#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48559659	48559659	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:48559659T>C	ENST00000435803.1	+	53	13844	c.13820T>C	c.(13819-13821)gTc>gCc	p.V4607A	ABCA13_ENST00000544596.1_Missense_Mutation_p.V337A	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4607					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATCTATGATGTCCTCAAGTGG	0.328																																					p.V4607A		.											.	ABCA13	521	0			c.T13820C						.						101.0	89.0	93.0					7																	48559659		1833	4073	5906	SO:0001583	missense	154664	exon53			ATGATGTCCTCAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13820T>C	7.37:g.48559659T>C	ENSP00000411096:p.Val4607Ala	179.0	1.0		134.0	16.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.520975	0.44866	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.86694	-2.16;-2.16;-2.16	5.35	1.61	0.23674	.	0.474755	0.17696	N	0.165083	D	0.82586	0.5069	L	0.41824	1.3	0.19300	N	0.99998	B;P;P	0.51791	0.321;0.459;0.948	B;B;P	0.49799	0.205;0.173;0.622	T	0.72849	-0.4168	10	0.52906	T	0.07	.	4.1499	0.10234	0.1492:0.1619:0.0:0.6889	.	337;2309;4607	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	A	4607;380;337	ENSP00000411096:V4607A;ENSP00000391042:V380A;ENSP00000442634:V337A	ENSP00000391042:V380A	V	+	2	0	ABCA13	48530205	0.954000	0.32549	0.038000	0.18304	0.982000	0.71751	2.503000	0.45407	0.036000	0.15547	0.528000	0.53228	GTC	.		0.328	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABRA	137735	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	107782232	107782232	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:107782232G>C	ENST00000311955.3	-	1	241	c.187C>G	c.(187-189)Cct>Gct	p.P63A		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.P63T(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			ATTGGTTTAGGAGCTTGAGGT	0.607																																					p.P63A		.											ABRA,NS,carcinoma,0	ABRA	92	1	Substitution - Missense(1)	ovary(1)	c.C187G						.						89.0	90.0	90.0					8																	107782232		2203	4300	6503	SO:0001583	missense	137735	exon1			GTTTAGGAGCTTG	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.187C>G	8.37:g.107782232G>C	ENSP00000311436:p.Pro63Ala	573.0	0.0		354.0	32.0	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	G	1.608	-0.524884	0.04141	.	.	ENSG00000174429	ENST00000311955	D	0.92446	-3.04	5.66	0.368	0.16146	.	0.804396	0.11835	N	0.524850	D	0.85124	0.5625	L	0.50333	1.59	0.09310	N	1	B	0.27068	0.167	B	0.24269	0.052	T	0.71269	-0.4643	10	0.31617	T	0.26	0.172	0.8137	0.01098	0.3794:0.1161:0.2683:0.2362	.	63	Q8N0Z2	ABRA_HUMAN	A	63	ENSP00000311436:P63A	ENSP00000311436:P63A	P	-	1	0	ABRA	107851408	0.000000	0.05858	0.008000	0.14137	0.330000	0.28571	0.103000	0.15292	0.030000	0.15379	-0.150000	0.13652	CCT	.		0.607	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
AHNAK2	113146	hgsc.bcm.edu;bcgsc.ca	37	14	105419292	105419292	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr14:105419292C>A	ENST00000333244.5	-	7	2615	c.2496G>T	c.(2494-2496)aaG>aaT	p.K832N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	832						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCATTTTGAACTTGCTGTCTT	0.622																																					p.K832N		.											.	AHNAK2	47	0			c.G2496T						.						236.0	259.0	252.0					14																	105419292		1956	4145	6101	SO:0001583	missense	113146	exon7			TTTGAACTTGCTG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2496G>T	14.37:g.105419292C>A	ENSP00000353114:p.Lys832Asn	323.0	0.0		228.0	13.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	8.580	0.882016	0.17467	.	.	ENSG00000185567	ENST00000333244	T	0.01871	4.59	4.02	2.13	0.27403	.	.	.	.	.	T	0.11367	0.0277	M	0.87328	2.875	0.21184	N	0.999764	D	0.76494	0.999	D	0.81914	0.995	T	0.16512	-1.0400	9	0.20519	T	0.43	.	9.0866	0.36586	0.0:0.7193:0.0:0.2807	.	832	Q8IVF2	AHNK2_HUMAN	N	832	ENSP00000353114:K832N	ENSP00000353114:K832N	K	-	3	2	AHNAK2	104490337	0.000000	0.05858	0.558000	0.28319	0.017000	0.09413	-0.608000	0.05641	0.187000	0.20147	-1.579000	0.00862	AAG	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ARHGAP10	79658	hgsc.bcm.edu;bcgsc.ca	37	4	148886196	148886196	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr4:148886196G>A	ENST00000336498.3	+	17	1711	c.1472G>A	c.(1471-1473)cGt>cAt	p.R491H	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.R140H	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	1254					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CCAGAATCTCGTGTTAATGCG	0.308																																					p.R491H		.											.	ARHGAP10	229	0			c.G1472A						.						78.0	76.0	77.0					4																	148886196		2203	4300	6503	SO:0001583	missense	79658	exon17			AATCTCGTGTTAA	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1472G>A	4.37:g.148886196G>A	ENSP00000336923:p.Arg491His	561.0	0.0		466.0	23.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	37	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634973	0.67130	.	.	ENSG00000071205	ENST00000336498;ENST00000414545	T;T	0.22743	1.94;1.94	5.55	5.55	0.83447	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	H	0.97465	4.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.991;0.996	T	0.78548	-0.2162	10	0.87932	D	0	.	19.5156	0.95162	0.0:0.0:1.0:0.0	.	72;140;491	Q86T21;E7EUW5;A1A4S6	.;.;RHG10_HUMAN	H	491;140	ENSP00000336923:R491H;ENSP00000406624:R140H	ENSP00000336923:R491H	R	+	2	0	ARHGAP10	149105646	1.000000	0.71417	0.961000	0.40146	0.122000	0.20287	9.059000	0.93902	2.611000	0.88343	0.561000	0.74099	CGT	.		0.308	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	
CCDC185	164127	hgsc.bcm.edu;bcgsc.ca	37	1	223568584	223568584	+	Silent	SNP	C	C	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:223568584C>T	ENST00000366875.3	+	1	1870	c.1767C>T	c.(1765-1767)ctC>ctT	p.L589L		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		589										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		TCCAGAAGCTCCCTCAGGCCT	0.557																																					p.L589L		.											.	C1orf65	91	0			c.C1767T						.						65.0	64.0	64.0					1																	223568584		2203	4300	6503	SO:0001819	synonymous_variant	164127	exon1			GAAGCTCCCTCAG																												ENST00000366875.3:c.1767C>T	1.37:g.223568584C>T		138.0	0.0		115.0	9.0	NM_152610	Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	37	CCDS1537.1																																																																																			.		0.557	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
C6orf106	64771	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	34574641	34574641	+	Silent	SNP	A	A	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:34574641A>C	ENST00000374023.3	-	4	795	c.552T>G	c.(550-552)ctT>ctG	p.L184L	C6orf106_ENST00000374026.3_Silent_p.L118L|C6orf106_ENST00000374021.1_Silent_p.L110L	NM_024294.2	NP_077270.1	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106	184										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10						TTACTCCTAAAAGTCCACCCA	0.468																																					p.L184L		.											.	C6orf106	93	0			c.T552G						.						73.0	65.0	68.0					6																	34574641		2203	4300	6503	SO:0001819	synonymous_variant	64771	exon4			TCCTAAAAGTCCA	AF052106	CCDS4795.1, CCDS4796.1	6p21.31	2012-01-27			ENSG00000196821	ENSG00000196821			21215	protein-coding gene	gene with protein product		612217					Standard	XM_005249298		Approved	FLJ22195, dJ391O22.4	uc003ojr.2	Q9H6K1	OTTHUMG00000014553	ENST00000374023.3:c.552T>G	6.37:g.34574641A>C		91.0	0.0		67.0	8.0	NM_024294	B2R8K7|Q5VV77|Q96MG5|Q9BUR9	Silent	SNP	ENST00000374023.3	37	CCDS4796.1																																																																																			.		0.468	C6orf106-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040251.1	NM_022758	
CTHRC1	115908	hgsc.bcm.edu;bcgsc.ca	37	8	104388131	104388131	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:104388131T>A	ENST00000330295.5	+	2	458	c.316T>A	c.(316-318)Tac>Aac	p.Y106N	CTHRC1_ENST00000415886.2_Missense_Mutation_p.Y106N|CTHRC1_ENST00000520880.1_5'Flank|CTHRC1_ENST00000520337.1_Missense_Mutation_p.Y92N	NM_138455.3	NP_612464.1	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	106					cell migration (GO:0016477)|cochlea morphogenesis (GO:0090103)|establishment of planar polarity involved in neural tube closure (GO:0090177)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|ossification involved in bone remodeling (GO:0043932)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein binding (GO:0032092)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				endometrium(1)|large_intestine(5)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			GACACCCAACTACAAGCAGTG	0.433																																					p.Y106N		.											.	CTHRC1	91	0			c.T316A						.						65.0	62.0	63.0					8																	104388131		2203	4300	6503	SO:0001583	missense	115908	exon2			CCCAACTACAAGC	BC014245	CCDS6299.1, CCDS59110.1	8q22.3	2008-08-07			ENSG00000164932	ENSG00000164932			18831	protein-coding gene	gene with protein product		610635				15618538	Standard	NM_138455		Approved		uc003ylk.4	Q96CG8	OTTHUMG00000164887	ENST00000330295.5:c.316T>A	8.37:g.104388131T>A	ENSP00000330523:p.Tyr106Asn	147.0	0.0		143.0	8.0	NM_138455	G3V141|Q6UW91|Q8IX63	Missense_Mutation	SNP	ENST00000330295.5	37	CCDS6299.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717135	0.68844	.	.	ENSG00000164932	ENST00000330295;ENST00000415886;ENST00000520337;ENST00000297577	T;D;T	0.97066	-0.09;-4.23;0.93	5.69	5.69	0.88448	.	0.113131	0.64402	D	0.000007	D	0.96996	0.9019	L	0.36672	1.1	0.80722	D	1	D;P	0.76494	0.999;0.734	P;B	0.62014	0.897;0.133	D	0.97670	1.0166	10	0.59425	D	0.04	-13.2529	15.9482	0.79809	0.0:0.0:0.0:1.0	.	106;106	E7EVQ5;Q96CG8	.;CTHR1_HUMAN	N	106;106;92;92	ENSP00000330523:Y106N;ENSP00000416045:Y106N;ENSP00000430550:Y92N	ENSP00000297577:Y92N	Y	+	1	0	CTHRC1	104457307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.166000	0.68216	0.477000	0.44152	TAC	.		0.433	CTHRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380792.1	NM_138455	
DCSTAMP	81501	bcgsc.ca;mdanderson.org	37	8	105360964	105360964	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:105360964G>A	ENST00000297581.2	+	2	233	c.184G>A	c.(184-186)Gct>Act	p.A62T	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.A62T|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	62	Poly-Ala. {ECO:0000255}.				cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CATAGCGGCCGCTGCCTCCTG	0.507																																					p.A62T		.											.	.	.	0			c.G184A						.						131.0	120.0	124.0					8																	105360964		2203	4300	6503	SO:0001583	missense	81501	exon2			GCGGCCGCTGCCT	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.184G>A	8.37:g.105360964G>A	ENSP00000297581:p.Ala62Thr	457.0	0.0		323.0	18.0	NM_001257317	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	7.740	0.701009	0.15172	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.30182	1.54	5.84	-11.7	0.00046	.	1.847400	0.01832	N	0.034757	T	0.12347	0.0300	N	0.12182	0.205	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.06338	-1.0832	9	.	.	.	2.7823	5.6546	0.17635	0.5878:0.146:0.178:0.0883	.	62	Q9H295	TM7S4_HUMAN	T	62	ENSP00000297581:A62T	.	A	+	1	0	TM7SF4	105430140	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.120000	0.03273	-2.683000	0.00407	-0.302000	0.09304	GCT	.		0.507	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
GUSB	2990	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	65439983	65439983	+	Missense_Mutation	SNP	C	C	A	rs561880652	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:65439983C>A	ENST00000304895.4	-	6	1118	c.988G>T	c.(988-990)Gct>Tct	p.A330S	GUSB_ENST00000345660.6_Intron|GUSB_ENST00000476486.1_5'Flank|GUSB_ENST00000421103.1_Missense_Mutation_p.A184S	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	330					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						TTGGTGACAGCCACAGTGCGG	0.557													C|||	2	0.000399361	0.0	0.0	5008	,	,		21048	0.0		0.0	False		,,,				2504	0.002				p.A330S		.											.	GUSB	90	0			c.G988T						.						108.0	101.0	104.0					7																	65439983		2203	4300	6503	SO:0001583	missense	2990	exon6			TGACAGCCACAGT	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.988G>T	7.37:g.65439983C>A	ENSP00000302728:p.Ala330Ser	144.0	1.0		111.0	14.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	C	5.473	0.272346	0.10349	.	.	ENSG00000169919	ENST00000304895;ENST00000421103	D;D	0.95518	-3.73;-3.73	4.9	1.83	0.25207	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.689176	0.15020	N	0.285080	D	0.87140	0.6103	N	0.13198	0.31	0.80722	D	1	B;B	0.22346	0.068;0.006	B;B	0.29176	0.086;0.099	T	0.76260	-0.3024	10	0.06625	T	0.88	.	6.1047	0.20067	0.0:0.3614:0.4486:0.19	.	184;330	E9PCV0;P08236	.;BGLR_HUMAN	S	330;184	ENSP00000302728:A330S;ENSP00000391390:A184S	ENSP00000302728:A330S	A	-	1	0	GUSB	65077418	0.414000	0.25408	0.856000	0.33681	0.043000	0.13939	1.027000	0.30115	0.638000	0.30545	-0.291000	0.09656	GCT	.		0.557	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
GUSB	2990	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	65440043	65440043	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:65440043G>A	ENST00000304895.4	-	6	1058	c.928C>T	c.(928-930)Cag>Tag	p.Q310*	GUSB_ENST00000345660.6_Intron|GUSB_ENST00000476486.1_5'UTR|GUSB_ENST00000421103.1_Nonsense_Mutation_p.Q164*	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	310					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						AGTGACGTCTGTGCAGTCAGC	0.607																																					p.Q310X		.											.	GUSB	90	0			c.C928T						.						70.0	64.0	66.0					7																	65440043		2203	4300	6503	SO:0001587	stop_gained	2990	exon6			ACGTCTGTGCAGT	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.928C>T	7.37:g.65440043G>A	ENSP00000302728:p.Gln310*	80.0	0.0		68.0	9.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Nonsense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376815	0.82682	.	.	ENSG00000169919	ENST00000304895;ENST00000421103	.	.	.	4.99	1.04	0.20106	.	0.888310	0.09996	N	0.729024	.	.	.	.	.	.	0.38947	D	0.958264	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	9.8986	0.41334	0.0:0.3697:0.3767:0.2536	.	.	.	.	X	310;164	.	ENSP00000302728:Q310X	Q	-	1	0	GUSB	65077478	0.937000	0.31787	0.003000	0.11579	0.219000	0.24729	1.931000	0.40134	0.005000	0.14708	0.511000	0.50034	CAG	.		0.607	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
HIF1A	3091	hgsc.bcm.edu;bcgsc.ca	37	14	62207716	62207716	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr14:62207716A>T	ENST00000337138.4	+	12	2168	c.1903A>T	c.(1903-1905)Att>Ttt	p.I635F	HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000557538.1_Missense_Mutation_p.I576F|HIF1A_ENST00000539097.1_Missense_Mutation_p.I659F|HIF1A_ENST00000394997.1_Missense_Mutation_p.I636F|HIF1A_ENST00000323441.6_Missense_Mutation_p.I635F|RP11-618G20.1_ENST00000555937.1_RNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	635	ID.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TATGGAAGACATTAAAATATT	0.408																																					p.I659F		.											.	HIF1A	1149	0			c.A1975T						.						108.0	100.0	103.0					14																	62207716		2203	4300	6503	SO:0001583	missense	3091	exon12			GAAGACATTAAAA	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1903A>T	14.37:g.62207716A>T	ENSP00000338018:p.Ile635Phe	235.0	0.0		158.0	9.0	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	A	8.810	0.935036	0.18206	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.72	2.13	0.27403	.	3.176880	0.00628	N	0.000473	T	0.30916	0.0780	N	0.19112	0.55	0.30200	N	0.798702	B;B;B	0.26809	0.16;0.16;0.16	B;B;B	0.26693	0.072;0.072;0.072	T	0.21381	-1.0247	10	0.15952	T	0.53	.	2.0923	0.03660	0.4959:0.1201:0.2679:0.1161	.	636;635;635	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	F	386;576;635;636;635;576;659	ENSP00000338018:I635F;ENSP00000378446:I636F;ENSP00000323326:I635F;ENSP00000451696:I576F;ENSP00000437955:I659F	ENSP00000323326:I635F	I	+	1	0	HIF1A	61277469	0.902000	0.30710	0.996000	0.52242	0.898000	0.52572	0.814000	0.27239	0.187000	0.20147	-0.256000	0.11100	ATT	.		0.408	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
HMCN1	83872	bcgsc.ca;mdanderson.org	37	1	186007150	186007150	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:186007150C>A	ENST00000271588.4	+	37	6063	c.5834C>A	c.(5833-5835)gCt>gAt	p.A1945D	HMCN1_ENST00000367492.2_Missense_Mutation_p.A1945D	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1945	Ig-like C2-type 17.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGTAAGGCAGCTGGAAATCCT	0.398																																					p.A1945D		.											.	HMCN1	113	0			c.C5834A						.						140.0	134.0	136.0					1																	186007150		2203	4300	6503	SO:0001583	missense	83872	exon37			AGGCAGCTGGAAA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5834C>A	1.37:g.186007150C>A	ENSP00000271588:p.Ala1945Asp	234.0	1.0		215.0	19.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.568365	0.28003	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67345	-0.26;-0.26	5.52	5.52	0.82312	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.406062	0.28192	N	0.016246	T	0.52175	0.1718	N	0.03238	-0.38	0.29889	N	0.825357	P	0.49253	0.921	P	0.51193	0.662	T	0.52396	-0.8581	10	0.24483	T	0.36	.	13.7184	0.62712	0.0:0.9241:0.0:0.0758	.	1945	Q96RW7	HMCN1_HUMAN	D	1945	ENSP00000271588:A1945D;ENSP00000356462:A1945D	ENSP00000271588:A1945D	A	+	2	0	HMCN1	184273773	0.224000	0.23674	0.372000	0.25991	0.191000	0.23601	2.161000	0.42358	2.597000	0.87782	0.555000	0.69702	GCT	.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMGB3	3149	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	X	150155724	150155724	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chrX:150155724A>T	ENST00000325307.7	+	4	510	c.414A>T	c.(412-414)gaA>gaT	p.E138D	HMGB3_ENST00000448905.2_Missense_Mutation_p.E138D	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	138					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					ATGACAGTGAAAAGCAGCCTT	0.488																																					p.E138D		.											.	HMGB3	226	0			c.A414T						.						47.0	45.0	46.0					X																	150155724		2203	4297	6500	SO:0001583	missense	3149	exon4			CAGTGAAAAGCAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.414A>T	X.37:g.150155724A>T	ENSP00000359393:p.Glu138Asp	219.0	0.0		158.0	11.0	NM_005342	O95556|Q6NS40	Missense_Mutation	SNP	ENST00000325307.7	37	CCDS35428.1	.	.	.	.	.	.	.	.	.	.	a	5.724	0.318006	0.10845	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905;ENST00000430118	D;D;D;D;D	0.95342	-3.68;-3.68;-3.68;-3.68;-3.68	5.05	-3.08	0.05347	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.127237	0.52532	D	0.000079	T	0.81341	0.4802	N	0.02192	-0.645	0.41426	D	0.987836	B	0.19200	0.034	B	0.24848	0.056	T	0.66763	-0.5841	10	0.02654	T	1	.	15.3324	0.74223	0.2667:0.0:0.7333:0.0	.	138	O15347	HMGB3_HUMAN	D	138	ENSP00000410354:E138D;ENSP00000359393:E138D;ENSP00000405601:E138D;ENSP00000442758:E138D;ENSP00000417027:E138D	ENSP00000359393:E138D	E	+	3	2	HMGB3	149906382	0.619000	0.27059	0.765000	0.31456	0.990000	0.78478	-0.130000	0.10498	-0.793000	0.04475	0.430000	0.28490	GAA	.		0.488	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060867.1	NM_005342	
IFT57	55081	hgsc.bcm.edu;bcgsc.ca	37	3	107937444	107937444	+	Silent	SNP	T	T	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr3:107937444T>C	ENST00000264538.3	-	3	679	c.432A>G	c.(430-432)gtA>gtG	p.V144V		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	144					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			GAACATAGCATACATGTTCTC	0.338																																					p.V144V		.											.	IFT57	227	0			c.A432G						.						69.0	70.0	69.0					3																	107937444		2203	4300	6503	SO:0001819	synonymous_variant	55081	exon3			ATAGCATACATGT	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.432A>G	3.37:g.107937444T>C		393.0	0.0		307.0	13.0	NM_018010	Q96DA9	Silent	SNP	ENST00000264538.3	37	CCDS2951.1																																																																																			.		0.338	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
NCL	4691	hgsc.bcm.edu;mdanderson.org	37	2	232325423	232325423	+	Missense_Mutation	SNP	A	A	T	rs375194579		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:232325423A>T	ENST00000322723.4	-	4	1008	c.768T>A	c.(766-768)gaT>gaA	p.D256E	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	256	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		cttcatcatcatcatcttcat	0.433																																					p.D256E		.											.	NCL	230	0			c.T768A						.						238.0	199.0	212.0					2																	232325423		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCATCATCATCT		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.768T>A	2.37:g.232325423A>T	ENSP00000318195:p.Asp256Glu	474.0	0.0		385.0	35.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	37	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	A	0.085	-1.176650	0.01646	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.41400	1.0	4.86	-9.72	0.00515	.	1.228550	0.05655	N	0.585809	T	0.09379	0.0231	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05500	-1.0881	10	0.06365	T	0.9	0.1898	3.4755	0.07583	0.235:0.3943:0.2326:0.1382	.	256	P19338	NUCL_HUMAN	E	256;148	ENSP00000318195:D256E	ENSP00000318195:D256E	D	-	3	2	NCL	232033667	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.904000	0.00091	-3.318000	0.00188	-2.212000	0.00299	GAT	.		0.433	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
OBSCN	84033	hgsc.bcm.edu;bcgsc.ca	37	1	228495849	228495849	+	Silent	SNP	G	G	T	rs562134549		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:228495849G>T	ENST00000422127.1	+	47	12548	c.12504G>T	c.(12502-12504)gcG>gcT	p.A4168A	OBSCN_ENST00000284548.11_Silent_p.A4168A|OBSCN_ENST00000366707.4_Silent_p.A1802A|OBSCN_ENST00000570156.2_Silent_p.A5125A|OBSCN_ENST00000366709.4_Silent_p.A1287A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4168					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGTTGATGCGGAGGTGACGG	0.602																																					p.A5125A		.											.	OBSCN	403	0			c.G15375T						.						88.0	101.0	97.0					1																	228495849		2160	4257	6417	SO:0001819	synonymous_variant	84033	exon58			TGATGCGGAGGTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12504G>T	1.37:g.228495849G>T		168.0	0.0		129.0	9.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.602	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PIGO	84720	ucsc.edu;bcgsc.ca	37	9	35093208	35093208	+	Splice_Site	SNP	T	T	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr9:35093208T>C	ENST00000378617.3	-	6	1334		c.e6-2		PIGO_ENST00000361778.2_Splice_Site|PIGO_ENST00000298004.5_Splice_Site|PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000341666.3_Splice_Site	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CTCTGGCTCCTAAAGGAAAAT	0.512																																					.		.											.	PIGO	290	0			c.940-2A>G						.						36.0	35.0	36.0					9																	35093208		2203	4300	6503	SO:0001630	splice_region_variant	84720	exon7			GGCTCCTAAAGGA	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.940-2A>G	9.37:g.35093208T>C		47.0	0.0		42.0	4.0	NM_152850	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Splice_Site	SNP	ENST00000378617.3	37	CCDS6575.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261708	0.59431	.	.	ENSG00000165282	ENST00000298004;ENST00000378617;ENST00000341666;ENST00000361778	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8615	0.79026	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIGO	35083208	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	6.581000	0.74045	2.333000	0.79357	0.533000	0.62120	.	.		0.512	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	Intron
ORM1	5004	hgsc.bcm.edu;bcgsc.ca	37	9	117086341	117086341	+	Missense_Mutation	SNP	C	C	T	rs369031896	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr9:117086341C>T	ENST00000259396.8	+	3	379	c.301C>T	c.(301-303)Cgg>Tgg	p.R101W	ORM1_ENST00000477456.1_3'UTR|ORM1_ENST00000538816.1_3'UTR	NM_000607.2	NP_000598.2	P02763	A1AG1_HUMAN	orosomucoid 1	101					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|large_intestine(4)|lung(2)	8		Myeloproliferative disorder(63;0.163)			Abiraterone(DB05812)|Acenocoumarol(DB01418)|Ajmaline(DB01426)|Alfentanil(DB00802)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aprindine(DB01429)|Bupropion(DB01156)|Canagliflozin(DB08907)|Celecoxib(DB00482)|Chlorpromazine(DB00477)|Desipramine(DB01151)|Disopyramide(DB00280)|Doxazosin(DB00590)|Doxepin(DB01142)|Erlotinib(DB00530)|Fluoxetine(DB00472)|Gefitinib(DB00317)|Imatinib(DB00619)|Imipramine(DB00458)|Ivacaftor(DB08820)|Maprotiline(DB00934)|Mirabegron(DB08893)|Nateglinide(DB00731)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxycodone(DB00497)|Penbutolol(DB01359)|Pethidine(DB00454)|Phenprocoumon(DB00946)|Pitavastatin(DB08860)|Prazosin(DB00457)|Propranolol(DB00571)|Quinidine(DB00908)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Tamsulosin(DB00706)|Telaprevir(DB05521)|Thalidomide(DB01041)|Trazodone(DB00656)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Vismodegib(DB08828)|Warfarin(DB00682)	GAATGTCCAGCGGGAAAATGG	0.542													C|||	3	0.000599042	0.0	0.0029	5008	,	,		23625	0.001		0.0	False		,,,				2504	0.0				p.R101W		.											.	ORM1	90	0			c.C301T						.						145.0	153.0	150.0					9																	117086341		2203	4300	6503	SO:0001583	missense	5004	exon3			GTCCAGCGGGAAA		CCDS6803.1	9q32	2013-09-19			ENSG00000229314	ENSG00000229314		"""Lipocalins"""	8498	protein-coding gene	gene with protein product		138600					Standard	NM_000607		Approved		uc004bik.4	P02763	OTTHUMG00000021012	ENST00000259396.8:c.301C>T	9.37:g.117086341C>T	ENSP00000259396:p.Arg101Trp	286.0	0.0		240.0	10.0	NM_000607	B7ZKQ5|Q5T539|Q5U067|Q8TC16	Missense_Mutation	SNP	ENST00000259396.8	37	CCDS6803.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970570	0.53614	.	.	ENSG00000229314	ENST00000259396	T	0.09911	2.93	3.39	-5.93	0.02254	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.276047	0.33980	N	0.004361	T	0.09069	0.0224	M	0.73217	2.22	0.09310	N	1	D	0.60575	0.988	B	0.43536	0.423	T	0.04386	-1.0955	10	0.87932	D	0	-13.5568	2.0689	0.03609	0.4308:0.2335:0.2344:0.1013	.	101	P02763	A1AG1_HUMAN	W	101	ENSP00000259396:R101W	ENSP00000259396:R101W	R	+	1	2	ORM1	116126162	0.000000	0.05858	0.000000	0.03702	0.226000	0.24999	-0.878000	0.04192	-1.151000	0.02836	0.313000	0.20887	CGG	.		0.542	ORM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055426.1		
OLFML2A	169611	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	9	127561615	127561615	+	Missense_Mutation	SNP	C	C	A	rs533587628	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr9:127561615C>A	ENST00000373580.3	+	4	514	c.514C>A	c.(514-516)Cgc>Agc	p.R172S	OLFML2A_ENST00000288815.5_5'Flank	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	172					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						GGACAGCGTGCGCCACCTCAG	0.597																																					p.R172S		.											.	OLFML2A	68	0			c.C514A						.						45.0	51.0	49.0					9																	127561615		2157	4275	6432	SO:0001583	missense	169611	exon4			AGCGTGCGCCACC	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.514C>A	9.37:g.127561615C>A	ENSP00000362682:p.Arg172Ser	159.0	0.0		125.0	10.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	37	CCDS6857.2	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861208	0.32884	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580	T;T	0.44083	0.93;0.93	5.67	3.76	0.43208	.	0.489979	0.22803	N	0.055449	T	0.31009	0.0783	L	0.44542	1.39	0.80722	D	1	P;B	0.36392	0.551;0.395	B;B	0.34489	0.184;0.062	T	0.03202	-1.1061	10	0.19147	T	0.46	.	10.8651	0.46851	0.1204:0.661:0.2186:0.0	.	136;172	Q5JTM7;Q68BL7	.;OLM2A_HUMAN	S	136;136;172	ENSP00000336425:R136S;ENSP00000362682:R172S	ENSP00000336425:R136S	R	+	1	0	OLFML2A	126601436	0.683000	0.27633	1.000000	0.80357	0.691000	0.40173	1.032000	0.30178	2.681000	0.91329	0.655000	0.94253	CGC	.		0.597	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
PRPF31	26121	ucsc.edu;bcgsc.ca	37	19	54631459	54631459	+	Silent	SNP	A	A	G			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr19:54631459A>G	ENST00000321030.4	+	10	1306	c.957A>G	c.(955-957)gaA>gaG	p.E319E	AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000419967.1_Silent_p.E319E|PRPF31_ENST00000391755.1_Intron|PRPF31_ENST00000498612.1_3'UTR	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	319	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGGGCTACGAACTGAAGGATG	0.667																																					p.E319E		.											.	PRPF31	91	0			c.A957G						.						32.0	28.0	30.0					19																	54631459		2033	4045	6078	SO:0001819	synonymous_variant	26121	exon10			CTACGAACTGAAG	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.957A>G	19.37:g.54631459A>G		76.0	1.0		46.0	4.0	NM_015629	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Silent	SNP	ENST00000321030.4	37	CCDS12879.1																																																																																			.		0.667	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141417.2		
PTPRZ1	5803	bcgsc.ca;mdanderson.org	37	7	121684477	121684477	+	Splice_Site	SNP	A	A	G			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:121684477A>G	ENST00000393386.2	+	23	6350	c.5939A>G	c.(5938-5940)gAg>gGg	p.E1980G	PTPRZ1_ENST00000449182.1_Splice_Site_p.E1113G	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1980	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TTTTGCCAGGAGCAATATGTC	0.383																																					p.E1980G		.											.	PTPRZ1	699	0			c.A5939G						.						183.0	169.0	174.0					7																	121684477		2203	4300	6503	SO:0001630	splice_region_variant	5803	exon23			GCCAGGAGCAATA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5938-1A>G	7.37:g.121684477A>G		446.0	1.0		404.0	22.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.584806	0.86748	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	D;D	0.85013	-1.93;-1.93	5.65	5.65	0.86999	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000003	D	0.92264	0.7546	M	0.77313	2.365	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	0.999;0.993;1.0	D	0.93199	0.6590	10	0.87932	D	0	.	15.8828	0.79216	1.0:0.0:0.0:0.0	.	1119;1113;1980	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	G	1980;1113	ENSP00000377047:E1980G;ENSP00000410000:E1113G	ENSP00000377047:E1980G	E	+	2	0	PTPRZ1	121471713	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.339000	0.96797	2.152000	0.67230	0.533000	0.62120	GAG	.		0.383	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	Missense_Mutation
SGTB	54557	hgsc.bcm.edu;bcgsc.ca	37	5	64976616	64976616	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr5:64976616G>A	ENST00000381007.4	-	7	720	c.485C>T	c.(484-486)gCc>gTc	p.A162V		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	162										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		GGCAGTGAGGGCCAGCCTGAA	0.353																																					p.A162V		.											.	SGTB	90	0			c.C485T						.						71.0	69.0	70.0					5																	64976616		2203	4300	6503	SO:0001583	missense	54557	exon7			GTGAGGGCCAGCC	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.485C>T	5.37:g.64976616G>A	ENSP00000370395:p.Ala162Val	182.0	0.0		136.0	9.0	NM_019072		Missense_Mutation	SNP	ENST00000381007.4	37	CCDS3988.1	.	.	.	.	.	.	.	.	.	.	G	34	5.356958	0.95854	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.67171	-0.25;-0.25	5.31	5.31	0.75309	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.114435	0.64402	D	0.000014	D	0.82504	0.5051	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.83842	0.0258	10	0.56958	D	0.05	-26.1574	18.9824	0.92760	0.0:0.0:1.0:0.0	.	162	Q96EQ0	SGTB_HUMAN	V	162	ENSP00000370395:A162V;ENSP00000421447:A162V	ENSP00000370395:A162V	A	-	2	0	SGTB	65012372	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.444000	0.97578	2.496000	0.84212	0.557000	0.71058	GCC	.		0.353	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072	
SHKBP1	92799	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41089577	41089577	+	Silent	SNP	G	G	A	rs373580394		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr19:41089577G>A	ENST00000291842.5	+	12	1168	c.1119G>A	c.(1117-1119)gcG>gcA	p.A373A	SHKBP1_ENST00000600733.1_Silent_p.A348A	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	373					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGGACCCAGCGGAGGATGGGG	0.632																																					p.A373A		.											.	SHKBP1	92	0			c.G1119A						.	G		0,4406		0,0,2203	130.0	115.0	120.0		1119	-11.1	0.0	19		120	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	SHKBP1	NM_138392.3		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		373/708	41089577	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	92799	exon12			CCCAGCGGAGGAT	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1119G>A	19.37:g.41089577G>A		174.0	0.0		105.0	11.0	NM_138392	Q8N2I6|Q8WY93|Q96IB8	Silent	SNP	ENST00000291842.5	37	CCDS12560.1																																																																																			.		0.632	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
SON	6651	hgsc.bcm.edu;bcgsc.ca	37	21	34925206	34925206	+	Silent	SNP	T	T	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr21:34925206T>A	ENST00000356577.4	+	3	4144	c.3669T>A	c.(3667-3669)ccT>ccA	p.P1223P	SON_ENST00000290239.6_Silent_p.P1223P|SON_ENST00000381679.4_Silent_p.P1223P|SON_ENST00000300278.4_Silent_p.P1223P|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1223					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TTTCGGAGCCTTCAGCAGTGC	0.493																																					p.P1223P		.											.	SON	97	0			c.T3669A						.						153.0	156.0	155.0					21																	34925206		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			GGAGCCTTCAGCA	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3669T>A	21.37:g.34925206T>A		282.0	0.0		237.0	14.0	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	5.392	0.257602	0.10239	.	.	ENSG00000159140	ENST00000436227	.	.	.	5.42	4.25	0.50352	.	.	.	.	.	T	0.55016	0.1894	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	.	5.6107	0.17404	0.0:0.0869:0.1746:0.7385	.	.	.	.	H	218	.	.	L	+	2	0	SON	33847076	0.879000	0.30193	0.882000	0.34594	0.509000	0.34042	1.139000	0.31504	0.875000	0.35847	0.460000	0.39030	CTT	.		0.493	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SPTA1	6708	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	158651408	158651408	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:158651408G>A	ENST00000368147.4	-	4	620	c.440C>T	c.(439-441)aCc>aTc	p.T147I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	147					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTCTCCAGGGTCAGCTCTAA	0.547																																					p.T147I		.											.	SPTA1	142	0			c.C440T						.						132.0	135.0	134.0					1																	158651408		2011	4166	6177	SO:0001583	missense	6708	exon4			TCCAGGGTCAGCT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.440C>T	1.37:g.158651408G>A	ENSP00000357129:p.Thr147Ile	281.0	0.0		224.0	16.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	9.380	1.072843	0.20147	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48836	0.8;0.8	5.15	3.25	0.37280	.	.	.	.	.	T	0.24470	0.0593	M	0.65677	2.01	0.35854	D	0.826973	B	0.10296	0.003	B	0.18561	0.022	T	0.06881	-1.0802	9	0.23302	T	0.38	.	6.9641	0.24613	0.3221:0.0:0.6779:0.0	.	147	P02549	SPTA1_HUMAN	I	147	ENSP00000357130:T147I;ENSP00000357129:T147I	ENSP00000357129:T147I	T	-	2	0	SPTA1	156918032	0.999000	0.42202	0.960000	0.40013	0.347000	0.29111	3.240000	0.51368	1.401000	0.46761	0.563000	0.77884	ACC	.		0.547	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
TNRC6C	57690	ucsc.edu;bcgsc.ca	37	17	76060811	76060811	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr17:76060811G>A	ENST00000588061.1	+	6	3131	c.2404G>A	c.(2404-2406)Ggc>Agc	p.G802S	RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000541771.1_Missense_Mutation_p.G802S|TNRC6C_ENST00000544502.1_Missense_Mutation_p.G799S|TNRC6C_ENST00000588847.1_Missense_Mutation_p.G799S|TNRC6C_ENST00000301624.4_Missense_Mutation_p.G802S|TNRC6C_ENST00000335749.4_Missense_Mutation_p.G799S			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	802	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGTTTCATCAGGCTGGGGAGA	0.403																																					p.G802S		.											.	TNRC6C	24	0			c.G2404A						.						57.0	57.0	57.0					17																	76060811		1829	4099	5928	SO:0001583	missense	57690	exon5			TCATCAGGCTGGG	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2404G>A	17.37:g.76060811G>A	ENSP00000468647:p.Gly802Ser	71.0	0.0		39.0	4.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693013	0.68271	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.19669	2.39;2.13;2.13;2.39	5.66	4.69	0.59074	.	0.225797	0.45606	D	0.000359	T	0.26448	0.0646	M	0.69823	2.125	0.80722	D	1	B;P;P	0.42296	0.4;0.775;0.5	B;B;B	0.41412	0.121;0.356;0.173	T	0.06180	-1.0841	10	0.17832	T	0.49	-7.1825	14.5741	0.68232	0.0707:0.0:0.9293:0.0	.	799;802;802	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	S	802;799;799;802;802;799	ENSP00000336783:G799S;ENSP00000301624:G802S;ENSP00000440310:G802S;ENSP00000442421:G799S	ENSP00000301624:G802S	G	+	1	0	TNRC6C	73572406	1.000000	0.71417	0.930000	0.37139	0.996000	0.88848	9.415000	0.97375	1.397000	0.46682	0.655000	0.94253	GGC	.		0.403	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
UHRF1BP1	54887	bcgsc.ca;mdanderson.org	37	6	34802105	34802105	+	Silent	SNP	C	C	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:34802105C>A	ENST00000192788.5	+	5	621	c.450C>A	c.(448-450)ctC>ctA	p.L150L	UHRF1BP1_ENST00000452449.2_Silent_p.L150L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	150							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TGTGGCAGCTCCAGGGCTATA	0.517																																					p.L150L		.											.	UHRF1BP1	93	0			c.C450A						.						66.0	64.0	65.0					6																	34802105		1983	4154	6137	SO:0001819	synonymous_variant	54887	exon5			GCAGCTCCAGGGC	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.450C>A	6.37:g.34802105C>A		285.0	1.0		223.0	20.0	NM_017754	Q9NXE0	Silent	SNP	ENST00000192788.5	37	CCDS43455.1																																																																																			.		0.517	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
URI1	8725	hgsc.bcm.edu;bcgsc.ca	37	19	30476164	30476164	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr19:30476164G>A	ENST00000542441.2	+	3	484	c.187G>A	c.(187-189)Gaa>Aaa	p.E63K	URI1_ENST00000360605.4_Missense_Mutation_p.E45K|URI1_ENST00000392271.1_5'UTR|URI1_ENST00000312051.6_Missense_Mutation_p.E23K			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	63					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TGCCCTTCGAGAAAGACTCAG	0.279																																					p.E63K		.											.	.	.	0			c.G187A						.						188.0	196.0	193.0					19																	30476164		2203	4300	6503	SO:0001583	missense	8725	exon3			CTTCGAGAAAGAC	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.187G>A	19.37:g.30476164G>A	ENSP00000442436:p.Glu63Lys	359.0	0.0		263.0	15.0	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	37	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035399	0.93630	.	.	ENSG00000105176	ENST00000360605;ENST00000542441;ENST00000312051	T;T	0.46451	0.87;0.87	4.8	4.8	0.61643	Prefoldin (1);Prefoldin subunit (1);	0.049109	0.85682	D	0.000000	T	0.55465	0.1922	L	0.43152	1.355	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.69824	0.96;0.958;0.966	T	0.53041	-0.8494	10	0.38643	T	0.18	-19.7679	16.0247	0.80536	0.0:0.0:1.0:0.0	.	23;63;61	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	K	61;63;23	ENSP00000442436:E63K;ENSP00000312530:E23K	ENSP00000312530:E23K	E	+	1	0	C19orf2	35168004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.082000	0.76851	2.230000	0.72887	0.563000	0.77884	GAA	.		0.279	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
ZNF638	27332	hgsc.bcm.edu;bcgsc.ca	37	2	71658550	71658550	+	Missense_Mutation	SNP	T	T	G	rs201989581		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:71658550T>G	ENST00000409544.1	+	26	6374	c.5744T>G	c.(5743-5745)gTc>gGc	p.V1915G	ZNF638_ENST00000409407.1_Missense_Mutation_p.V855G|ZNF638_ENST00000264447.4_Missense_Mutation_p.V1915G|ZNF638_ENST00000355812.3_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1915					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GCGTCTGATGTCCCTGAGGGT	0.443																																					p.V1915G		.											.	ZNF638	94	0			c.T5744G						.						48.0	47.0	47.0					2																	71658550		2203	4300	6503	SO:0001583	missense	27332	exon26			CTGATGTCCCTGA	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5744T>G	2.37:g.71658550T>G	ENSP00000386433:p.Val1915Gly	404.0	0.0		292.0	12.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.714121	0.48622	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.34072	1.38;1.38;1.78	4.87	2.38	0.29361	.	0.747498	0.11444	N	0.563489	T	0.34395	0.0896	L	0.29908	0.895	0.33958	D	0.645225	P;P	0.49783	0.928;0.546	P;B	0.50659	0.647;0.205	T	0.45131	-0.9282	10	0.66056	D	0.02	0.1063	7.1578	0.25647	0.0:0.189:0.0:0.811	.	1915;1915	Q14966-3;Q14966	.;ZN638_HUMAN	G	1915;1915;855	ENSP00000264447:V1915G;ENSP00000386433:V1915G;ENSP00000386813:V855G	ENSP00000264447:V1915G	V	+	2	0	ZNF638	71512058	0.550000	0.26489	0.722000	0.30670	0.991000	0.79684	0.518000	0.22847	0.390000	0.25115	0.392000	0.25879	GTC	T|0.999;C|0.001		0.443	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
USP40	55230	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	2	234394446	234394446	+	Silent	SNP	G	G	A	rs542793420		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:234394446G>A	ENST00000427112.2	-	28	3407	c.3372C>T	c.(3370-3372)ccC>ccT	p.P1124P	USP40_ENST00000496298.1_5'UTR|USP40_ENST00000251722.6_Silent_p.P1124P|USP40_ENST00000450966.1_Silent_p.P1136P			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1124					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		CGAACTTTTCGGGAAAGTATT	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		18876	0.001		0.0	False		,,,				2504	0.0				p.P1136P		.											.	USP40	455	0			c.C3408T						.						24.0	27.0	26.0					2																	234394446		1875	4098	5973	SO:0001819	synonymous_variant	55230	exon28			CTTTTCGGGAAAG	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3372C>T	2.37:g.234394446G>A		438.0	0.0		335.0	21.0	NM_018218	Q6NX38|Q70EL0	Silent	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312564	0.23908	.	.	ENSG00000085982	ENST00000454354	T	0.34072	1.38	5.75	-2.8	0.05823	.	0.636347	0.17268	N	0.180514	T	0.36853	0.0982	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33574	-0.9863	7	0.62326	D	0.03	.	4.7274	0.12948	0.4326:0.0:0.3385:0.2289	.	.	.	.	L	92	ENSP00000394133:P92L	ENSP00000394133:P92L	P	-	2	0	USP40	234059185	0.357000	0.24938	0.954000	0.39281	0.965000	0.64279	-0.372000	0.07504	-0.444000	0.07170	-1.000000	0.02509	CCG	.		0.512	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
