#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	1051263	1051263	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:1051263A>T	ENST00000263094.6	+	20	3025	c.2794A>T	c.(2794-2796)Aag>Tag	p.K932*	ABCA7_ENST00000435683.2_Nonsense_Mutation_p.K794*|ABCA7_ENST00000433129.1_Nonsense_Mutation_p.K932*	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	932	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGTCTCCAAGCAGAGTGT	0.642																																					p.K932X		.											.	ABCA7	98	0			c.A2794T						.						51.0	49.0	50.0					19																	1051263		2190	4288	6478	SO:0001587	stop_gained	10347	exon20			GTCTCCAAGCAGA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2794A>T	19.37:g.1051263A>T	ENSP00000263094:p.Lys932*	53.0	0.0		85.0	27.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Nonsense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	A	43	10.507155	0.99418	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7119	0.51630	1.0:0.0:0.0:0.0	.	.	.	.	X	932	.	ENSP00000263094:K932X	K	+	1	0	ABCA7	1002263	1.000000	0.71417	0.622000	0.29159	0.789000	0.44602	8.712000	0.91403	1.665000	0.50811	0.374000	0.22700	AAG	.		0.642	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ABCC5	10057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183667834	183667834	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:183667834T>A	ENST00000334444.6	-	21	3264	c.3024A>T	c.(3022-3024)gcA>gcT	p.A1008A	ABCC5_ENST00000265586.6_Silent_p.A1008A	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1008	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGAAGACTCCTGCGATCATTC	0.517																																					p.A1008A		.											.	ABCC5	137	0			c.A3024T						.						59.0	67.0	64.0					3																	183667834		2067	4220	6287	SO:0001819	synonymous_variant	10057	exon21			GACTCCTGCGATC	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3024A>T	3.37:g.183667834T>A		105.0	0.0		143.0	45.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	37	CCDS43176.1																																																																																			.		0.517	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
ABHD8	79575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17412326	17412326	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:17412326T>A	ENST00000247706.3	-	2	339	c.100A>T	c.(100-102)Acc>Tcc	p.T34S	MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000600434.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	34							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						TCTACAAAGGTGTAGCCATCG	0.672																																					p.T34S	Ovarian(156;1368 2543 15275 41187)	.											.	ABHD8	90	0			c.A100T						.						18.0	22.0	21.0					19																	17412326		2192	4278	6470	SO:0001583	missense	79575	exon2			CAAAGGTGTAGCC	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.100A>T	19.37:g.17412326T>A	ENSP00000247706:p.Thr34Ser	26.0	0.0		49.0	23.0	NM_024527	Q9HAE9	Missense_Mutation	SNP	ENST00000247706.3	37	CCDS12355.1	.	.	.	.	.	.	.	.	.	.	T	11.14	1.551576	0.27739	.	.	ENSG00000127220	ENST00000247706	T	0.30182	1.54	5.24	3.0	0.34707	.	0.386165	0.29722	N	0.011368	T	0.11452	0.0279	N	0.08118	0	0.27073	N	0.963261	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	10	0.17832	T	0.49	-39.906	1.8784	0.03223	0.1671:0.0899:0.1743:0.5688	.	34	Q96I13	ABHD8_HUMAN	S	34	ENSP00000247706:T34S	ENSP00000247706:T34S	T	-	1	0	ABHD8	17273326	1.000000	0.71417	0.971000	0.41717	0.986000	0.74619	2.101000	0.41787	0.253000	0.21552	0.402000	0.26972	ACC	.		0.672	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	NM_024527	
AOAH	313	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	36633945	36633945	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:36633945C>T	ENST00000258749.5	-	12	1337	c.938G>A	c.(937-939)gGa>gAa	p.G313E	AOAH_ENST00000538464.1_Splice_Site_p.G35E|AOAH_ENST00000431169.1_Splice_Site_p.G313E|AOAH_ENST00000535891.1_Splice_Site_p.G281E	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	313					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						AGACACTTACCCAACAGTGGA	0.448																																					p.G313E		.											.	AOAH	91	0			c.G938A						.						133.0	127.0	129.0					7																	36633945		2203	4300	6503	SO:0001630	splice_region_variant	313	exon12			ACTTACCCAACAG	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.938+1G>A	7.37:g.36633945C>T		146.0	0.0		213.0	12.0	NM_001637	A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741165	0.30865	.	.	ENSG00000136250	ENST00000538464;ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.05	4.17	0.49024	Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	0.736603	0.12841	N	0.434811	T	0.26666	0.0652	.	.	.	0.39287	D	0.964669	P;P;B	0.51057	0.849;0.941;0.166	P;P;B	0.49192	0.602;0.577;0.138	T	0.03315	-1.1049	8	.	.	.	-9.2314	9.0872	0.36587	0.0:0.9015:0.0:0.0985	.	281;313;313	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	E	35;281;313;313;313	ENSP00000439283:G35E;ENSP00000441101:G281E;ENSP00000258749:G313E;ENSP00000405683:G313E	.	G	-	2	0	AOAH	36600470	0.966000	0.33281	0.779000	0.31741	0.003000	0.03518	2.282000	0.43461	1.360000	0.45960	0.557000	0.71058	GGA	.		0.448	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637	Missense_Mutation
ARAF	369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47428285	47428285	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:47428285G>T	ENST00000377045.4	+	11	1439	c.1245G>T	c.(1243-1245)caG>caT	p.Q415H		NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	415	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	AGACTGCCCAGGGCATGGAGT	0.657											OREG0019759	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q418H		.											.	ARAF	1557	0			c.G1254T						.						29.0	24.0	26.0					X																	47428285		2203	4300	6503	SO:0001583	missense	369	exon11			TGCCCAGGGCATG	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1245G>T	X.37:g.47428285G>T	ENSP00000366244:p.Gln415His	62.0	0.0	946	106.0	84.0	NM_001256196	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990746	0.74589	.	.	ENSG00000078061	ENST00000377045	D	0.83163	-1.69	5.33	4.47	0.54385	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	L	0.41356	1.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84916	0.0851	10	0.87932	D	0	.	7.5126	0.27583	0.1992:0.0:0.8008:0.0	.	415;281	P10398;B4DV85	ARAF_HUMAN;.	H	415	ENSP00000366244:Q415H	ENSP00000366244:Q415H	Q	+	3	2	ARAF	47313229	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.143000	0.64826	1.008000	0.39264	0.422000	0.28245	CAG	.		0.657	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
B4GALNT3	283358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	668557	668557	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:668557G>A	ENST00000266383.5	+	19	2871	c.2858G>A	c.(2857-2859)tGg>tAg	p.W953*		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	953					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CGAGACCGCTGGGGCGGGGAA	0.617																																					p.W953X		.											.	B4GALNT3	92	0			c.G2858A						.						88.0	94.0	92.0					12																	668557		2203	4300	6503	SO:0001587	stop_gained	283358	exon19			ACCGCTGGGGCGG	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2858G>A	12.37:g.668557G>A	ENSP00000266383:p.Trp953*	69.0	0.0		93.0	34.0	NM_173593	Q6ZNC1|Q8N7T6	Nonsense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	G	41	8.958160	0.99016	.	.	ENSG00000139044	ENST00000266383	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6164	18.2881	0.90120	0.0:0.0:1.0:0.0	.	.	.	.	X	953	.	ENSP00000266383:W953X	W	+	2	0	B4GALNT3	538818	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.809000	0.86057	2.383000	0.81215	0.462000	0.41574	TGG	.		0.617	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
BCL9	607	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	147092307	147092307	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:147092307A>T	ENST00000234739.3	+	8	3086	c.2346A>T	c.(2344-2346)agA>agT	p.R782S		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	782	Pro-rich.		R -> K (in dbSNP:rs34002844).		canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGGGCCCCAGACCATTCCTTC	0.587			T	"""IGH@, IGL@"""	B-ALL																																p.R782S		.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	707	0			c.A2346T						.						44.0	45.0	45.0					1																	147092307		2203	4300	6503	SO:0001583	missense	607	exon8			CCCCAGACCATTC	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2346A>T	1.37:g.147092307A>T	ENSP00000234739:p.Arg782Ser	66.0	1.0		120.0	33.0	NM_004326	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	A	3.671	-0.067608	0.07273	.	.	ENSG00000116128	ENST00000234739	T	0.51574	0.7	5.0	3.12	0.35913	.	0.148378	0.64402	D	0.000013	T	0.12220	0.0297	N	0.19112	0.55	0.40408	D	0.979729	B;B	0.33694	0.421;0.421	B;B	0.25291	0.059;0.059	T	0.06409	-1.0828	10	0.23891	T	0.37	-13.7937	9.2264	0.37410	0.2381:0.0:0.7619:0.0	.	782;782	Q1JQ81;O00512	.;BCL9_HUMAN	S	782	ENSP00000234739:R782S	ENSP00000234739:R782S	R	+	3	2	BCL9	145558931	1.000000	0.71417	0.707000	0.30419	0.004000	0.04260	1.869000	0.39519	0.688000	0.31529	-0.242000	0.12053	AGA	.		0.587	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
BTN2A2	10385	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26390936	26390936	+	Splice_Site	SNP	G	G	A	rs200463511		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:26390936G>A	ENST00000356709.4	+	6	1063		c.e6+1		BTN2A2_ENST00000416795.2_Splice_Site|BTN2A2_ENST00000432533.2_Splice_Site|BTN2A2_ENST00000482536.1_Splice_Site|BTN2A2_ENST00000352867.2_Splice_Site|BTN2A2_ENST00000469230.1_Splice_Site	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2						negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						GAAGAATTGCGTAAGTTTAGC	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		25369	0.0		0.0	False		,,,				2504	0.001				.		.											.	BTN2A2	90	0			c.952+1G>A						.						271.0	239.0	250.0					6																	26390936		2203	4300	6503	SO:0001630	splice_region_variant	10385	exon6			AATTGCGTAAGTT	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.952+1G>A	6.37:g.26390936G>A		513.0	2.0		694.0	199.0	NM_001197238	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Splice_Site	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341066	0.41498	.	.	ENSG00000124508	ENST00000469230;ENST00000490025;ENST00000356709;ENST00000352867;ENST00000482536;ENST00000432533;ENST00000416795;ENST00000495632	.	.	.	3.89	3.89	0.44902	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4406	0.61109	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTN2A2	26498915	1.000000	0.71417	0.976000	0.42696	0.584000	0.36387	2.998000	0.49465	2.025000	0.59659	0.552000	0.68991	.	G|0.999;A|0.001		0.388	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		Intron
CFAP61	26074	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20056165	20056165	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:20056165G>T	ENST00000245957.5	+	6	548	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000377306.1_Missense_Mutation_p.G158W|C20orf26_ENST00000451767.2_Missense_Mutation_p.G158W	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		158										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TGACCAAGTGGGGAACATCCC	0.423																																					p.G158W		.											.	C20orf26	94	0			c.G472T						.						145.0	139.0	141.0					20																	20056165		2203	4300	6503	SO:0001583	missense	26074	exon6			CAAGTGGGGAACA																												ENST00000245957.5:c.472G>T	20.37:g.20056165G>T	ENSP00000245957:p.Gly158Trp	161.0	1.0		169.0	69.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789748	0.70337	.	.	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000377303;ENST00000451767;ENST00000472660	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.9	5.9	0.94986	.	0.393691	0.26719	N	0.022852	T	0.51991	0.1707	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.97;0.992;1.0	T	0.48433	-0.9036	10	0.72032	D	0.01	.	15.7823	0.78269	0.0:0.0:1.0:0.0	.	158;158;112;158	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	W	112;158;158;158;158;158;158;54	ENSP00000345553:G112W;ENSP00000245957:G158W;ENSP00000366521:G158W;ENSP00000366518:G158W;ENSP00000414537:G158W;ENSP00000420498:G54W	ENSP00000245957:G158W	G	+	1	0	C20orf26	20004165	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	2.650000	0.46665	2.806000	0.96561	0.655000	0.94253	GGG	.		0.423	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
CALN1	83698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	71571275	71571275	+	Silent	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:71571275G>T	ENST00000329008.5	-	3	421	c.123C>A	c.(121-123)atC>atA	p.I41I	CALN1_ENST00000431984.1_Silent_p.I41I|CALN1_ENST00000405452.2_Silent_p.I41I|CALN1_ENST00000412588.1_Silent_p.I83I|CALN1_ENST00000395275.2_Silent_p.I83I|CALN1_ENST00000395276.2_Silent_p.I41I	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	41	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGGCCTCTCGGATTTCTACAA	0.522																																					p.I83I		.											.	CALN1	91	0			c.C249A						.						48.0	50.0	49.0					7																	71571275		2203	4300	6503	SO:0001819	synonymous_variant	83698	exon4			CTCTCGGATTTCT	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.123C>A	7.37:g.71571275G>T		45.0	0.0		56.0	20.0	NM_031468	J3KQA7	Silent	SNP	ENST00000329008.5	37	CCDS5541.1																																																																																			.		0.522	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320044.2	NM_031468	
CCDC108	255101	bcgsc.ca;mdanderson.org	37	2	219893116	219893116	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:219893116A>G	ENST00000341552.5	-	12	1741	c.1658T>C	c.(1657-1659)cTg>cCg	p.L553P	CCDC108_ENST00000453220.1_Missense_Mutation_p.L553P|CCDC108_ENST00000441968.1_Missense_Mutation_p.L553P|CCDC108_ENST00000409865.3_Missense_Mutation_p.L542P|CCDC108_ENST00000410037.1_Missense_Mutation_p.L488P	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	553						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCCAGGAACAGTGGGTCCTG	0.637																																					p.L553P		.											.	CCDC108	94	0			c.T1658C						.						97.0	90.0	92.0					2																	219893116		2203	4300	6503	SO:0001583	missense	255101	exon12			AGGAACAGTGGGT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.1658T>C	2.37:g.219893116A>G	ENSP00000340776:p.Leu553Pro	139.0	2.0		224.0	88.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	A	16.81	3.226929	0.58668	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000545086;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.13657	2.85;2.85;2.85;2.57;2.57	4.65	4.65	0.58169	.	0.231107	0.22183	N	0.063477	T	0.40297	0.1111	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.38265	-0.9669	10	0.56958	D	0.05	-6.3232	14.2465	0.65993	1.0:0.0:0.0:0.0	.	542;553	E9PG25;Q6ZU64	.;CC108_HUMAN	P	553;553;553;29;542;488;487	ENSP00000340776:L553P;ENSP00000413377:L553P;ENSP00000409117:L553P;ENSP00000386945:L542P;ENSP00000386258:L488P	ENSP00000340776:L553P	L	-	2	0	CCDC108	219601360	0.976000	0.34144	0.854000	0.33618	0.628000	0.37860	5.797000	0.69087	1.949000	0.56562	0.459000	0.35465	CTG	.		0.637	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
CD19	930	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28946809	28946809	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:28946809G>A	ENST00000324662.3	+	5	924	c.880G>A	c.(880-882)Gct>Act	p.A294T	CD19_ENST00000567541.1_Missense_Mutation_p.A294T|CD19_ENST00000538922.1_Missense_Mutation_p.A294T			P15391	CD19_HUMAN	CD19 molecule	294					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GAAGGTCTCAGCTGTGACTTT	0.547																																					p.A294T		.											.	CD19	92	0			c.G880A						.						318.0	243.0	269.0					16																	28946809		2197	4300	6497	SO:0001583	missense	930	exon5			GTCTCAGCTGTGA		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.880G>A	16.37:g.28946809G>A	ENSP00000313419:p.Ala294Thr	394.0	2.0		607.0	217.0	NM_001178098	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	37	CCDS10644.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287512	0.59976	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662;ENST00000537306	T;T	0.42131	0.98;0.98	5.05	5.05	0.67936	.	0.982646	0.08269	N	0.971709	T	0.45736	0.1357	L	0.46157	1.445	0.24613	N	0.993711	P;P	0.44139	0.827;0.734	B;B	0.44133	0.442;0.257	T	0.41197	-0.9522	10	0.54805	T	0.06	-0.3878	13.8988	0.63790	0.0:0.0:1.0:0.0	.	294;294	F5H635;P15391	.;CD19_HUMAN	T	294;101;294;143	ENSP00000437940:A294T;ENSP00000313419:A294T	ENSP00000313419:A294T	A	+	1	0	CD19	28854310	0.582000	0.26749	0.093000	0.20910	0.383000	0.30230	2.830000	0.48136	2.337000	0.79520	0.313000	0.20887	GCT	.		0.547	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2		
CEP135	9662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56846403	56846403	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:56846403A>T	ENST00000257287.4	+	12	1692	c.1568A>T	c.(1567-1569)cAg>cTg	p.Q523L		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	523					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAAGATATACAGTCCAATGTT	0.289																																					p.Q523L		.											.	CEP135	94	0			c.A1568T						.						71.0	74.0	73.0					4																	56846403		2203	4296	6499	SO:0001583	missense	9662	exon12			ATATACAGTCCAA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1568A>T	4.37:g.56846403A>T	ENSP00000257287:p.Gln523Leu	502.0	0.0		432.0	168.0	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.387832	0.82902	.	.	ENSG00000174799	ENST00000257287	T	0.57273	0.41	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.73187	0.3555	M	0.78801	2.425	0.58432	D	0.999995	D	0.89917	1.0	D	0.80764	0.994	T	0.74553	-0.3627	10	0.46703	T	0.11	.	16.2813	0.82687	1.0:0.0:0.0:0.0	.	523	Q66GS9	CP135_HUMAN	L	523	ENSP00000257287:Q523L	ENSP00000257287:Q523L	Q	+	2	0	CEP135	56541160	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.121000	0.71602	2.244000	0.73946	0.533000	0.62120	CAG	.		0.289	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
CEP76	79959	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	12691398	12691398	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:12691398C>A	ENST00000262127.2	-	7	1118	c.893G>T	c.(892-894)cGa>cTa	p.R298L	CEP76_ENST00000423709.2_Missense_Mutation_p.R223L|PSMG2_ENST00000585331.2_Intron	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	298					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGTGAGGGTCGAATTTGCAA	0.348																																					p.R298L		.											.	CEP76	90	0			c.G893T						.						101.0	102.0	102.0					18																	12691398		2203	4300	6503	SO:0001583	missense	79959	exon7			GAGGGTCGAATTT	BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.893G>T	18.37:g.12691398C>A	ENSP00000262127:p.Arg298Leu	162.0	1.0		205.0	101.0	NM_024899	B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Missense_Mutation	SNP	ENST00000262127.2	37	CCDS11861.1	.	.	.	.	.	.	.	.	.	.	C	34	5.373872	0.95923	.	.	ENSG00000101624	ENST00000262127;ENST00000423709	D;T	0.81499	-1.5;-1.45	5.67	5.67	0.87782	.	0.056826	0.64402	D	0.000001	D	0.90253	0.6952	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.987	D	0.87685	0.2550	10	0.31617	T	0.26	-9.0197	20.1358	0.98028	0.0:1.0:0.0:0.0	.	223;298;120	Q8TAP6-2;Q8TAP6;Q8TAP6-3	.;CEP76_HUMAN;.	L	298;223	ENSP00000262127:R298L;ENSP00000403074:R223L	ENSP00000262127:R298L	R	-	2	0	CEP76	12681398	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.776000	0.85560	2.833000	0.97629	0.585000	0.79938	CGA	.		0.348	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254611.1	NM_024899	
CHD8	57680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21878045	21878045	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:21878045G>A	ENST00000557364.1	-	11	2592	c.2329C>T	c.(2329-2331)Cgg>Tgg	p.R777W	CHD8_ENST00000430710.3_Missense_Mutation_p.R498W|CHD8_ENST00000399982.2_Missense_Mutation_p.R777W|CHD8_ENST00000555962.1_Intron			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	777	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GACTGAATCCGTTTAAATTCT	0.393																																					p.R777W		.											.	CHD8	277	0			c.C2329T						.						146.0	135.0	138.0					14																	21878045		1865	4097	5962	SO:0001583	missense	57680	exon10			GAATCCGTTTAAA	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2329C>T	14.37:g.21878045G>A	ENSP00000451601:p.Arg777Trp	331.0	0.0		311.0	30.0	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.85|18.85	3.712158|3.712158	0.68730|0.68730	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364|ENST00000555935	T;T;T|.	0.74002|.	-0.8;-0.8;-0.8|.	5.0|5.0	4.08|4.08	0.47627|0.47627	.|.	0.138303|.	0.48286|.	D|.	0.000189|.	T|T	0.58293|0.58293	0.2112|0.2112	L|L	0.42245|0.42245	1.32|1.32	0.48452|0.48452	D|D	0.999657|0.999657	D|.	0.76494|.	0.999|.	D|.	0.65987|.	0.94|.	T|T	0.55068|0.55068	-0.8198|-0.8198	10|5	0.87932|.	D|.	0|.	-16.3856|-16.3856	13.372|13.372	0.60719|0.60719	0.0:0.0:0.8411:0.1589|0.0:0.0:0.8411:0.1589	.|.	498|.	Q9HCK8-2|.	.|.	W|M	498;777;497;777|2	ENSP00000406288:R498W;ENSP00000382863:R777W;ENSP00000451601:R777W|.	ENSP00000262707:R497W|.	R|T	-|-	1|2	2|0	CHD8|CHD8	20947885|20947885	0.052000|0.052000	0.20516|0.20516	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.639000|1.639000	0.37176|0.37176	1.270000|1.270000	0.44297|0.44297	0.655000|0.655000	0.94253|0.94253	CGG|ACG	.		0.393	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57759022	57759022	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:57759022T>C	ENST00000269122.3	+	21	3538	c.3264T>C	c.(3262-3264)caT>caC	p.H1088H	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Silent_p.H1088H	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1088	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TAATTGAGCATATTGGAAACT	0.388			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.H1088H		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	835	0			c.T3264C						.						103.0	99.0	101.0					17																	57759022		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon21			TGAGCATATTGGA	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.3264T>C	17.37:g.57759022T>C		147.0	0.0		179.0	93.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	37	CCDS32696.1																																																																																			.		0.388	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
COL22A1	169044	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	139736902	139736902	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr8:139736902C>A	ENST00000303045.6	-	25	2649	c.2203G>T	c.(2203-2205)Gga>Tga	p.G735*	COL22A1_ENST00000435777.1_Nonsense_Mutation_p.G735*|COL22A1_ENST00000341807.4_5'Flank	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	735	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCGATCTCTCCAGGCAAACCC	0.597										HNSCC(7;0.00092)																											p.G735X		.											.	COL22A1	103	0			c.G2203T						.						75.0	59.0	65.0					8																	139736902		2203	4300	6503	SO:0001587	stop_gained	169044	exon25			TCTCTCCAGGCAA	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2203G>T	8.37:g.139736902C>A	ENSP00000303153:p.Gly735*	38.0	1.0		45.0	10.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Nonsense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	45	11.313755	0.99545	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	.	.	.	4.72	4.72	0.59763	.	0.144833	0.31061	U	0.008323	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.9041	0.63823	0.0:1.0:0.0:0.0	.	.	.	.	X	735;735;448	.	ENSP00000303153:G735X	G	-	1	0	COL22A1	139806084	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.651000	0.54431	2.542000	0.85734	0.655000	0.94253	GGA	.		0.597	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CRLF3	51379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29119458	29119458	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:29119458C>T	ENST00000324238.6	-	6	1083	c.959G>A	c.(958-960)aGa>aAa	p.R320K	CRLF3_ENST00000544695.1_Splice_Site_p.R204K|CTD-2349P21.9_ENST00000580085.1_lincRNA|CRLF3_ENST00000577725.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	320					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATCTACTTGCCTGAATGTTAA	0.418																																					p.R320K	Pancreas(30;346 881 29244 33464 41299)	.											.	CRLF3	90	0			c.G959A						.						114.0	110.0	112.0					17																	29119458		2203	4300	6503	SO:0001630	splice_region_variant	51379	exon6			ACTTGCCTGAATG	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.959+1G>A	17.37:g.29119458C>T		116.0	0.0		131.0	46.0	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	ENST00000324238.6	37	CCDS32607.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957192	0.53293	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.60171	0.21;0.21	5.49	5.49	0.81192	.	0.565711	0.21304	N	0.076745	T	0.44159	0.1280	N	0.17082	0.46	0.43798	D	0.996349	B	0.16396	0.017	B	0.10450	0.005	T	0.28964	-1.0027	9	.	.	.	-5.7154	19.3434	0.94355	0.0:1.0:0.0:0.0	.	320	Q8IUI8	CRLF3_HUMAN	K	320;204	ENSP00000318804:R320K;ENSP00000444188:R204K	.	R	-	2	0	CRLF3	26143584	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.595000	0.54016	2.560000	0.86352	0.591000	0.81541	AGA	.		0.418	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		Missense_Mutation
CYP4A22	284541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47610101	47610101	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:47610101A>G	ENST00000371891.3	+	7	894	c.863A>G	c.(862-864)cAc>cGc	p.H288R	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000371890.3_Silent_p.A236A|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000294337.3_Missense_Mutation_p.H288R	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	288						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGGAAGAGGCACTTGGATTTT	0.507																																					p.H288R	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22	139	0			c.A863G						.						165.0	156.0	159.0					1																	47610101		2203	4300	6503	SO:0001583	missense	284541	exon7			AGAGGCACTTGGA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.863A>G	1.37:g.47610101A>G	ENSP00000360958:p.His288Arg	325.0	1.0		435.0	176.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	a	8.716	0.913237	0.17907	.	.	ENSG00000162365	ENST00000371891;ENST00000294337	T;T	0.66280	-0.2;-0.2	1.51	1.51	0.23008	.	0.394484	0.30704	N	0.009050	T	0.29882	0.0747	N	0.02275	-0.615	0.30176	N	0.800886	B	0.13594	0.008	B	0.20577	0.03	T	0.15492	-1.0435	10	0.26408	T	0.33	.	5.6291	0.17499	0.8494:0.0:0.1506:0.0	.	288	Q5TCH4	CP4AM_HUMAN	R	288	ENSP00000360958:H288R;ENSP00000294337:H288R	ENSP00000294337:H288R	H	+	2	0	CYP4A22	47382688	0.988000	0.35896	0.620000	0.29132	0.329000	0.28539	4.808000	0.62583	0.702000	0.31825	0.163000	0.16589	CAC	.		0.507	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
DOK1	1796	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74783904	74783904	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:74783904C>A	ENST00000233668.5	+	5	1778	c.1109C>A	c.(1108-1110)cCa>cAa	p.P370Q	DOK1_ENST00000340004.6_3'UTR|M1AP_ENST00000464686.1_5'Flank|LOXL3_ENST00000264094.3_5'Flank|DOK1_ENST00000480318.1_3'UTR|LOXL3_ENST00000409986.1_5'Flank|LOXL3_ENST00000393937.2_5'Flank|DOK1_ENST00000409429.1_Missense_Mutation_p.P231Q	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	370	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GGCCTGGCCCCAGTCCCTCCC	0.582																																					p.P370Q	Esophageal Squamous(36;520 860 12502 33616 51270)	.											.	DOK1	226	0			c.C1109A						.						48.0	55.0	53.0					2																	74783904		2203	4300	6503	SO:0001583	missense	1796	exon5			TGGCCCCAGTCCC	U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.1109C>A	2.37:g.74783904C>A	ENSP00000233668:p.Pro370Gln	82.0	2.0		113.0	36.0	NM_001381	O43204|Q53TY2|Q9UHG6	Missense_Mutation	SNP	ENST00000233668.5	37	CCDS1954.1	.	.	.	.	.	.	.	.	.	.	C	7.927	0.739786	0.15642	.	.	ENSG00000115325	ENST00000409429;ENST00000233668	T;T	0.31510	1.49;1.51	4.95	4.95	0.65309	.	0.335609	0.27720	N	0.018133	T	0.23965	0.0580	L	0.38175	1.15	0.80722	D	1	B;B	0.16603	0.018;0.007	B;B	0.15870	0.014;0.014	T	0.03514	-1.1029	10	0.37606	T	0.19	-19.3602	10.7272	0.46074	0.1899:0.8101:0.0:0.0	.	359;370	B4DJN1;Q99704	.;DOK1_HUMAN	Q	231;370	ENSP00000387016:P231Q;ENSP00000233668:P370Q	ENSP00000233668:P370Q	P	+	2	0	DOK1	74637412	0.108000	0.22018	0.613000	0.29037	0.325000	0.28411	4.140000	0.58031	2.580000	0.87095	0.561000	0.74099	CCA	.		0.582	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252218.3	NM_001381	
DVL2	1856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	7129551	7129551	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:7129551T>G	ENST00000005340.5	-	15	2126	c.1844A>C	c.(1843-1845)aAg>aCg	p.K615T	DVL2_ENST00000575458.1_Missense_Mutation_p.K609T|DVL2_ENST00000574642.1_5'Flank|MIR324_ENST00000362183.1_RNA	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	615					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						ACTGCCGGACTTGGACTCGGG	0.726																																					p.K615T		.											.	DVL2	659	0			c.A1844C						.						24.0	31.0	29.0					17																	7129551		2200	4296	6496	SO:0001583	missense	1856	exon15			CCGGACTTGGACT	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1844A>C	17.37:g.7129551T>G	ENSP00000005340:p.Lys615Thr	14.0	0.0		25.0	14.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	T	11.61	1.690114	0.29962	.	.	ENSG00000004975	ENST00000005340	T	0.04234	3.67	5.49	4.35	0.52113	Dishevelled C-terminal (1);	0.397637	0.27586	N	0.018707	T	0.04318	0.0119	L	0.38175	1.15	0.36357	D	0.86045	B;B	0.18013	0.025;0.025	B;B	0.16289	0.015;0.015	T	0.35151	-0.9800	10	0.14252	T	0.57	-26.9546	10.3546	0.43956	0.0:0.0:0.1647:0.8353	.	609;615	B4DLQ0;O14641	.;DVL2_HUMAN	T	615	ENSP00000005340:K615T	ENSP00000005340:K615T	K	-	2	0	DVL2	7070275	0.884000	0.30299	1.000000	0.80357	0.961000	0.63080	1.600000	0.36762	2.080000	0.62538	0.533000	0.62120	AAG	.		0.726	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38427282	38427282	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:38427282T>A	ENST00000354891.3	+	14	2328	c.1982T>A	c.(1981-1983)tTc>tAc	p.F661Y	EGFLAM_ENST00000322350.5_Missense_Mutation_p.F661Y|EGFLAM_ENST00000397202.2_Missense_Mutation_p.F27Y|EGFLAM_ENST00000336740.6_Missense_Mutation_p.F427Y|EGFLAM-AS1_ENST00000508986.1_RNA	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	661	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGCAAAGACTTCCTGTCCATC	0.537																																					p.F661Y	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.T1982A						.						154.0	153.0	153.0					5																	38427282		2203	4300	6503	SO:0001583	missense	133584	exon14			AAGACTTCCTGTC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1982T>A	5.37:g.38427282T>A	ENSP00000346964:p.Phe661Tyr	104.0	0.0		165.0	43.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004289	0.93287	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.31	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88804	0.6536	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.993	D;D;D	0.91635	0.999;0.999;0.946	D	0.88418	0.3026	10	0.42905	T	0.14	-10.3947	16.0677	0.80897	0.0:0.0:0.0:1.0	.	427;661;661	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	Y	661;661;427;27;427	ENSP00000346964:F661Y;ENSP00000313084:F661Y;ENSP00000337607:F427Y;ENSP00000380385:F27Y	ENSP00000313084:F661Y	F	+	2	0	EGFLAM	38463039	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.635000	0.83286	2.201000	0.70794	0.533000	0.62120	TTC	.		0.537	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EIF4E3	317649	ucsc.edu;bcgsc.ca	37	3	71748795	71748795	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:71748795T>C	ENST00000425534.3	-	3	321	c.314A>G	c.(313-315)cAt>cGt	p.H105R	EIF4E3_ENST00000421769.2_5'UTR|EIF4E3_ENST00000389826.3_5'UTR|EIF4E3_ENST00000295612.3_5'UTR|EIF4E3_ENST00000448225.1_5'UTR|EIF4E3_ENST00000468147.1_Intron	NM_001134651.1	NP_001128123.1	Q8N5X7	IF4E3_HUMAN	eukaryotic translation initiation factor 4E family member 3	105					cytokine-mediated signaling pathway (GO:0019221)|regulation of translation (GO:0006417)	cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			large_intestine(1)|lung(3)	4		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)		TCTCATTAAATGATAACTACA	0.353																																					p.H105R		.											.	EIF4E3	90	0			c.A314G						.						157.0	158.0	158.0					3																	71748795		2203	4300	6503	SO:0001583	missense	317649	exon3			ATTAAATGATAAC	AK126999	CCDS33786.1, CCDS46867.1	3p14	2008-02-05	2006-11-13		ENSG00000163412	ENSG00000163412			31837	protein-coding gene	gene with protein product		609896	"""eukaryotic translation initiation factor 4E member 3"""			15153109	Standard	NM_173359		Approved	MGC39820	uc003dov.4	Q8N5X7	OTTHUMG00000158797	ENST00000425534.3:c.314A>G	3.37:g.71748795T>C	ENSP00000393324:p.His105Arg	72.0	0.0		50.0	5.0	NM_001134651	B2R963|Q6NUT1	Missense_Mutation	SNP	ENST00000425534.3	37	CCDS46867.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.435524	0.83885	.	.	ENSG00000163412	ENST00000425534	T	0.49432	0.78	5.52	5.52	0.82312	Translation Initiation factor eIF- 4e-like  domain (2);	0.000000	0.85682	D	0.000000	T	0.76765	0.4033	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83496	0.0072	10	0.72032	D	0.01	-18.2834	15.6493	0.77078	0.0:0.0:0.0:1.0	.	105	Q8N5X7	IF4E3_HUMAN	R	105	ENSP00000393324:H105R	ENSP00000393324:H105R	H	-	2	0	EIF4E3	71831485	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.542000	0.82095	2.109000	0.64355	0.402000	0.26972	CAT	.		0.353	EIF4E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352294.2	NM_173359	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	21231426	21231426	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:21231426G>A	ENST00000264211.8	-	9	1728	c.1534C>T	c.(1534-1536)Cca>Tca	p.P512S	EIF4G3_ENST00000536266.1_Missense_Mutation_p.P116S|EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000602326.1_Missense_Mutation_p.P518S|EIF4G3_ENST00000400422.1_Missense_Mutation_p.P512S|EIF4G3_ENST00000374935.3_Missense_Mutation_p.P232S|EIF4G3_ENST00000374937.3_Missense_Mutation_p.P518S|EIF4G3_ENST00000544689.1_Missense_Mutation_p.P55S	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	512					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CGATCTTTTGGTTTCTTCCAT	0.408																																					p.P518S		.											.	EIF4G3	91	0			c.C1552T						.						240.0	209.0	220.0					1																	21231426		2203	4300	6503	SO:0001583	missense	8672	exon13			CTTTTGGTTTCTT	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1534C>T	1.37:g.21231426G>A	ENSP00000264211:p.Pro512Ser	372.0	0.0		393.0	144.0	NM_001198802	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427611	0.62733	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	T;T;T;T;T;D	0.87029	2.06;2.06;2.21;2.06;2.06;-2.2	5.44	4.5	0.54988	.	0.053329	0.85682	D	0.000000	T	0.74114	0.3674	N	0.08118	0	0.80722	D	1	P;B;B;P;B	0.48589	0.847;0.278;0.04;0.912;0.232	B;B;B;B;B	0.37480	0.219;0.057;0.029;0.251;0.108	T	0.78743	-0.2085	10	0.52906	T	0.07	-5.6273	15.4333	0.75121	0.0:0.0:0.8557:0.1442	.	707;232;116;518;512	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	S	512;708;512;232;518;116;55;55	ENSP00000264211:P512S;ENSP00000383274:P512S;ENSP00000364071:P232S;ENSP00000364073:P518S;ENSP00000444693:P116S;ENSP00000444401:P55S	ENSP00000264211:P512S	P	-	1	0	EIF4G3	21104013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.553000	0.67287	1.371000	0.46172	0.557000	0.71058	CCA	.		0.408	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
ELMO2	63916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45004003	45004003	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:45004003T>C	ENST00000290246.6	-	13	1131	c.937A>G	c.(937-939)Agg>Ggg	p.R313G	ELMO2_ENST00000454865.2_Missense_Mutation_p.R45G|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000372176.1_Missense_Mutation_p.R225G|ELMO2_ENST00000352077.2_Missense_Mutation_p.R311G|ELMO2_ENST00000439931.2_Missense_Mutation_p.R325G|ELMO2_ENST00000396391.1_Missense_Mutation_p.R313G|ELMO2_ENST00000445496.2_Missense_Mutation_p.R130G	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	313	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				ATGATGTCCCTTTGAGCCTGC	0.502																																					p.R313G		.											.	ELMO2	91	0			c.A937G						.						112.0	78.0	90.0					20																	45004003		2203	4300	6503	SO:0001583	missense	63916	exon12			TGTCCCTTTGAGC	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.937A>G	20.37:g.45004003T>C	ENSP00000290246:p.Arg313Gly	152.0	0.0		206.0	76.0	NM_182764	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756808	0.69648	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077;ENST00000425546;ENST00000450812	T;T;T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.73	4.81	3.67	0.42095	Terpene synthase-like (1);Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	T	0.53642	0.1809	M	0.62723	1.935	0.80722	D	1	P;D;D;D;P	0.67145	0.785;0.996;0.985;0.974;0.943	P;D;P;P;P	0.72625	0.636;0.978;0.83;0.908;0.867	T	0.54214	-0.8327	10	0.66056	D	0.02	-14.8006	10.8249	0.46627	0.0:0.0:0.1588:0.8412	.	325;45;313;130;313	B4DRL5;B4DZ20;E9PBG2;B7Z1S8;Q96JJ3	.;.;.;.;ELMO2_HUMAN	G	313;225;313;325;130;45;311;101;313	ENSP00000290246:R313G;ENSP00000361249:R225G;ENSP00000379673:R313G;ENSP00000396519:R325G;ENSP00000409920:R130G;ENSP00000415641:R45G;ENSP00000326172:R311G;ENSP00000388962:R101G;ENSP00000416181:R313G	ENSP00000290246:R313G	R	-	1	2	ELMO2	44437410	1.000000	0.71417	0.995000	0.50966	0.776000	0.43924	4.964000	0.63701	0.828000	0.34709	0.454000	0.30748	AGG	.		0.502	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
ERCC6	2074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	50732464	50732464	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr10:50732464T>A	ENST00000355832.5	-	5	1090	c.1012A>T	c.(1012-1014)Agg>Tgg	p.R338W	ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.R338W|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.R338W|PGBD3_ENST00000603152.1_Missense_Mutation_p.R338W|PGBD3_ENST00000374127.3_5'Flank	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	338					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TGCAAAGCCCTCTTCTGGAGT	0.488								Direct reversal of damage;Nucleotide excision repair (NER)																													p.K338X		.											.	ERCC6	1153	0			c.A1012T						.						111.0	107.0	109.0					10																	50732464		2203	4300	6503	SO:0001583	missense	2074	exon5			AAGCCCTCTTCTG	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1012A>T	10.37:g.50732464T>A	ENSP00000348089:p.Arg338Trp	736.0	2.0		985.0	364.0	NM_000124	D3DX94|Q5W0L9	Nonsense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.699856	0.88924	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.83755	-1.76;3.17;3.17	6.03	3.58	0.41010	.	.	.	.	.	D	0.87273	0.6136	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.979	D;P	0.64321	0.924;0.699	D	0.87592	0.2491	9	0.66056	D	0.02	-22.645	11.924	0.52808	0.0:0.0:0.4892:0.5108	.	338;338	E7EV46;Q03468	.;ERCC6_HUMAN	W	338	ENSP00000348089:R338W;ENSP00000423550:R338W;ENSP00000387966:R338W	ENSP00000348089:R338W	R	-	1	2	ERCC6;RP11-123B3.6	50402470	0.996000	0.38824	0.994000	0.49952	0.996000	0.88848	4.072000	0.57563	1.091000	0.41335	0.533000	0.62120	AGG	.		0.488	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
EVA1B	55194	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	36788575	36788575	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:36788575G>C	ENST00000270824.1	-	2	355	c.64C>G	c.(64-66)Cgc>Ggc	p.R22G	EVA1B_ENST00000490466.1_5'UTR|RP11-268J15.5_ENST00000373137.2_5'Flank|SH3D21_ENST00000474766.1_Intron	NM_018166.1	NP_060636.1	Q9NVM1	EVA1B_HUMAN	eva-1 homolog B (C. elegans)	22						integral component of membrane (GO:0016021)											CCCTCACCGCGGATGTGCGCG	0.701																																					p.R22G		.											.	.	.	0			c.C64G						.						40.0	45.0	44.0					1																	36788575		2203	4300	6503	SO:0001583	missense	55194	exon2			CACCGCGGATGTG	AK001509	CCDS406.1	1p34.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000142694	ENSG00000142694			25558	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 78"", ""family with sequence similarity 176, member B"""	C1orf78, FAM176B		14702039	Standard	XM_005270998		Approved	FLJ10647	uc001caj.1	Q9NVM1	OTTHUMG00000007867	ENST00000270824.1:c.64C>G	1.37:g.36788575G>C	ENSP00000270824:p.Arg22Gly	175.0	1.0		256.0	82.0	NM_018166	D3DPS7	Missense_Mutation	SNP	ENST00000270824.1	37	CCDS406.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158435	0.78114	.	.	ENSG00000142694	ENST00000270824	T	0.48201	0.82	4.59	2.53	0.30540	.	0.066949	0.64402	D	0.000017	T	0.48370	0.1496	L	0.57536	1.79	0.48901	D	0.999725	P	0.52170	0.951	P	0.47744	0.556	T	0.52503	-0.8567	10	0.72032	D	0.01	.	10.318	0.43749	0.0:0.0:0.6473:0.3527	.	22	Q9NVM1	F176B_HUMAN	G	22	ENSP00000270824:R22G	ENSP00000270824:R22G	R	-	1	0	FAM176B	36561162	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.961000	0.29267	0.889000	0.36185	0.462000	0.41574	CGC	.		0.701	EVA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021689.1	NM_018166	
FAM134C	162427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	40733882	40733889	+	Frame_Shift_Del	DEL	CAGAAGTT	CAGAAGTT	-	rs546107864		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	CAGAAGTT	CAGAAGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:40733882_40733889delCAGAAGTT	ENST00000309428.5	-	9	1402_1409	c.1343_1350delAACTTCTG	c.(1342-1350)gaacttctgfs	p.ELL448fs	FAM134C_ENST00000585894.1_Frame_Shift_Del_p.ELL351fs|FAM134C_ENST00000543197.1_Frame_Shift_Del_p.ELL253fs	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	448						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		CCGACTGGTCCAGAAGTTCAAAGTCATC	0.572																																					p.448_450del		.											.	FAM134C	70	0			c.1343_1350del						.																																			SO:0001589	frameshift_variant	162427	exon9			CTGGTCCAGAAGT	BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.1343_1350delAACTTCTG	17.37:g.40733882_40733889delCAGAAGTT	ENSP00000309432:p.Glu448fs	47.0	0.0		98.0	22.0	NM_178126	B3KR75	Frame_Shift_Del	DEL	ENST00000309428.5	37	CCDS11432.1																																																																																			.		0.572	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80039104	80039104	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:80039104G>A	ENST00000306749.2	-	38	6749	c.6531C>T	c.(6529-6531)cgC>cgT	p.R2177R	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2177	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCCGCACCTCGCGCACGGACA	0.682																																					p.R2177R	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.C6531T						.						27.0	24.0	25.0					17																	80039104		2188	4286	6474	SO:0001819	synonymous_variant	2194	exon38			CACCTCGCGCACG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6531C>T	17.37:g.80039104G>A		43.0	0.0		113.0	68.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.682	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FGF20	26281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	16853235	16853235	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr8:16853235G>T	ENST00000180166.5	-	2	467	c.319C>A	c.(319-321)Ctg>Atg	p.L107M		NM_019851.2	NP_062825.1	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	107					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of cardiac muscle cell proliferation (GO:0060043)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	11				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		ATACTGACCAGTCCCACTGCC	0.338																																					p.L107M		.											.	FGF20	522	0			c.C319A						.						113.0	107.0	109.0					8																	16853235		2203	4300	6503	SO:0001583	missense	26281	exon2			TGACCAGTCCCAC	AB030648	CCDS5998.1	8p22	2008-05-15			ENSG00000078579	ENSG00000078579			3677	protein-coding gene	gene with protein product		605558				10913340	Standard	NM_019851		Approved		uc003wxc.1	Q9NP95	OTTHUMG00000096964	ENST00000180166.5:c.319C>A	8.37:g.16853235G>T	ENSP00000180166:p.Leu107Met	152.0	0.0		103.0	56.0	NM_019851	B2RPH5	Missense_Mutation	SNP	ENST00000180166.5	37	CCDS5998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.97|17.97	3.518782|3.518782	0.64634|0.64634	.|.	.|.	ENSG00000078579|ENSG00000078579	ENST00000180166|ENST00000381981	T|.	0.68479|.	-0.33|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67088|0.67088	0.2856|0.2856	L|L	0.58302|0.58302	1.8|1.8	0.58432|0.58432	D|D	0.999998|0.999998	B|.	0.32693|.	0.38|.	B|.	0.39971|.	0.315|.	T|T	0.68511|0.68511	-0.5389|-0.5389	10|6	0.66056|0.87932	D|D	0.02|0	.|.	13.4923|13.4923	0.61402|0.61402	0.0714:0.0:0.9286:0.0|0.0714:0.0:0.9286:0.0	.|.	107|.	Q9NP95|.	FGF20_HUMAN|.	M|N	107|75	ENSP00000180166:L107M|.	ENSP00000180166:L107M|ENSP00000371411:T75N	L|T	-|-	1|2	2|0	FGF20|FGF20	16897606|16897606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.808000|3.808000	0.55598|0.55598	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CTG|ACT	.		0.338	FGF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214030.1		
FGFBP1	9982	ucsc.edu;bcgsc.ca	37	4	15937856	15937856	+	Missense_Mutation	SNP	C	C	T	rs143214990	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:15937856C>T	ENST00000382333.1	-	3	694	c.400G>A	c.(400-402)Gtg>Atg	p.V134M	FGFBP1_ENST00000259988.2_Missense_Mutation_p.V134M	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	134					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						CTGGTTTTCACAGCTGTCTTG	0.448																																					p.V134M		.											.	FGFBP1	90	0			c.G400A						.						91.0	90.0	91.0					4																	15937856		2203	4300	6503	SO:0001583	missense	9982	exon3			TTTTCACAGCTGT	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.400G>A	4.37:g.15937856C>T	ENSP00000371770:p.Val134Met	397.0	2.0		445.0	181.0	NM_005130	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	37	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512110	0.27036	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.14893	2.47;2.47	5.65	1.92	0.25849	.	0.222940	0.37809	N	0.001940	T	0.11024	0.0269	L	0.29908	0.895	0.22213	N	0.999282	P	0.40266	0.71	B	0.37198	0.243	T	0.13548	-1.0505	10	0.66056	D	0.02	-2.2716	7.3664	0.26776	0.1509:0.2705:0.5787:0.0	.	134	Q14512	FGFP1_HUMAN	M	134	ENSP00000371770:V134M;ENSP00000259988:V134M	ENSP00000259988:V134M	V	-	1	0	FGFBP1	15546954	0.998000	0.40836	0.064000	0.19789	0.003000	0.03518	1.322000	0.33689	0.048000	0.15891	-0.178000	0.13098	GTG	C|0.999;G|0.001		0.448	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130	
FILIP1	27145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	76024218	76024218	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:76024218T>A	ENST00000237172.7	-	5	1660	c.1330A>T	c.(1330-1332)Aag>Tag	p.K444*	FILIP1_ENST00000393004.2_Nonsense_Mutation_p.K444*|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Nonsense_Mutation_p.K345*	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	444										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GATTTACTCTTGCTAAATGCT	0.408																																					p.K444X		.											.	FILIP1	94	0			c.A1330T						.						141.0	142.0	142.0					6																	76024218		2203	4300	6503	SO:0001587	stop_gained	27145	exon5			TACTCTTGCTAAA	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1330A>T	6.37:g.76024218T>A	ENSP00000237172:p.Lys444*	457.0	1.0		662.0	328.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Nonsense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	T	38	6.803656	0.97849	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	.	.	.	5.65	3.07	0.35406	.	0.221173	0.45867	D	0.000329	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.2141	12.2983	0.54860	0.0:0.0:0.2768:0.7232	.	.	.	.	X	444;444;345	.	ENSP00000237172:K444X	K	-	1	0	FILIP1	76080938	0.800000	0.28916	1.000000	0.80357	0.942000	0.58702	0.942000	0.29017	1.057000	0.40506	0.533000	0.62120	AAG	.		0.408	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
FNIP2	57600	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	159790073	159790073	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:159790073A>T	ENST00000264433.6	+	13	2360	c.2285A>T	c.(2284-2286)cAg>cTg	p.Q762L	FNIP2_ENST00000379346.3_Missense_Mutation_p.Q785L	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	762	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CAGGACCCGCAGGTTTCTAGG	0.532																																					p.Q762L		.											.	FNIP2	68	0			c.A2285T						.						45.0	50.0	49.0					4																	159790073		1933	4140	6073	SO:0001583	missense	57600	exon13			ACCCGCAGGTTTC	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2285A>T	4.37:g.159790073A>T	ENSP00000264433:p.Gln762Leu	59.0	1.0		99.0	39.0	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199874	0.38905	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.24908	1.83;1.83	5.55	-4.96	0.03038	.	1.330380	0.04524	N	0.385205	T	0.22820	0.0551	M	0.74258	2.255	0.09310	N	1	B	0.28933	0.228	B	0.24394	0.053	T	0.25882	-1.0119	9	.	.	.	.	2.2785	0.04108	0.3484:0.2244:0.3184:0.1087	.	762	Q9P278	FNIP2_HUMAN	L	762;785	ENSP00000264433:Q762L;ENSP00000368651:Q785L	.	Q	+	2	0	FNIP2	160009523	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.484000	0.22308	-0.736000	0.04831	-1.127000	0.01993	CAG	.		0.532	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
FPGT	8790	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	74671212	74671212	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:74671212G>T	ENST00000609362.1	+	4	1518	c.1481G>T	c.(1480-1482)gGa>gTa	p.G494V	FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT_ENST00000370894.5_3'UTR|FPGT_ENST00000534056.1_Missense_Mutation_p.G240V|FPGT-TNNI3K_ENST00000557284.2_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT_ENST00000524915.1_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT_ENST00000370898.3_Missense_Mutation_p.G507V|FPGT-TNNI3K_ENST00000370893.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	494					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						CAATTCTTTGGAGTCTGTTTC	0.368																																					p.G494V		.											.	FPGT	91	0			c.G1481T						.						102.0	95.0	97.0					1																	74671212		2203	4300	6503	SO:0001583	missense	8790	exon4			TCTTTGGAGTCTG	AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1481G>T	1.37:g.74671212G>T	ENSP00000476680:p.Gly494Val	214.0	1.0		206.0	72.0	NM_003838	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	CCDS663.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276437	0.59649	.	.	ENSG00000254685	ENST00000370898;ENST00000534056	T;T	0.45668	0.89;0.89	5.1	5.1	0.69264	L-fucokinase (1);	.	.	.	.	T	0.61123	0.2322	M	0.77616	2.38	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.65294	-0.6203	9	0.56958	D	0.05	.	18.5201	0.90948	0.0:0.0:1.0:0.0	.	240;119;494	E9PNQ2;B4E2Y7;O14772	.;.;FPGT_HUMAN	V	494;240	ENSP00000359935:G494V;ENSP00000432819:G240V	ENSP00000359935:G494V	G	+	2	0	TNNI3K	74443800	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.434000	0.97515	2.351000	0.79841	0.563000	0.77884	GGA	.		0.368	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GATA3-AS1	399717	broad.mit.edu;mdanderson.org	37	10	8093125	8093125	+	lincRNA	SNP	G	G	T	rs563461889	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr10:8093125G>T	ENST00000418270.1	+	0	0				RP11-379F12.3_ENST00000458727.1_lincRNA|GATA3-AS1_ENST00000355358.1_lincRNA																							GGGCGGGTGGGAGGGACTTGC	0.612																																					.		.											.	.	.	0			.						.						13.0	15.0	14.0					10																	8093125		1876	4106	5982			399717	.			GGGTGGGAGGGAC																													10.37:g.8093125G>T		139.0	2.0		216.0	98.0	.		RNA	SNP	ENST00000418270.1	37																																																																																				.		0.612	RP11-379F12.4-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000046724.1		
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	89910835	89910835	+	Splice_Site	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:89910835C>A	ENST00000405460.2	+	2	302	c.206C>A	c.(205-207)tCg>tAg	p.S69*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	69	Calx-beta 1. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GCAATTGTATCGGTAAGAAAT	0.308																																					p.S69X		.											.	GPR98	103	0			c.C206A						.						46.0	41.0	43.0					5																	89910835		1804	4056	5860	SO:0001630	splice_region_variant	84059	exon2			TTGTATCGGTAAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.207+1C>A	5.37:g.89910835C>A		227.0	0.0		110.0	63.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.034704	0.93575	.	.	ENSG00000164199	ENST00000508842;ENST00000405460;ENST00000296619;ENST00000399043	.	.	.	5.98	5.98	0.97165	.	0.167402	0.48286	D	0.000194	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	15.2005	0.73132	0.1408:0.8592:0.0:0.0	.	.	.	.	X	73;69;69;69	.	ENSP00000296619:S69X	S	+	2	0	GPR98	89946591	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.714000	0.47202	2.838000	0.97847	0.591000	0.81541	TCG	.		0.308	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Nonsense_Mutation
HOXD4	3233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	177017653	177017653	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:177017653G>C	ENST00000306324.3	+	2	1163	c.751G>C	c.(751-753)Gac>Cac	p.D251H	MIR10B_ENST00000385011.1_RNA|HOXD3_ENST00000468418.3_5'UTR	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	251					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		CCACCACACGGACCTGACGAC	0.627																																					p.D251H		.											.	HOXD4	91	0			c.G751C						.						70.0	77.0	75.0					2																	177017653		2203	4300	6503	SO:0001583	missense	3233	exon2			CACACGGACCTGA		CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.751G>C	2.37:g.177017653G>C	ENSP00000302548:p.Asp251His	86.0	0.0		138.0	52.0	NM_014621	B2R9R3|Q96AU0	Missense_Mutation	SNP	ENST00000306324.3	37	CCDS2269.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988556	0.74589	.	.	ENSG00000170166	ENST00000306324	D	0.91011	-2.77	5.67	5.67	0.87782	.	1.924890	0.02868	N	0.131199	D	0.95529	0.8547	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	D	0.85832	0.1392	10	0.87932	D	0	.	19.7626	0.96329	0.0:0.0:1.0:0.0	.	251	P09016	HXD4_HUMAN	H	251	ENSP00000302548:D251H	ENSP00000302548:D251H	D	+	1	0	HOXD4	176725899	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.914000	0.87478	2.676000	0.91093	0.561000	0.74099	GAC	.		0.627	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2		
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	160454027	160454027	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:160454027G>T	ENST00000356956.1	+	9	1247	c.1099G>T	c.(1099-1101)Gga>Tga	p.G367*		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	367					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GAATGTCTGTGGAGAAACTGA	0.338																																					p.G367X		.											.	IGF2R	118	0			c.G1099T						.						92.0	97.0	96.0					6																	160454027		2203	4300	6503	SO:0001587	stop_gained	3482	exon9			GTCTGTGGAGAAA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1099G>T	6.37:g.160454027G>T	ENSP00000349437:p.Gly367*	143.0	0.0		197.0	59.0	NM_000876	Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	36	5.629446	0.96671	.	.	ENSG00000197081	ENST00000356956	.	.	.	4.81	4.81	0.61882	.	0.113164	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-17.0764	16.4499	0.83976	0.0:0.0:1.0:0.0	.	.	.	.	X	367	.	ENSP00000349437:G367X	G	+	1	0	IGF2R	160374017	1.000000	0.71417	0.459000	0.27081	0.120000	0.20174	4.843000	0.62838	2.386000	0.81285	0.655000	0.94253	GGA	.		0.338	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
ITPK1	3705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	93483123	93483123	+	Silent	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:93483123C>T	ENST00000267615.6	-	4	317	c.144G>A	c.(142-144)gaG>gaA	p.E48E	ITPK1_ENST00000556954.1_5'UTR|ITPK1_ENST00000555495.1_5'UTR|ITPK1_ENST00000354313.3_Silent_p.E48E|ITPK1_ENST00000556603.2_Silent_p.E48E			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	48					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GGCCCTGCTCCTCGATCGGCC	0.582																																					p.E48E		.											.	ITPK1	115	0			c.G144A						.						110.0	91.0	98.0					14																	93483123		2203	4300	6503	SO:0001819	synonymous_variant	3705	exon4			CTGCTCCTCGATC	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.144G>A	14.37:g.93483123C>T		47.0	0.0		71.0	34.0	NM_001142593	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	37	CCDS9907.1																																																																																			.		0.582	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
KCNJ12	3768	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	21319449	21319449	+	Silent	SNP	G	G	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:21319449G>C	ENST00000583088.1	+	3	1690	c.795G>C	c.(793-795)gtG>gtC	p.V265V	KCNJ12_ENST00000331718.5_Silent_p.V265V	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	265					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TCTTTCTGGTGTCGCCCATCA	0.607										Prostate(3;0.18)																											p.V265V		.											.	.	.	0			c.G795C						.						125.0	93.0	104.0					17																	21319449		2203	4300	6503	SO:0001819	synonymous_variant	100134444	exon3			TCTGGTGTCGCCC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.795G>C	17.37:g.21319449G>C		136.0	1.0		184.0	34.0	NM_001194958	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1																																																																																			.		0.607	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
KHSRP	8570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6416830	6416830	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:6416830C>T	ENST00000398148.3	-	13	1338	c.1246G>A	c.(1246-1248)Ggc>Agc	p.G416S	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	416	Gly-rich.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TTGCCTTGGCCTCTTCCTCGG	0.662																																					p.G416S	Colon(55;593 1006 2067 9135 22980)	.											.	KHSRP	226	0			c.G1246A						.						17.0	20.0	19.0					19																	6416830		1939	4123	6062	SO:0001583	missense	8570	exon13			CTTGGCCTCTTCC	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1246G>A	19.37:g.6416830C>T	ENSP00000381216:p.Gly416Ser	31.0	0.0		34.0	14.0	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637286	0.87760	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	T	0.54071	0.59	5.53	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	L	0.48642	1.525	0.58432	D	0.999999	D	0.61080	0.989	P	0.61722	0.893	T	0.60042	-0.7340	10	0.37606	T	0.19	.	13.5826	0.61911	0.0:0.9229:0.0:0.0771	.	416	Q92945	FUBP2_HUMAN	S	416	ENSP00000381216:G416S	ENSP00000201886:G416S	G	-	1	0	KHSRP	6367830	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	5.811000	0.69187	1.301000	0.44836	0.655000	0.94253	GGC	.		0.662	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123274094	123274094	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:123274094G>A	ENST00000264501.4	+	81	14258	c.13885G>A	c.(13885-13887)Gta>Ata	p.V4629I	KIAA1109_ENST00000388738.3_Missense_Mutation_p.V4629I			Q2LD37	K1109_HUMAN	KIAA1109	4629					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTGGCCTGGAGTATTGAAGGT	0.418																																					p.V4629I		.											.	KIAA1109	80	0			c.G13885A						.						163.0	156.0	158.0					4																	123274094		1998	4182	6180	SO:0001583	missense	84162	exon79			CCTGGAGTATTGA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13885G>A	4.37:g.123274094G>A	ENSP00000264501:p.Val4629Ile	121.0	0.0		152.0	52.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741024	0.89573	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.50277	0.75;0.75;0.75	5.98	5.98	0.97165	Fragile site-associated protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.79108	0.98;0.992	T	0.55939	-0.8061	10	0.32370	T	0.25	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	4628;4629	Q2LD37-4;Q2LD37	.;K1109_HUMAN	I	4629;4629;1298;230	ENSP00000264501:V4629I;ENSP00000373390:V4629I;ENSP00000410874:V1298I	ENSP00000264501:V4629I	V	+	1	0	KIAA1109	123493544	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	GTA	.		0.418	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
KIAA2026	158358	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5922996	5922996	+	Silent	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr9:5922996C>T	ENST00000399933.3	-	8	2999	c.3000G>A	c.(2998-3000)caG>caA	p.Q1000Q	KIAA2026_ENST00000381461.2_Silent_p.Q970Q	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1000										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TGGTCCCTTTCTGGAGAGTAG	0.428																																					p.Q1000Q		.											.	KIAA2026	92	0			c.G3000A						.						117.0	111.0	113.0					9																	5922996		1891	4116	6007	SO:0001819	synonymous_variant	158358	exon8			CCCTTTCTGGAGA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3000G>A	9.37:g.5922996C>T		316.0	2.0		356.0	112.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.428	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KIF19	124602	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	72343926	72343926	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:72343926G>A	ENST00000389916.4	+	9	1073	c.935G>A	c.(934-936)gGa>gAa	p.G312E		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	312	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GACTCTCTGGGAGGAAACAGC	0.637																																					p.G312E		.											.	KIF19	90	0			c.G935A						.						80.0	46.0	58.0					17																	72343926		2202	4286	6488	SO:0001583	missense	124602	exon9			CTCTGGGAGGAAA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.935G>A	17.37:g.72343926G>A	ENSP00000374566:p.Gly312Glu	26.0	0.0		50.0	13.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921765	0.73213	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.76448	-1.02;-1.02	5.68	5.68	0.88126	Kinesin, motor domain (4);	.	.	.	.	D	0.90920	0.7146	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.969;0.969	D;D;D;P	0.91635	0.98;0.999;0.918;0.891	D	0.92383	0.5915	9	0.87932	D	0	.	18.629	0.91352	0.0:0.0:1.0:0.0	.	312;270;270;312	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	E	270;312	ENSP00000449134:G270E;ENSP00000374566:G312E	ENSP00000374566:G312E	G	+	2	0	KIF19	69855521	1.000000	0.71417	0.995000	0.50966	0.292000	0.27327	9.336000	0.96533	2.705000	0.92388	0.556000	0.70494	GGA	.		0.637	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	245847619	245847619	+	Silent	SNP	G	G	A	rs201075952		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:245847619G>A	ENST00000407071.2	+	11	2783	c.2343G>A	c.(2341-2343)gcG>gcA	p.A781A	KIF26B_ENST00000366518.4_Silent_p.A400A	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	781	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCTCGGCCGCGGTCGGGAGCT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18869	0.0		0.001	False		,,,				2504	0.0				p.A781A		.											.	KIF26B	25	0			c.G2343A						.						56.0	61.0	59.0					1																	245847619		2060	4183	6243	SO:0001819	synonymous_variant	55083	exon11			GGCCGCGGTCGGG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2343G>A	1.37:g.245847619G>A		68.0	0.0		124.0	42.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	37	CCDS44342.1																																																																																			G|0.999;A|0.001		0.577	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KL	9365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	33638123	33638123	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:33638123A>G	ENST00000380099.3	+	5	2847	c.2839A>G	c.(2839-2841)Att>Gtt	p.I947V	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	947	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TTACAGGAAAATTATTGACAG	0.453																																					p.I947V		.											.	KL	155	0			c.A2839G						.						124.0	124.0	124.0					13																	33638123		2203	4300	6503	SO:0001583	missense	9365	exon5			AGGAAAATTATTG	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2839A>G	13.37:g.33638123A>G	ENSP00000369442:p.Ile947Val	322.0	0.0		225.0	51.0	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.707815	0.48412	.	.	ENSG00000133116	ENST00000380099	T	0.27890	1.64	5.52	4.32	0.51571	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.111045	0.64402	D	0.000011	T	0.32071	0.0817	L	0.48260	1.515	0.50313	D	0.999868	P	0.41597	0.756	P	0.44647	0.456	T	0.02179	-1.1200	10	0.28530	T	0.3	-10.3003	12.5759	0.56363	0.8611:0.1389:0.0:0.0	.	947	Q9UEF7	KLOT_HUMAN	V	947	ENSP00000369442:I947V	ENSP00000369442:I947V	I	+	1	0	KL	32536123	1.000000	0.71417	0.817000	0.32601	0.948000	0.59901	6.653000	0.74382	0.893000	0.36288	0.533000	0.62120	ATT	.		0.453	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
KLHL33	123103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20897958	20897958	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:20897958G>T	ENST00000344581.4	-	2	1099	c.877C>A	c.(877-879)Ctc>Atc	p.L293I		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	293												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		TTATACCTGAGAGTTGAAGCC	0.577																																					p.L293I		.											.	.	.	0			c.C877A						.						45.0	42.0	43.0					14																	20897958		692	1591	2283	SO:0001583	missense	123103	exon2			ACCTGAGAGTTGA		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.877C>A	14.37:g.20897958G>T	ENSP00000341549:p.Leu293Ile	66.0	0.0		76.0	24.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	37	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.313218	0.23908	.	.	ENSG00000185271	ENST00000344581	T	0.67345	-0.26	4.88	3.98	0.46160	Kelch-type beta propeller (1);	0.236080	0.37393	N	0.002104	T	0.58380	0.2118	L	0.54323	1.7	0.43522	D	0.995796	B	0.19817	0.039	B	0.18871	0.023	T	0.59193	-0.7500	10	0.72032	D	0.01	.	7.2719	0.26262	0.1953:0.0:0.8047:0.0	.	293	A6NCF5	KLH33_HUMAN	I	293	ENSP00000341549:L293I	ENSP00000341549:L293I	L	-	1	0	KLHL33	19967798	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.174000	0.50847	1.256000	0.44068	0.655000	0.94253	CTC	.		0.577	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
KRT28	162605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38955214	38955214	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:38955214A>G	ENST00000306658.7	-	2	553	c.488T>C	c.(487-489)cTg>cCg	p.L163P		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				ATCAATCTGCAGAATGACATT	0.328																																					p.L163P	Melanoma(19;789 869 15380 26882 39836)	.											.	KRT28	91	0			c.T488C						.						111.0	114.0	113.0					17																	38955214		2203	4299	6502	SO:0001583	missense	162605	exon2			ATCTGCAGAATGA	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.488T>C	17.37:g.38955214A>G	ENSP00000305263:p.Leu163Pro	595.0	0.0		782.0	217.0	NM_181535		Missense_Mutation	SNP	ENST00000306658.7	37	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	A	19.71	3.877625	0.72294	.	.	ENSG00000173908	ENST00000306658	T	0.73789	-0.78	5.36	5.36	0.76844	Filament (1);	0.000000	0.47093	D	0.000254	D	0.91250	0.7242	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94285	0.7523	10	0.87932	D	0	.	14.8194	0.70059	1.0:0.0:0.0:0.0	.	163	Q7Z3Y7	K1C28_HUMAN	P	163	ENSP00000305263:L163P	ENSP00000305263:L163P	L	-	2	0	KRT28	36208740	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.494000	0.90477	2.162000	0.67917	0.533000	0.62120	CTG	.		0.328	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
KRT78	196374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53237937	53237937	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:53237937G>A	ENST00000304620.4	-	6	1050	c.987C>T	c.(985-987)atC>atT	p.I329I	KRT78_ENST00000359499.4_Silent_p.I219I	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	329	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						GTAGCTGAGAGATCTGGACTT	0.517																																					p.I329I		.											.	KRT78	188	0			c.C987T						.						203.0	187.0	193.0					12																	53237937		2203	4300	6503	SO:0001819	synonymous_variant	196374	exon6			CTGAGAGATCTGG	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.987C>T	12.37:g.53237937G>A		289.0	0.0		402.0	152.0	NM_173352	A8K4D6|Q5HYM7|Q7RTT2	Silent	SNP	ENST00000304620.4	37	CCDS8840.1																																																																																			.		0.517	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
LAT	27040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	29001267	29001267	+	Silent	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:29001267C>A	ENST00000360872.5	+	10	801	c.723C>A	c.(721-723)tcC>tcA	p.S241S	LAT_ENST00000395456.2_Silent_p.S212S|LAT_ENST00000354453.4_Silent_p.S231S|LAT_ENST00000564277.1_Silent_p.S211S|LAT_ENST00000566177.1_Silent_p.S240S|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000454369.2_Silent_p.S211S|LAT_ENST00000395461.3_Silent_p.S248S|RP11-264B17.3_ENST00000569969.1_RNA			O43561	LAT_HUMAN	linker for activation of T cells	241					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CCCTGAGTTCCCAGGAGGCAG	0.632																																					p.S248S		.											.	LAT	44	0			c.C744A						.						71.0	68.0	69.0					16																	29001267		2197	4300	6497	SO:0001819	synonymous_variant	27040	exon12			GAGTTCCCAGGAG	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.723C>A	16.37:g.29001267C>A		95.0	0.0		161.0	53.0	NM_001014989	B7WPI0|C7C5T6|G5E9K3|O43919	Silent	SNP	ENST00000360872.5	37	CCDS10647.1																																																																																			.		0.632	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
LCP2	3937	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169697820	169697820	+	Silent	SNP	G	G	A	rs561432915	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:169697820G>A	ENST00000046794.5	-	7	1041	c.426C>T	c.(424-426)gaC>gaT	p.D142D		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	142					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CATAATCCGCGTCATCTTCCA	0.532													G|||	2	0.000399361	0.0	0.0	5008	,	,		18877	0.001		0.0	False		,,,				2504	0.001				p.D142D		.											.	LCP2	23	0			c.C426T						.						91.0	112.0	105.0					5																	169697820		2164	4257	6421	SO:0001819	synonymous_variant	3937	exon7			ATCCGCGTCATCT		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.426C>T	5.37:g.169697820G>A		242.0	1.0		348.0	124.0	NM_005565	A8KA25|Q53XV4	Silent	SNP	ENST00000046794.5	37	CCDS47339.1																																																																																			.		0.532	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
NPIPB5	100132247	broad.mit.edu;bcgsc.ca	37	16	22545898	22545898	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:22545898A>C	ENST00000517539.1	+	8	1669	c.1594A>C	c.(1594-1596)Aca>Cca	p.T532P	NPIPB5_ENST00000415654.1_3'UTR|NPIPB5_ENST00000424340.1_Missense_Mutation_p.T532P			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	532	Pro-rich.					integral component of membrane (GO:0016021)											TAATATCAAGACACCTGCCGA	0.597																																					p.T532P		.											.	.	.	0			c.A1594C						.						10.0	7.0	8.0					16																	22545898		685	1572	2257	SO:0001583	missense	0	exon7			ATCAAGACACCTG		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1594A>C	16.37:g.22545898A>C	ENSP00000430633:p.Thr532Pro	53.0	1.0		104.0	23.0	NM_001135865	B4DK13	Missense_Mutation	SNP	ENST00000517539.1	37	CCDS45443.1	.	.	.	.	.	.	.	.	.	.	.	7.815	0.716460	0.15306	.	.	ENSG00000243716	ENST00000415833;ENST00000424340;ENST00000342168;ENST00000503072;ENST00000517539;ENST00000528249	T;T;T;T	0.23950	2.03;1.88;1.88;2.03	.	.	.	.	.	.	.	.	T	0.35856	0.0946	L	0.43923	1.385	0.09310	N	1	P;P	0.47106	0.89;0.767	D;B	0.64237	0.923;0.15	T	0.15350	-1.0440	6	0.32370	T	0.25	.	.	.	.	.	532;532	F5GWX0;A8MRT5	.;K220L_HUMAN	P	532;532;532;410;532;532	ENSP00000445388:T532P;ENSP00000440703:T532P;ENSP00000430633:T532P;ENSP00000431553:T532P	ENSP00000441680:T532P	T	+	1	0	RP11-368J21.2	22453399	.	.	.	.	.	.	.	.	.	.	.	.	ACA	.		0.597	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
ATP2A1	487	broad.mit.edu;bcgsc.ca	37	16	28890418	28890418	+	Splice_Site	SNP	A	A	G	rs201535825		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:28890418A>G	ENST00000357084.3	+	2	385		c.e2-1		ATP2A1_ENST00000536376.1_5'Flank|SNORA43_ENST00000516652.1_RNA|ATP2A1_ENST00000395503.4_Splice_Site|RP11-22P6.3_ENST00000561547.1_RNA|RP11-22P6.3_ENST00000566956.1_RNA	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1						apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						TTTCCTGGGTAGAGCTCCCTG	0.537													A|||	1	0.000199681	0.0	0.0	5008	,	,		13936	0.001		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.						180.0	184.0	182.0					16																	28890418		2197	4300	6497	SO:0001630	splice_region_variant	0	.			CTGGGTAGAGCTC		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.119-1A>G	16.37:g.28890418A>G		196.0	1.0		236.0	90.0	.	A8K5J9|B3KY17|O14984	RNA	SNP	ENST00000357084.3	37	CCDS10643.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	18.86	3.712985	0.68730	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498	.	.	.	5.01	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2949	0.43618	0.8336:0.1664:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP2A1	28797919	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	5.778000	0.68940	0.843000	0.35070	0.459000	0.35465	.	A|0.999;G|0.000		0.537	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	Intron
MASTL	84930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27459791	27459791	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr10:27459791A>T	ENST00000375940.4	+	8	1960	c.1903A>T	c.(1903-1905)Atg>Ttg	p.M635L	MASTL_ENST00000375946.4_Missense_Mutation_p.M635L|MASTL_ENST00000342386.6_Missense_Mutation_p.M635L|MASTL_ENST00000477034.1_3'UTR			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	635	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAACCAAAAAATGTTAGGTCC	0.383																																					p.M635L		.											.	MASTL	522	0			c.A1903T						.						63.0	61.0	62.0					10																	27459791		2203	4300	6503	SO:0001583	missense	84930	exon8			CAAAAAATGTTAG	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1903A>T	10.37:g.27459791A>T	ENSP00000365107:p.Met635Leu	110.0	0.0		139.0	49.0	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	37	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	A	7.795	0.712418	0.15306	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.21734	1.99;1.99;1.99	5.28	2.83	0.33086	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.539261	0.22682	N	0.056939	T	0.14399	0.0348	L	0.48362	1.52	0.23401	N	0.997751	B;B;B	0.22211	0.066;0.04;0.066	B;B;B	0.20577	0.03;0.013;0.03	T	0.33979	-0.9847	10	0.05959	T	0.93	-13.5015	8.4168	0.32676	0.6766:0.0:0.3234:0.0	.	635;635;635	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	L	635	ENSP00000365113:M635L;ENSP00000343446:M635L;ENSP00000365107:M635L	ENSP00000343446:M635L	M	+	1	0	MASTL	27499797	0.182000	0.23173	0.986000	0.45419	0.824000	0.46624	0.604000	0.24164	0.891000	0.36235	0.482000	0.46254	ATG	.		0.383	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
MCM7	4176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99693701	99693701	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:99693701C>A	ENST00000303887.5	-	11	1936	c.1291G>T	c.(1291-1293)Ggt>Tgt	p.G431C	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.G255C|MIR93_ENST00000385024.1_RNA|MIR106B_ENST00000385301.1_RNA|MIR25_ENST00000384816.1_RNA	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	431	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGGCCCCACCCTCTAAGGTC	0.607																																					p.G431C		.											.	MCM7	651	0			c.G1291T						.						57.0	54.0	55.0					7																	99693701		2203	4300	6503	SO:0001583	missense	4176	exon11			CCCCACCCTCTAA		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1291G>T	7.37:g.99693701C>A	ENSP00000307288:p.Gly431Cys	69.0	0.0		94.0	35.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254289	0.80135	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.11495	2.77;2.77	5.02	4.13	0.48395	ATPase, AAA+ type, core (1);	0.109029	0.64402	D	0.000007	T	0.48909	0.1526	H	0.98370	4.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67821	-0.5571	10	0.87932	D	0	-23.2828	12.4978	0.55937	0.1682:0.8318:0.0:0.0	.	431	P33993	MCM7_HUMAN	C	431;368;324;255	ENSP00000307288:G431C;ENSP00000346171:G255C	ENSP00000307288:G431C	G	-	1	0	MCM7	99531637	1.000000	0.71417	0.988000	0.46212	0.914000	0.54420	7.604000	0.82830	1.302000	0.44855	0.655000	0.94253	GGT	.		0.607	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
MLLT4	4301	ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168271129	168271129	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:168271129G>A	ENST00000447894.2	+	3	365	c.365G>A	c.(364-366)cGg>cAg	p.R122Q	MLLT4_ENST00000344191.4_Missense_Mutation_p.R122Q|MLLT4_ENST00000392108.3_Missense_Mutation_p.R122Q|MLLT4_ENST00000366806.2_Missense_Mutation_p.R122Q|MLLT4_ENST00000392112.1_Missense_Mutation_p.R122Q|MLLT4_ENST00000351017.4_Missense_Mutation_p.R122Q|MLLT4_ENST00000400822.3_Missense_Mutation_p.R122Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	122	Ras-associating 1. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AAAGATGATCGGGAAGGCAGA	0.393			T	MLL	AL																																p.R122Q		.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	685	0			c.G365A						.						222.0	240.0	234.0					6																	168271129		2203	4296	6499	SO:0001583	missense	4301	exon3			ATGATCGGGAAGG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.365G>A	6.37:g.168271129G>A	ENSP00000404595:p.Arg122Gln	160.0	2.0		234.0	23.0	NM_001207008	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	G	36	5.706101	0.96812	.	.	ENSG00000130396	ENST00000400825;ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400824;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32;2.32;2.32;2.32	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	L	0.52573	1.65	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.944;0.995	T	0.00668	-1.1618	10	0.51188	T	0.08	-3.1717	20.3854	0.98941	0.0:0.0:1.0:0.0	.	122;122;122	P55196-5;P55196-6;P55196-2	.;.;.	Q	123;122;122;122;122;122;122;123;122;122	ENSP00000383626:R123Q;ENSP00000341118:R122Q;ENSP00000252692:R122Q;ENSP00000375956:R122Q;ENSP00000355771:R122Q;ENSP00000375960:R122Q;ENSP00000383625:R123Q;ENSP00000383623:R122Q;ENSP00000404595:R122Q	ENSP00000345834:R122Q	R	+	2	0	MLLT4	168013978	1.000000	0.71417	0.959000	0.39883	0.971000	0.66376	9.239000	0.95389	2.825000	0.97269	0.655000	0.94253	CGG	.		0.393	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
MLPH	79083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238449167	238449167	+	Silent	SNP	G	G	A	rs202229121		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:238449167G>A	ENST00000264605.3	+	10	1575	c.1281G>A	c.(1279-1281)gcG>gcA	p.A427A	MLPH_ENST00000409373.1_Silent_p.A359A|MLPH_ENST00000445024.2_Silent_p.A427A|MLPH_ENST00000338530.4_Silent_p.A399A|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000410032.1_Silent_p.A284A	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	427					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TCCCCCAGGCGGACCCGGAGG	0.637													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19131	0.0		0.0	False		,,,				2504	0.0				p.A427A		.											.	MLPH	91	0			c.G1281A						.						38.0	43.0	41.0					2																	238449167		2202	4299	6501	SO:0001819	synonymous_variant	79083	exon10			CCAGGCGGACCCG	AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.1281G>A	2.37:g.238449167G>A		21.0	0.0		25.0	14.0	NM_024101	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Silent	SNP	ENST00000264605.3	37	CCDS2518.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	0|0	0.0|0.0	G|G	3.953|3.953	-0.011900|-0.011900	0.07727|0.07727	.|.	.|.	ENSG00000115648|ENSG00000115648	ENST00000415753|ENST00000436965	.|.	.|.	.|.	4.8|4.8	-3.69|-3.69	0.04450|0.04450	.|.	.|.	.|.	.|.	.|.	T|T	0.18299|0.18299	0.0439|0.0439	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.25950|0.25950	-1.0117|-1.0117	4|4	.|.	.|.	.|.	4.0E-4|4.0E-4	2.1958|2.1958	0.03910|0.03910	0.431:0.1271:0.3212:0.1207|0.431:0.1271:0.3212:0.1207	.|.	.|.	.|.	.|.	R|Q	115|148	.|.	.|.	G|R	+|+	1|2	0|0	MLPH|MLPH	238113906|238113906	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.430000|-1.430000	0.02434|0.02434	-0.641000|-0.641000	0.05487|0.05487	-1.684000|-1.684000	0.00734|0.00734	GGA|CGG	G|0.999;A|0.000		0.637	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101	
MNDA	4332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158817665	158817665	+	Missense_Mutation	SNP	C	C	A	rs139902913		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:158817665C>A	ENST00000368141.4	+	6	1396	c.1135C>A	c.(1135-1137)Cgc>Agc	p.R379S		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	379	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AACAGTTGACCGCAAGCTGAA	0.443																																					p.R379S		.											.	MNDA	94	0			c.C1135A						.						130.0	123.0	125.0					1																	158817665		2203	4300	6503	SO:0001583	missense	4332	exon6			GTTGACCGCAAGC	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.1135C>A	1.37:g.158817665C>A	ENSP00000357123:p.Arg379Ser	127.0	0.0		145.0	58.0	NM_002432		Missense_Mutation	SNP	ENST00000368141.4	37	CCDS1177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.250|0.250	-1.007183|-1.007183	0.02112|0.02112	.|.	.|.	ENSG00000163563|ENSG00000163563	ENST00000438394|ENST00000368141	.|T	.|0.21543	.|2.0	3.76|3.76	-7.52|-7.52	0.01341|0.01341	.|HIN-200/IF120x (1);Nucleic acid-binding, OB-fold (1);	.|3.094270	.|0.01403	.|N	.|0.013692	T|T	0.01870|0.01870	0.0059|0.0059	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|P	.|0.34724	.|0.465	.|B	.|0.28849	.|0.095	T|T	0.30119|0.30119	-0.9989|-0.9989	5|10	.|0.10902	.|T	.|0.67	9.6375|9.6375	1.2349|1.2349	0.01951|0.01951	0.2408:0.3124:0.2874:0.1594|0.2408:0.3124:0.2874:0.1594	.|.	.|379	.|P41218	.|MNDA_HUMAN	Q|S	84|379	.|ENSP00000357123:R379S	.|ENSP00000357123:R379S	P|R	+|+	2|1	0|0	MNDA|MNDA	157084289|157084289	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-2.155000|-2.155000	0.01284|0.01284	-2.488000|-2.488000	0.00518|0.00518	-0.440000|-0.440000	0.05779|0.05779	CCG|CGC	C|1.000;T|0.000		0.443	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
MPP2	4355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41958848	41958848	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:41958848T>G	ENST00000461854.1	-	8	948	c.863A>C	c.(862-864)cAg>cCg	p.Q288P	MPP2_ENST00000518766.1_Missense_Mutation_p.Q309P|MPP2_ENST00000269095.4_Missense_Mutation_p.Q264P|MPP2_ENST00000520305.1_Missense_Mutation_p.Q125P|MPP2_ENST00000377184.3_Missense_Mutation_p.Q281P|MPP2_ENST00000536246.1_Missense_Mutation_p.Q253P|MPP2_ENST00000473246.1_5'Flank|MPP2_ENST00000523501.1_Missense_Mutation_p.Q253P			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	288	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GGCATCATCCTGGTTTACGAT	0.617																																					p.Q264P		.											.	MPP2	90	0			c.A791C						.						93.0	84.0	87.0					17																	41958848		2203	4300	6503	SO:0001583	missense	4355	exon7			TCATCCTGGTTTA		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.863A>C	17.37:g.41958848T>G	ENSP00000428286:p.Gln288Pro	55.0	0.0		105.0	30.0	NM_005374	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000461854.1	37		.	.	.	.	.	.	.	.	.	.	t	19.91	3.914920	0.72983	.	.	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000520305;ENST00000523501;ENST00000536246;ENST00000518766	T;T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08;3.08	5.1	4.02	0.46733	.	.	.	.	.	T	0.26593	0.0650	M	0.81682	2.555	0.58432	D	0.99999	D;D	0.63046	0.992;0.991	D;P	0.69142	0.962;0.894	T	0.01039	-1.1472	9	0.87932	D	0	.	9.17	0.37074	0.0:0.0861:0.0:0.9139	.	309;281	E7EV80;Q14168-3	.;.	P	281;264;288;125;253;253;309	ENSP00000366389:Q281P;ENSP00000269095:Q264P;ENSP00000428286:Q288P;ENSP00000428136:Q125P;ENSP00000430540:Q253P;ENSP00000438012:Q253P;ENSP00000428182:Q309P	ENSP00000269095:Q264P	Q	-	2	0	MPP2	39314374	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	3.296000	0.51802	0.964000	0.38108	0.454000	0.30748	CAG	.		0.617	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374	
MPPE1	65258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	11889442	11889442	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:11889442T>A	ENST00000588072.1	-	5	1659	c.438A>T	c.(436-438)ccA>ccT	p.P146P	MPPE1_ENST00000399978.2_Silent_p.P146P|MPPE1_ENST00000317235.7_Silent_p.P146P|MPPE1_ENST00000344987.7_Silent_p.P146P|MPPE1_ENST00000309976.9_Silent_p.P146P	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	146					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GTACATGACTTGGGTGTCTGA	0.488																																					p.P146P		.											.	MPPE1	90	0			c.A438T						.						127.0	108.0	114.0					18																	11889442		2203	4300	6503	SO:0001819	synonymous_variant	65258	exon4			ATGACTTGGGTGT	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.438A>T	18.37:g.11889442T>A		135.0	0.0		203.0	50.0	NM_001242904	B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Silent	SNP	ENST00000588072.1	37	CCDS11853.1																																																																																			.		0.488	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9045799	9045799	+	Silent	SNP	G	G	C	rs375775766		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:9045799G>C	ENST00000397910.4	-	5	36035	c.35832C>G	c.(35830-35832)acC>acG	p.T11944T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11946	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGGTATCAAGGTCATAGTGG	0.473																																					p.T11944T		.											.	MUC16	566	0			c.C35832G						.						167.0	158.0	161.0					19																	9045799		1958	4151	6109	SO:0001819	synonymous_variant	94025	exon5			TATCAAGGTCATA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35832C>G	19.37:g.9045799G>C		313.0	0.0		455.0	148.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH7	4625	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23902387	23902387	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:23902387A>G	ENST00000355349.3	-	4	413	c.251T>C	c.(250-252)tTc>tCc	p.F84S		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	84					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GATTTTGTCGAACTTGGGTGG	0.582																																					p.F84S		.											.	MYH7	94	0			c.T251C						.						274.0	197.0	223.0					14																	23902387		2203	4300	6503	SO:0001583	missense	4625	exon4			TTGTCGAACTTGG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.251T>C	14.37:g.23902387A>G	ENSP00000347507:p.Phe84Ser	248.0	2.0		288.0	111.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.816033	0.70912	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95272	-3.66	3.64	3.64	0.41730	Myosin head, motor domain (1);	.	.	.	.	D	0.96288	0.8789	M	0.86420	2.815	0.58432	D	0.999999	D	0.56746	0.977	P	0.57468	0.821	D	0.96183	0.9132	9	0.87932	D	0	.	9.4759	0.38871	0.8423:0.0:0.0:0.1577	.	84	P12883	MYH7_HUMAN	S	84	ENSP00000347507:F84S	ENSP00000347507:F84S	F	-	2	0	MYH7	22972227	0.997000	0.39634	1.000000	0.80357	0.875000	0.50365	3.421000	0.52742	1.651000	0.50673	0.254000	0.18369	TTC	.		0.582	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYLK3	91807	hgsc.bcm.edu;mdanderson.org	37	16	46766546	46766546	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:46766546C>T	ENST00000394809.4	-	4	1151	c.1036G>A	c.(1036-1038)Ggg>Agg	p.G346R	MYLK3_ENST00000536476.1_Missense_Mutation_p.G5R	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	346					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGCATCTCCCCAGGAGTATCC	0.607																																					p.G346R		.											.	MYLK3	374	0			c.G1036A						.						20.0	15.0	17.0					16																	46766546		2011	4016	6027	SO:0001583	missense	91807	exon4			TCTCCCCAGGAGT	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1036G>A	16.37:g.46766546C>T	ENSP00000378288:p.Gly346Arg	8.0	0.0		18.0	14.0	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	C	9.418	1.082352	0.20309	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.68765	-0.35;-0.35	5.51	3.57	0.40892	.	0.470755	0.15827	N	0.242698	T	0.51635	0.1686	L	0.34521	1.04	0.32663	N	0.517819	B;B	0.24533	0.105;0.105	B;B	0.20184	0.028;0.028	T	0.54153	-0.8336	10	0.30078	T	0.28	.	8.1388	0.31071	0.0:0.8171:0.0:0.1829	.	346;346	B5BUL9;Q32MK0	.;MYLK3_HUMAN	R	346;5	ENSP00000378288:G346R;ENSP00000439297:G5R	ENSP00000378288:G346R	G	-	1	0	MYLK3	45324047	0.104000	0.21937	0.653000	0.29593	0.055000	0.15305	0.836000	0.27545	0.685000	0.31468	0.655000	0.94253	GGG	.		0.607	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
MYO3B	140469	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171242774	171242774	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:171242774T>C	ENST00000408978.4	+	13	1509	c.1366T>C	c.(1366-1368)Ttg>Ctg	p.L456L	MYO3B_ENST00000409044.3_Silent_p.L456L|MYO3B_ENST00000334231.6_Silent_p.L465L|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	456	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TTTGACTTTCTTGGGAAAGGT	0.438																																					p.L456L		.											.	MYO3B	530	0			c.T1366C						.						115.0	114.0	114.0					2																	171242774		1940	4140	6080	SO:0001819	synonymous_variant	140469	exon13			ACTTTCTTGGGAA		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1366T>C	2.37:g.171242774T>C		296.0	2.0		371.0	129.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	ENST00000408978.4	37	CCDS42773.1																																																																																			.		0.438	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	52638630	52638630	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr15:52638630delA	ENST00000399231.3	-	30	4130	c.3887delT	c.(3886-3888)ttgfs	p.L1296fs	MYO5A_ENST00000356338.6_Frame_Shift_Del_p.L1296fs|MYO5A_ENST00000399233.2_Frame_Shift_Del_p.L1293fs|MYO5A_ENST00000553916.1_Frame_Shift_Del_p.L1296fs|MYO5A_ENST00000358212.6_Frame_Shift_Del_p.L1296fs	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1296					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TACATCTTCCAAAAGTATTGT	0.299																																					p.L1296fs		.											.	MYO5A	93	0			c.3887delT						.						170.0	156.0	160.0					15																	52638630		1829	4073	5902	SO:0001589	frameshift_variant	4644	exon30			TCTTCCAAAAGTA		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3887delT	15.37:g.52638630delA	ENSP00000382177:p.Leu1296fs	280.0	0.0		274.0	107.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Frame_Shift_Del	DEL	ENST00000399231.3	37	CCDS42037.1																																																																																			.		0.299	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
NALCN	259232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	101717813	101717813	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:101717813C>T	ENST00000251127.6	-	40	4628	c.4547G>A	c.(4546-4548)tGc>tAc	p.C1516Y		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1516					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CATTTCGTAGCACATGTGCTT	0.592																																					p.C1516Y		.											.	NALCN	167	0			c.G4547A						.						175.0	135.0	149.0					13																	101717813		2203	4300	6503	SO:0001583	missense	259232	exon40			TCGTAGCACATGT	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4547G>A	13.37:g.101717813C>T	ENSP00000251127:p.Cys1516Tyr	64.0	0.0		130.0	42.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751465	0.89753	.	.	ENSG00000102452	ENST00000251127	D	0.97906	-4.6	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.98333	0.9447	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.99647	1.0990	10	0.87932	D	0	.	19.8625	0.96789	0.0:1.0:0.0:0.0	.	1516	Q8IZF0	NALCN_HUMAN	Y	1516	ENSP00000251127:C1516Y	ENSP00000251127:C1516Y	C	-	2	0	NALCN	100515814	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.689000	0.91719	0.655000	0.94253	TGC	.		0.592	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
NCKAP5	344148	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	133547663	133547663	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:133547663C>A	ENST00000409261.1	-	13	1398	c.1025G>T	c.(1024-1026)aGc>aTc	p.S342I	NCKAP5_ENST00000409213.1_Missense_Mutation_p.S342I|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S342I|NCKAP5_ENST00000405974.3_Missense_Mutation_p.S342I	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	342	Ser-rich.									NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCTGCAGGTGCTTGAAAGAGA	0.532																																					p.S342I		.											.	.	.	0			c.G1025T						.						75.0	81.0	79.0					2																	133547663		2072	4213	6285	SO:0001583	missense	344148	exon13			CAGGTGCTTGAAA	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1025G>T	2.37:g.133547663C>A	ENSP00000387128:p.Ser342Ile	120.0	1.0		159.0	73.0	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628812	0.87560	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.56941	1.79;0.43;1.79;0.43	5.12	5.12	0.69794	.	0.000000	0.37623	U	0.002008	T	0.62889	0.2465	L	0.29908	0.895	0.38970	D	0.958732	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67952	-0.5537	10	0.87932	D	0	.	16.9089	0.86135	0.0:1.0:0.0:0.0	.	342;342	O14513-2;O14513	.;NCKP5_HUMAN	I	342	ENSP00000387128:S342I;ENSP00000386952:S342I;ENSP00000380603:S342I;ENSP00000385692:S342I	ENSP00000380603:S342I	S	-	2	0	NCKAP5	133264133	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.426000	0.73374	2.658000	0.90341	0.650000	0.86243	AGC	.		0.532	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NF2	4771	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	30050696	30050696	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:30050696G>T	ENST00000338641.4	+	5	939	c.498G>T	c.(496-498)gaG>gaT	p.E166D	NF2_ENST00000347330.5_Intron|NF2_ENST00000361452.4_Missense_Mutation_p.E125D|NF2_ENST00000361166.4_Missense_Mutation_p.E166D|NF2_ENST00000413209.2_Intron|NF2_ENST00000403435.1_Missense_Mutation_p.E166D|NF2_ENST00000353887.4_Missense_Mutation_p.E83D|NF2_ENST00000334961.7_Missense_Mutation_p.E83D|NF2_ENST00000403999.3_Missense_Mutation_p.E166D|NF2_ENST00000397789.3_Missense_Mutation_p.E166D|NF2_ENST00000361676.4_Missense_Mutation_p.E124D	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	166	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TGGCCCAAGAGGAATTGCTTC	0.423			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.E166D		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	4696	3	Unknown(3)	large_intestine(1)|stomach(1)|central_nervous_system(1)	c.G498T						.						133.0	134.0	133.0					22																	30050696		2203	4300	6503	SO:0001583	missense	4771	exon5	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CCAAGAGGAATTG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.498G>T	22.37:g.30050696G>T	ENSP00000344666:p.Glu166Asp	229.0	2.0		268.0	117.0	NM_000268	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	8.575	0.880936	0.17467	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.99	-1.48	0.08745	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.099782	0.64402	D	0.000002	T	0.55847	0.1946	N	0.16098	0.37	0.80722	D	1	B;B;B;B;B;B	0.13145	0.007;0.001;0.002;0.003;0.001;0.0	B;B;B;B;B;B	0.19666	0.026;0.016;0.009;0.008;0.004;0.005	T	0.24261	-1.0165	9	.	.	.	.	10.3256	0.43792	0.4986:0.0:0.5014:0.0	.	125;166;166;124;83;166	P35240-5;P35240;P35240-2;P35240-6;P35240-4;P35240-3	.;MERL_HUMAN;.;.;.;.	D	166;166;125;166;166;83;83;166;124;166	ENSP00000344666:E166D;ENSP00000384029:E166D;ENSP00000354897:E125D;ENSP00000384797:E166D;ENSP00000335652:E83D;ENSP00000340626:E83D;ENSP00000380891:E166D;ENSP00000355183:E124D;ENSP00000354529:E166D	.	E	+	3	2	NF2	28380696	0.996000	0.38824	0.982000	0.44146	0.987000	0.75469	0.353000	0.20130	-0.399000	0.07668	-0.768000	0.03414	GAG	.		0.423	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
NOM1	64434	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	156743259	156743259	+	Silent	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:156743259A>T	ENST00000275820.3	+	1	843	c.828A>T	c.(826-828)gcA>gcT	p.A276A		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	276	Glu-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		cgcaggaagcagaagcgcaga	0.547																																					p.A276A		.											.	NOM1	90	0			c.A828T						.						73.0	47.0	56.0					7																	156743259		2201	4298	6499	SO:0001819	synonymous_variant	64434	exon1			GGAAGCAGAAGCG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.828A>T	7.37:g.156743259A>T		101.0	1.0		132.0	57.0	NM_138400	Q96I08	Silent	SNP	ENST00000275820.3	37	CCDS34787.1																																																																																			.		0.547	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
NOX3	50508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155718096	155718096	+	Splice_Site	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:155718096G>T	ENST00000159060.2	-	13	1683	c.1581C>A	c.(1579-1581)agC>agA	p.S527R		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	527					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CAATACTGCTGCTGCAGTAGG	0.458																																					p.S527R		.											.	NOX3	91	0			c.C1581A						.						60.0	62.0	61.0					6																	155718096		2203	4300	6503	SO:0001630	splice_region_variant	50508	exon13			ACTGCTGCTGCAG	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1581-1C>A	6.37:g.155718096G>T		77.0	0.0		159.0	38.0	NM_015718	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899972	0.33535	.	.	ENSG00000074771	ENST00000159060	D	0.95001	-3.58	5.53	5.53	0.82687	Ferric reductase, NAD binding (1);	0.089605	0.48767	D	0.000164	D	0.91637	0.7357	L	0.27975	0.815	0.46149	D	0.998891	D	0.56746	0.977	P	0.62298	0.9	D	0.89533	0.3787	10	0.21540	T	0.41	.	12.0236	0.53358	0.0788:0.0:0.9212:0.0	.	527	Q9HBY0	NOX3_HUMAN	R	527	ENSP00000159060:S527R	ENSP00000159060:S527R	S	-	3	2	NOX3	155759788	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	3.888000	0.56204	2.608000	0.88229	0.561000	0.74099	AGC	.		0.458	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		Missense_Mutation
NPBWR2	2832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62737266	62737266	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:62737266C>T	ENST00000369768.1	-	1	1258	c.919G>A	c.(919-921)Gcc>Acc	p.A307T		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	307					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CACGAGTTGGCGTAGCTGAGG	0.597																																					p.A307T		.											.	NPBWR2	153	0			c.G919A						.						197.0	132.0	154.0					20																	62737266		2202	4298	6500	SO:0001583	missense	2832	exon1			AGTTGGCGTAGCT	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.919G>A	20.37:g.62737266C>T	ENSP00000358783:p.Ala307Thr	71.0	0.0		73.0	28.0	NM_005286	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	ENST00000369768.1	37	CCDS13557.1	.	.	.	.	.	.	.	.	.	.	C	6.535	0.467050	0.12402	.	.	ENSG00000125522	ENST00000369768	T	0.37915	1.17	3.43	0.189	0.15119	GPCR, rhodopsin-like superfamily (1);	0.224693	0.35262	N	0.003338	T	0.19525	0.0469	L	0.33137	0.985	0.39667	D	0.970707	B	0.29766	0.256	B	0.26310	0.068	T	0.18366	-1.0339	10	0.06236	T	0.91	.	9.5523	0.39317	0.0:0.7615:0.0:0.2385	.	307	P48146	NPBW2_HUMAN	T	307	ENSP00000358783:A307T	ENSP00000358783:A307T	A	-	1	0	NPBWR2	62207710	0.975000	0.34042	0.272000	0.24630	0.688000	0.40055	1.370000	0.34238	0.104000	0.17725	0.491000	0.48974	GCC	.		0.597	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1	NM_005286	
NR4A2	4929	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	157186659	157186659	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:157186659C>T	ENST00000339562.4	-	3	402	c.40G>A	c.(40-42)Gga>Aga	p.G14R	NR4A2_ENST00000409572.1_Missense_Mutation_p.G14R|NR4A2_ENST00000539077.1_Missense_Mutation_p.G25R|NR4A2_ENST00000409108.2_Missense_Mutation_p.G14R|NR4A2_ENST00000426264.1_Intron|NR4A2_ENST00000429376.1_Intron	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	14					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						GGGCTGGCTCCTTGAGGCGAG	0.517																																					p.G14R		.											.	NR4A2	189	0			c.G40A						.						48.0	51.0	50.0					2																	157186659		2203	4300	6503	SO:0001583	missense	4929	exon3			TGGCTCCTTGAGG	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.40G>A	2.37:g.157186659C>T	ENSP00000344479:p.Gly14Arg	122.0	0.0		147.0	38.0	NM_006186	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003131	0.74932	.	.	ENSG00000153234	ENST00000339562;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000424077	D;D;D;D;D	0.93859	-3.04;-3.04;-3.02;-3.3;-1.75	5.43	5.43	0.79202	.	0.214284	0.48286	D	0.000187	D	0.95007	0.8384	L	0.42245	1.32	0.80722	D	1	D	0.63880	0.993	D	0.64237	0.923	D	0.95066	0.8200	10	0.66056	D	0.02	.	19.0129	0.92881	0.0:1.0:0.0:0.0	.	14	P43354	NR4A2_HUMAN	R	14;14;25;14;14	ENSP00000344479:G14R;ENSP00000386747:G14R;ENSP00000444925:G25R;ENSP00000386993:G14R;ENSP00000406808:G14R	ENSP00000344479:G14R	G	-	1	0	NR4A2	156894905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.825000	0.97269	0.655000	0.94253	GGA	.		0.517	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
NUMA1	4926	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	71721833	71721833	+	Splice_Site	SNP	T	T	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:71721833T>G	ENST00000393695.3	-	17	5049	c.4718A>C	c.(4717-4719)aAg>aCg	p.K1573T	NUMA1_ENST00000358965.6_Splice_Site_p.K1559T|NUMA1_ENST00000351960.6_Splice_Site_p.K437T	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTGCCCCACCTTCAGCTTCTG	0.602			T	RARA	APL																																p.K1573T		.		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	NUMA1	633	0			c.A4718C						.						191.0	198.0	196.0					11																	71721833		2200	4293	6493	SO:0001630	splice_region_variant	4926	exon17			CCCACCTTCAGCT	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.4719+1A>C	11.37:g.71721833T>G		26.0	0.0		46.0	16.0	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.638715	0.67130	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T;T	0.39997	2.12;1.05;2.6	4.38	4.38	0.52667	.	0.000000	0.53938	D	0.000041	T	0.48840	0.1522	N	0.24115	0.695	0.40577	D	0.98135	D;D;D;D;P	0.71674	0.998;0.989;0.998;0.998;0.939	D;D;D;D;P	0.72982	0.957;0.979;0.948;0.957;0.654	T	0.53380	-0.8447	10	0.52906	T	0.07	.	13.7403	0.62845	0.0:0.0:0.0:1.0	.	1579;1043;1559;1573;437	Q4LE64;Q59HB8;Q14980-2;Q14980;Q9BTE9	.;.;.;NUMA1_HUMAN;.	T	437;1559;1573;1122;528	ENSP00000260051:K437T;ENSP00000351851:K1559T;ENSP00000377298:K1573T	ENSP00000260051:K437T	K	-	2	0	NUMA1	71399481	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.173000	0.50839	1.963000	0.57068	0.459000	0.35465	AAG	.		0.602	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		Missense_Mutation
NUP210L	91181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154033436	154033436	+	Silent	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:154033436A>G	ENST00000368559.3	-	19	2801	c.2730T>C	c.(2728-2730)taT>taC	p.Y910Y	NUP210L_ENST00000271854.3_Silent_p.Y910Y	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	910					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAGGGTGGTTATAGATGGTGG	0.358																																					p.Y910Y		.											.	NUP210L	77	0			c.T2730C						.						107.0	101.0	103.0					1																	154033436		1869	4114	5983	SO:0001819	synonymous_variant	91181	exon19			GTGGTTATAGATG	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2730T>C	1.37:g.154033436A>G		262.0	0.0		324.0	118.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	37	CCDS41399.1																																																																																			.		0.358	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
OPHN1	4983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	67283856	67283856	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:67283856T>A	ENST00000355520.5	-	21	2639	c.1998A>T	c.(1996-1998)ccA>ccT	p.P666P	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	666	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CGTCCACCTCTGGGCAGGGCT	0.582																																					p.P666P		.											.	OPHN1	110	0			c.A1998T						.						84.0	69.0	74.0					X																	67283856		2203	4300	6503	SO:0001819	synonymous_variant	4983	exon21			CACCTCTGGGCAG	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1998A>T	X.37:g.67283856T>A		114.0	0.0		216.0	168.0	NM_002547	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Silent	SNP	ENST00000355520.5	37	CCDS14388.1																																																																																			.		0.582	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547	
OR10V1	390201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	59481145	59481145	+	Silent	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:59481145G>T	ENST00000307552.2	-	1	192	c.174C>A	c.(172-174)ccC>ccA	p.P58P	STX3_ENST00000300150.7_5'UTR	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AAAAGTACATGGGGGTGTGGA	0.448																																					p.P58P		.											.	OR10V1	68	0			c.C174A						.						61.0	65.0	63.0					11																	59481145		2201	4295	6496	SO:0001819	synonymous_variant	390201	exon1			GTACATGGGGGTG	AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.174C>A	11.37:g.59481145G>T		167.0	0.0		231.0	10.0	NM_001005324	Q6IFD9|Q96R50	Silent	SNP	ENST00000307552.2	37	CCDS31565.1																																																																																			.		0.448	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394517.1	NM_001005324	
OR4F15	390649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	102359072	102359072	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr15:102359072A>T	ENST00000332238.4	+	1	707	c.683A>T	c.(682-684)cAt>cTt	p.H228L		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GTTTGGAAACATTCTTCTGGT	0.463																																					p.H228L		.											.	OR4F15	68	0			c.A683T						.						280.0	242.0	255.0					15																	102359072		2203	4300	6503	SO:0001583	missense	390649	exon1			GGAAACATTCTTC	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.683A>T	15.37:g.102359072A>T	ENSP00000333184:p.His228Leu	611.0	0.0		989.0	257.0	NM_001001674	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	8.090	0.774339	0.16051	.	.	ENSG00000182854	ENST00000332238	T	0.00042	8.84	5.57	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.095904	0.46442	D	0.000294	T	0.00073	0.0002	N	0.03324	-0.35	0.09310	N	1	B	0.20368	0.044	B	0.23852	0.049	T	0.02026	-1.1227	9	.	.	.	.	9.5446	0.39273	0.9181:0.0:0.0819:0.0	.	228	Q8NGB8	O4F15_HUMAN	L	228	ENSP00000333184:H228L	.	H	+	2	0	OR4F15	100176595	0.000000	0.05858	0.202000	0.23494	0.201000	0.24016	-0.249000	0.08842	1.134000	0.42165	0.528000	0.53228	CAT	.		0.463	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674	
OR4M1	441670	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	20249422	20249422	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:20249422G>A	ENST00000315957.4	+	1	1022	c.941G>A	c.(940-942)tGa>tAa	p.*314*		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAAGAGAAGTGAAAGATAAAT	0.363																																					p.X314X		.											.	OR4M1	68	0			c.G941A						.						32.0	34.0	33.0					14																	20249422		2172	4281	6453	SO:0001819	synonymous_variant	441670	exon1			AGAAGTGAAAGAT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.941G>A	14.37:g.20249422G>A		494.0	1.0		554.0	98.0	NM_001005500	B9EH18|Q6IFA3	Silent	SNP	ENST00000315957.4	37	CCDS32021.1																																																																																			.		0.363	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
OR5M10	390167	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	56345082	56345082	+	Missense_Mutation	SNP	A	A	T	rs375773400		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:56345082A>T	ENST00000526812.2	-	1	181	c.116T>A	c.(115-117)cTg>cAg	p.L39Q		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						GTTGCCTGCCAGTGTGATTAG	0.483																																					p.L39Q		.											.	.	.	0			c.T116A						.						161.0	157.0	158.0					11																	56345082		1968	4147	6115	SO:0001583	missense	390167	exon1			CCTGCCAGTGTGA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.116T>A	11.37:g.56345082A>T	ENSP00000436004:p.Leu39Gln	418.0	2.0		508.0	195.0	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972301	0.53614	.	.	ENSG00000254834	ENST00000526812	T	0.00620	6.17	4.04	4.04	0.47022	.	.	.	.	.	T	0.02610	0.0079	M	0.87827	2.91	0.09310	N	1	P	0.50156	0.932	P	0.51487	0.671	T	0.17776	-1.0358	9	0.87932	D	0	.	12.2902	0.54815	1.0:0.0:0.0:0.0	.	39	Q6IEU7	OR5MA_HUMAN	Q	39	ENSP00000436004:L39Q	ENSP00000436004:L39Q	L	-	2	0	OR5M10	56101658	0.002000	0.14202	0.004000	0.12327	0.038000	0.13279	1.928000	0.40104	1.816000	0.52996	0.514000	0.50259	CTG	.		0.483	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
OR6C75	390323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55759521	55759521	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:55759521G>T	ENST00000343399.3	+	1	627	c.627G>T	c.(625-627)ttG>ttT	p.L209F		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGGTCACCTTGACATTAGTTA	0.408																																					p.L209F		.											.	OR6C75	70	0			c.G627T						.						147.0	129.0	135.0					12																	55759521		2203	4300	6503	SO:0001583	missense	390323	exon1			CACCTTGACATTA		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.627G>T	12.37:g.55759521G>T	ENSP00000368987:p.Leu209Phe	406.0	1.0		466.0	174.0	NM_001005497		Missense_Mutation	SNP	ENST00000343399.3	37	CCDS31820.1	.	.	.	.	.	.	.	.	.	.	g	15.12	2.740123	0.49045	.	.	ENSG00000187857	ENST00000343399	T	0.40476	1.03	5.22	-0.481	0.12082	GPCR, rhodopsin-like superfamily (1);	0.201247	0.23896	N	0.043482	T	0.32224	0.0822	L	0.28274	0.84	0.09310	N	0.999996	P	0.45011	0.848	P	0.50825	0.651	T	0.15464	-1.0436	10	0.72032	D	0.01	.	3.0854	0.06276	0.2711:0.4368:0.1802:0.1119	.	209	A6NL08	O6C75_HUMAN	F	209	ENSP00000368987:L209F	ENSP00000368987:L209F	L	+	3	2	OR6C75	54045788	0.000000	0.05858	0.904000	0.35570	0.966000	0.64601	-2.394000	0.01054	-0.010000	0.14271	0.632000	0.83419	TTG	.		0.408	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
PDE10A	10846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	165846593	165846593	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:165846593C>G	ENST00000366882.1	-	8	686	c.532G>C	c.(532-534)Gga>Cga	p.G178R	PDE10A_ENST00000539869.2_Missense_Mutation_p.G188R|PDE10A_ENST00000354448.4_Missense_Mutation_p.G178R			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	178	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GATTCCAGTCCAGTACCTCTT	0.388																																					p.G188R	Esophageal Squamous(22;308 615 5753 12038 40624)	.											.	PDE10A	519	0			c.G562C						.						94.0	90.0	91.0					6																	165846593		2203	4300	6503	SO:0001583	missense	10846	exon7			CCAGTCCAGTACC	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.532G>C	6.37:g.165846593C>G	ENSP00000355847:p.Gly178Arg	231.0	0.0		323.0	84.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	C	27.8	4.867217	0.91511	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69435	-0.4;-0.4	5.89	5.89	0.94794	GAF (2);	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	M	0.68952	2.095	0.80722	D	1	D;P	0.89917	1.0;0.86	D;P	0.97110	1.0;0.643	T	0.79475	-0.1788	10	0.72032	D	0.01	.	20.2508	0.98407	0.0:1.0:0.0:0.0	.	188;178	Q9ULW9;Q9Y233	.;PDE10_HUMAN	R	178;206;188;178;177	ENSP00000355847:G178R;ENSP00000346435:G178R	ENSP00000341187:G188R	G	-	1	0	PDE10A	165766583	1.000000	0.71417	0.927000	0.36925	0.842000	0.47809	7.538000	0.82048	2.788000	0.95919	0.585000	0.79938	GGA	.		0.388	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
PDXDC1	23042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	15126797	15126797	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:15126797A>T	ENST00000396410.4	+	18	1748	c.1651A>T	c.(1651-1653)Aag>Tag	p.K551*	PDXDC1_ENST00000447912.2_Nonsense_Mutation_p.K460*|PDXDC1_ENST00000569715.1_Nonsense_Mutation_p.K524*|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000450288.2_Nonsense_Mutation_p.K523*|PDXDC1_ENST00000563679.1_Nonsense_Mutation_p.K569*|PDXDC1_ENST00000325823.7_Nonsense_Mutation_p.K536*	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	551					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACTCCTGAAGAAGTTAAATGA	0.408																																					p.K551X		.											.	PDXDC1	91	0			c.A1651T						.						94.0	100.0	98.0					16																	15126797		2197	4300	6497	SO:0001587	stop_gained	23042	exon18			CTGAAGAAGTTAA	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1651A>T	16.37:g.15126797A>T	ENSP00000379691:p.Lys551*	124.0	0.0		138.0	52.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Nonsense_Mutation	SNP	ENST00000396410.4	37	CCDS32393.1	.	.	.	.	.	.	.	.	.	.	A	38	6.906433	0.97924	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000396410;ENST00000450288	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7462	14.9371	0.70964	1.0:0.0:0.0:0.0	.	.	.	.	X	536;460;551;523	.	ENSP00000322807:K536X	K	+	1	0	PDXDC1	15034298	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.142000	0.77339	2.131000	0.65755	0.533000	0.62120	AAG	.		0.408	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
PGLYRP4	57115	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153314164	153314164	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:153314164C>A	ENST00000359650.5	-	6	628	c.564G>T	c.(562-564)caG>caT	p.Q188H	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.Q184H	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	188					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGAAGTGGCTGAACATAAC	0.572																																					p.Q188H		.											.	PGLYRP4	94	0			c.G564T						.						122.0	116.0	118.0					1																	153314164		2203	4300	6503	SO:0001583	missense	57115	exon6			AAGTGGCTGAACA	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.564G>T	1.37:g.153314164C>A	ENSP00000352672:p.Gln188His	77.0	1.0		132.0	55.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	37	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.588345	0.28357	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.05319	3.46;3.46	4.2	1.05	0.20165	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.000000	0.44483	D	0.000451	T	0.09774	0.0240	M	0.76838	2.35	0.27729	N	0.944877	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.03981	-1.0987	10	0.62326	D	0.03	-42.2259	5.3818	0.16196	0.0:0.6116:0.0:0.3884	.	184;188	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	H	184;188	ENSP00000357728:Q184H;ENSP00000352672:Q188H	ENSP00000352672:Q188H	Q	-	3	2	PGLYRP4	151580788	1.000000	0.71417	0.985000	0.45067	0.031000	0.12232	0.559000	0.23485	0.421000	0.25980	-0.194000	0.12790	CAG	.		0.572	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
PMVK	10654	hgsc.bcm.edu;bcgsc.ca	37	1	154904884	154904884	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:154904884C>G	ENST00000368467.3	-	2	408	c.103G>C	c.(103-105)Gct>Cct	p.A35P		NM_006556.3	NP_006547.1	Q15126	PMVK_HUMAN	phosphomevalonate kinase	35					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|response to cholesterol (GO:0070723)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|phosphomevalonate kinase activity (GO:0004631)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGACATCAGCTCCAAGTCTG	0.562																																					p.A35P		.											.	PMVK	115	0			c.G103C						.						102.0	91.0	95.0					1																	154904884		2203	4300	6503	SO:0001583	missense	10654	exon2			CATCAGCTCCAAG	L77213	CCDS1073.1	1q21.3	2012-09-20			ENSG00000163344	ENSG00000163344	2.7.4.2		9141	protein-coding gene	gene with protein product		607622				8663599, 10191291	Standard	NM_006556		Approved	PMK, PMKA, HUMPMKI	uc001ffq.3	Q15126	OTTHUMG00000037415	ENST00000368467.3:c.103G>C	1.37:g.154904884C>G	ENSP00000357452:p.Ala35Pro	179.0	0.0		259.0	14.0	NM_006556	Q5TZW9	Missense_Mutation	SNP	ENST00000368467.3	37	CCDS1073.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580194	0.46006	.	.	ENSG00000163344	ENST00000368467	T	0.45276	0.9	4.59	2.71	0.32032	.	0.312350	0.31404	N	0.007710	T	0.10121	0.0248	N	0.21097	0.63	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16808	-1.0390	10	0.30854	T	0.27	-0.5485	6.3066	0.21141	0.0:0.7829:0.0:0.2171	.	35	Q15126	PMVK_HUMAN	P	35	ENSP00000357452:A35P	ENSP00000357452:A35P	A	-	1	0	PMVK	153171508	0.005000	0.15991	0.009000	0.14445	0.846000	0.48090	0.682000	0.25335	1.283000	0.44513	0.561000	0.74099	GCT	.		0.562	PMVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091088.1	NM_006556	
PPARD	5467	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35378867	35378867	+	Start_Codon_SNP	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:35378867G>T	ENST00000311565.4	+	4	352	c.3G>T	c.(1-3)atG>atT	p.M1I	PPARD_ENST00000444397.1_Start_Codon_SNP_p.M1I|PPARD_ENST00000540939.1_5'UTR|PPARD_ENST00000448077.2_Intron|PPARD_ENST00000360694.3_Start_Codon_SNP_p.M1I|PPARD_ENST00000337400.2_Start_Codon_SNP_p.M1I|PPARD_ENST00000418635.2_Start_Codon_SNP_p.M1I	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	1					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	GATCAGCCATGGAGCAGCCAC	0.622																																					p.M1I		.											.	PPARD	187	0			c.G3T						.						50.0	45.0	47.0					6																	35378867		2200	4300	6500	SO:0001582	initiator_codon_variant	5467	exon4			AGCCATGGAGCAG	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.3G>T	6.37:g.35378867G>T	ENSP00000310928:p.Met1Ile	81.0	0.0		129.0	38.0	NM_001171818	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Missense_Mutation	SNP	ENST00000311565.4	37	CCDS4803.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595100	0.66219	.	.	ENSG00000112033	ENST00000360694;ENST00000418635;ENST00000444397;ENST00000311565;ENST00000337400	D;D;D;D;D	0.96745	-3.1;-4.11;-3.31;-3.1;-3.31	4.93	4.93	0.64822	.	0.267147	0.38959	N	0.001504	D	0.94994	0.8380	.	.	.	0.80722	D	1	P;P;P	0.35872	0.525;0.525;0.525	B;B;B	0.42214	0.38;0.38;0.38	D	0.95885	0.8902	9	0.72032	D	0.01	.	16.5116	0.84287	0.0:0.0:1.0:0.0	.	1;1;1	E9PE18;Q03181;F1D8S7	.;PPARD_HUMAN;.	I	1	ENSP00000353916:M1I;ENSP00000413314:M1I;ENSP00000410837:M1I;ENSP00000310928:M1I;ENSP00000337063:M1I	ENSP00000310928:M1I	M	+	3	0	PPARD	35486845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.790000	0.69038	2.545000	0.85829	0.655000	0.94253	ATG	.		0.622	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238	Missense_Mutation
PPP1R12C	54776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55606963	55606963	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:55606963T>C	ENST00000263433.3	-	10	1251	c.1236A>G	c.(1234-1236)gaA>gaG	p.E412E	PPP1R12C_ENST00000435544.2_Silent_p.E338E|PPP1R12C_ENST00000376393.2_Silent_p.E412E	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		AGGGGGCCTCTTCAAGCTGCT	0.592																																					p.E412E		.											.	PPP1R12C	227	0			c.A1236G						.						9.0	11.0	10.0					19																	55606963		2192	4275	6467	SO:0001819	synonymous_variant	54776	exon10			GGCCTCTTCAAGC	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.1236A>G	19.37:g.55606963T>C		25.0	0.0		54.0	18.0	NM_017607		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			.		0.592	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
PPP2R4	5524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131909700	131909700	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr9:131909700A>G	ENST00000337738.1	+	11	1301	c.1034A>G	c.(1033-1035)aAg>aGg	p.K345R	PPP2R4_ENST00000435132.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000414510.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000432651.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000347048.4_Missense_Mutation_p.K91R|PPP2R4_ENST00000393370.2_Missense_Mutation_p.K310R|PPP2R4_ENST00000348141.5_Missense_Mutation_p.K316R|PPP2R4_ENST00000423100.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000355007.3_Missense_Mutation_p.K268R|PPP2R4_ENST00000419582.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000357197.4_Missense_Mutation_p.K281R|PPP2R4_ENST00000434095.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000358994.4_Missense_Mutation_p.K310R	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	345					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CAGCACTTCAAGTTCGGGAGC	0.632																																					p.K345R	Colon(158;2158 2504 4450 20433)	.											.	PPP2R4	660	0			c.A1034G						.						90.0	71.0	78.0					9																	131909700		2203	4300	6503	SO:0001583	missense	5524	exon11			ACTTCAAGTTCGG	X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.1034A>G	9.37:g.131909700A>G	ENSP00000337448:p.Lys345Arg	43.0	0.0		88.0	44.0	NM_178001	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	37		.	.	.	.	.	.	.	.	.	.	A	13.87	2.365001	0.41902	.	.	ENSG00000119383	ENST00000358994;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000347048;ENST00000357197;ENST00000355007;ENST00000423100;ENST00000414510;ENST00000419582;ENST00000432651;ENST00000435132;ENST00000434095	T;T;T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.16	4.02	0.46733	.	0.045098	0.85682	D	0.000000	T	0.19765	0.0475	N	0.17248	0.465	0.80722	D	1	B;B;B;B;B	0.15473	0.0;0.013;0.001;0.001;0.001	B;B;B;B;B	0.28465	0.005;0.09;0.004;0.012;0.002	T	0.05305	-1.0893	10	0.25106	T	0.35	.	9.9436	0.41596	0.9199:0.0:0.0801:0.0	.	281;91;268;345;310	Q15257-3;Q68CR8;Q15257-4;Q15257;Q15257-2	.;.;.;PTPA_HUMAN;.	R	310;310;345;316;91;281;268;48;48;48;48;48;48	ENSP00000351885:K310R;ENSP00000377036:K310R;ENSP00000337448:K345R;ENSP00000335200:K316R;ENSP00000337412:K91R;ENSP00000349726:K281R;ENSP00000347109:K268R;ENSP00000408316:K48R;ENSP00000408726:K48R;ENSP00000394001:K48R;ENSP00000416661:K48R;ENSP00000387726:K48R;ENSP00000411604:K48R	ENSP00000337448:K345R	K	+	2	0	PPP2R4	130949521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.960000	0.76036	0.812000	0.34326	0.459000	0.35465	AAG	.		0.632	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131	
PPP2R4	5524	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131909703	131909703	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr9:131909703T>C	ENST00000337738.1	+	11	1304	c.1037T>C	c.(1036-1038)tTc>tCc	p.F346S	PPP2R4_ENST00000435132.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000414510.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000432651.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000347048.4_Missense_Mutation_p.F92S|PPP2R4_ENST00000393370.2_Missense_Mutation_p.F311S|PPP2R4_ENST00000348141.5_Missense_Mutation_p.F317S|PPP2R4_ENST00000423100.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000355007.3_Missense_Mutation_p.F269S|PPP2R4_ENST00000419582.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000357197.4_Missense_Mutation_p.F282S|PPP2R4_ENST00000434095.1_Missense_Mutation_p.F49S|PPP2R4_ENST00000358994.4_Missense_Mutation_p.F311S	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	346					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CACTTCAAGTTCGGGAGCCTG	0.637																																					p.F346S	Colon(158;2158 2504 4450 20433)	.											.	PPP2R4	660	0			c.T1037C						.						89.0	70.0	76.0					9																	131909703		2203	4300	6503	SO:0001583	missense	5524	exon11			TCAAGTTCGGGAG	X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.1037T>C	9.37:g.131909703T>C	ENSP00000337448:p.Phe346Ser	40.0	1.0		87.0	45.0	NM_178001	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	37		.	.	.	.	.	.	.	.	.	.	T	33	5.231764	0.95207	.	.	ENSG00000119383	ENST00000358994;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000347048;ENST00000357197;ENST00000355007;ENST00000423100;ENST00000414510;ENST00000419582;ENST00000432651;ENST00000435132;ENST00000434095	T;T;T;T;T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;1.04;0.73;0.73;1.04;1.04;1.04;1.04;1.04;1.04	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.78566	0.4303	H	0.96861	3.895	0.80722	D	1	P;D;P;D;D	0.89917	0.892;0.999;0.938;0.997;1.0	P;D;P;D;D	0.81914	0.883;0.986;0.851;0.992;0.995	D	0.86023	0.1508	10	0.87932	D	0	.	14.1769	0.65546	0.0:0.0:0.0:1.0	.	282;92;269;346;311	Q15257-3;Q68CR8;Q15257-4;Q15257;Q15257-2	.;.;.;PTPA_HUMAN;.	S	311;311;346;317;92;282;269;49;49;49;49;49;49	ENSP00000351885:F311S;ENSP00000377036:F311S;ENSP00000337448:F346S;ENSP00000335200:F317S;ENSP00000337412:F92S;ENSP00000349726:F282S;ENSP00000347109:F269S;ENSP00000408316:F49S;ENSP00000408726:F49S;ENSP00000394001:F49S;ENSP00000416661:F49S;ENSP00000387726:F49S;ENSP00000411604:F49S	ENSP00000337448:F346S	F	+	2	0	PPP2R4	130949524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.539000	0.82063	1.944000	0.56390	0.459000	0.35465	TTC	.		0.637	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131	
PTGER3	5733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	71512812	71512812	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:71512812G>A	ENST00000306666.5	-	1	659	c.449C>T	c.(448-450)gCc>gTc	p.A150V	ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000460330.1_Missense_Mutation_p.A150V|PTGER3_ENST00000414819.1_Missense_Mutation_p.A150V|PTGER3_ENST00000370931.3_Missense_Mutation_p.A150V|PTGER3_ENST00000370924.4_Missense_Mutation_p.A150V|PTGER3_ENST00000354608.5_Missense_Mutation_p.A150V|PTGER3_ENST00000370932.2_Missense_Mutation_p.A150V|PTGER3_ENST00000351052.5_Missense_Mutation_p.A150V|PTGER3_ENST00000356595.4_Missense_Mutation_p.A150V	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	150					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GACGGCCATGGCGCTGGCGAT	0.662																																					p.A150V		.											.	PTGER3	660	0			c.C449T						.						14.0	15.0	14.0					1																	71512812		2194	4281	6475	SO:0001583	missense	5733	exon1			GCCATGGCGCTGG	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.449C>T	1.37:g.71512812G>A	ENSP00000302313:p.Ala150Val	24.0	0.0		51.0	24.0	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	37	CCDS657.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146958	0.77888	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	4.9	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	L	0.59912	1.85	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.997;0.997;0.997;0.999;0.999;0.993;0.996;0.997	D;D;D;D;D;P;P;D	0.70487	0.943;0.943;0.962;0.969;0.969;0.906;0.906;0.943	T	0.22173	-1.0224	10	0.28530	T	0.3	-18.8832	13.4836	0.61353	0.0758:0.0:0.9242:0.0	.	150;150;150;150;150;150;150;150	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	V	150	ENSP00000359969:A150V;ENSP00000359970:A150V;ENSP00000280208:A150V;ENSP00000418073:A150V;ENSP00000346624:A150V;ENSP00000349003:A150V;ENSP00000401423:A150V;ENSP00000302313:A150V;ENSP00000359962:A150V	ENSP00000302313:A150V	A	-	2	0	PTGER3	71285400	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.371000	0.66150	1.282000	0.44496	0.462000	0.41574	GCC	.		0.662	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
PTPRH	5794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55716907	55716907	+	Missense_Mutation	SNP	C	C	A	rs144055741	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:55716907C>A	ENST00000376350.3	-	4	428	c.406G>T	c.(406-408)Gcc>Tcc	p.A136S	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	136	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CAGGTCAGGGCGATGGAGCTG	0.592																																					p.A136S		.											.	PTPRH	138	0			c.G406T						.						106.0	86.0	93.0					19																	55716907		2203	4300	6503	SO:0001583	missense	5794	exon4			TCAGGGCGATGGA		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.406G>T	19.37:g.55716907C>A	ENSP00000365528:p.Ala136Ser	255.0	0.0		396.0	156.0	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	c	0.017	-1.509536	0.00984	.	.	ENSG00000080031	ENST00000376350	T	0.55413	0.52	4.23	2.09	0.27110	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.265460	0.06178	N	0.678911	T	0.28764	0.0713	N	0.04162	-0.26	0.29679	N	0.841854	B	0.14438	0.01	B	0.10450	0.005	T	0.26780	-1.0093	10	0.08599	T	0.76	.	9.1546	0.36985	0.0:0.1011:0.0:0.8989	.	136	Q9HD43	PTPRH_HUMAN	S	136	ENSP00000365528:A136S	ENSP00000365528:A136S	A	-	1	0	PTPRH	60408719	0.733000	0.28132	0.086000	0.20670	0.000000	0.00434	0.023000	0.13533	0.177000	0.19895	-2.885000	0.00097	GCC	C|1.000;T|0.000		0.592	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
RALBP1	10928	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	9535918	9535918	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:9535918A>T	ENST00000019317.4	+	10	2174	c.1951A>T	c.(1951-1953)Aag>Tag	p.K651*	RALBP1_ENST00000383432.3_Nonsense_Mutation_p.K651*			Q15311	RBP1_HUMAN	ralA binding protein 1	651					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	CAGGGATAGGAAGGAGACGTC	0.627																																					p.K651X		.											.	RALBP1	522	0			c.A1951T						.						20.0	23.0	22.0					18																	9535918		2199	4289	6488	SO:0001587	stop_gained	10928	exon10			GATAGGAAGGAGA	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1951A>T	18.37:g.9535918A>T	ENSP00000019317:p.Lys651*	75.0	1.0		153.0	52.0	NM_006788	D3DUI0	Nonsense_Mutation	SNP	ENST00000019317.4	37	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	A	39	7.312512	0.98203	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	.	.	.	5.01	5.01	0.66863	.	0.055233	0.64402	D	0.000001	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.127	15.0425	0.71803	1.0:0.0:0.0:0.0	.	.	.	.	X	651	.	ENSP00000019317:K651X	K	+	1	0	RALBP1	9525918	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.969000	0.63735	2.006000	0.58801	0.533000	0.62120	AAG	.		0.627	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	114425456	114425456	+	Silent	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:114425456A>T	ENST00000424776.3	+	1	1494	c.1452A>T	c.(1450-1452)ggA>ggT	p.G484G	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	484	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCAACAGTGGAGGCTGCTCGC	0.637																																					p.G484G		.											.	.	.	0			c.A1452T						.						35.0	37.0	36.0					X																	114425456		692	1591	2283	SO:0001819	synonymous_variant	139804	exon1			CAGTGGAGGCTGC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1452A>T	X.37:g.114425456A>T		33.0	0.0		62.0	13.0	NM_001145346	B4DXC0	Silent	SNP	ENST00000424776.3	37	CCDS55478.1																																																																																			.		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RCOR1	23186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	103174914	103174914	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:103174914A>G	ENST00000570597.1	+	6	764	c.764A>G	c.(763-765)gAg>gGg	p.E255G	RCOR1_ENST00000262241.6_Missense_Mutation_p.E258G			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	255					blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						CGGGAGCGGGAGGAGAGGTGA	0.483																																					p.E258G		.											.	RCOR1	91	0			c.A773G						.						97.0	102.0	100.0					14																	103174914		2203	4300	6503	SO:0001583	missense	23186	exon6			AGCGGGAGGAGAG	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.764A>G	14.37:g.103174914A>G	ENSP00000459789:p.Glu255Gly	83.0	1.0		95.0	29.0	NM_015156	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	37		.	.	.	.	.	.	.	.	.	.	A	16.91	3.253093	0.59212	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.88	5.88	0.94601	.	0.105736	0.64402	D	0.000005	T	0.44850	0.1313	N	0.21142	0.635	0.58432	D	0.999997	B	0.15719	0.014	B	0.15484	0.013	T	0.31668	-0.9935	9	0.21014	T	0.42	-28.233	16.2879	0.82732	1.0:0.0:0.0:0.0	.	255	Q9UKL0	RCOR1_HUMAN	G	255	.	ENSP00000262241:E255G	E	+	2	0	RCOR1	102244667	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	5.846000	0.69444	2.242000	0.73789	0.533000	0.62120	GAG	.		0.483	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156	
RNF182	221687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	13977395	13977395	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:13977395T>C	ENST00000488300.1	+	3	568	c.45T>C	c.(43-45)tcT>tcC	p.S15S	RNF182_ENST00000544682.1_Silent_p.S15S|RNF182_ENST00000537388.1_Silent_p.S15S|RNF182_ENST00000537663.1_Silent_p.S15S	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	15					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CTCAGGCCTCTGATGAGCTGG	0.463																																					p.S15S		.											.	RNF182	586	0			c.T45C						.						113.0	114.0	114.0					6																	13977395		2203	4300	6503	SO:0001819	synonymous_variant	221687	exon4			GGCCTCTGATGAG	AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.45T>C	6.37:g.13977395T>C		113.0	0.0		193.0	85.0	NM_001165032	B2RDG2|Q8NBG3	Silent	SNP	ENST00000488300.1	37	CCDS4531.1																																																																																			.		0.463	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039911.2	NM_152737	
RXFP3	51289	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	33937817	33937817	+	Silent	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:33937817C>A	ENST00000330120.3	+	1	1327	c.972C>A	c.(970-972)gtC>gtA	p.V324V		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	324					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						TGTCGAAGGTCACCAAATCAG	0.657																																					p.V324V		.											.	RXFP3	91	0			c.C972A						.						56.0	48.0	51.0					5																	33937817		2203	4300	6503	SO:0001819	synonymous_variant	51289	exon1			GAAGGTCACCAAA	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.972C>A	5.37:g.33937817C>A		58.0	2.0		170.0	102.0	NM_016568	Q14DA5	Silent	SNP	ENST00000330120.3	37	CCDS3900.1																																																																																			.		0.657	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
SASH1	23328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	148867236	148867236	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:148867236T>A	ENST00000367467.3	+	19	3909	c.3434T>A	c.(3433-3435)aTg>aAg	p.M1145K		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1145					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCCGCCAACATGGACCAGATC	0.602																																					p.M1145K		.											.	SASH1	90	0			c.T3434A						.						71.0	64.0	66.0					6																	148867236		2203	4300	6503	SO:0001583	missense	23328	exon19			CCAACATGGACCA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3434T>A	6.37:g.148867236T>A	ENSP00000356437:p.Met1145Lys	57.0	0.0		104.0	51.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028284	0.75390	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	T	0.41065	1.01	5.46	5.46	0.80206	.	0.229371	0.64402	D	0.000020	T	0.17195	0.0413	N	0.24115	0.695	0.51767	D	0.999936	P	0.36048	0.534	B	0.28553	0.091	T	0.11084	-1.0602	10	0.87932	D	0	-18.4612	15.5466	0.76108	0.0:0.0:0.0:1.0	.	1145	O94885	SASH1_HUMAN	K	1145;555	ENSP00000356437:M1145K	ENSP00000356437:M1145K	M	+	2	0	SASH1	148908929	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.519000	0.81809	2.077000	0.62373	0.533000	0.62120	ATG	.		0.602	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SCCPDH	51097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	246923373	246923373	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:246923373A>T	ENST00000366510.3	+	8	1304	c.928A>T	c.(928-930)Ata>Tta	p.I310L		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	310						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		GCAACTTCTCATAAAAGTAAG	0.308																																					p.I310L		.											.	SCCPDH	91	0			c.A928T						.						175.0	162.0	167.0					1																	246923373		2203	4300	6503	SO:0001583	missense	51097	exon8			CTTCTCATAAAAG		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.928A>T	1.37:g.246923373A>T	ENSP00000355467:p.Ile310Leu	854.0	1.0		934.0	323.0	NM_016002	Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	A	4.955	0.177422	0.09443	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.43688	0.94	5.43	1.28	0.21552	.	0.216134	0.53938	D	0.000052	T	0.15262	0.0368	N	0.01529	-0.815	0.46298	D	0.998973	B	0.06786	0.001	B	0.14578	0.011	T	0.05068	-1.0908	10	0.26408	T	0.33	.	9.7998	0.40757	0.7365:0.0:0.2635:0.0	.	310	Q8NBX0	SCPDL_HUMAN	L	310;141	ENSP00000355467:I310L	ENSP00000355466:I141L	I	+	1	0	SCCPDH	244989996	0.988000	0.35896	1.000000	0.80357	0.998000	0.95712	1.425000	0.34859	0.396000	0.25283	0.533000	0.62120	ATA	.		0.308	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002	
SEMA3C	10512	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	80432006	80432006	+	Silent	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:80432006G>T	ENST00000265361.3	-	9	1452	c.891C>A	c.(889-891)ggC>ggA	p.G297G	SEMA3C_ENST00000419255.2_Silent_p.G297G|SEMA3C_ENST00000536800.1_Silent_p.G149G|SEMA3C_ENST00000544525.1_Silent_p.G315G	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	297	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GTGTTTCTGGGCCGTCTTCAT	0.393																																					p.G297G		.											.	SEMA3C	515	0			c.C891A						.						118.0	108.0	111.0					7																	80432006		2203	4300	6503	SO:0001819	synonymous_variant	10512	exon9			TTCTGGGCCGTCT	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.891C>A	7.37:g.80432006G>T		148.0	1.0		173.0	62.0	NM_006379	B4DRL8	Silent	SNP	ENST00000265361.3	37	CCDS5596.1																																																																																			.		0.393	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
SEPT2	4735	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242275425	242275425	+	Missense_Mutation	SNP	A	A	G	rs533422343		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:242275425A>G	ENST00000391973.2	+	5	781	c.253A>G	c.(253-255)Act>Gct	p.T85A	SEPT2_ENST00000401990.1_Missense_Mutation_p.T95A|SEPT2_ENST00000391971.2_Missense_Mutation_p.T85A|SEPT2_ENST00000407971.1_Missense_Mutation_p.T45A|SEPT2_ENST00000402092.2_Missense_Mutation_p.T85A|SEPT2_ENST00000360051.3_Missense_Mutation_p.T85A	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	85	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		TGAGGCTTCAACTGTTGAAAT	0.438																																					p.T85A		.											.	SEPT2	68	0			c.A253G						.						82.0	80.0	81.0					2																	242275425		2203	4300	6503	SO:0001583	missense	4735	exon6			GCTTCAACTGTTG	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.253A>G	2.37:g.242275425A>G	ENSP00000375834:p.Thr85Ala	153.0	1.0		200.0	77.0	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868815	0.72065	.	.	ENSG00000168385	ENST00000391973;ENST00000428282;ENST00000360051;ENST00000407017;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000436795;ENST00000411484;ENST00000434955;ENST00000402092;ENST00000443492;ENST00000437066;ENST00000391972;ENST00000449239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.67625	2.065	0.80722	D	1	B;D;D	0.71674	0.298;0.997;0.998	B;D;D	0.83275	0.239;0.991;0.996	T	0.66500	-0.5908	10	0.41790	T	0.15	.	16.4075	0.83691	1.0:0.0:0.0:0.0	.	120;45;85	Q15019-2;B5MCX3;Q15019	.;.;SEPT2_HUMAN	A	85;45;85;45;85;95;45;85;96;85;85;45;85;120;85	ENSP00000375834:T85A;ENSP00000397195:T45A;ENSP00000353157:T85A;ENSP00000386001:T45A;ENSP00000375832:T85A;ENSP00000385109:T95A;ENSP00000384525:T45A;ENSP00000406181:T85A;ENSP00000394666:T96A;ENSP00000399767:T85A;ENSP00000385172:T85A;ENSP00000399195:T45A;ENSP00000412434:T85A;ENSP00000391717:T85A	ENSP00000353157:T85A	T	+	1	0	SEPT2	241924098	1.000000	0.71417	0.467000	0.27180	0.995000	0.86356	8.649000	0.91067	2.275000	0.75901	0.528000	0.53228	ACT	.		0.438	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
SIGLEC1	6614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3669214	3669214	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:3669214A>T	ENST00000344754.4	-	21	5122	c.5123T>A	c.(5122-5124)cTg>cAg	p.L1708Q	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.W1684R	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1708					cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						TGGTCAGCCCAGGGGTGGGGC	0.577																																					p.L1708Q		.											.	SIGLEC1	167	0			c.T5123A						.						57.0	45.0	49.0					20																	3669214		2201	4297	6498	SO:0001583	missense	6614	exon21			CAGCCCAGGGGTG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.5123T>A	20.37:g.3669214A>T	ENSP00000341141:p.Leu1708Gln	81.0	0.0		107.0	44.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.06|15.06	2.720618|2.720618	0.48728|0.48728	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000344754|ENST00000202578	T|T	0.24151|0.22134	1.87|1.97	4.76|4.76	2.43|2.43	0.29744|0.29744	.|.	.|.	.|.	.|.	.|.	T|T	0.12347|0.12347	0.0300|0.0300	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|B	0.20550|0.02656	0.046|0.0	B|B	0.14578|0.01281	0.011|0.0	T|T	0.26780|0.26780	-1.0093|-1.0093	9|9	0.87932|0.87932	D|D	0|0	.|.	4.1782|4.1782	0.10362|0.10362	0.7253:0.0:0.0972:0.1776|0.7253:0.0:0.0972:0.1776	.|.	1708|1684	Q9BZZ2|Q9BZZ2-3	SN_HUMAN|.	Q|R	1708|1684	ENSP00000341141:L1708Q|ENSP00000202578:W1684R	ENSP00000341141:L1708Q|ENSP00000202578:W1684R	L|W	-|-	2|1	0|0	SIGLEC1|SIGLEC1	3617214|3617214	0.003000|0.003000	0.15002|0.15002	0.505000|0.505000	0.27651|0.27651	0.028000|0.028000	0.11728|0.11728	1.202000|1.202000	0.32271|0.32271	0.374000|0.374000	0.24650|0.24650	0.454000|0.454000	0.30748|0.30748	CTG|TGG	.		0.577	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SLC1A3	6507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	36684073	36684073	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:36684073C>T	ENST00000265113.4	+	9	1873	c.1397C>T	c.(1396-1398)aCg>aTg	p.T466M	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Intron	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	466					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GACGACATCACGCTCATCATC	0.597																																					p.T466M		.											.	SLC1A3	90	0			c.C1397T						.						171.0	143.0	153.0					5																	36684073		2203	4300	6503	SO:0001583	missense	6507	exon9			ACATCACGCTCAT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1397C>T	5.37:g.36684073C>T	ENSP00000265113:p.Thr466Met	173.0	0.0		383.0	87.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732405	0.89482	.	.	ENSG00000079215	ENST00000265113;ENST00000427100	T	0.59502	0.26	5.74	5.74	0.90152	.	0.047302	0.85682	D	0.000000	T	0.80592	0.4652	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.83127	-0.0115	10	0.87932	D	0	-17.5109	19.9326	0.97124	0.0:1.0:0.0:0.0	.	466	P43003	EAA1_HUMAN	M	466;414	ENSP00000265113:T466M	ENSP00000265113:T466M	T	+	2	0	SLC1A3	36719830	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	5.969000	0.70422	2.720000	0.93068	0.650000	0.86243	ACG	.		0.597	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
SLC22A18	5002	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	2939298	2939298	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:2939298G>T	ENST00000380574.1	+	7	1167	c.736G>T	c.(736-738)Gtg>Ttg	p.V246L	SLC22A18_ENST00000449793.2_Missense_Mutation_p.V148L|SLC22A18_ENST00000312221.5_Missense_Mutation_p.V246L|SLC22A18_ENST00000347936.2_Missense_Mutation_p.V246L|SLC22A18_ENST00000441077.1_3'UTR			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	246					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		GATCTTCCTGGTGAAGGTGGC	0.687																																					p.V246L		.											.	SLC22A18	92	0			c.G736T						.						69.0	59.0	63.0					11																	2939298		2202	4299	6501	SO:0001583	missense	5002	exon7			TTCCTGGTGAAGG	AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.736G>T	11.37:g.2939298G>T	ENSP00000369948:p.Val246Leu	105.0	1.0		151.0	46.0	NM_002555	O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Missense_Mutation	SNP	ENST00000380574.1	37	CCDS7740.1	.	.	.	.	.	.	.	.	.	.	G	6.623	0.483455	0.12581	.	.	ENSG00000110628	ENST00000347936;ENST00000312221;ENST00000449793;ENST00000380574	T;T;T;T	0.57273	0.57;0.57;0.41;0.57	3.74	-2.89	0.05665	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.297275	0.26268	N	0.025352	T	0.43188	0.1236	M	0.69823	2.125	0.23546	N	0.997446	P;B	0.36483	0.555;0.009	B;B	0.33454	0.164;0.017	T	0.40997	-0.9533	10	0.52906	T	0.07	-11.2065	8.7325	0.34507	0.7073:0.0:0.2927:0.0	.	148;246	E9PRM7;Q96BI1	.;S22AI_HUMAN	L	246;246;148;246	ENSP00000307859:V246L;ENSP00000311139:V246L;ENSP00000392072:V148L;ENSP00000369948:V246L	ENSP00000311139:V246L	V	+	1	0	SLC22A18	2895874	0.004000	0.15560	0.081000	0.20488	0.009000	0.06853	-0.119000	0.10676	-0.404000	0.07610	-0.350000	0.07774	GTG	.		0.687	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027770.1	NM_183233	
SLFN11	91607	ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33690385	33690385	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:33690385C>A	ENST00000394566.1	-	4	714	c.442G>T	c.(442-444)Gca>Tca	p.A148S	SLFN11_ENST00000308377.4_Missense_Mutation_p.A148S	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	148					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAACAGAATGCCTCTCTTGAG	0.468																																					p.A148S		.											.	SLFN11	159	0			c.G442T						.						83.0	84.0	84.0					17																	33690385		2203	4300	6503	SO:0001583	missense	91607	exon2			AGAATGCCTCTCT	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.442G>T	17.37:g.33690385C>A	ENSP00000378067:p.Ala148Ser	133.0	2.0		142.0	42.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	37	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122495	0.56613	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	T;T	0.03035	4.07;4.07	4.33	2.22	0.28083	.	0.199884	0.24876	N	0.034883	T	0.07999	0.0200	M	0.84082	2.675	0.09310	N	1	P	0.43857	0.819	B	0.43889	0.435	T	0.10497	-1.0627	10	0.87932	D	0	.	7.2927	0.26374	0.0:0.7859:0.0:0.2141	.	148	Q7Z7L1	SLN11_HUMAN	S	148	ENSP00000312402:A148S;ENSP00000378067:A148S	ENSP00000312402:A148S	A	-	1	0	SLFN11	30714498	0.096000	0.21769	0.000000	0.03702	0.003000	0.03518	0.916000	0.28651	1.011000	0.39340	0.655000	0.94253	GCA	.		0.468	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
SLIT3	6586	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	168127670	168127670	+	Silent	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:168127670A>G	ENST00000519560.1	-	27	3278	c.2859T>C	c.(2857-2859)acT>acC	p.T953T	SLIT3_ENST00000404867.3_Silent_p.T953T|SLIT3_ENST00000332966.8_Silent_p.T960T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	953	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGATGGGCACAGTGCAGTCCT	0.597																																					p.T960T	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.T2880C						.						101.0	86.0	91.0					5																	168127670		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon27			GGGCACAGTGCAG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2859T>C	5.37:g.168127670A>G		153.0	1.0		176.0	60.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			.		0.597	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SMG8	55181	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57288227	57288227	+	Missense_Mutation	SNP	A	A	G	rs548055635		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:57288227A>G	ENST00000543872.2	+	2	1079	c.815A>G	c.(814-816)aAt>aGt	p.N272S	CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.N272S|SMG8_ENST00000578922.1_Missense_Mutation_p.N272S			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	272					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TTTCAACTCAATGGAGCCCTC	0.517													A|||	1	0.000199681	0.0	0.0	5008	,	,		20521	0.0		0.0	False		,,,				2504	0.001				p.N272S		.											.	SMG8	93	0			c.A815G						.						72.0	82.0	79.0					17																	57288227		2203	4300	6503	SO:0001583	missense	55181	exon1			AACTCAATGGAGC	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.815A>G	17.37:g.57288227A>G	ENSP00000438748:p.Asn272Ser	67.0	1.0		126.0	74.0	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	A	8.343	0.829101	0.16749	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.47528	0.84;0.84	5.46	5.46	0.80206	.	0.122499	0.85682	D	0.000000	T	0.40546	0.1121	L	0.51422	1.61	0.52099	D	0.999947	B	0.33135	0.399	B	0.28916	0.096	T	0.23691	-1.0181	10	0.18276	T	0.48	-24.8098	14.8818	0.70540	1.0:0.0:0.0:0.0	.	272	Q8ND04	SMG8_HUMAN	S	272	ENSP00000300917:N272S;ENSP00000438748:N272S	ENSP00000300917:N272S	N	+	2	0	SMG8	54643009	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.517000	0.81783	2.291000	0.77112	0.533000	0.62120	AAT	.		0.517	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
ST13	6767	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41223190	41223190	+	Missense_Mutation	SNP	C	C	A	rs710193	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:41223190C>A	ENST00000216218.3	-	11	1372	c.891G>T	c.(889-891)atG>atT	p.M297I		NM_003932.3	NP_003923.2	P50502	F10A1_HUMAN	suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)	297	Gly/Met/Pro-rich.		M -> I (in dbSNP:rs710193).		chaperone cofactor-dependent protein refolding (GO:0070389)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	dATP binding (GO:0032564)|protein binding, bridging (GO:0030674)			cervix(1)|large_intestine(1)|lung(3)|skin(1)	6						CCATTCCAGGCATTCCTCCGG	0.458																																					p.M297I		.											.	ST13	226	0			c.G891T						.						53.0	58.0	56.0					22																	41223190		2203	4298	6501	SO:0001583	missense	6767	exon11			TCCAGGCATTCCT		CCDS14006.1	22q13.2	2013-01-10	2001-11-29		ENSG00000100380	ENSG00000100380		"""Tetratricopeptide (TTC) repeat domain containing"""	11343	protein-coding gene	gene with protein product	"""progesterone receptor-associated p48 protein"""	606796	"""suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein)"""			9925927, 8721986	Standard	NM_003932		Approved	SNC6, HSPABP1, HIP, P48, FAM10A1	uc003aze.3	P50502	OTTHUMG00000151201	ENST00000216218.3:c.891G>T	22.37:g.41223190C>A	ENSP00000216218:p.Met297Ile	39.0	0.0		49.0	20.0	NM_003932	O14999|Q2TU77	Missense_Mutation	SNP	ENST00000216218.3	37	CCDS14006.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812778	0.32053	.	.	ENSG00000100380	ENST00000216218	D	0.84730	-1.89	5.01	5.01	0.66863	.	0.135171	0.64402	D	0.000003	D	0.85396	0.5687	M	0.80746	2.51	0.43803	D	0.996355	B;B	0.27765	0.188;0.188	B;B	0.31101	0.124;0.124	T	0.82544	-0.0404	10	0.26408	T	0.33	.	13.9913	0.64369	0.1521:0.8479:0.0:0.0	.	287;297	B4E0U6;P50502	.;F10A1_HUMAN	I	297	ENSP00000216218:M297I	ENSP00000216218:M297I	M	-	3	0	ST13	39553136	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.292000	0.51772	2.340000	0.79590	0.555000	0.69702	ATG	C|0.941;T|0.059		0.458	ST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321759.1	NM_003932	
ST6GALNAC1	55808	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74625419	74625419	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:74625419C>T	ENST00000156626.7	-	2	705	c.506G>A	c.(505-507)gGc>gAc	p.G169D	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	169					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCTGGTCTGGCCCCCATTTCC	0.582																																					p.G169D		.											.	ST6GALNAC1	90	0			c.G506A						.						176.0	154.0	161.0					17																	74625419		2203	4300	6503	SO:0001583	missense	55808	exon2			GTCTGGCCCCCAT	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.506G>A	17.37:g.74625419C>T	ENSP00000156626:p.Gly169Asp	345.0	2.0		670.0	201.0	NM_018414	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	C	0.170	-1.072512	0.01918	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.20463	2.1;2.07	3.77	-2.32	0.06745	.	1.514510	0.03972	N	0.291858	T	0.07324	0.0185	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25779	-1.0122	10	0.02654	T	1	-4.3073	4.0007	0.09579	0.0:0.2255:0.359:0.4155	.	169	Q9NSC7	SIA7A_HUMAN	D	169	ENSP00000156626:G169D;ENSP00000351991:G169D	ENSP00000156626:G169D	G	-	2	0	ST6GALNAC1	72137014	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-2.038000	0.01419	-0.401000	0.07644	0.491000	0.48974	GGC	.		0.582	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
STXBP3	6814	ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109340798	109340799	+	Missense_Mutation	DNP	GG	GG	TT	rs374868665		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.|Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:109340798_109340799GG>TT	ENST00000370008.3	+	16	1438_1439	c.1388_1389GG>TT	c.(1387-1389)cGG>cTT	p.R463L		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	463					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AGAAAGGATCGGTCTGCAGAAG	0.332																																					p.R463L|p.R463R		.											.	STXBP3	93	0			c.G1388T|c.G1389T						.																																			SO:0001583	missense	6814	exon16			AGGATCGGTCTGC|GGATCGGTCTGCA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	Exception_encountered	1.37:g.109340798_109340799delinsTT	ENSP00000359025:p.Arg463Leu	533.0|536.0	2.0|1.0		600.0|598.0	246.0|245.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation|Silent	SNP	ENST00000370008.3	37	CCDS790.1																																																																																			.		0.332	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
SULT2B1	6820	ucsc.edu;bcgsc.ca	37	19	49094943	49094943	+	Missense_Mutation	SNP	G	G	T	rs149312079	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:49094943G>T	ENST00000201586.2	+	4	679	c.501G>T	c.(499-501)aaG>aaT	p.K167N	SULT2B1_ENST00000323090.4_Missense_Mutation_p.K152N|SULT2B1_ENST00000594274.1_3'UTR	NM_177973.1	NP_814444.1	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	167					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	alcohol sulfotransferase activity (GO:0004027)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	11		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		GGCAGTTAAAGGACCCGGGCA	0.622																																					p.K167N		.											.	SULT2B1	91	0			c.G501T						.						40.0	35.0	37.0					19																	49094943		2202	4300	6502	SO:0001583	missense	6820	exon4			GTTAAAGGACCCG	U92314	CCDS12723.1, CCDS12724.1	19q13.3	2008-02-05				ENSG00000088002		"""Sulfotransferases, cytosolic"""	11459	protein-coding gene	gene with protein product		604125				9799594	Standard	NM_177973		Approved	HSST2	uc002pjl.3	O00204		ENST00000201586.2:c.501G>T	19.37:g.49094943G>T	ENSP00000201586:p.Lys167Asn	45.0	0.0		52.0	6.0	NM_177973	O00205|O75814	Missense_Mutation	SNP	ENST00000201586.2	37	CCDS12723.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688163	0.48097	.	.	ENSG00000088002	ENST00000201586;ENST00000323090	T;T	0.01613	4.73;4.73	4.3	2.17	0.27698	Sulfotransferase domain (1);	0.086854	0.48286	D	0.000200	T	0.06005	0.0156	M	0.70108	2.13	0.30433	N	0.776949	P;D	0.63046	0.928;0.992	B;P	0.61132	0.391;0.884	T	0.02138	-1.1207	10	0.49607	T	0.09	.	8.1002	0.30852	0.204:0.0:0.796:0.0	.	152;167	O00204-2;O00204	.;ST2B1_HUMAN	N	167;152	ENSP00000201586:K167N;ENSP00000312880:K152N	ENSP00000201586:K167N	K	+	3	2	SULT2B1	53786755	0.993000	0.37304	0.988000	0.46212	0.413000	0.31143	0.390000	0.20768	1.111000	0.41721	0.655000	0.94253	AAG	G|0.998;A|0.002		0.622	SULT2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466140.1	NM_004605	
SYCP2	10388	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	58444857	58444857	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:58444857delC	ENST00000357552.3	-	36	3962	c.3737delG	c.(3736-3738)agafs	p.R1246fs	SYCP2_ENST00000371001.2_Frame_Shift_Del_p.R1246fs			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1246					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ACTTACCTCTCTTTTGCTTTG	0.299																																					p.R1246fs		.											.	SYCP2	525	0			c.3737delG						.						109.0	105.0	107.0					20																	58444857		2199	4296	6495	SO:0001589	frameshift_variant	10388	exon35			ACCTCTCTTTTGC	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3737delG	20.37:g.58444857delC	ENSP00000350162:p.Arg1246fs	280.0	0.0		196.0	70.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Frame_Shift_Del	DEL	ENST00000357552.3	37	CCDS13482.1																																																																																			.		0.299	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	40854035	40854035	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:40854035T>A	ENST00000255224.3	-	2	727	c.359A>T	c.(358-360)aAt>aTt	p.N120I	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.N102I	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	120					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CGGGGTTGCATTCTCCAGATC	0.433																																					p.N120I	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4	132	0			c.A359T						.						118.0	116.0	117.0					18																	40854035		2203	4298	6501	SO:0001583	missense	6860	exon2			GTTGCATTCTCCA	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.359A>T	18.37:g.40854035T>A	ENSP00000255224:p.Asn120Ile	207.0	0.0		329.0	105.0	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	T	7.314	0.615635	0.14129	.	.	ENSG00000132872	ENST00000255224	T	0.37235	1.21	5.87	2.2	0.27929	.	0.335126	0.36002	N	0.002846	T	0.27489	0.0675	L	0.44542	1.39	0.33493	D	0.589003	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.25222	-1.0138	10	0.28530	T	0.3	.	9.812	0.40828	0.0:0.1939:0.0:0.8061	.	102;120	B4DEU3;Q9H2B2	.;SYT4_HUMAN	I	120	ENSP00000255224:N120I	ENSP00000255224:N120I	N	-	2	0	SYT4	39108033	1.000000	0.71417	0.949000	0.38748	0.606000	0.37113	3.844000	0.55873	0.206000	0.20587	0.533000	0.62120	AAT	.		0.433	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
SYT6	148281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114646254	114646254	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:114646254G>T	ENST00000610222.1	-	4	1307	c.1161C>A	c.(1159-1161)aaC>aaA	p.N387K	SYT6_ENST00000607941.1_Missense_Mutation_p.N302K|SYT6_ENST00000393296.1_Missense_Mutation_p.N387K|SYT6_ENST00000369547.1_Missense_Mutation_p.N302K|SYT6_ENST00000609117.1_Missense_Mutation_p.N302K			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	387	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCGCCTTGAGGTTCCGACACT	0.537																																					p.N302K		.											.	SYT6	94	0			c.C906A						.						144.0	113.0	124.0					1																	114646254		2203	4300	6503	SO:0001583	missense	148281	exon4			CTTGAGGTTCCGA		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1161C>A	1.37:g.114646254G>T	ENSP00000476396:p.Asn387Lys	76.0	0.0		83.0	39.0	NM_205848	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	37		.	.	.	.	.	.	.	.	.	.	G	19.53	3.844182	0.71488	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.71	3.82	0.43975	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.75488	0.3856	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.77600	-0.2527	10	0.87932	D	0	.	6.7243	0.23348	0.4015:0.0:0.5985:0.0	.	387	Q5T7P8	SYT6_HUMAN	K	302;387;302;387	ENSP00000358560:N302K;ENSP00000376974:N387K;ENSP00000358559:N302K;ENSP00000358558:N387K	ENSP00000358558:N387K	N	-	3	2	SYT6	114447777	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.247000	0.43151	0.738000	0.32606	0.561000	0.74099	AAC	.		0.537	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
TBX19	9095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	168262484	168262484	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:168262484T>C	ENST00000367821.3	+	3	622	c.571T>C	c.(571-573)Ttc>Ctc	p.F191L		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	191					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TGAAACCCAGTTCATAGCCGT	0.468																																					p.F191L		.											.	TBX19	90	0			c.T571C						.						91.0	70.0	77.0					1																	168262484		2203	4300	6503	SO:0001583	missense	9095	exon3			ACCCAGTTCATAG	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.571T>C	1.37:g.168262484T>C	ENSP00000356795:p.Phe191Leu	67.0	0.0		126.0	52.0	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	37	CCDS1272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.122564|5.122564	0.94429|0.94429	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000367821;ENST00000367828|ENST00000431969	D|.	0.93189|.	-3.18|.	5.02|5.02	5.02|5.02	0.67125|0.67125	p53-like transcription factor, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86422|0.86422	0.5929|0.5929	H|H	0.98199|0.98199	4.17|4.17	0.49582|.	D|.	0.999803|.	D;D|.	0.71674|.	0.998;0.99|.	D;P|.	0.64877|.	0.93;0.841|.	D|D	0.91584|0.91584	0.5281|0.5281	9|4	0.72032|.	D|.	0.01|.	.|.	14.4281|14.4281	0.67230|0.67230	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	191;122|.	O60806;B3KRD9|.	TBX19_HUMAN;.|.	L|A	191;131|123	ENSP00000356795:F191L|.	ENSP00000356795:F191L|.	F|V	+|+	1|2	0|0	TBX19|TBX19	166529108|166529108	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.507000|7.507000	0.81676|0.81676	1.884000|1.884000	0.54569|0.54569	0.460000|0.460000	0.39030|0.39030	TTC|GTT	.		0.468	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179603595	179603595	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:179603595A>T	ENST00000367614.1	+	8	1489	c.1130A>T	c.(1129-1131)cAg>cTg	p.Q377L	TDRD5_ENST00000444136.1_Missense_Mutation_p.Q377L|TDRD5_ENST00000294848.8_Missense_Mutation_p.Q377L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	377					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGTTTAGTTCAGTCAGATAAG	0.383																																					p.Q377L		.											.	TDRD5	94	0			c.A1130T						.						101.0	101.0	101.0					1																	179603595		2203	4300	6503	SO:0001583	missense	163589	exon8			TAGTTCAGTCAGA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1130A>T	1.37:g.179603595A>T	ENSP00000356586:p.Gln377Leu	183.0	0.0		184.0	73.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	A	9.612	1.131531	0.21041	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.12774	2.65;2.65;2.83	5.24	2.72	0.32119	.	0.626135	0.16158	N	0.226908	T	0.12689	0.0308	L	0.54323	1.7	0.29136	N	0.879299	B;B	0.12013	0.005;0.002	B;B	0.09377	0.004;0.002	T	0.12344	-1.0551	10	0.27785	T	0.31	-2.8607	8.2597	0.31777	0.687:0.0:0.0:0.313	.	377;377	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	L	377	ENSP00000356586:Q377L;ENSP00000294848:Q377L;ENSP00000406052:Q377L	ENSP00000294848:Q377L	Q	+	2	0	TDRD5	177870218	0.997000	0.39634	0.996000	0.52242	0.864000	0.49448	1.718000	0.38001	0.910000	0.36722	0.533000	0.62120	CAG	.		0.383	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TET3	200424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74327943	74327943	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:74327943A>T	ENST00000409262.3	+	9	3623	c.3623A>T	c.(3622-3624)cAg>cTg	p.Q1208L		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1208					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGCCCAGCCAGGCTGTTCCC	0.642																																					p.Q1208L		.											.	.	.	0			c.A3623T						.						20.0	23.0	22.0					2																	74327943		2075	4210	6285	SO:0001583	missense	200424	exon9			CCAGCCAGGCTGT		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.3623A>T	2.37:g.74327943A>T	ENSP00000386869:p.Gln1208Leu	46.0	0.0		69.0	27.0	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.871563	0.33069	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.12039	2.72	4.91	3.74	0.42951	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.364872	0.23811	N	0.044329	T	0.14830	0.0358	L	0.41961	1.31	0.37416	D	0.913455	B	0.31413	0.322	B	0.37198	0.243	T	0.09596	-1.0667	10	0.51188	T	0.08	.	10.5629	0.45156	0.6928:0.3072:0.0:0.0	.	1208	O43151	TET3_HUMAN	L	1208	ENSP00000386869:Q1208L	ENSP00000233310:Q1208L	Q	+	2	0	TET3	74181451	0.829000	0.29322	1.000000	0.80357	0.986000	0.74619	2.472000	0.45136	0.977000	0.38444	0.533000	0.62120	CAG	.		0.642	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
TGM1	7051	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24727745	24727745	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:24727745C>A	ENST00000206765.6	-	8	1417	c.1294G>T	c.(1294-1296)Gtc>Ttc	p.V432F	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	432					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GCTCACCAGACAGAATCATGG	0.572																																					p.V432F		.											.	TGM1	91	0			c.G1294T						.						143.0	121.0	128.0					14																	24727745		2203	4300	6503	SO:0001583	missense	7051	exon8			ACCAGACAGAATC	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1294G>T	14.37:g.24727745C>A	ENSP00000206765:p.Val432Phe	277.0	1.0		338.0	108.0	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241845	0.58995	.	.	ENSG00000092295	ENST00000206765	D	0.95690	-3.78	5.08	5.08	0.68730	Transglutaminase-like (2);	0.057299	0.64402	D	0.000002	D	0.97090	0.9049	M	0.67397	2.05	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	D	0.97467	1.0038	10	0.87932	D	0	.	16.0061	0.80363	0.0:1.0:0.0:0.0	.	432	P22735	TGM1_HUMAN	F	432	ENSP00000206765:V432F	ENSP00000206765:V432F	V	-	1	0	TGM1	23797585	0.013000	0.17824	0.887000	0.34795	0.837000	0.47467	0.180000	0.16860	2.648000	0.89879	0.561000	0.74099	GTC	.		0.572	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
TGM1	7051	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24730963	24730963	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:24730963A>G	ENST00000206765.6	-	3	569	c.446T>C	c.(445-447)aTg>aCg	p.M149T	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	149					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GAGGAGGAGCATATGGAAAGG	0.587																																					p.M149T		.											.	TGM1	91	0			c.T446C						.						133.0	117.0	123.0					14																	24730963		2203	4300	6503	SO:0001583	missense	7051	exon3			AGGAGCATATGGA	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.446T>C	14.37:g.24730963A>G	ENSP00000206765:p.Met149Thr	181.0	1.0		253.0	84.0	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	A	8.065	0.768902	0.15983	.	.	ENSG00000092295	ENST00000206765	D	0.86769	-2.17	5.09	3.95	0.45737	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.436117	0.25205	N	0.032343	D	0.83571	0.5283	L	0.52905	1.665	0.80722	D	1	B	0.19073	0.033	B	0.22880	0.042	T	0.79420	-0.1811	10	0.87932	D	0	-1.817	9.712	0.40251	0.9162:0.0:0.0838:0.0	.	149	P22735	TGM1_HUMAN	T	149	ENSP00000206765:M149T	ENSP00000206765:M149T	M	-	2	0	TGM1	23800803	0.203000	0.23435	0.001000	0.08648	0.005000	0.04900	4.454000	0.60068	0.795000	0.33922	0.379000	0.24179	ATG	.		0.587	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
TMEM170A	124491	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	75485578	75485578	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:75485578C>T	ENST00000561878.1	-	2	390	c.293G>A	c.(292-294)gGa>gAa	p.G98E	RP11-77K12.1_ENST00000561887.1_Intron|TMEM170A_ENST00000569540.1_Missense_Mutation_p.G60E|TMEM170A_ENST00000357613.4_Intron|TMEM170A_ENST00000567796.1_Missense_Mutation_p.G53E|TMEM170A_ENST00000569276.1_Missense_Mutation_p.G98E|TMEM170A_ENST00000566980.1_Intron|RP11-77K12.1_ENST00000567194.1_Intron	NM_145254.1	NP_660297.1	Q8WVE7	T170A_HUMAN	transmembrane protein 170A	98						integral component of membrane (GO:0016021)				endometrium(1)	1						TGTCAAGATTCCAGCAGTAAT	0.393																																					p.G98E		.											.	TMEM170A	68	0			c.G293A						.						115.0	101.0	106.0					16																	75485578		2198	4300	6498	SO:0001583	missense	124491	exon2			AAGATTCCAGCAG	BX648484	CCDS10917.1	16q23.1	2008-06-10	2008-06-10	2008-06-10	ENSG00000166822	ENSG00000166822			29577	protein-coding gene	gene with protein product			"""transmembrane protein 170"""	TMEM170		12477932	Standard	NM_145254		Approved	FLJ37611	uc002fee.1	Q8WVE7	OTTHUMG00000137614	ENST00000561878.1:c.293G>A	16.37:g.75485578C>T	ENSP00000454404:p.Gly98Glu	88.0	0.0		67.0	37.0	NM_145254	B2R4R3|B4DPS4|D3DUK2|Q7Z6F3	Missense_Mutation	SNP	ENST00000561878.1	37	CCDS10917.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701369	0.88924	.	.	ENSG00000166822	ENST00000357613	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	M	0.77486	2.375	0.80722	D	1	D;D	0.64830	0.994;0.983	P;P	0.59357	0.856;0.822	T	0.80355	-0.1417	9	0.87932	D	0	-4.3376	17.2034	0.86912	0.0:1.0:0.0:0.0	.	98;60	Q8WVE7;B3KT46	T170A_HUMAN;.	E	98	.	ENSP00000350230:G98E	G	-	2	0	TMEM170A	74043079	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.232000	0.78116	2.652000	0.90054	0.655000	0.94253	GGA	.		0.393	TMEM170A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269030.2	NM_145254	
TMEM59L	25789	broad.mit.edu;mdanderson.org	37	19	18731265	18731265	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:18731265G>A	ENST00000600490.1	+	9	1133	c.948G>A	c.(946-948)tgG>tgA	p.W316*	TMEM59L_ENST00000262817.3_Nonsense_Mutation_p.W316*			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	316						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						AGCCCGATTGGCCCCTGTACC	0.652																																					p.W316X		.											.	TMEM59L	94	0			c.G948A						.						76.0	69.0	72.0					19																	18731265		2203	4300	6503	SO:0001587	stop_gained	25789	exon8			CGATTGGCCCCTG	AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.948G>A	19.37:g.18731265G>A	ENSP00000470879:p.Trp316*	30.0	0.0		41.0	9.0	NM_012109		Nonsense_Mutation	SNP	ENST00000600490.1	37	CCDS12383.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425546	0.62733	.	.	ENSG00000105696	ENST00000262817	.	.	.	3.86	2.69	0.31865	.	0.221081	0.35615	N	0.003084	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-16.6864	8.5612	0.33511	0.0:0.2384:0.7616:0.0	.	.	.	.	X	316	.	ENSP00000262817:W316X	W	+	3	0	TMEM59L	18592265	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	2.187000	0.42602	2.082000	0.62665	0.561000	0.74099	TGG	.		0.652	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465143.2		
TNFRSF19	55504	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	24243206	24243206	+	Silent	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:24243206C>A	ENST00000382258.4	+	9	1419	c.1215C>A	c.(1213-1215)gtC>gtA	p.V405V	TNFRSF19_ENST00000248484.4_Silent_p.V405V|TNFRSF19_ENST00000403372.2_Silent_p.V273V|TNFRSF19_ENST00000382263.3_Silent_p.V405V	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	405			V -> I (in dbSNP:rs3751362). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		GTGGTGCTGTCATCCACCCAG	0.488																																					p.V405V		.											.	TNFRSF19	228	0			c.C1215A						.						51.0	48.0	49.0					13																	24243206		2203	4300	6503	SO:0001819	synonymous_variant	55504	exon9			TGCTGTCATCCAC	AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.1215C>A	13.37:g.24243206C>A		65.0	1.0		145.0	37.0	NM_018647	A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Silent	SNP	ENST00000382258.4	37	CCDS9302.1																																																																																			.		0.488	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044156.2	NM_018647	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	7577107	7577107	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:7577107A>T	ENST00000269305.4	-	8	1020	c.831T>A	c.(829-831)tgT>tgA	p.C277*	TP53_ENST00000445888.2_Nonsense_Mutation_p.C277*|TP53_ENST00000455263.2_Nonsense_Mutation_p.C277*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C277*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C277*|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	277	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C277*(8)|p.C277C(4)|p.?(2)|p.P278fs*28(2)|p.C277W(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.A276_C277delAC(1)|p.V274_P278del(1)|p.C277_P278insXXXXXXX(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCTCCCAGGACAGGCACAAA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C277X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-2	TP53	70225	38	Substitution - Nonsense(8)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(4)|Substitution - coding silent(4)|Insertion - Frameshift(2)|Unknown(2)|Substitution - Missense(2)|Insertion - In frame(1)	upper_aerodigestive_tract(6)|breast(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|central_nervous_system(2)|oesophagus(2)|lung(2)|biliary_tract(1)|large_intestine(1)|ovary(1)|prostate(1)	c.T831A	GRCh37	CM065496	TP53	M		.						72.0	62.0	65.0					17																	7577107		2203	4300	6503	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCCAGGACAGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.831T>A	17.37:g.7577107A>T	ENSP00000269305:p.Cys277*	87.0	0.0		65.0	47.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	37	6.040834	0.97226	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.13	1.53	0.23141	.	0.044315	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0792	7.7422	0.28848	0.6581:0.0:0.3419:0.0	.	.	.	.	X	277;277;277;277;277;266;145	.	ENSP00000269305:C277X	C	-	3	2	TP53	7517832	0.987000	0.35691	1.000000	0.80357	0.977000	0.68977	0.281000	0.18810	0.383000	0.24910	0.379000	0.24179	TGT	.		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TPST1	8460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	65751568	65751568	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:65751568A>G	ENST00000304842.5	+	3	1341	c.916A>G	c.(916-918)Ata>Gta	p.I306V	TPST1_ENST00000480281.1_3'UTR	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	306					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GGTTGGGAAGATACCGCCAGA	0.413																																					p.I306V		.											.	TPST1	90	0			c.A916G						.						140.0	124.0	130.0					7																	65751568		2203	4300	6503	SO:0001583	missense	8460	exon3			GGGAAGATACCGC	AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.916A>G	7.37:g.65751568A>G	ENSP00000302413:p.Ile306Val	139.0	0.0		147.0	68.0	NM_003596	A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	37	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370232	0.61624	.	.	ENSG00000169902	ENST00000304842;ENST00000544114	T	0.45276	0.9	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.86740	2.835	0.80722	D	1	P;P	0.40834	0.73;0.467	B;B	0.43445	0.42;0.175	T	0.61108	-0.7129	10	0.42905	T	0.14	-21.5617	14.8826	0.70545	1.0:0.0:0.0:0.0	.	306;306	F5H7U7;O60507	.;TPST1_HUMAN	V	306	ENSP00000302413:I306V	ENSP00000302413:I306V	I	+	1	0	TPST1	65389003	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	8.266000	0.89871	2.123000	0.65237	0.383000	0.25322	ATA	.		0.413	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596	
TTC21A	199223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	39171742	39171742	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:39171742G>T	ENST00000431162.2	+	17	2367	c.2233G>T	c.(2233-2235)Gag>Tag	p.E745*	TTC21A_ENST00000301819.6_Nonsense_Mutation_p.E746*|TTC21A_ENST00000440121.1_Nonsense_Mutation_p.E697*			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	745										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCACCAGCCCGAGAAGGCCCT	0.582																																					p.E745X		.											.	TTC21A	91	0			c.G2233T						.						44.0	45.0	45.0					3																	39171742		1914	4118	6032	SO:0001587	stop_gained	199223	exon17			CAGCCCGAGAAGG	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2233G>T	3.37:g.39171742G>T	ENSP00000398211:p.Glu745*	77.0	0.0		63.0	42.0	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Nonsense_Mutation	SNP	ENST00000431162.2	37	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	38	7.162369	0.98107	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	.	.	.	4.85	4.85	0.62838	.	0.159354	0.38217	N	0.001765	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-28.9477	17.1263	0.86715	0.0:0.0:1.0:0.0	.	.	.	.	X	746;728;745;697	.	ENSP00000301819:E746X	E	+	1	0	TTC21A	39146746	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.872000	0.75536	2.414000	0.81942	0.563000	0.77884	GAG	.		0.582	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179419703	179419703	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:179419703G>A	ENST00000591111.1	-	281	83784	c.83560C>T	c.(83560-83562)Ctc>Ttc	p.L27854F	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L20555F|TTN_ENST00000460472.2_Missense_Mutation_p.L20430F|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L29495F|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L20622F|TTN_ENST00000342992.6_Missense_Mutation_p.L26927F			Q8WZ42	TITIN_HUMAN	titin	27854	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGATGCGAGGTCCGTGGTA	0.438																																					p.L29495F		.											.	TTN	636	0			c.C88483T						.						86.0	81.0	82.0					2																	179419703		1915	4125	6040	SO:0001583	missense	7273	exon331			ATGCGAGGTCCGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83560C>T	2.37:g.179419703G>A	ENSP00000465570:p.Leu27854Phe	150.0	0.0		198.0	79.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	17.36	3.370558	0.61624	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.66	4.76	0.60689	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49184	0.1542	N	0.25144	0.715	0.31858	N	0.62137	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.003;0.003;0.003	T	0.54057	-0.8350	9	0.87932	D	0	.	4.5974	0.12336	0.1759:0.0:0.6327:0.1914	.	20430;20555;20622;27854	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	26927;20430;20622;20555;20427	ENSP00000343764:L26927F;ENSP00000434586:L20430F;ENSP00000340554:L20622F;ENSP00000352154:L20555F	ENSP00000340554:L20622F	L	-	1	0	TTN	179127949	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.150000	0.64869	1.462000	0.47948	0.655000	0.94253	CTC	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94088075	94088075	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:94088075A>G	ENST00000393151.2	+	30	4496	c.4496A>G	c.(4495-4497)cAa>cGa	p.Q1499R	UNC79_ENST00000256339.4_Missense_Mutation_p.Q1322R|UNC79_ENST00000555664.1_Missense_Mutation_p.Q1499R|UNC79_ENST00000553484.1_Missense_Mutation_p.Q1521R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1499					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCTTTCAAACAAAAATCTCTT	0.433																																					p.Q1322R		.											.	.	.	0			c.A3965G						.						81.0	80.0	81.0					14																	94088075		2203	4300	6503	SO:0001583	missense	57578	exon30			TCAAACAAAAATC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4496A>G	14.37:g.94088075A>G	ENSP00000376858:p.Gln1499Arg	149.0	0.0		182.0	63.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	18.97	3.735305	0.69189	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.26373	1.79;1.74;1.8;1.79	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	L	0.32530	0.975	0.48185	D	0.999609	D	0.63046	0.992	D	0.72982	0.979	T	0.29549	-1.0008	10	0.87932	D	0	-16.0344	16.4728	0.84119	1.0:0.0:0.0:0.0	.	1521	C9JQL1	.	R	1322;1499;1521;1499;1521	ENSP00000256339:Q1322R;ENSP00000450868:Q1499R;ENSP00000451360:Q1521R;ENSP00000376858:Q1499R	ENSP00000256339:Q1322R	Q	+	2	0	KIAA1409	93157828	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.296000	0.77279	0.482000	0.46254	CAA	.		0.433	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
YWHAG	7532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	75959524	75959524	+	Silent	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:75959524C>G	ENST00000307630.3	-	2	336	c.114G>C	c.(112-114)tcG>tcC	p.S38S		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	38					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						GTTCCTCATTCGACAGTGGCT	0.502																																					p.S38S		.											YWHAG,NS,carcinoma,-1	YWHAG	523	0			c.G114C						.						76.0	58.0	64.0					7																	75959524		2203	4300	6503	SO:0001819	synonymous_variant	7532	exon2			CTCATTCGACAGT	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.114G>C	7.37:g.75959524C>G		36.0	0.0		56.0	27.0	NM_012479	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	ENST00000307630.3	37	CCDS5584.1																																																																																			.		0.502	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479	
ZC3H7B	23264	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	41739420	41739420	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:41739420C>T	ENST00000352645.4	+	13	1556	c.1299C>T	c.(1297-1299)ggC>ggT	p.G433G	ZC3H7B_ENST00000351589.4_Splice_Site_p.G433G	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	449					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TGCCCATAGGCCCCCGGGCTG	0.622																																					p.G433G		.											.	ZC3H7B	90	0			c.C1299T						.						55.0	57.0	56.0					22																	41739420		2203	4298	6501	SO:0001630	splice_region_variant	23264	exon13			CATAGGCCCCCGG		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.1298-1C>T	22.37:g.41739420C>T		50.0	0.0		108.0	36.0	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	ENST00000352645.4	37	CCDS14013.1																																																																																			.		0.622	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	Silent
ZIC4	84107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	147120535	147120535	+	Missense_Mutation	SNP	C	C	G	rs148365070		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:147120535C>G	ENST00000383075.3	-	2	562	c.50G>C	c.(49-51)cGa>cCa	p.R17P	ZIC4_ENST00000473123.1_Missense_Mutation_p.R17P|ZIC4_ENST00000491672.1_Missense_Mutation_p.R17P|ZIC4_ENST00000484399.1_Missense_Mutation_p.R17P|ZIC4_ENST00000525172.2_Missense_Mutation_p.R67P|ZIC4_ENST00000425731.3_Missense_Mutation_p.R55P	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	17						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AAGAGTGTTTCGGTAAAGCCG	0.353																																					p.R67P		.											.	ZIC4	91	0			c.G200C						.						152.0	139.0	143.0					3																	147120535		1854	4089	5943	SO:0001583	missense	84107	exon2			GTGTTTCGGTAAA	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.50G>C	3.37:g.147120535C>G	ENSP00000372553:p.Arg17Pro	181.0	0.0		191.0	65.0	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825324	0.71143	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672;ENST00000462748;ENST00000484586;ENST00000463250	T;T;T;T;T;T;T	0.38077	2.63;2.43;2.39;2.63;2.63;1.16;2.48	6.06	5.19	0.71726	.	0.670270	0.12134	N	0.496457	T	0.33411	0.0862	L	0.27053	0.805	0.80722	D	1	P;P	0.43094	0.766;0.799	P;B	0.44811	0.461;0.423	T	0.08330	-1.0727	10	0.87932	D	0	.	11.3963	0.49843	0.0:0.8625:0.0:0.1375	.	67;17	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	P	17;55;67;17;17;17;17;17;17	ENSP00000372553:R17P;ENSP00000397695:R55P;ENSP00000435509:R67P;ENSP00000417855:R17P;ENSP00000420775:R17P;ENSP00000418277:R17P;ENSP00000420627:R17P	ENSP00000372553:R17P	R	-	2	0	ZIC4	148603225	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.965000	0.40471	1.576000	0.49790	0.655000	0.94253	CGA	C|0.999;T|0.001		0.353	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
ZNF141	7700	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	367384	367397	+	Frame_Shift_Del	DEL	AAAAATTCATACTG	AAAAATTCATACTG	-	rs544940326		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	AAAAATTCATACTG	AAAAATTCATACTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:367384_367397delAAAAATTCATACTG	ENST00000240499.7	+	4	1307_1320	c.1158_1171delAAAAATTCATACTG	c.(1156-1173)aaaaaaattcatactggafs	p.KIHTG387fs	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	387					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ATGAACATAAAAAAATTCATACTGGAGAGAAACC	0.411																																					p.386_391del		.											.	ZNF141	90	0			c.1158_1171del						.																																			SO:0001589	frameshift_variant	7700	exon4			ACATAAAAAAATT	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1158_1171delAAAAATTCATACTG	4.37:g.367384_367397delAAAAATTCATACTG	ENSP00000240499:p.Lys387fs	112.0	0.0		130.0	0.0	NM_003441	Q6DK07	Frame_Shift_Del	DEL	ENST00000240499.7	37	CCDS33931.1																																																																																			.		0.411	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF230	7773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44514563	44514563	+	Silent	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:44514563C>G	ENST00000429154.2	+	5	600	c.372C>G	c.(370-372)tcC>tcG	p.S124S		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	124	KRNB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				ATGTCCCCTCCCAGGTTGAGG	0.433																																					p.S124S	GBM(175;914 2069 22996 47111 52600)	.											.	ZNF230	90	0			c.C372G						.						102.0	96.0	98.0					19																	44514563		2203	4300	6503	SO:0001819	synonymous_variant	7773	exon5			CCCCTCCCAGGTT	U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.372C>G	19.37:g.44514563C>G		193.0	0.0		134.0	95.0	NM_006300	O15322|Q504X7|Q86W84|Q9P1U6	Silent	SNP	ENST00000429154.2	37	CCDS33044.1																																																																																			.		0.433	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460456.1		
ZNF264	9422	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	57723567	57723567	+	Nonsense_Mutation	SNP	G	G	T	rs373693955		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:57723567G>T	ENST00000263095.6	+	4	1516	c.1102G>T	c.(1102-1104)Gag>Tag	p.E368*	ZNF264_ENST00000536056.1_Nonsense_Mutation_p.E368*	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TCATACCGGGGAGAAGCCCTA	0.512																																					p.E368X		.											.	ZNF264	92	0			c.G1102T						.						78.0	85.0	83.0					19																	57723567		2203	4300	6503	SO:0001587	stop_gained	9422	exon4			ACCGGGGAGAAGC	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1102G>T	19.37:g.57723567G>T	ENSP00000263095:p.Glu368*	172.0	1.0		192.0	77.0	NM_003417	A8K8Y9|Q9P1V0	Nonsense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	G	37	6.267388	0.97426	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	.	.	.	2.35	0.159	0.14968	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	7.162	0.25669	0.2431:0.0:0.7569:0.0	.	.	.	.	X	368	.	ENSP00000263095:E368X	E	+	1	0	ZNF264	62415379	1.000000	0.71417	0.962000	0.40283	0.648000	0.38561	3.351000	0.52232	0.096000	0.17463	0.491000	0.48974	GAG	.		0.512	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
ZNF469	84627	ucsc.edu;bcgsc.ca	37	16	88501177	88501177	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:88501177T>C	ENST00000437464.1	+	2	7215	c.7215T>C	c.(7213-7215)acT>acC	p.T2405T	ZNF469_ENST00000565624.1_Silent_p.T2433T	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCACCAGACTCCCCAGGGGG	0.602																																					p.T2405T		.											.	.	.	0			c.T7215C						.						41.0	48.0	46.0					16																	88501177		692	1591	2283	SO:0001819	synonymous_variant	84627	exon2			CCAGACTCCCCAG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7215T>C	16.37:g.88501177T>C		86.0	1.0		52.0	6.0	NM_001127464		Silent	SNP	ENST00000437464.1	37	CCDS45544.1																																																																																			.		0.602	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23927768	23927768	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:23927768A>T	ENST00000402377.3	-	4	725	c.584T>A	c.(583-585)gTa>gAa	p.V195E	ZNF681_ENST00000395385.3_Missense_Mutation_p.V126E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTAGAAATTTACTCTAGTACA	0.279																																					p.V195E		.											.	.	.	0			c.T584A						.						22.0	23.0	23.0					19																	23927768		2197	4290	6487	SO:0001583	missense	148213	exon4			AAATTTACTCTAG	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.584T>A	19.37:g.23927768A>T	ENSP00000384000:p.Val195Glu	280.0	0.0		202.0	77.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.690277	0.00738	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.22539	2.83;2.83;1.95;6.31	1.39	-2.77	0.05877	.	.	.	.	.	T	0.03608	0.0103	N	0.00403	-1.54	0.26265	N	0.978515	B	0.13145	0.007	B	0.17433	0.018	T	0.40813	-0.9543	9	0.02654	T	1	.	4.9577	0.14050	0.3414:0.0:0.0:0.6586	.	195	Q96N22	ZN681_HUMAN	E	195;126;126;126	ENSP00000384000:V195E;ENSP00000378783:V126E;ENSP00000433806:V126E;ENSP00000435824:V126E	ENSP00000378783:V126E	V	-	2	0	ZNF681	23719608	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	0.407000	0.21049	-0.383000	0.07858	-0.732000	0.03574	GTA	.		0.279	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
MAB21L1	4081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	36050192	36050193	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:36050192_36050193GG>TT	ENST00000379919.4	-	1	639_640	c.83_84CC>AA	c.(82-84)gCC>gAA	p.A28E	NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	28					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GGATAGTTTTGGCAATGGCAGC	0.51																																					p.A28E		.											.	.	.	0			.						.																																			SO:0001583	missense	4081	.			AGTTTTGGCAATG	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.83_84delinsTT	13.37:g.36050192_36050193delinsTT	ENSP00000369251:p.Ala28Glu	82.0	0.0		56.0	35.0	.	Q6I9T5	Missense_Mutation	DNP	ENST00000379919.4	37	CCDS9353.1																																																																																			.		0.510	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
GRIA2	2891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	158262498	158262499	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:158262498_158262499GC>AA	ENST00000264426.9	+	12	2206_2207	c.1927_1928GC>AA	c.(1927-1929)GCc>AAc	p.A643N	GRIA2_ENST00000393815.2_Missense_Mutation_p.A596N|GRIA2_ENST00000507898.1_Missense_Mutation_p.A596N|GRIA2_ENST00000449365.1_Missense_Mutation_p.A596N|GRIA2_ENST00000296526.7_Missense_Mutation_p.A643N	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	643					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TAACTTAGCTGCCTTCCTGACT	0.455																																					p.A643N		.											.	.	.	0			.						.																																			SO:0001583	missense	2891	.			TTAGCTGCCTTCC		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	Exception_encountered	4.37:g.158262498_158262499delinsAA	ENSP00000264426:p.Ala643Asn	639.0	0.0		608.0	231.0	.	A8MT92|I6L997|Q96FP6	Missense_Mutation	DNP	ENST00000264426.9	37	CCDS43274.1																																																																																			.		0.455	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
CITED2	10370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139694674	139694675	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:139694674_139694675CG>TT	ENST00000367651.2	-	2	622_623	c.407_408CG>AA	c.(406-408)cCG>cAA	p.P136Q	CITED2_ENST00000536159.1_Missense_Mutation_p.P136Q|CITED2_ENST00000537332.1_Missense_Mutation_p.P136Q	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	136					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GGTGCAAATCCGGCATGTAGTG	0.624																																					p.P136Q	NSCLC(98;1219 1550 33720 43229 49330)	.											.	.	.	0			.						.																																			SO:0001583	missense	10370	.			CAAATCCGGCATG	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.407_408delinsTT	6.37:g.139694674_139694675delinsTT	ENSP00000356623:p.Pro136Gln	154.0	0.0		288.0	141.0	.	O95426|Q5VTF4	Missense_Mutation	DNP	ENST00000367651.2	37	CCDS5195.1																																																																																			.		0.624	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
