																																					p.V137V		.											.	MPP7	45	0			c.A411G						.						134.0	122.0	126.0					10																	28420525		2203	4300	6503	SO:0001819	synonymous_variant	143098	exon8			TATTTTTACTGAG	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.411A>G	10.37:g.28420525T>C		73.0	0.0		225.0	82.0	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Silent	SNP	ENST00000375732.1	37	CCDS7158.1																																																																																			.		0.433	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
MRPL11	65003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	66206166	66206166	+	Silent	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:66206166G>T	ENST00000310999.7	-	1	153	c.60C>A	c.(58-60)atC>atA	p.I20I	MRPL11_ENST00000430466.2_Intron|MRPL11_ENST00000524576.1_Intron|MRPL11_ENST00000329819.4_Silent_p.I20I	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	20					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						CGATCGCCCGGATCACACCGC	0.721																																					p.I20I		.											.	MRPL11	90	0			c.C60A						.						9.0	12.0	11.0					11																	66206166		2073	4192	6265	SO:0001819	synonymous_variant	65003	exon1			CGCCCGGATCACA	AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.60C>A	11.37:g.66206166G>T		67.0	0.0		81.0	24.0	NM_170739	A6NLT0|A8K219|Q32P46|Q96Q73	Silent	SNP	ENST00000310999.7	37	CCDS8139.1																																																																																			.		0.721	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393098.2	NM_016050	
NAA38	84316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117828373	117828373	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:117828373G>T	ENST00000249299.2	+	3	306	c.114G>T	c.(112-114)ttG>ttT	p.L38F	NAA38_ENST00000422760.1_Missense_Mutation_p.L17F|NAA38_ENST00000424702.1_Missense_Mutation_p.L38F	NM_016200.4	NP_057284.1	Q9BRA0	LSMD1_HUMAN	N(alpha)-acetyltransferase 38, NatC auxiliary subunit	78					negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						ATTTGATTTTGGATGAAAGCC	0.353																																					p.L38F		.											.	NAA38	90	0			c.G114T						.						91.0	92.0	92.0					7																	117828373		2203	4300	6503	SO:0001583	missense	51691	exon3			GATTTTGGATGAA		CCDS11122.1	17p13.1	2014-01-21	2014-01-21	2014-01-21		ENSG00000183011		"""N(alpha)-acetyltransferase subunits"""	28212	protein-coding gene	gene with protein product			"""LSM domain containing 1"""	LSMD1		16484612, 19398576	Standard	NM_032356		Approved	MGC14151, PFAAP2	uc002gja.3	Q9BRA0		ENST00000249299.2:c.114G>T	7.37:g.117828373G>T	ENSP00000249299:p.Leu38Phe	99.0	0.0		161.0	53.0	NM_016200	Q8N4M0	Missense_Mutation	SNP	ENST00000249299.2	37	CCDS5775.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965706	0.92855	.	.	ENSG00000128534	ENST00000249299;ENST00000424702;ENST00000422760;ENST00000411938	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.69	5.69	0.88448	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.64402	D	0.000001	T	0.81522	0.4840	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82563	-0.0395	9	0.62326	D	0.03	-9.8012	19.8148	0.96562	0.0:0.0:1.0:0.0	.	38	O95777	NAA38_HUMAN	F	38;38;17;49	ENSP00000249299:L38F;ENSP00000395263:L38F;ENSP00000403811:L17F;ENSP00000408267:L49F	ENSP00000249299:L38F	L	+	3	2	NAA38	117615609	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.753000	0.68736	2.687000	0.91594	0.650000	0.86243	TTG	.		0.353	NAA38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346774.2	NM_032356	
NELFCD	51497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57561177	57561177	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr20:57561177T>A	ENST00000344018.3	+	2	144	c.117T>A	c.(115-117)gaT>gaA	p.D39E	NELFCD_ENST00000602795.1_Missense_Mutation_p.D48E			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	39					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											AAGGAGAGGATGATGCGGAGG	0.423																																					p.D48E		.											.	.	.	0			c.T144A						.						113.0	118.0	116.0					20																	57561177		2203	4300	6503	SO:0001583	missense	51497	exon2			AGAGGATGATGCG	AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.117T>A	20.37:g.57561177T>A	ENSP00000342300:p.Asp39Glu	78.0	0.0		135.0	63.0	NM_198976	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	ENST00000344018.3	37		.	.	.	.	.	.	.	.	.	.	T	14.05	2.419627	0.42918	.	.	ENSG00000101158	ENST00000344018	.	.	.	5.43	-2.54	0.06307	.	0.206028	0.43416	D	0.000566	T	0.18964	0.0455	N	0.03608	-0.345	0.38649	D	0.951805	P;B;B	0.38280	0.625;0.164;0.071	B;B;B	0.35182	0.197;0.062;0.042	T	0.11108	-1.0601	9	0.15952	T	0.53	-25.7774	12.7703	0.57417	0.0:0.5094:0.0:0.4906	.	39;48;39	B4E2K1;E1P5H4;Q8IXH7	.;.;NELFD_HUMAN	E	39	.	ENSP00000342300:D39E	D	+	3	2	TH1L	56994572	0.820000	0.29190	0.499000	0.27577	0.870000	0.49936	-0.174000	0.09839	-0.839000	0.04212	0.533000	0.62120	GAT	.		0.423	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976	
NPAP1	23742	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	24924085	24924085	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:24924085T>C	ENST00000329468.2	+	1	3545	c.3071T>C	c.(3070-3072)aTg>aCg	p.M1024T		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1024					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GGGTTCAGCATGTCTGCCCCA	0.522																																					p.M1024T		.											.	.	.	0			c.T3071C						.						59.0	56.0	57.0					15																	24924085		2203	4300	6503	SO:0001583	missense	23742	exon1			TCAGCATGTCTGC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3071T>C	15.37:g.24924085T>C	ENSP00000333735:p.Met1024Thr	70.0	1.0		129.0	47.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	1.719	-0.497034	0.04291	.	.	ENSG00000185823	ENST00000329468	T	0.05786	3.39	2.04	0.896	0.19253	.	2.211570	0.02026	N	0.048201	T	0.04092	0.0114	N	0.19112	0.55	0.09310	N	1	B	0.16603	0.018	B	0.20767	0.031	T	0.33904	-0.9850	10	0.02654	T	1	.	3.6331	0.08140	0.0:0.2052:0.0:0.7948	.	1024	Q9NZP6	CO002_HUMAN	T	1024	ENSP00000333735:M1024T	ENSP00000333735:M1024T	M	+	2	0	C15orf2	22475178	0.001000	0.12720	0.000000	0.03702	0.027000	0.11550	-0.005000	0.12855	0.241000	0.21283	0.260000	0.18958	ATG	.		0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
NT5DC3	51559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104208729	104208729	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:104208729T>C	ENST00000392876.3	-	2	419	c.379A>G	c.(379-381)Atc>Gtc	p.I127V		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	127						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						TGTTCATTGATGAGAAGGTCC	0.463																																					p.I127V		.											.	NT5DC3	228	0			c.A379G						.						164.0	155.0	158.0					12																	104208729		2203	4300	6503	SO:0001583	missense	51559	exon2			CATTGATGAGAAG	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.379A>G	12.37:g.104208729T>C	ENSP00000376615:p.Ile127Val	158.0	0.0		530.0	288.0	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	T	9.834	1.189300	0.21954	.	.	ENSG00000111696	ENST00000392876	T	0.16457	2.34	5.87	5.87	0.94306	HAD-like domain (1);	0.043669	0.85682	D	0.000000	T	0.10252	0.0251	N	0.20357	0.565	0.47584	D	0.99946	B	0.10296	0.003	B	0.17722	0.019	T	0.11036	-1.0604	10	0.06757	T	0.87	-43.6022	11.6025	0.51012	0.0:0.069:0.0:0.931	.	127	Q86UY8	NT5D3_HUMAN	V	127	ENSP00000376615:I127V	ENSP00000376615:I127V	I	-	1	0	NT5DC3	102732859	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.166000	0.50785	2.371000	0.80710	0.533000	0.62120	ATC	.		0.463	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228462084	228462084	+	Silent	SNP	C	C	T	rs202200633		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:228462084C>T	ENST00000422127.1	+	19	5666	c.5622C>T	c.(5620-5622)gaC>gaT	p.D1874D	RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000284548.11_Silent_p.D1874D|OBSCN_ENST00000570156.2_Silent_p.D2249D|OBSCN_ENST00000359599.6_Silent_p.D721D|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|RP5-1139B12.2_ENST00000602517.1_RNA	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1874	Ig-like 18.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCGCAGAGGACGCAGGGGAGT	0.657																																					p.D2249D		.											.	OBSCN	403	0			c.C6747T						.	C	,	0,4342		0,0,2171	45.0	52.0	50.0		5622,5622	-4.5	0.2	1		50	2,8526		0,2,4262	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,2,6433	TT,TC,CC		0.0235,0.0,0.0155	,	1874/7969,1874/6621	228462084	2,12868	2171	4264	6435	SO:0001819	synonymous_variant	84033	exon23			AGAGGACGCAGGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5622C>T	1.37:g.228462084C>T		86.0	0.0		127.0	56.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			C|0.996;T|0.004		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ODF3L1	161753	ucsc.edu;bcgsc.ca	37	15	76019647	76019647	+	Silent	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:76019647A>G	ENST00000332145.2	+	4	814	c.591A>G	c.(589-591)ggA>ggG	p.G197G	DNM1P35_ENST00000501931.1_RNA	NM_175881.3	NP_787077.1	Q8IXM7	OD3L1_HUMAN	outer dense fiber of sperm tails 3-like 1	197										kidney(1)|lung(1)	2						ATGTGGCAGGAGGCCCTGGAC	0.612																																					p.G197G		.											.	ODF3L1	68	0			c.A591G						.						93.0	78.0	83.0					15																	76019647		2197	4294	6491	SO:0001819	synonymous_variant	161753	exon4			GGCAGGAGGCCCT	BC039862	CCDS10285.1	15q23	2008-02-05			ENSG00000182950	ENSG00000182950			28735	protein-coding gene	gene with protein product							Standard	NM_175881		Approved	MGC48986	uc002bax.1	Q8IXM7	OTTHUMG00000142837	ENST00000332145.2:c.591A>G	15.37:g.76019647A>G		31.0	1.0		70.0	19.0	NM_175881		Silent	SNP	ENST00000332145.2	37	CCDS10285.1																																																																																			.		0.612	ODF3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286473.1	NM_175881	
OPALIN	93377	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98108095	98108095	+	Missense_Mutation	SNP	T	T	C	rs113141694		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:98108095T>C	ENST00000371172.3	-	5	605	c.200A>G	c.(199-201)gAc>gGc	p.D67G	OPALIN_ENST00000393870.2_Missense_Mutation_p.D56G|OPALIN_ENST00000536387.1_Missense_Mutation_p.D57G|OPALIN_ENST00000419479.1_Missense_Mutation_p.D57G|OPALIN_ENST00000393871.1_Missense_Mutation_p.D44G	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	67						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						ACATGGTCTGTCACTTTCCTA	0.318																																					p.D67G		.											.	OPALIN	68	0			c.A200G						.						66.0	67.0	66.0					10																	98108095		2202	4299	6501	SO:0001583	missense	93377	exon5			GGTCTGTCACTTT	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.200A>G	10.37:g.98108095T>C	ENSP00000360214:p.Asp67Gly	37.0	0.0		93.0	23.0	NM_033207	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	ENST00000371172.3	37	CCDS7448.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.392535	0.42410	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.92	4.92	0.64577	.	0.494915	0.18727	N	0.132852	T	0.19846	0.0477	N	0.08118	0	0.22412	N	0.999123	B;B;B	0.30281	0.13;0.13;0.275	B;B;B	0.26416	0.051;0.051;0.069	T	0.16778	-1.0391	9	0.66056	D	0.02	-5.1212	11.1806	0.48625	0.0:0.0:0.0:1.0	.	44;67;57	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	G	67;44;57;56;57	.	ENSP00000360214:D67G	D	-	2	0	OPALIN	98098085	0.914000	0.31030	0.983000	0.44433	0.866000	0.49608	3.167000	0.50793	2.198000	0.70561	0.456000	0.33151	GAC	T|0.500;C|0.500		0.318	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049606.1	NM_033207	
OPRM1	4988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	154331688	154331688	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr6:154331688C>T	ENST00000518759.1	+	1	53	c.41C>T	c.(40-42)cCc>cTc	p.P14L	OPRM1_ENST00000520708.1_5'UTR|OPRM1_ENST00000434900.2_5'UTR	NM_001145281.1	NP_001138753.1	P35372	OPRM_HUMAN	opioid receptor, mu 1	0					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GCTGGGAAGCCCTCCAGGTTC	0.413																																					p.P14L		.											.	OPRM1	69	0			c.C41T						.						128.0	108.0	114.0					6																	154331688		692	1591	2283	SO:0001583	missense	4988	exon1			GGAAGCCCTCCAG	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000518759.1:c.41C>T	6.37:g.154331688C>T	ENSP00000430260:p.Pro14Leu	47.0	0.0		115.0	31.0	NM_001145281	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000518759.1	37	CCDS55068.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320709	0.23994	.	.	ENSG00000112038	ENST00000518759	T	0.71934	-0.61	5.5	0.435	0.16544	.	.	.	.	.	T	0.33556	0.0867	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.27434	-1.0074	8	0.51188	T	0.08	.	4.4125	0.11439	0.1448:0.5267:0.0:0.3285	.	14	B8Q1L9	.	L	14	ENSP00000430260:P14L	ENSP00000430260:P14L	P	+	2	0	OPRM1	154373381	0.016000	0.18221	0.281000	0.24762	0.649000	0.38597	-0.136000	0.10405	0.034000	0.15491	-0.142000	0.14014	CCC	.		0.413	OPRM1-006	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375911.1	NM_000914	
OR2B11	127623	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	247615077	247615077	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:247615077delG	ENST00000318749.6	-	1	231	c.208delC	c.(208-210)ctgfs	p.L70fs		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGGAAGGACAGGTGACTGAGG	0.572																																					p.L70fs		.											.	OR2B11	69	0			c.208delC						.						173.0	167.0	169.0					1																	247615077		2203	4300	6503	SO:0001589	frameshift_variant	127623	exon1			AGGACAGGTGACT		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.208delC	1.37:g.247615077delG	ENSP00000325682:p.Leu70fs	75.0	0.0		223.0	46.0	NM_001004492	B2RP03	Frame_Shift_Del	DEL	ENST00000318749.6	37	CCDS31090.1																																																																																			.		0.572	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
OR8I2	120586	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55861148	55861148	+	Missense_Mutation	SNP	G	G	T	rs148027692		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:55861148G>T	ENST00000302124.2	+	1	396	c.365G>T	c.(364-366)cGc>cTc	p.R122L		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122H(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					GCCTACAATCGCTACATAGCA	0.438																																					p.R122L		.											.	OR8I2	113	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G365T						.						155.0	138.0	144.0					11																	55861148		2201	4296	6497	SO:0001583	missense	120586	exon1			ACAATCGCTACAT	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.365G>T	11.37:g.55861148G>T	ENSP00000303864:p.Arg122Leu	80.0	1.0		175.0	58.0	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604242	0.46423	.	.	ENSG00000172154	ENST00000302124	T	0.77358	-1.09	4.5	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40728	U	0.001035	D	0.84727	0.5536	H	0.96489	3.83	0.38452	D	0.946974	P	0.47106	0.89	B	0.43155	0.41	D	0.89065	0.3465	10	0.87932	D	0	-8.8288	12.1049	0.53807	0.0861:0.0:0.9139:0.0	.	122	Q8N0Y5	OR8I2_HUMAN	L	122	ENSP00000303864:R122L	ENSP00000303864:R122L	R	+	2	0	OR8I2	55617724	0.962000	0.33011	0.343000	0.25615	0.002000	0.02628	4.874000	0.63064	1.019000	0.39547	0.440000	0.28878	CGC	G|1.000;A|0.000		0.438	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
PAPPA	5069	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	119115996	119115996	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr9:119115996G>C	ENST00000328252.3	+	17	4640	c.4271G>C	c.(4270-4272)gGg>gCg	p.G1424A	PAPPA_ENST00000534838.1_Missense_Mutation_p.G462A	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1424	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AAATTCCATGGGCTCTACCAG	0.522																																					p.G1424A		.											.	PAPPA	77	0			c.G4271C						.						215.0	181.0	192.0					9																	119115996		2203	4300	6503	SO:0001583	missense	5069	exon17			TCCATGGGCTCTA		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4271G>C	9.37:g.119115996G>C	ENSP00000330658:p.Gly1424Ala	118.0	0.0		276.0	102.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876759	0.91664	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.67345	-0.26;-0.26	5.91	5.91	0.95273	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.83482	0.5264	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.83441	0.0043	10	0.52906	T	0.07	-20.7366	19.2865	0.94077	0.0:0.0:1.0:0.0	.	462;1424	F5GZ19;Q13219	.;PAPP1_HUMAN	A	1424;462	ENSP00000330658:G1424A;ENSP00000441461:G462A	ENSP00000330658:G1424A	G	+	2	0	PAPPA	118155817	1.000000	0.71417	0.998000	0.56505	0.824000	0.46624	9.589000	0.98235	2.802000	0.96397	0.655000	0.94253	GGG	.		0.522	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PAX3	5077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	223163313	223163313	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:223163313C>A	ENST00000350526.4	-	1	158	c.22G>T	c.(22-24)Gtg>Ttg	p.V8L	PAX3_ENST00000344493.4_Missense_Mutation_p.V8L|PAX3_ENST00000392069.2_Missense_Mutation_p.V8L|PAX3_ENST00000409828.3_Missense_Mutation_p.V8L|PAX3_ENST00000336840.6_Missense_Mutation_p.V8L|PAX3_ENST00000392070.2_Missense_Mutation_p.V8L|PAX3_ENST00000258387.5_Missense_Mutation_p.V8L|CCDC140_ENST00000295226.1_Intron|PAX3_ENST00000409551.3_Missense_Mutation_p.V8L	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	8					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCCTGGGCACAGCGCCGGCC	0.682			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.V8L		.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3	1821	0			c.G22T						.						8.0	10.0	10.0					2																	223163313		2188	4279	6467	SO:0001583	missense	5077	exon1			TGGGCACAGCGCC		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.22G>T	2.37:g.223163313C>A	ENSP00000343052:p.Val8Leu	44.0	0.0		96.0	30.0	NM_181457	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174503	0.38413	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000409828;ENST00000258387	D;D;D;D;D;D;D;D	0.99399	-3.42;-3.43;-3.39;-3.38;-3.38;-3.38;-5.82;-5.83	5.37	4.47	0.54385	.	0.188750	0.46758	N	0.000270	D	0.97451	0.9166	N	0.17082	0.46	0.80722	D	1	B;B;B;B;B;B;B	0.16166	0.009;0.007;0.001;0.001;0.004;0.016;0.002	B;B;B;B;B;B;B	0.17098	0.005;0.012;0.004;0.002;0.006;0.017;0.006	D	0.95197	0.8313	10	0.62326	D	0.03	.	14.9316	0.70919	0.1444:0.8556:0.0:0.0	.	8;8;8;8;8;8;8	P23760;P23760-2;P23760-3;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.;.;.	L	8	ENSP00000375921:V8L;ENSP00000342092:V8L;ENSP00000343052:V8L;ENSP00000375922:V8L;ENSP00000338767:V8L;ENSP00000386750:V8L;ENSP00000386817:V8L;ENSP00000258387:V8L	ENSP00000258387:V8L	V	-	1	0	PAX3	222871557	0.999000	0.42202	0.984000	0.44739	0.545000	0.35147	2.787000	0.47798	1.208000	0.43306	0.655000	0.94253	GTG	.		0.682	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
PDE3A	5139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20833113	20833113	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:20833113T>A	ENST00000359062.3	+	16	3374	c.3334T>A	c.(3334-3336)Tct>Act	p.S1112T	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	1112					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TCAGTCGCACTCTTCAGAACA	0.483																																					p.S1112T		.											.	PDE3A	94	0			c.T3334A						.						100.0	98.0	99.0					12																	20833113		2203	4300	6503	SO:0001583	missense	5139	exon16			TCGCACTCTTCAG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.3334T>A	12.37:g.20833113T>A	ENSP00000351957:p.Ser1112Thr	203.0	0.0		402.0	87.0	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	T	6.231	0.410840	0.11812	.	.	ENSG00000172572	ENST00000359062	T	0.61980	0.06	5.72	-6.01	0.02199	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	2.019320	0.01443	N	0.015176	T	0.43964	0.1271	L	0.28274	0.84	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25433	-1.0132	10	0.14656	T	0.56	.	8.267	0.31819	0.1151:0.4918:0.0:0.3931	.	1112	Q14432	PDE3A_HUMAN	T	1112	ENSP00000351957:S1112T	ENSP00000351957:S1112T	S	+	1	0	PDE3A	20724380	0.000000	0.05858	0.003000	0.11579	0.360000	0.29518	-2.237000	0.01200	-1.136000	0.02892	0.533000	0.62120	TCT	.		0.483	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
PDGFD	80310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103797732	103797732	+	Missense_Mutation	SNP	C	C	T	rs371743652		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:103797732C>T	ENST00000393158.2	-	6	1074	c.895G>A	c.(895-897)Gtg>Atg	p.V299M	PDGFD_ENST00000302251.5_Missense_Mutation_p.V293M			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	299					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CAGCGCTGCACGAGGAGGCAA	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		21537	0.0		0.0	False		,,,				2504	0.001				p.V299M		.											.	PDGFD	723	0			c.G895A						.						147.0	121.0	130.0					11																	103797732		2202	4299	6501	SO:0001583	missense	80310	exon6			GCTGCACGAGGAG	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.895G>A	11.37:g.103797732C>T	ENSP00000376865:p.Val299Met	61.0	0.0		137.0	51.0	NM_025208	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643067	0.87859	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.46451	0.87;0.87	5.87	5.87	0.94306	Platelet-derived growth factor (PDGF) (3);	0.059149	0.64402	D	0.000002	T	0.62720	0.2451	M	0.69823	2.125	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.957	T	0.64824	-0.6316	10	0.87932	D	0	-13.9236	13.4113	0.60944	0.0:0.9285:0.0:0.0715	.	299;293	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	M	299;293	ENSP00000376865:V299M;ENSP00000302193:V293M	ENSP00000302193:V293M	V	-	1	0	PDGFD	103302942	1.000000	0.71417	0.965000	0.40720	0.977000	0.68977	5.757000	0.68766	2.774000	0.95407	0.650000	0.86243	GTG	.		0.483	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
PHF23	79142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7139869	7139869	+	Missense_Mutation	SNP	G	G	C	rs564325710		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr17:7139869G>C	ENST00000320316.3	-	4	603	c.377C>G	c.(376-378)aCc>aGc	p.T126S	PHF23_ENST00000454255.2_Missense_Mutation_p.T122S|PHF23_ENST00000576955.1_5'UTR|PHF23_ENST00000571362.1_Missense_Mutation_p.T59S|PHF23_ENST00000570753.1_5'Flank|DVL2_ENST00000575458.1_5'Flank|DVL2_ENST00000005340.5_5'Flank	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	126							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						CTCAAGCAAGGTAGCACTGTC	0.562																																					p.T126S		.											.	PHF23	90	0			c.C377G						.						86.0	95.0	92.0					17																	7139869		1964	4149	6113	SO:0001583	missense	79142	exon4			AGCAAGGTAGCAC	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.377C>G	17.37:g.7139869G>C	ENSP00000322579:p.Thr126Ser	66.0	0.0		137.0	37.0	NM_024297	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Missense_Mutation	SNP	ENST00000320316.3	37	CCDS42250.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973698	0.34848	.	.	ENSG00000040633	ENST00000320316;ENST00000454255;ENST00000043410	T;T	0.37584	1.2;1.19	4.81	3.83	0.44106	.	0.200803	0.42682	N	0.000678	T	0.23766	0.0575	N	0.19112	0.55	0.32888	D	0.511521	B;B	0.29162	0.012;0.235	B;B	0.29077	0.007;0.098	T	0.30119	-0.9989	10	0.41790	T	0.15	-4.8691	11.055	0.47913	0.0:0.1868:0.8132:0.0	.	59;126	B4DLK6;Q9BUL5	.;PHF23_HUMAN	S	126;122;126	ENSP00000322579:T126S;ENSP00000414607:T122S	ENSP00000043410:T126S	T	-	2	0	PHF23	7080593	0.992000	0.36948	0.691000	0.30163	0.812000	0.45895	3.015000	0.49599	1.214000	0.43395	0.563000	0.77884	ACC	.		0.562	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1	NM_024297	
PKNOX2	63876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	125237753	125237753	+	Silent	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:125237753C>T	ENST00000298282.9	+	5	370	c.99C>T	c.(97-99)acC>acT	p.T33T	PKNOX2_ENST00000542175.1_Intron|PKNOX2_ENST00000530517.1_3'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	33					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TGACGGCAACCGCCCAGCCAC	0.662																																					p.T33T		.											.	PKNOX2	93	0			c.C99T						.						53.0	65.0	61.0					11																	125237753		2090	4203	6293	SO:0001819	synonymous_variant	63876	exon5			GGCAACCGCCCAG	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.99C>T	11.37:g.125237753C>T		73.0	0.0		156.0	53.0	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Silent	SNP	ENST00000298282.9	37	CCDS41730.1																																																																																			.		0.662	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
POFUT2	23275	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	46707671	46707671	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr21:46707671G>A	ENST00000349485.5	-	1	142	c.116C>T	c.(115-117)gCg>gTg	p.A39V	BX322557.10_ENST00000454115.2_RNA|POFUT2_ENST00000331343.7_Missense_Mutation_p.A39V	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	39					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		GCGGGAAGCCGCCCCCGACAG	0.697																																					p.A39V		.											.	POFUT2	90	0			c.C116T						.						8.0	11.0	10.0					21																	46707671		2093	4124	6217	SO:0001583	missense	23275	exon1			GAAGCCGCCCCCG	AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.116C>T	21.37:g.46707671G>A	ENSP00000339613:p.Ala39Val	30.0	0.0		54.0	21.0	NM_015227	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Missense_Mutation	SNP	ENST00000349485.5	37	CCDS13719.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186937	0.38609	.	.	ENSG00000186866	ENST00000331343;ENST00000349485	.	.	.	2.89	1.98	0.26296	.	0.461733	0.19783	N	0.106164	T	0.23649	0.0572	N	0.19112	0.55	0.36415	D	0.863997	P;B;B	0.35011	0.48;0.006;0.002	B;B;B	0.20577	0.03;0.005;0.001	T	0.17684	-1.0361	9	0.25106	T	0.35	-12.3452	7.8696	0.29558	0.0:0.2566:0.7434:0.0	.	39;39;39	B4DH78;Q9Y2G5-1;Q9Y2G5	.;.;OFUT2_HUMAN	V	39	.	ENSP00000329682:A39V	A	-	2	0	POFUT2	45532099	0.000000	0.05858	0.987000	0.45799	0.868000	0.49771	-0.448000	0.06820	0.766000	0.33244	0.650000	0.86243	GCG	.		0.697	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192573.2	NM_015227	
PSD3	23362	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	18730127	18730127	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr8:18730127C>G	ENST00000327040.8	-	3	349	c.247G>C	c.(247-249)Gct>Cct	p.A83P	PSD3_ENST00000523619.1_Missense_Mutation_p.A18P|PSD3_ENST00000440756.2_Missense_Mutation_p.A83P	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	83					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CATGGCAGAGCCTCACCATCA	0.512																																					p.A83P		.											.	PSD3	93	0			c.G247C						.						60.0	60.0	60.0					8																	18730127		1934	4153	6087	SO:0001583	missense	23362	exon3			GCAGAGCCTCACC	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.247G>C	8.37:g.18730127C>G	ENSP00000324127:p.Ala83Pro	61.0	1.0		77.0	46.0	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	T	4.750	0.139496	0.09083	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000523619	T;T;T	0.10192	2.9;2.9;2.9	5.93	0.229	0.15368	.	0.838798	0.10486	N	0.668936	T	0.03263	0.0095	N	0.03608	-0.345	0.09310	N	1	B	0.27068	0.167	B	0.23419	0.046	T	0.43972	-0.9358	10	0.13108	T	0.6	.	1.9056	0.03276	0.283:0.3327:0.0783:0.306	.	83	E9KL50	.	P	83;83;18	ENSP00000324127:A83P;ENSP00000401704:A83P;ENSP00000430640:A18P	ENSP00000324127:A83P	A	-	1	0	PSD3	18774407	0.542000	0.26426	0.702000	0.30337	0.099000	0.18886	0.129000	0.15830	-0.099000	0.12263	-2.401000	0.00224	GCT	.		0.512	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
PTK2B	2185	ucsc.edu;bcgsc.ca	37	8	27288457	27288457	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr8:27288457A>G	ENST00000397501.1	+	13	1542	c.734A>G	c.(733-735)gAg>gGg	p.E245G	PTK2B_ENST00000338238.4_Missense_Mutation_p.E245G|PTK2B_ENST00000346049.5_Missense_Mutation_p.E245G|PTK2B_ENST00000397497.4_5'UTR|PTK2B_ENST00000544172.1_Missense_Mutation_p.E245G|PTK2B_ENST00000517339.1_Missense_Mutation_p.E245G|PTK2B_ENST00000420218.2_Missense_Mutation_p.E245G	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	245	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	AGGGAGGAGGAGTGCGTCATG	0.582																																					p.E245G		.											.	PTK2B	1378	0			c.A734G						.						142.0	123.0	130.0					8																	27288457		2203	4300	6503	SO:0001583	missense	2185	exon13			AGGAGGAGTGCGT	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.734A>G	8.37:g.27288457A>G	ENSP00000380638:p.Glu245Gly	43.0	0.0		39.0	4.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334977	0.81801	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	5.8	5.8	0.92144	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.100739	0.64402	D	0.000002	T	0.53738	0.1815	M	0.64404	1.975	0.80722	D	1	B;B;B	0.33739	0.18;0.234;0.422	B;B;B	0.41666	0.248;0.248;0.363	T	0.57952	-0.7722	10	0.87932	D	0	.	14.107	0.65096	1.0:0.0:0.0:0.0	.	250;245;245	Q59GM4;Q14289-2;Q14289	.;.;FAK2_HUMAN	G	245;250;245;245;245;245;245	ENSP00000380638:E245G;ENSP00000342242:E245G;ENSP00000440926:E245G;ENSP00000332816:E245G;ENSP00000391995:E245G;ENSP00000427931:E245G	ENSP00000342242:E245G	E	+	2	0	PTK2B	27344374	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.712000	0.91403	2.209000	0.71365	0.533000	0.62120	GAG	.		0.582	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78328292	78328292	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr17:78328292A>G	ENST00000582970.1	+	36	10921	c.10778A>G	c.(10777-10779)cAa>cGa	p.Q3593R	RNF213_ENST00000336301.6_Missense_Mutation_p.Q1666R|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.Q3642R|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3593					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTAAAGAAGCAAGAAGAGAGC	0.532																																					p.Q3593R		.											.	RNF213	577	0			c.A10778G						.						83.0	78.0	79.0					17																	78328292		2203	4300	6503	SO:0001583	missense	57674	exon36			AGAAGCAAGAAGA	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10778A>G	17.37:g.78328292A>G	ENSP00000464087:p.Gln3593Arg	27.0	0.0		90.0	22.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	9.693	1.152391	0.21371	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.22134	1.97	4.93	4.93	0.64822	.	0.216684	0.42294	D	0.000726	T	0.26666	0.0652	M	0.72576	2.205	0.25911	N	0.98323	P;B	0.50528	0.936;0.287	B;B	0.42555	0.391;0.078	T	0.23119	-1.0197	10	0.30078	T	0.28	.	14.5981	0.68422	1.0:0.0:0.0:0.0	.	3642;1666	C9JCP4;Q63HN8	.;RN213_HUMAN	R	3593;3642;1666	ENSP00000338218:Q1666R	ENSP00000338218:Q1666R	Q	+	2	0	RNF213	75942887	0.997000	0.39634	0.973000	0.42090	0.236000	0.25371	4.122000	0.57910	1.856000	0.53863	0.528000	0.53228	CAA	.		0.532	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SCAF8	22828	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155109132	155109132	+	Missense_Mutation	SNP	A	A	T	rs149559791	byFrequency	TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr6:155109132A>T	ENST00000367178.3	+	4	873	c.297A>T	c.(295-297)ttA>ttT	p.L99F	SCAF8_ENST00000461219.1_3'UTR|SCAF8_ENST00000367186.4_Missense_Mutation_p.L165F|SCAF8_ENST00000417268.1_Missense_Mutation_p.L99F	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	99	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TCCAGAATTTATATCGTTGCC	0.368																																					p.L99F		.											.	SCAF8	91	0			c.A297T						.						181.0	174.0	176.0					6																	155109132		2203	4300	6503	SO:0001583	missense	22828	exon4			GAATTTATATCGT	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.297A>T	6.37:g.155109132A>T	ENSP00000356146:p.Leu99Phe	91.0	2.0		203.0	66.0	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.526327	0.44969	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.48836	0.8;0.8;0.8	5.27	0.0537	0.14308	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	0.000000	0.64402	U	0.000020	T	0.59307	0.2184	M	0.86651	2.83	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	T	0.65903	-0.6055	10	0.87932	D	0	.	10.6885	0.45856	0.5524:0.0:0.4476:0.0	.	144;165;177;99	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	F	99;99;165	ENSP00000356146:L99F;ENSP00000413098:L99F;ENSP00000356154:L165F	ENSP00000356146:L99F	L	+	3	2	SCAF8	155150824	0.290000	0.24343	0.997000	0.53966	0.984000	0.73092	-0.162000	0.10012	-0.137000	0.11455	-0.899000	0.02877	TTA	A|0.999;G|0.001		0.368	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77087747	77087747	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:77087747C>T	ENST00000563290.1	-	8	741	c.646G>A	c.(646-648)Gct>Act	p.A216T	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000562890.1_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.A216T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	216						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CCTGTGGGAGCCAGACGAGGA	0.423																																					p.A216T		.											.	SCAPER	137	0			c.G646A						.						68.0	66.0	67.0					15																	77087747		1868	4096	5964	SO:0001583	missense	49855	exon7			TGGGAGCCAGACG	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.646G>A	15.37:g.77087747C>T	ENSP00000454973:p.Ala216Thr	87.0	0.0		113.0	34.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868777	0.51588	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.25250	1.81	5.66	5.66	0.87406	.	0.103099	0.64402	D	0.000002	T	0.21921	0.0528	L	0.39898	1.24	0.46279	D	0.998962	B;B	0.18610	0.014;0.029	B;B	0.16289	0.013;0.015	T	0.02860	-1.1101	10	0.28530	T	0.3	.	13.0138	0.58745	0.0:0.9263:0.0:0.0737	.	216;231	Q6NSF1;Q9BY12-2	.;.	T	216;232	ENSP00000326924:A216T	ENSP00000303560:A232T	A	-	1	0	SCAPER	74874802	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.781000	0.47750	2.681000	0.91329	0.585000	0.79938	GCT	.		0.423	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4009044	4009044	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:4009044C>T	ENST00000404826.2	+	11	1841	c.1702C>T	c.(1702-1704)Ctc>Ttc	p.L568F	SDK1_ENST00000389531.3_Missense_Mutation_p.L568F	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	568	Ig-like C2-type 5.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ATCGGCCACGCTCACTGTGTG	0.587																																					p.L568F		.											.	SDK1	138	0			c.C1702T						.						75.0	75.0	75.0					7																	4009044		2203	4300	6503	SO:0001583	missense	221935	exon11			GCCACGCTCACTG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1702C>T	7.37:g.4009044C>T	ENSP00000385899:p.Leu568Phe	30.0	0.0		74.0	31.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840180	0.51057	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	D;D	0.98602	-5.02;-5.02	5.63	5.63	0.86233	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000025	D	0.99180	0.9716	M	0.93328	3.405	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99087	1.0839	10	0.87932	D	0	.	14.8485	0.70277	0.1436:0.8563:0.0:0.0	.	568	Q7Z5N4	SDK1_HUMAN	F	568	ENSP00000385899:L568F;ENSP00000374182:L568F	ENSP00000374182:L568F	L	+	1	0	SDK1	3975570	1.000000	0.71417	0.337000	0.25536	0.004000	0.04260	4.351000	0.59398	2.826000	0.97356	0.655000	0.94253	CTC	.		0.587	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SEC24B	10427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	110447421	110447421	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr4:110447421G>A	ENST00000265175.5	+	17	2886	c.2831G>A	c.(2830-2832)cGt>cAt	p.R944H	SEC24B_ENST00000504968.2_Missense_Mutation_p.R974H|SEC24B_ENST00000399100.2_Missense_Mutation_p.R909H	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	944					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.R944H(1)|p.R909H(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCTTTGTCCGTTCTACTGAT	0.358																																					p.R944H		.											.	SEC24B	137	2	Substitution - Missense(2)	prostate(2)	c.G2831A						.						205.0	186.0	192.0					4																	110447421		1856	4094	5950	SO:0001583	missense	10427	exon17			TTGTCCGTTCTAC	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2831G>A	4.37:g.110447421G>A	ENSP00000265175:p.Arg944His	162.0	0.0		276.0	19.0	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870183	0.91587	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.27256	1.68;1.68;1.68	5.21	4.35	0.52113	Sec23/Sec24 beta-sandwich (1);	0.054311	0.85682	D	0.000000	T	0.51466	0.1676	M	0.77616	2.38	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.979;0.986;0.991;0.984;0.979	T	0.56523	-0.7965	10	0.87932	D	0	-16.5841	14.7926	0.69854	0.0735:0.0:0.9265:0.0	.	858;543;974;909;944	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	H	974;909;944	ENSP00000428564:R974H;ENSP00000382051:R909H;ENSP00000265175:R944H	ENSP00000265175:R944H	R	+	2	0	SEC24B	110666870	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.013000	0.88655	2.596000	0.87737	0.591000	0.81541	CGT	.		0.358	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48057214	48057214	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:48057214G>T	ENST00000316364.5	+	13	1827	c.1388G>T	c.(1387-1389)aGc>aTc	p.S463I	SEMA6D_ENST00000558014.1_Missense_Mutation_p.S463I|SEMA6D_ENST00000355997.3_Missense_Mutation_p.S463I|SEMA6D_ENST00000537942.1_Missense_Mutation_p.S463I|SEMA6D_ENST00000354744.4_Missense_Mutation_p.S463I|SEMA6D_ENST00000536845.2_Missense_Mutation_p.S463I|SEMA6D_ENST00000558816.1_Missense_Mutation_p.S463I|SEMA6D_ENST00000389433.2_Missense_Mutation_p.S463I|SEMA6D_ENST00000389432.2_Missense_Mutation_p.S463I|SEMA6D_ENST00000389428.3_Missense_Mutation_p.S463I|SEMA6D_ENST00000389425.3_Missense_Mutation_p.S463I|SEMA6D_ENST00000358066.4_Missense_Mutation_p.S463I	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	463	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTGAACGACAGCGTATTACTG	0.448																																					p.S463I		.											.	SEMA6D	138	0			c.G1388T						.						132.0	116.0	122.0					15																	48057214		2198	4297	6495	SO:0001583	missense	80031	exon13			ACGACAGCGTATT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1388G>T	15.37:g.48057214G>T	ENSP00000324857:p.Ser463Ile	46.0	0.0		109.0	30.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	32	5.142822	0.94560	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	M	0.65677	2.01	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.994;0.998;0.998;0.998	D;D;D;D;D	0.79108	0.925;0.919;0.925;0.992;0.925	T	0.01488	-1.1342	10	0.87932	D	0	.	20.04	0.97581	0.0:0.0:1.0:0.0	.	463;463;463;463;463	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	I	463	ENSP00000442040:S463I;ENSP00000446152:S463I;ENSP00000324857:S463I;ENSP00000374084:S463I;ENSP00000374083:S463I;ENSP00000346786:S463I;ENSP00000350770:S463I;ENSP00000374079:S463I;ENSP00000348276:S463I;ENSP00000374076:S463I	ENSP00000324857:S463I	S	+	2	0	SEMA6D	45844506	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	7.912000	0.87465	2.733000	0.93635	0.655000	0.94253	AGC	.		0.448	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SLC39A4	55630	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145639418	145639418	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr8:145639418A>T	ENST00000301305.3	-	7	1316	c.1211T>A	c.(1210-1212)cTg>cAg	p.L404Q	SLC39A4_ENST00000276833.5_Missense_Mutation_p.L379Q|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	404					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CAGCATAGCCAGGAGGCGCCA	0.657																																					p.L404Q		.											.	SLC39A4	90	0			c.T1211A						.						14.0	15.0	15.0					8																	145639418		2193	4283	6476	SO:0001583	missense	55630	exon7			ATAGCCAGGAGGC	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.1211T>A	8.37:g.145639418A>T	ENSP00000301305:p.Leu404Gln	55.0	1.0		159.0	50.0	NM_130849	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	37	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089247	0.76756	.	.	ENSG00000147804	ENST00000276833;ENST00000301305	T;T	0.57436	0.4;0.4	4.85	4.85	0.62838	.	0.285006	0.28470	N	0.015237	T	0.77857	0.4193	M	0.93594	3.435	0.46376	D	0.999016	D;D	0.89917	1.0;0.997	D;D	0.72338	0.977;0.964	D	0.83565	0.0109	10	0.87932	D	0	-3.4564	12.4096	0.55459	1.0:0.0:0.0:0.0	.	404;379	Q6P5W5;A6NDY5	S39A4_HUMAN;.	Q	379;404	ENSP00000276833:L379Q;ENSP00000301305:L404Q	ENSP00000276833:L379Q	L	-	2	0	SLC39A4	145610226	0.999000	0.42202	0.949000	0.38748	0.515000	0.34225	4.216000	0.58540	1.832000	0.53329	0.529000	0.55759	CTG	.		0.657	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1		
SLC8A1	6546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	40656836	40656836	+	Silent	SNP	T	T	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:40656836T>G	ENST00000403092.1	-	2	618	c.585A>C	c.(583-585)acA>acC	p.T195T	SLC8A1_ENST00000542756.1_Silent_p.T195T|SLC8A1_ENST00000402441.1_Silent_p.T195T|SLC8A1_ENST00000542024.1_Silent_p.T195T|SLC8A1_ENST00000405901.3_Silent_p.T195T|SLC8A1_ENST00000405269.1_Silent_p.T195T|SLC8A1_ENST00000406785.2_Silent_p.T195T|SLC8A1_ENST00000408028.2_Silent_p.T195T|SLC8A1_ENST00000406391.2_Silent_p.T195T|SLC8A1_ENST00000332839.4_Silent_p.T195T			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	195					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAATCTTCCTTGTCTCTCCGT	0.468																																					p.T195T		.											.	SLC8A1	93	0			c.A585C						.						80.0	77.0	78.0					2																	40656836		2203	4300	6503	SO:0001819	synonymous_variant	6546	exon1			CTTCCTTGTCTCT		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.585A>C	2.37:g.40656836T>G		71.0	0.0		189.0	94.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	CCDS1806.1																																																																																			.		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SNX12	29934	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70281775	70281775	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chrX:70281775G>C	ENST00000374274.3	-	3	420	c.304C>G	c.(304-306)Ctc>Gtc	p.L102V	SNX12_ENST00000276105.3_Missense_Mutation_p.L98V|SNX12_ENST00000465030.1_Intron	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	102	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					CGGAAAGGGAGCTGCCGCTTC	0.512																																					p.L102V		.											.	SNX12	226	0			c.C304G						.						40.0	37.0	38.0					X																	70281775		2203	4300	6503	SO:0001583	missense	29934	exon4			AAGGGAGCTGCCG	AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.304C>G	X.37:g.70281775G>C	ENSP00000363392:p.Leu102Val	58.0	1.0		96.0	36.0	NM_001256185	F8W8K5|Q8WUG9	Missense_Mutation	SNP	ENST00000374274.3	37	CCDS14405.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700292	0.48307	.	.	ENSG00000147164	ENST00000374274;ENST00000276105	T;T	0.65549	-0.11;-0.16	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.65196	0.2668	M	0.66560	2.04	0.58432	D	0.999999	B	0.16166	0.016	B	0.28011	0.085	T	0.64698	-0.6346	10	0.59425	D	0.04	-15.5081	16.8254	0.85929	0.0:0.0:1.0:0.0	.	102	Q3SYF1	.	V	102;98	ENSP00000363392:L102V;ENSP00000276105:L98V	ENSP00000276105:L98V	L	-	1	0	SNX12	70198500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.409000	0.66374	2.438000	0.82558	0.600000	0.82982	CTC	.		0.512	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346	
SPATA31A6	389730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	43630592	43630592	+	Missense_Mutation	SNP	C	C	T	rs543743372		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr9:43630592C>T	ENST00000332857.6	-	1	138	c.110G>A	c.(109-111)gGg>gAg	p.G37E	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	37					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAAGAAGAACCCCAGGGCAAA	0.498																																					p.G37E		.											.	.	.	0			c.G110A						.																																			SO:0001583	missense	389730	exon1			AAGAACCCCAGGG		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.110G>A	9.37:g.43630592C>T	ENSP00000329825:p.Gly37Glu	17.0	0.0		30.0	11.0	NM_001145196		Missense_Mutation	SNP	ENST00000332857.6	37	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	C	7.383	0.629230	0.14257	.	.	ENSG00000185775	ENST00000332857	T	0.18657	2.2	1.96	0.992	0.19819	.	0.379536	0.19422	N	0.114662	T	0.10423	0.0255	N	0.16903	0.455	0.09310	N	1	B	0.10296	0.003	B	0.14023	0.01	T	0.24799	-1.0150	10	0.30854	T	0.27	-5.6059	5.5217	0.16936	0.328:0.672:0.0:0.0	.	37	Q5VVP1	F75A6_HUMAN	E	37	ENSP00000329825:G37E	ENSP00000329825:G37E	G	-	2	0	FAM75A6	43570588	0.001000	0.12720	0.233000	0.24025	0.393000	0.30537	0.147000	0.16202	0.360000	0.24265	0.184000	0.17185	GGG	.		0.498	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
SRMS	6725	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	62178615	62178615	+	Missense_Mutation	SNP	C	C	T	rs149894938		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr20:62178615C>T	ENST00000217188.1	-	1	242	c.202G>A	c.(202-204)Ggg>Agg	p.G68R		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	68	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.G68W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CTCAGCTCCCCGCCACACCGC	0.697																																					p.G68R		.											.	SRMS	521	1	Substitution - Missense(1)	lung(1)	c.G202A						.	C	ARG/GLY	1,4341		0,1,2170	135.0	138.0	137.0		202	4.1	0.0	20	dbSNP_134	137	0,8464		0,0,4232	no	missense	SRMS	NM_080823.2	125	0,1,6402	TT,TC,CC		0.0,0.023,0.0078	benign	68/489	62178615	1,12805	2171	4232	6403	SO:0001583	missense	6725	exon1			GCTCCCCGCCACA		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.202G>A	20.37:g.62178615C>T	ENSP00000217188:p.Gly68Arg	34.0	0.0		49.0	18.0	NM_080823		Missense_Mutation	SNP	ENST00000217188.1	37	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466318	0.26335	2.3E-4	0.0	ENSG00000125508	ENST00000217188	T	0.49720	0.77	4.09	4.09	0.47781	Src homology-3 domain (3);	1.198130	0.06232	N	0.688818	T	0.40119	0.1104	L	0.44542	1.39	0.09310	N	1	P	0.39964	0.697	B	0.21917	0.037	T	0.43782	-0.9370	10	0.44086	T	0.13	.	15.9068	0.79436	0.0:1.0:0.0:0.0	.	68	Q9H3Y6	SRMS_HUMAN	R	68	ENSP00000217188:G68R	ENSP00000217188:G68R	G	-	1	0	SRMS	61649059	0.119000	0.22226	0.002000	0.10522	0.006000	0.05464	4.328000	0.59253	1.820000	0.53075	0.491000	0.48974	GGG	C|1.000;T|0.000		0.697	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
SSH3	54961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67075197	67075197	+	Silent	SNP	C	C	T	rs79688961	byFrequency	TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr11:67075197C>T	ENST00000308127.4	+	7	958	c.780C>T	c.(778-780)gcC>gcT	p.A260A	SSH3_ENST00000308298.7_Silent_p.A260A|SSH3_ENST00000532181.1_Intron|SSH3_ENST00000376757.5_Silent_p.A260A	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	260					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CTCCCAGCGCCGAGCCTGGCG	0.652													C|||	6	0.00119808	0.0045	0.0	5008	,	,		18871	0.0		0.0	False		,,,				2504	0.0				p.A260A		.											.	SSH3	91	0			c.C780T						.	C		4,4396		0,4,2196	26.0	31.0	29.0		780	-8.8	0.0	11	dbSNP_131	29	0,8590		0,0,4295	no	coding-synonymous	SSH3	NM_017857.3		0,4,6491	TT,TC,CC		0.0,0.0909,0.0308		260/660	67075197	4,12986	2200	4295	6495	SO:0001819	synonymous_variant	54961	exon7			CAGCGCCGAGCCT	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.780C>T	11.37:g.67075197C>T		47.0	0.0		118.0	42.0	NM_017857	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Silent	SNP	ENST00000308127.4	37	CCDS8157.1																																																																																			C|0.999;T|0.001		0.652	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276	
SUPT20H	55578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	37599542	37599542	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr13:37599542T>C	ENST00000350612.6	-	17	1464	c.1244A>G	c.(1243-1245)aAt>aGt	p.N415S	SUPT20H_ENST00000475892.1_Missense_Mutation_p.N415S|SUPT20H_ENST00000464744.1_Missense_Mutation_p.N416S|SUPT20H_ENST00000542180.1_Missense_Mutation_p.N379S|SUPT20H_ENST00000356185.3_Missense_Mutation_p.N416S|SUPT20H_ENST00000360252.4_Missense_Mutation_p.N416S	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	415					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TTTGGCTTCATTCTGGACTAA	0.383																																					p.N416S		.											.	.	.	0			c.A1247G						.						122.0	106.0	111.0					13																	37599542		2203	4300	6503	SO:0001583	missense	55578	exon17			GCTTCATTCTGGA	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.1244A>G	13.37:g.37599542T>C	ENSP00000218894:p.Asn415Ser	121.0	0.0		265.0	83.0	NM_017569	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	ENST00000350612.6	37	CCDS31959.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.17|10.17	1.277928|1.277928	0.23307|0.23307	.|.	.|.	ENSG00000102710|ENSG00000102710	ENST00000469488|ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180	.|T;T;T;T;T;T	.|0.40476	.|1.03;1.03;1.61;1.03;1.03;1.05	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.154235	.|0.64402	.|D	.|0.000014	T|T	0.19248|0.19248	0.0462|0.0462	N|N	0.10874|0.10874	0.06|0.06	0.30065|0.30065	N|N	0.810589|0.810589	.|B;B;B;B;B;B	.|0.09022	.|0.0;0.001;0.002;0.001;0.002;0.001	.|B;B;B;B;B;B	.|0.09377	.|0.002;0.002;0.004;0.002;0.004;0.003	T|T	0.22521|0.22521	-1.0214|-1.0214	5|10	.|0.07813	.|T	.|0.8	-12.5689|-12.5689	6.8917|6.8917	0.24232|0.24232	0.1338:0.0725:0.0:0.7937|0.1338:0.0725:0.0:0.7937	.|.	.|379;415;415;416;416;415	.|B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.|.;.;.;.;.;FA48A_HUMAN	V|S	23|416;415;415;416;415;416;379	.|ENSP00000353388:N416S;ENSP00000417510:N415S;ENSP00000218894:N415S;ENSP00000348512:N416S;ENSP00000419754:N416S;ENSP00000439000:N379S	.|ENSP00000218894:N415S	M|N	-|-	1|2	0|0	FAM48A|FAM48A	36497542|36497542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.834000|0.834000	0.47266|0.47266	1.791000|1.791000	0.38744|0.38744	2.126000|2.126000	0.65437|0.65437	0.482000|0.482000	0.46254|0.46254	ATG|AAT	.		0.383	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152676100	152676100	+	Silent	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr6:152676100T>C	ENST00000367255.5	-	67	11221	c.10620A>G	c.(10618-10620)gtA>gtG	p.V3540V	SYNE1_ENST00000341594.5_Silent_p.V3511V|SYNE1_ENST00000423061.1_Silent_p.V3547V|SYNE1_ENST00000448038.1_Silent_p.V3547V|SYNE1_ENST00000265368.4_Silent_p.V3540V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3540					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGCACAGTGTACCTGTAGCT	0.527										HNSCC(10;0.0054)																											p.V3547V		.											.	SYNE1	607	0			c.A10641G						.						88.0	91.0	90.0					6																	152676100		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon67			ACAGTGTACCTGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10620A>G	6.37:g.152676100T>C		26.0	0.0		73.0	31.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.		0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TARM1	441864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54573335	54573335	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr19:54573335G>C	ENST00000432826.1	-	5	762	c.738C>G	c.(736-738)atC>atG	p.I246M	TARM1_ENST00000446034.2_Missense_Mutation_p.I254M	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	246						integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						AAGCTCCCATGATAACCACAA	0.552																																					p.I246M		.											.	.	.	0			c.C738G						.						79.0	81.0	80.0					19																	54573335		692	1591	2283	SO:0001583	missense	441864	exon5			TCCCATGATAACC		CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.738C>G	19.37:g.54573335G>C	ENSP00000439454:p.Ile246Met	40.0	0.0		97.0	24.0	NM_001135686	B4DWY4	Missense_Mutation	SNP	ENST00000432826.1	37	CCDS46173.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547107	0.27652	.	.	ENSG00000248385	ENST00000432826;ENST00000446034	T;T	0.00524	6.95;6.82	2.98	-5.6	0.02497	.	.	.	.	.	T	0.00524	0.0017	L	0.55103	1.725	0.09310	N	1	P	0.50528	0.936	P	0.48368	0.575	T	0.14504	-1.0470	9	0.66056	D	0.02	.	3.6076	0.08049	0.1783:0.1456:0.5216:0.1544	.	246	B6A8C7	TARM1_HUMAN	M	246;254	ENSP00000439454:I246M;ENSP00000441055:I254M	ENSP00000439454:I246M	I	-	3	3	TARM1	59265147	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.853000	0.01666	-1.482000	0.01860	-0.438000	0.05819	ATC	.		0.552	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465679.1	NM_001135686	
THADA	63892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	43819171	43819171	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:43819171C>A	ENST00000405006.4	-	3	442	c.91G>T	c.(91-93)Gaa>Taa	p.E31*	THADA_ENST00000402360.2_Nonsense_Mutation_p.E31*|THADA_ENST00000415080.2_5'UTR|THADA_ENST00000405975.2_Nonsense_Mutation_p.E31*|THADA_ENST00000403856.1_Nonsense_Mutation_p.E31*|THADA_ENST00000404790.1_Nonsense_Mutation_p.E31*	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	31										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTTTTCCCTTCCACATCAGCA	0.308																																					p.E31X		.											.	THADA	228	0			c.G91T						.						50.0	44.0	46.0					2																	43819171		1821	4063	5884	SO:0001587	stop_gained	63892	exon3			TCCCTTCCACATC	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.91G>T	2.37:g.43819171C>A	ENSP00000385995:p.Glu31*	101.0	0.0		297.0	179.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Nonsense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	C	38	6.820254	0.97861	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	.	.	.	5.04	5.04	0.67666	.	0.173309	0.49916	D	0.000136	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-11.8142	16.7404	0.85457	0.0:1.0:0.0:0.0	.	.	.	.	X	31	.	ENSP00000349464:E31X	E	-	1	0	THADA	43672675	1.000000	0.71417	0.852000	0.33557	0.976000	0.68499	4.557000	0.60782	2.622000	0.88805	0.591000	0.81541	GAA	.		0.308	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
TM4SF18	116441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	149051080	149051080	+	Silent	SNP	G	G	A	rs35087723		TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr3:149051080G>A	ENST00000296059.2	-	2	355	c.90C>T	c.(88-90)ttC>ttT	p.F30F	TM4SF18_ENST00000470080.1_Silent_p.F30F|RP11-206M11.7_ENST00000489011.1_RNA	NM_138786.3	NP_620141.1	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	30						integral component of membrane (GO:0016021)				lung(1)|ovary(1)|prostate(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GCCCATTCGGGAAATACAATA	0.428																																					p.F30F		.											.	TM4SF18	69	0			c.C90T						.						96.0	91.0	93.0					3																	149051080		2203	4300	6503	SO:0001819	synonymous_variant	116441	exon1			ATTCGGGAAATAC	BC014339	CCDS3142.1	3q25.1	2005-08-09			ENSG00000163762	ENSG00000163762			25181	protein-coding gene	gene with protein product						10975581	Standard	NM_001184723		Approved	L6D	uc021xfl.1	Q96CE8	OTTHUMG00000159582	ENST00000296059.2:c.90C>T	3.37:g.149051080G>A		87.0	0.0		375.0	107.0	NM_001184723	B2R8K0|D3DNH5	Silent	SNP	ENST00000296059.2	37	CCDS3142.1																																																																																			.		0.428	TM4SF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356326.1	NM_138786	
TMEM127	55654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	96919804	96919804	+	Silent	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:96919804G>A	ENST00000258439.3	-	4	715	c.459C>T	c.(457-459)ctC>ctT	p.L153L	TMEM127_ENST00000435268.1_Silent_p.L69L|TMEM127_ENST00000432959.1_Silent_p.L153L	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127	153					negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						GGGCCAAGATGAGTTCAGAAG	0.537																																					p.L153L		.											.	TMEM127	90	0			c.C459T						.						103.0	99.0	100.0					2																	96919804		2203	4300	6503	SO:0001819	synonymous_variant	55654	exon4			CAAGATGAGTTCA	AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454	ENST00000258439.3:c.459C>T	2.37:g.96919804G>A		55.0	0.0		129.0	11.0	NM_001193304	D3DXH0	Silent	SNP	ENST00000258439.3	37	CCDS2018.1																																																																																			.		0.537	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252845.3	NM_017849	
UBE2O	63893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74387574	74387574	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr17:74387574T>A	ENST00000319380.7	-	18	3393	c.3329A>T	c.(3328-3330)cAg>cTg	p.Q1110L		NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	1110					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						GGTCATGGACTGCACCACGCG	0.592																																					p.Q1110L		.											.	UBE2O	272	0			c.A3329T						.						92.0	88.0	90.0					17																	74387574		2203	4300	6503	SO:0001583	missense	63893	exon18			ATGGACTGCACCA	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.3329A>T	17.37:g.74387574T>A	ENSP00000323687:p.Gln1110Leu	82.0	0.0		178.0	40.0	NM_022066	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	37	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370436	0.82573	.	.	ENSG00000175931	ENST00000319380	T	0.71222	-0.55	4.49	4.49	0.54785	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.64402	D	0.000001	T	0.79441	0.4446	L	0.57536	1.79	0.58432	D	0.999999	D	0.57899	0.981	D	0.67231	0.95	T	0.80353	-0.1418	10	0.52906	T	0.07	-22.5804	12.5171	0.56038	0.0:0.0:0.0:1.0	.	1110	Q9C0C9	UBE2O_HUMAN	L	1110	ENSP00000323687:Q1110L	ENSP00000323687:Q1110L	Q	-	2	0	UBE2O	71899169	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.509000	0.81698	1.889000	0.54706	0.533000	0.62120	CAG	.		0.592	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54435882	54435882	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr15:54435882G>A	ENST00000260323.11	+	3	3071		c.e3+1		UNC13C_ENST00000537900.1_Splice_Site|UNC13C_ENST00000545554.1_Splice_Site	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)						exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGTGTGGTGGGTAAGTACCTT	0.383																																					.		.											.	UNC13C	51	0			c.3071+1G>A						.						150.0	141.0	144.0					15																	54435882		1894	4124	6018	SO:0001630	splice_region_variant	440279	exon3			TGGTGGGTAAGTA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3071+1G>A	15.37:g.54435882G>A		72.0	0.0		224.0	67.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Splice_Site	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634978	0.67130	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5373	0.91015	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13C	52223174	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.636000	0.74299	2.636000	0.89361	0.484000	0.47621	.	.		0.383	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	Intron
UNG	7374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	109540669	109540669	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr12:109540669T>C	ENST00000242576.2	+	5	665	c.559T>C	c.(559-561)Tct>Cct	p.S187P	UNG_ENST00000336865.2_Missense_Mutation_p.S178P	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						TAAAGAGTTGTCTACAGACAT	0.363								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																												p.S187P		.											.	UNG	1083	0			c.T559C						.						67.0	70.0	69.0					12																	109540669		2203	4300	6503	SO:0001583	missense	7374	exon5	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	GAGTTGTCTACAG	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.559T>C	12.37:g.109540669T>C	ENSP00000242576:p.Ser187Pro	59.0	0.0		187.0	49.0	NM_080911		Missense_Mutation	SNP	ENST00000242576.2	37	CCDS9124.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.363887	0.61513	.	.	ENSG00000076248	ENST00000242576;ENST00000336865;ENST00000537518	T;T	0.77098	-1.07;-1.07	5.26	5.26	0.73747	Uracil-DNA glycosylase-like (3);	0.187321	0.46442	D	0.000289	T	0.81616	0.4860	M	0.85197	2.74	0.41372	D	0.987493	P;P	0.49447	0.866;0.924	P;P	0.46479	0.518;0.518	D	0.84016	0.0351	10	0.51188	T	0.08	-20.3511	10.7753	0.46346	0.0:0.0:0.1588:0.8412	.	178;187	E5KTA6;P13051	.;UNG_HUMAN	P	187;178;144	ENSP00000242576:S187P;ENSP00000337398:S178P	ENSP00000242576:S187P	S	+	1	0	UNG	108025052	0.998000	0.40836	1.000000	0.80357	0.916000	0.54674	1.900000	0.39828	2.123000	0.65237	0.528000	0.53228	TCT	.		0.363	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403067.1	NM_080911	
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61415443	61415443	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr2:61415443C>G	ENST00000398571.2	-	80	10511	c.10435G>C	c.(10435-10437)Gac>Cac	p.D3479H	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3479					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCAGCTAAGTCAGACAGAACT	0.468																																					p.D3479H		.											.	USP34	579	0			c.G10435C						.						74.0	71.0	72.0					2																	61415443		1900	4122	6022	SO:0001583	missense	9736	exon80			CTAAGTCAGACAG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10435G>C	2.37:g.61415443C>G	ENSP00000381577:p.Asp3479His	55.0	0.0		149.0	83.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.14|17.14	3.313010|3.313010	0.60414|0.60414	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269|ENST00000411912	T|.	0.04049|.	3.72|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.164580|.	0.53938|.	D|.	0.000048|.	T|.	0.56659|.	0.2000|.	N|N	0.24115|0.24115	0.695|0.695	0.45477|0.45477	D|D	0.998447|0.998447	P|.	0.44578|.	0.838|.	B|.	0.35550|.	0.205|.	T|.	0.49762|.	-0.8905|.	10|.	0.72032|.	D|.	0.01|.	.|.	19.8041|19.8041	0.96521|0.96521	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3479|.	Q70CQ2|.	UBP34_HUMAN|.	H|S	3327;3244;3479;357|1155	ENSP00000381577:D3479H|.	ENSP00000263989:D3327H|.	D|X	-|-	1|2	0|2	USP34|USP34	61268947|61268947	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.105000|4.105000	0.57797|0.57797	2.748000|2.748000	0.94277|0.94277	0.591000|0.591000	0.81541|0.81541	GAC|TGA	.		0.468	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50028385	50028385	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:50028385G>A	ENST00000325239.5	+	32	5639	c.5612G>A	c.(5611-5613)cGg>cAg	p.R1871Q	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1871						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CATCCCGCCCGGAGGAAGCTG	0.667																																					p.R1871Q		.											.	WDFY4	22	0			c.G5612A						.						25.0	32.0	30.0					10																	50028385		692	1591	2283	SO:0001583	missense	57705	exon33			CCGCCCGGAGGAA	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5612G>A	10.37:g.50028385G>A	ENSP00000320563:p.Arg1871Gln	78.0	0.0		180.0	65.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311479	0.23821	.	.	ENSG00000128815	ENST00000426033;ENST00000325239	T	0.56776	0.44	5.43	1.49	0.22878	.	0.250550	0.30732	N	0.008992	T	0.33294	0.0858	L	0.38531	1.155	0.40715	D	0.982606	B;B	0.23490	0.086;0.018	B;B	0.10450	0.005;0.003	T	0.06679	-1.0813	9	.	.	.	.	4.0348	0.09725	0.3314:0.0:0.5123:0.1563	.	399;1871	F2Z372;Q6ZS81	.;WDFY4_HUMAN	Q	1871	ENSP00000320563:R1871Q	.	R	+	2	0	WDFY4	49698391	0.181000	0.23161	0.601000	0.28877	0.063000	0.16089	0.022000	0.13511	0.020000	0.15106	0.491000	0.48974	CGG	.		0.667	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	50040632	50040632	+	Missense_Mutation	SNP	T	T	C	rs3747871	byFrequency	TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:50040632T>C	ENST00000325239.5	+	38	6568	c.6541T>C	c.(6541-6543)Tca>Cca	p.S2181P	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2181						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TGAGAAGAAGTCACTGGCAAG	0.512													T|||	2	0.000399361	0.0	0.0	5008	,	,		20380	0.002		0.0	False		,,,				2504	0.0				p.S2181P		.											.	WDFY4	22	0			c.T6541C						.						65.0	60.0	61.0					10																	50040632		692	1591	2283	SO:0001583	missense	57705	exon39			AAGAAGTCACTGG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.6541T>C	10.37:g.50040632T>C	ENSP00000320563:p.Ser2181Pro	43.0	0.0		143.0	21.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	0|0	0.0|0.0	2|2	0.0034965034965034965|0.0034965034965034965	0|0	0.0|0.0	T|T	6.053|6.053	0.378133|0.378133	0.11466|0.11466	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	T|.	0.57273|.	0.41|.	5.54|5.54	0.105|0.105	0.14535|0.14535	.|.	1.605920|.	0.03320|.	N|.	0.191796|.	T|T	0.35480|0.35480	0.0933|0.0933	L|L	0.54323|0.54323	1.7|1.7	0.22112|0.22112	N|N	0.999351|0.999351	B|.	0.21147|.	0.052|.	B|.	0.22386|.	0.039|.	T|T	0.32188|0.32188	-0.9916|-0.9916	9|5	.|.	.|.	.|.	.|.	1.6931|1.6931	0.02856|0.02856	0.381:0.0862:0.3156:0.2172|0.381:0.0862:0.3156:0.2172	rs3747871;rs52811129;rs3747871|rs3747871;rs52811129;rs3747871	2181|.	Q6ZS81|.	WDFY4_HUMAN|.	P|A	2181|1271	ENSP00000320563:S2181P|.	.|.	S|V	+|+	1|2	0|0	WDFY4|WDFY4	49710638|49710638	0.000000|0.000000	0.05858|0.05858	0.066000|0.066000	0.19879|0.19879	0.279000|0.279000	0.26890|0.26890	-0.713000|-0.713000	0.05007|0.05007	-0.159000|-0.159000	0.11021|0.11021	-0.301000|-0.301000	0.09380|0.09380	TCA|GTC	T|0.998;C|0.002		0.512	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
ZNF518A	9849	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	97916784	97916784	+	RNA	SNP	G	G	T			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr10:97916784G>T	ENST00000534948.1	+	0	1562							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TTCATTATAAGTGTGGTAAAT	0.353																																					.		.											.	ZNF518A	23	0			.						.						133.0	130.0	131.0					10																	97916784		1899	4116	6015			9849	.			TTATAAGTGTGGT	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97916784G>T		98.0	0.0		203.0	66.0	.	A0PJI5|O15044|Q32MP4	RNA	SNP	ENST00000534948.1	37																																																																																				.		0.353	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
ZNF532	55205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56651549	56651549	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr18:56651549G>A	ENST00000336078.4	+	11	4533	c.3757G>A	c.(3757-3759)Gag>Aag	p.E1253K	ZNF532_ENST00000591083.1_Missense_Mutation_p.E1253K|ZNF532_ENST00000591808.1_Missense_Mutation_p.E1253K|ZNF532_ENST00000589288.1_Missense_Mutation_p.E1253K|ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000591230.1_Missense_Mutation_p.E1253K	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						ACCCAGCCACGAGGATGAATC	0.493																																					p.E1253K		.											.	ZNF532	154	0			c.G3757A						.						35.0	38.0	37.0					18																	56651549		2203	4300	6503	SO:0001583	missense	55205	exon11			AGCCACGAGGATG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3757G>A	18.37:g.56651549G>A	ENSP00000338217:p.Glu1253Lys	125.0	0.0		232.0	84.0	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	g	18.26	3.583653	0.65992	.	.	ENSG00000074657	ENST00000336078	T	0.01548	4.78	5.79	5.79	0.91817	.	0.217202	0.45867	D	0.000329	T	0.02047	0.0064	N	0.22421	0.69	0.42356	D	0.992399	B;B	0.31040	0.082;0.305	B;B	0.18263	0.007;0.021	T	0.64114	-0.6483	10	0.51188	T	0.08	-24.7636	19.7038	0.96066	0.0:0.0:1.0:0.0	.	1253;1253	B3KXW2;Q9HCE3	.;ZN532_HUMAN	K	1253	ENSP00000338217:E1253K	ENSP00000338217:E1253K	E	+	1	0	ZNF532	54802529	1.000000	0.71417	0.955000	0.39395	0.649000	0.38597	4.408000	0.59761	2.762000	0.94881	0.550000	0.68814	GAG	.		0.493	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZNF572	137209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	125987939	125987939	+	Silent	SNP	G	G	A			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr8:125987939G>A	ENST00000319286.5	+	2	211	c.57G>A	c.(55-57)gaG>gaA	p.E19E		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGGAGAGGGAGAGTTTGAAAA	0.413										HNSCC(60;0.17)																											p.E19E		.											.	ZNF572	154	0			c.G57A						.						116.0	112.0	114.0					8																	125987939		2203	4300	6503	SO:0001819	synonymous_variant	137209	exon2			GAGGGAGAGTTTG	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.57G>A	8.37:g.125987939G>A		108.0	0.0		278.0	64.0	NM_152412	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	37	CCDS6354.1																																																																																			.		0.413	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
ZNHIT6	54680	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	86173940	86173940	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr1:86173940T>G	ENST00000370574.3	-	1	161	c.28A>C	c.(28-30)Aag>Cag	p.K10Q	ZNHIT6_ENST00000431532.2_Missense_Mutation_p.K10Q			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	10					box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						CCCCCAGACTTCCCTTCATTT	0.567																																					p.K10Q		.											.	ZNHIT6	153	0			c.A28C						.						56.0	59.0	58.0					1																	86173940		2203	4300	6503	SO:0001583	missense	54680	exon1			CAGACTTCCCTTC	AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.28A>C	1.37:g.86173940T>G	ENSP00000359606:p.Lys10Gln	39.0	0.0		56.0	16.0	NM_017953	B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Missense_Mutation	SNP	ENST00000370574.3	37	CCDS707.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.752754	0.31046	.	.	ENSG00000117174	ENST00000431532;ENST00000370574	T;T	0.45276	0.9;0.91	3.95	0.208	0.15221	.	1.063840	0.07437	N	0.896610	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	B;B	0.27192	0.079;0.171	B;B	0.15870	0.014;0.014	T	0.29971	-0.9994	10	0.59425	D	0.04	2.826	3.2819	0.06918	0.0:0.2327:0.2119:0.5554	.	10;10	B4DP13;Q9NWK9	.;BCD1_HUMAN	Q	10	ENSP00000414344:K10Q;ENSP00000359606:K10Q	ENSP00000359606:K10Q	K	-	1	0	ZNHIT6	85946528	0.002000	0.14202	0.000000	0.03702	0.094000	0.18550	0.117000	0.15583	-0.052000	0.13311	0.372000	0.22366	AAG	.		0.567	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029186.1	NM_017953	
C7orf49	78996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134852549	134852550	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-BC-A10T-01A-11D-A12Z-10	TCGA-BC-A10T-11A-11D-A16Z-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f755c284-603b-4eac-93b5-5d67fbd723da	ce57ada9-1bc1-4997-8890-8c7eca99c411	g.chr7:134852549_134852550TC>AA	ENST00000393114.3	-	3	328_329	c.147_148GA>TT	c.(145-150)gcGAca>gcTTca	p.T50S	C7orf49_ENST00000483029.2_5'UTR|RP11-134L10.1_ENST00000608819.1_RNA|C7orf49_ENST00000430372.1_Missense_Mutation_p.T49S|C7orf49_ENST00000424142.1_5'UTR|C7orf49_ENST00000459937.1_Intron			Q9BWK5	MRI_HUMAN	chromosome 7 open reading frame 49	50						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						ACAGTCCTTGTCGCAGGGAGTC	0.48																																					p.T50S		.											.	.	.	0			.						.																																			SO:0001583	missense	78996	.			TCCTTGTCGCAGG	BC000168	CCDS5838.2, CCDS59082.1, CCDS75663.1	7q33	2011-12-09			ENSG00000122783	ENSG00000122783			22432	protein-coding gene	gene with protein product	"""modulator of retrovirus infection"""					17043244	Standard	NM_001243755		Approved	MGC5242, FLJ27285, FLJ22450, MRI	uc003vsh.3	Q9BWK5	OTTHUMG00000155447	ENST00000393114.3:c.147_148delinsAA	7.37:g.134852549_134852550delinsAA	ENSP00000376823:p.Thr50Ser	66.0	0.0		125.0	47.0	.	Q6NWZ4|Q6ZNR5	Missense_Mutation	DNP	ENST00000393114.3	37	CCDS5838.2																																																																																			.		0.480	C7orf49-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340145.1	NM_024033	
